An interactive graphic showing the signaling pathways activated by CLC, the primary CLC-expressing cells, and the biological effects induced by CLC signaling

Multiple cytokines, including interleukin 6 (IL-6), IL-11, IL-27, oncostatin M (OSM), and leukemia inhibitory factor (LIF), signal via the common GP130 cytokine receptor subunit. leukemia inhibitory factor (LIF) receptor, oncostatin M (OSM) receptor, or ciliary neurotrophic factor (CNTF) receptor, facilitating recognition of multiple ligands including IL-6, IL-11, IL-27, LIF, OSM, CNTF, cardiotrophin 1 (CT1), and cardiotrophin-like cytokine (CLC). Signal transduction via GP130 is mediated by the JAK/STAT pathway and includes phosphorylation of STAT3 and STAT1, as well as activation of RAS/MAPK (OShea and Plenge, AC220 2012). An AC220 essential role for GP130-dependent signaling is shown by the lethality of the corresponding homozygous KO (mutations, is a complex immunodeficiency that presents with pneumonia, lung abnormalities, high levels of IgE, eosinophilia, eczema, and skeletal and connective tissue abnormalities including retained primary teeth, scoliosis, and craniosynostosis (Smithwick et ...

There is increasing evidence that neutrophins and their receptors play an important role in regulating development of both the central and the peripheral nervous systems. Human TRK-A (NTRK1) and TRK-C (NTRK3) have been cloned and sequenced, but only a truncated form of human TRK-B has been published …

PubMed comprises more than 30 million citations for biomedical literature from MEDLINE, life science journals, and online books. Citations may include links to full-text content from PubMed Central and publisher web sites.

Cardiotrophin-like cytokine (CLC), also known as novel neurotrophin-1 (NNT-1) and B cell stimulating factor (BSF-3), is a member of the IL-6 family of cytokines (1, 2). CLC associates with the secreted soluble cytokine-like factor 1 (CLF-1), a member of the cytokine type I receptor family, to form the heteromeric composite cytokine CLF-1/CLC (3, 5). CLC can also form an alternate composite cytokine with soluble ciliary neurotrophic factor receptor alpha (CNTF R alpha ) (4). Co-expression of CLC with either CLF-1 or CNTF R alpha is required for the formation of the composite cytokines and for CLC secretion (3-5). CLF-1/CLC binds to the membrane-associated CNTF R alpha to initiate the heterodimerization between gp130 and leukemia inhibitory factor receptor (LIFR) and stimulate the PI 3-kinase and the MAP kinase activity. The CLF-1/CLC complex displays activities only on those cells expressing the functional tripartite receptor complex (5). Mouse CLF-1 is a 425 amino acid (aa) protein that contains ...

CILIARY NEUROTROPHIC FACTOR VARIANTS - Nucleic acid molecule selected from the group consisting of (a) a nucleic acid molecule having a nucleotide sequence shown in SEQ ID: NO 1, (b) a nucleic acid molecule which encodes a peptide having an amino acid sequence shown in SEQ ID: NO 2, (c) a nucleic acid molecule whose complementary strand hybridizes to a nucleic acid molecule according to (a) or (b) and which codes for a peptide which binds to ciliary neurotrophic factor receptor (CNTFR), the peptide binding with lower affinity than ciliary neurotrophic factor to the interleukin-6 receptor (IL-6R), (d) a nucleic acid molecule whose nucleotide sequence differs from the nucleotide sequence of a nucleic acid molecule according to (c) due to the degenerated genetic code, the codon at positions 82-84 of the nucleic acid molecule according to (a) coding for a non-positively charged amino acid, and the peptide at position 28 shown in SEQ ID: NO 2 having a non-positively charged amino acid residue ...

L~..Lary IUeurotroph~cPactor: Pharmacokrnetics m-d Acute-Phase Response in Rat Falk Dittrich, Hans Thoenen, and Michael Sendtnet Ciliary neurotrophic factor (CNTF) supports the survival of motoneurons in vitro and in vivo. Recombinant CNTF is an investigational drug for the treatment of amyotrophic lateral sclerosis. We determined the pharmacokinetics of radioiodinated CNTF after intravenous injection into rats. CNTF shows a biphasic clearance with an initial plasma half-life of 2.9 minutes and is removed from the circulation by the liver. No accumulation of radioactivity was detectable in nerve tissue or skeletal muscle after intravenous injection of 0.1 pg and 0.5 pg of CNTF. Radioactive degradation products accumulate in the skin. Liver cells express specific binding proteins for CNTF, and the incorporation and degradation of intravenously injected CNTF by the liver may occur after association of CNTF with the soluble CNTF receptor cu in the circulation. Probably a9 a consequence of its ...

The relationship between ciliary neurotrophic factor CNTF genotype and motor unit physiology: preliminary studies. . Biblioteca virtual para leer y descargar libros, documentos, trabajos y tesis universitarias en PDF. Material universiario, documentación y tareas realizadas por universitarios en nuestra biblioteca. Para descargar gratis y para leer online.

Purpose: : There is only controversial data in literature if photoreceptors express the TrkB neurotrophin receptor. Some results indicate that the receptor is present in M-cones of the adult rat retina. The aim of the study was to examine whether cones express TrkB receptor during development and to test if BDNF and NT-4 are involved in cone differentiation. Methods: : Retinas of Sprague-Dawley rats were collected in different developmental ages and analyzed by immunocytochemistry using cone- and TrkB-specific antibodies. For the functional studies, organotypic retina cultures allowing M-cone development were prepared from P2 rats. In order to neutralize the endogenous neurotrophins acting via the TrkB receptor, cultures were treated with BDNF- or NT-4-specific antibodies continuously for 19 days. The cultures were then processed histologically, and the M-cone densities of treated and non-treated control retinas have been compared. Results: : The first M-opsin positive signals were detected at ...

Ciliary neurotrophic factor improves diabetic parameters and hepatic steatosis and increases basal metabolic rate in db/db mice.: Obesity plays a central role i

Description: Human CNTF ELISA development kit contains the key components required for the quantitative measurement of natural and/or recombinant CNTF in a sandwich ELISA format within the range of 47-3,000 pg/mL. Using the ELISA protocol described below, this kit provides sufficient reagents to assay CNTF in approximately 1,000 ELISA plate wells ...

This study examined the mechanisms underlying the long term functional outcome after bone marrow derived multipotent progenitor cell (MPC) transplantation in a porcine model of postinfarction Left Ventricular (LV) remodeling. Myocardial infarction (MI) was created by ligating the distal left anterior descending coronary artery (LAD). Intramyocardial injection of 50 million lacZ labeled MPC was performed in the periscar region (Cell, n=7) with 5 equal injections immediately after MI, while in control animals (CONT, n=7) saline was injected. Outcome was assessed with MRI and P-31 MRS. Engraftment was studied on histology and gene chip (Affymetrix) array analysis was used to study differential expression of genes in the two groups at 4 months. MPC treatment resulted in improvement of ejection fraction as early as 10 days after MI (32.2±9.5 vs. 43.4±5.1 in CONT and Cell respectively, p ,0.05). This improvement was seen each month and persisted up to 4 months (35.7±6.2 vs. 51.2±4.8 in CONT and ...

Complete information for CNTF gene (Protein Coding), Ciliary Neurotrophic Factor, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene Compendium

You can add a fourth component to the color by using glColor4f(). The fourth component, known as alpha, is not used in the default drawing mode, but it is possible to configure OpenGL to use it as the degree of transparency of the color, similarly to the use of the alpha component in the 2D graphics APIs that we have looked at. You need two commands to turn on transparency ...

wouldnt require any fix-up as long as the background area is at least 200px tall. If it was 150px tall, however, the blue color-stops position would be equivalent to 75px, which precedes the yellow color-stop, and would be corrected to a position of 100px. Note: The definition and implications of premultiplied color spaces are given elsewhere in the technical literature, but a quick primer is given here to illuminate the process. Given a color expressed as an rgba() 4-tuple, one can convert this to a premultiplied representation by multiplying the red, green, and blue components by the alpha component. For example, a partially-transparent blue may be given as rgba(0,0,255,.5), which would then be expressed as [0, 0, 127.5, .5] in its premultiplied representation. Interpolating colors using the premultiplied representations rather than the plain rgba representations tends to produce more attractive transitions, particularly when transitioning from a fully opaque color to fully transparent. ...

CNTF is a polypeptide trophic factor, member of the alpha-helical cytokine superfamily. It was initially purified from the chick eye on the basis of…

A recombinant version of human CNTF (rhCNTF), trade name Axokine, is a modified version with a 15 amino acid truncation of the C-terminus and two amino acid substitutions. It is three to five times more potent than CNTF in in vitro and in vivo assays and has improved stability properties.[6] Like CNTF it is a neurotrophic factor, and may stimulate nerve cells to survive. It was tested in the 1990s as a treatment for amyotrophic lateral sclerosis. It did not improve muscle control as much as expected, but trial participants did report a loss of appetite. Phase III clinical trials for the drug against obesity were conducted in 2003 by Axokines maker, Regeneron, demonstrating a small positive effect in some patients, but the drug was not commercialized. A major problem with the treatment was that in nearly 70% of the subjects tested, antibodies against Axokine were produced after approximately three months of treatment.[7] In the minority of subjects who did not develop the antibodies, weight loss ...

Wong, J. & Garner, B. (2012). Evidence that truncated TrkB isoform, TrkB-Shc can regulate phosphorylated TrkB protein levels. Biochemical and Biophysical Research Communications, 420 (2), 331-335 ...

A postdoctoral position is available in my laboratory in the areas of neurotrophic factor receptors, signal transduction and terminal differentiation of neural cells lines. Our studies include the structure of receptors, the roles of individual signal transduction pathways and the connection between neuronal differentiation and cell proliferation. My laboratory is located at the Worcester Foundation which offers a pleasant, relaxed atmosphere in a pretty suburban town near Boston. We are particularly eager to recruit a recent Ph.D. who would be eligible for a Neuroscience Training Grant recently awarded to the Worcester Foundation (American citizenship or Permanent Resident). The starting time is flexible. Some recent publications from our laboratory include: Timm et al. 1994. Circular dichroism studies of the interaction between four neurotrophins and the extracellular domain of the low affinity neurotrophin receptor. Protein Sci. 3, 451-458. Loy et al. 1994. Immunocytochemical localization of ...

The views presented here are those of the author and are not to be construed as official or reflecting the views of the Uniformed Services University of the Health Sciences, the Department of Defense or the U.S. Government ...

Rat CNTF ELISA development kit contains the key components required for the quantitative measurement of natural and/or recombinant Rat CNTF

MetabolismTransport and binding proteinsCations and iron carrying compoundspotassium uptake protein, Trk family (TIGR00934; HMM-score: 3.3) ...

References for Abcams Recombinant Human CNTF protein (ab78711). Please let us know if you have used this product in your publication

购买我们的TrkB肽。ab52216可作为ab18987的封闭肽并经过Blocking实验验证。Abcam提供免费的实验方案，操作技巧及专业的支持。中国80%以上现货。

Background: Antidepressant drugs (ADs) have been shown to activate BDNF (brain-derived neurotrophic factor) receptor TrkB in the rodent brain but the mechanism underlying this phenomenon remains unclear. ADs act as monoamine reuptake inhibitors and after prolonged treatments regulate brain bdnf mRNA levels indicating that monoamine-BDNF signaling regulate AD-induced TrkB activation in vivo. However, recent findings demonstrate that Trk receptors can be transactivated independently of their neurotrophin ligands. Methodology: In this study we examined the role of BDNF, TrkB kinase activity and monoamine reuptake in the AD-induced TrkB activation in vivo and in vitro by employing several transgenic mouse models, cultured neurons and TrkB-expressing cell lines. Principal Findings: Using a chemical-genetic TrkB(F616A) mutant and TrkB overexpressing mice, we demonstrate that ADs specifically activate both the maturely and immaturely glycosylated forms of TrkB receptors in the brain in a TrkB kinase ...

A method and apparatus for chroma keying filtered textures are provided. Chroma keying is performed which replaces the input texel color with a new color if the input texel color matches the chroma color. The chroma key circuitry keeps the input texel color and sets the alpha component to 1 if the input texel color does not match the chroma color. The chroma keyed texels are filtered using bilinear filtering. The color components of the filtered texels are fogged using a fog factor, a fog color, and the alpha component of the filtered texel. The fogged and filtered signal is blended with a background color to produce an output color for the texels.

Woodchuck Hepatitis Virus (WHP) Posttranscriptional Regulatory Element (WPRE) is a DNA sequence that, when transcribed, creates a tertiary structure enhancing expression. The sequence is commonly used in molecular biology to increase expression of genes delivered by viral vectors. WPRE is a tripartite regulatory element with gamma, alpha, and beta components. The alpha component is 80bp long: GCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGT When used alone without the gamma and beta WPRE components, the alpha component is only 9% as active as the full tripartite WPRE. The sequence for full tripartite WPRE is: AATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTA TCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGCGTG GTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGG ...

Motoneurons innervating the skeletal musculature were among the first neurons shown to require the presence of their target cells to develop appropriatelyl,2. But the characterization of molecules allowing motoneuron survival has been difficult. Ciliary neurotrophic factor prevents the death of motoneurons3-6, but its gene is not expressed during development7. Although the presence of a neurotrophin receptor on developing motoneurons8-1O has suggested a role for neurotrophins, none could be shown to promote motoneuron survival in vitro3. We report here that brainderived neurotrophic factor can prevent the death of axotomized motoneurons in newborn rats, suggesting a role for this neurotrophin for motoneuron survival in vivo.

Ciliary neurotrophic factor (CNTF) is a promyelinating trophic factor, and the mechanisms by which CNTF expression could be increased in the brain are poorly understood. Acetylsalicylic acid (aspirin) is one of the most widely used analgesics. Interestingly, aspirin increased mRNA and protein expression of CNTF in primary mouse and human astrocytes in a dose- and time-dependent manner. Aspirin induced the activation of protein kinase A (PKA) but not protein kinase C (PKC). H-89, an inhibitor of PKA, abrogated aspirin-induced expression of CNTF ...

PubMed comprises more than 30 million citations for biomedical literature from MEDLINE, life science journals, and online books. Citations may include links to full-text content from PubMed Central and publisher web sites.

Research proven, purified rabbit polyclonal GDNF Receptor Alpha 4/GFRA 4 antibody (Glial cell line-derived neurotrophic factor receptor alpha 3). Important marker embyogensis of kidneys, CNS and ENS and survival of central nervous system and peripheral neurons. Excellent for for immunohistochemistry, immunocytochemistry, western blotting, ELISA and related applications. IHC image available.

Astrocytes are activated by ciliary neurotrophic factor (CNTF) in vivo and in vitro, however, the consequences on the L-type calcium channel (LCC) of neurons are still poorly understood. Therefore, in the present study, whole-cell patch clamp, western-blot and RT-PCR assay were performed to evaluate the effects of CNTF-treated astrocyte conditioned medium (CNTF-ACM) on LCC current (I(Ca)-L) and the expression of Cav1.2 and Cav1.3 in Sprague-Dawley rat cortical neurons. The results revealed that CNTF-ACM enhanced the amplitude of Ica-L and the expression of Cav1.3 significantly, but had no effects on Cav1.2 expression. We also found an increase in the concentration of fibroblast growth factor-2 (FGF-2) in CNTF-ACM by ELISA assay. Taken together, these findings indicate that CNTF induces the release of factors, including FGF-2, from astrocytes, thereby potentiating the activity of LCC in cortical neurons.. ...

Animals and genotyping. LIFR +/− mice generated on the B6,129/J genetic background and C57BL6 STOCK (for expanding theLIFR +/− mice) were obtained from The Jackson Laboratory (Bar Harbor, ME). Mice were then bred to allow for the generation of homozygote, heterozygote, and wild-type littermates (Koblar et al., 1998). The genotyping of mice carryingLIFR mutations was performed as described previously (Ware et al., 1995). CD-1 mice stocks were maintained in the University of Calgary Bioscience Animal Resources Center.. Neural stem cell culture and growth factors. Generation and differentiation of spheres from embryonic and adult forebrain were performed as described previously with minor modifications (Reynolds and Weiss, 1992; Reynolds et al., 1992). Briefly, striato-pallidum complexes were removed from mouse embryos at E14 and collected into PBS containing 0.6% glucose, penicillin (50 U/ml), and streptomycin (50 U/ml; both from Life Technologies, Gaithersburg, MD) and then transferred into ...

Results: The athlete group showed an allelic distribution of ACTN3 (R/R:64%, R/X:16%, X/X:20%) and CNTF (G/G:72%, G/A:26%, A/A:2%), significantly imbalanced towards alleles R/R and G/G, respectively, compared to controls (ACTN3=R/R:40% R/X:22% X/X:38% and CNTF=G/G:52%, G/A:24%, A/A:24%) (p=0.0024 and p=0.0001, respectively). Only the ACTN3 577X/X polymorphism showed a significant association with the anaerobic threshold of athletes (F-ratio= 4.037; p=0.025). Factorial ANOVA demonstrated a non significant interaction between favourable allelic patterns of ACTN3 and CNTF genes on aerobic performance in the athlete group ...

The focus of this thesis is the life and death of adult retinal ganglion cells (RGCs). RGCs are neurons that convey visual information from the retina to higher centers in the brain. If the optic nerve is transected (ONT), adult RGCs die by a form of cell death called apoptosis, and a general hypothesis is that neurotrophic factors can support the survival of injured neurons.. With the intention to gain knowledge about systems that can be used to decrease RGC death after ONT, we have studied growth factor receptors belonging to the tyrosine kinase family of receptors (RTK), known to mediate important cell survival signals. We found that the RTK Ret and its coreceptor GFRα1 were expressed by RGCs, and to test the above-mentioned hypothesis, we intraocularly administered glial cell-line derived factor, which activates a Ret-GFRα1 complex, and found transiently mediated RGC survival after ONT.. To identify new, potential neurotrophic factor receptors expressed by RGCs, with the aim to improve RGC ...

Brain-Derived Neurotrophic Factor: A member of the nerve growth factor family of trophic factors. In the brain BDNF has a trophic action on retinal, cholinergic, and dopaminergic neurons, and in the peripheral nervous system it acts on both motor and sensory neurons. (From Kendrew, The Encyclopedia of Molecular Biology, 1994)

Abstract Background: Brain-derived neurotrophic factor (BDNF) could be as a molecular candidate for the development of bipolar disorder. We tried t..

Background: Brain-derived neurotrophic factor (BDNF) is associated with coronary artery diseases. However, its role and mechanism in myocardial infarction (MI) is not fully understood. Methods: ...

Researchers have reported that serum brain-derived neurotrophic factor (sBDNF) of drug-free depressed patients are lower than those of healthy controls and proposed that low sBDNF levels might reflect

Neurotech Pharmaceuticals, Inc., in collaboration with the Lowy Medical Research Institute (LMRI), has announced 24-month results demonstrating that NT-501 delivering Ciliary Neurotrophic Factor (CNTF) has a beneficial effect in patients with Macular Telangiectasia type 2 (MacTel). The multicenter, randomized clinical trial demonstrated a statistically significant reduction in the progressive loss of photoreceptors in treated versus untreated eyes. NT-501 utilizes the Companys proprietary Encapsulated Cell Therapy (ECT) platform that can be customized to deliver specific therapeutic molecules to the back of the eye for retinal disease.. [Read More]. ...

TY - JOUR. T1 - Small molecules activating TrkB receptor for treating a variety of CNS disorders. AU - Zeng, Yan. AU - Wang, Xiaonan. AU - Wang, Qiang. AU - Liu, Shumin. AU - Hu, Xiamin. AU - Mcclintock, Shawn M.. PY - 2013/11/1. Y1 - 2013/11/1. N2 - The brain-derived neurotrophic factor (BDNF) and its high affinity receptor tropomyosin-receptor-kinase B (TrkB) play a critical role in neuronal differentiation and survival, synapse plasticity, and memory. Indeed, both have been implicated in the pathophysiology of numerous diseases. Although the remarkable therapeutic potential of BDNF has generated much research over the past decade, the poor pharmacokinetics and adverse side effect profile have limited its clinical usefulness of BDNF. Small compounds that mimic BDNFs neurotrophic signaling and overcome the pharmacokinetic and side effect barriers may have greater therapeutic potential. The purpose of this review is to provide a survey of the various strategies taken towards the development of ...

Interleukin 11 receptor, alpha subunit is a subunit of the interleukin 11 receptor. IL11RA is its human gene. Interleukin 11 is a stromal cell-derived cytokine that belongs to a family of pleiotropic and redundant cytokines that use the gp130 transducing subunit in their high affinity receptors. This gene encodes the IL-11 receptor, which is a member of the hematopoietic cytokine receptor family. This particular receptor is very similar to ciliary neurotrophic factor, since both contain an extracellular region with a 2-domain structure composed of an immunoglobulin-like domain and a cytokine receptor-like domain. Alternative splicing has been observed at this locus and two variants, each encoding a distinct isoform, have been identified. GRCh38: Ensembl release 89: ENSG00000137070 - Ensembl, May 2017 Human PubMed Reference:. Mouse PubMed Reference:. Entrez Gene: IL11RA interleukin 11 receptor, alpha. Chérel M, Sorel M, Lebeau B, et al. (1995). Molecular cloning of two isoforms of a ...

DI-fusion, le Dépôt institutionnel numérique de lULB, est loutil de référencementde la production scientifique de lULB.Linterface de recherche DI-fusion permet de consulter les publications des chercheurs de lULB et les thèses qui y ont été défendues.

PRF readers can get free access to a selected Journal of Pain paper each month, thanks to the American Pain Society. Get the free full text of the selection from the February 2018 issue here.. ...

BDNF - BDNF (untagged)-Human brain-derived neurotrophic factor (BDNF), transcript variant 1 available for purchase from OriGene - Your Gene Company.

FGFR substrate 3 (human); FGFR-signaling adaptor SNT2 (human); SNT-2 (human); Suc1-associated neurotrophic factor target 2 (human ...

Objective(s): Occlusal trauma is one of the most common forms of oral biting dysfunction. Long-term occlusal trauma could weaken the stomatognathic system; especially damage ones masticatory muscle. Through using the rat model, this study investigated the trophic effect of ciliary neurotrophic factor (CNTF) on injured masseter muscle. Materials and Methods: Male Wistar rats (n=36) were randomly divided into five experimental groups and one control group (6 rats per group). Animals in the experimental group were cemented modified crowns on their mandibular first molars to artificially induce occlusal trauma in 1, 3, 7, 14, and 28 days. Control group was sham-treated with forced mouth-opening for about 5 min, while no crowns were placed. After 28 days of treatment, all rats were euthanized and their masseter muscle was collected. Through immunofluorescence and real-time quantitative PCR, the expression of desmin, CNTF, and CNTFRα was investigated in rat masseter muscle. The microstructure of ...

Motoneurons of the spinal nucleus of the bulbocavernosus (SNB) reside in the lower lumbar spinal cord and innervate the bulbocavernosus (BC) and levator ani (LA) muscles. Adult males have larger BC and LA muscles and many more SNB motoneurons than do females. This sex difference comes about as a result of androgen-regulated cell death. How is androgen stimulation of the BC/LA muscles translated into a live-or-die decision by the SNB motoneurons? Neurotrophic factors such as ciliary neurotrophic factor (CNTF) may play such a role. The experiments described in this dissertation are designed to (1)� identify potential direct sites of CNTF action in the SNB neuromuscular system, (2)� examine androgen regulation of CNTFR�± gene expression in BC/LA muscle and lumbosacral spinal cord, and (3)� to test whether endogenously produced neurotrophic factors normally influence SNB cell survival. To determine whether CNTFR�± is expressed in the developing SNB system, I first performed ...

One of the heavy progressive vascular complications of type 2 diabetes is a central nervous system, manifesting cognitive dysfunction due to metabolic changes. Goal. Defining the role of brain-derived neurotrophic factor (BDNF) in the diagnosis of cognitive dysfunction in patients with type 2 diabetes. Materials and methods. The study involved 83 patients with type 2 diabetes at the age of 40 - 70 years. Complex examination included clinical and laboratory examination, neuropsychological testing. To screen for cognitive impairment used the Montreal Cognitive Assessment Scale (MOS test). To identify early markers of cognitive impairment was determined the level of brain-derived neurotrophic factor (BDNF). Results. The study found a negative correlation between the level of BDNF and the HbA1c (r = - 0,494, p = 0.01), fasting glucose (r = - 0,499, p = 0.01), and a positive relationship between the level of BDNF and cognitive function in patients with type 2 diabetes. Conclusion. In patients with ...

One of the heavy progressive vascular complications of type 2 diabetes is a central nervous system, manifesting cognitive dysfunction due to metabolic changes. Goal. Defining the role of brain-derived neurotrophic factor (BDNF) in the diagnosis of cognitive dysfunction in patients with type 2 diabetes. Materials and methods. The study involved 83 patients with type 2 diabetes at the age of 40 - 70 years. Complex examination included clinical and laboratory examination, neuropsychological testing. To screen for cognitive impairment used the Montreal Cognitive Assessment Scale (MOS test). To identify early markers of cognitive impairment was determined the level of brain-derived neurotrophic factor (BDNF). Results. The study found a negative correlation between the level of BDNF and the HbA1c (r = - 0,494, p = 0.01), fasting glucose (r = - 0,499, p = 0.01), and a positive relationship between the level of BDNF and cognitive function in patients with type 2 diabetes. Conclusion. In patients with ...

Brain-derived neurotrophic factor modulates immune reaction in mice with peripheral nerve xenotransplantation Xin Yu,1 Laijin Lu,1 Zhigang Liu,1 Teng Yang,2 Xu Gong,1 Yubo Ning,3 Yanfang Jiang4 1Department of Hand Surgery, 2Department of Orthopedics, The First Hospital of Jilin University, Changchun, 3Department of Orthopedics, Ningshi Orthopedics Hospital of Tonghua, Tonghua, 4Department of Central Laboratory, The First Hospital of Jilin University, Changchun, Peoples Republic of China Background: Brain-derived neurotrophic factor (BDNF) has been demonstrated to play an important role in survival, differentiation, and neurite outgrowth for many types of neurons. This study was designed to identify the role of BDNF during peripheral nerve xenotransplantation. Materials and methods: A peripheral nerve xenotransplantation from rats to mice was performed. Intracellular cytokines were stained for natural killer (NK) cells, natural killer T (NKT) cells, T cells, and B cells and analyzed by flow cytometry

Interleukin 6 (IL-6) and related cytokines, such as leukemia inhibitory factor (LIF), oncostatin M (OSM), ciliary neurotrophic factor (CNTF) and IL-11 exhibit multiple functions and redundancy in biological activities and play important roles in the immune response, hematopoiesis, the nervous system …

Nerve growth factor (NGF) and brain-derived neurotrophic factor (BDNF) are molecules which regulate the development and maintenance of specific functions in dif

Figure 1. Immunolocalization of CNTFRα in the adult mouse retina. A: Negative control. B: Pattern of immunoenzymatic labeling with the anti-chick CNTFRα antibody. C: Pattern of immunoenzymatic labeling with the anti-rat CNTFRα antibody. D: Sequential section (to B) labeled with mouse cone arrestin antibody. E: Immunofluorescence labeling (overlaid images) with the anti-chick CNTFRα antibody (green), DAPI (blue), and peanut agglutinin (red). Intense labeling with the CNTFRα antibodies (B,E) was limited to ganglion cells, nerve fibers, and cells located predominantly at the vitreal and scleral borders of the inner nuclear layer (INL). Less intense labeling was also present at the inner plexiform layer (IPL) and outer plexiform layer (OPL). Nonspecific staining was observed at the photoreceptor layer (A-C) and was distinct from the specific cone inner segment labeling (arrows in D) obtained with the mouse cone arrestin antibody. Fluorescence immunocytochemistry confirmed the absence of ...

2 reviews. Compare Brain Derived Neurotrophic Factor ELISA Kits from leading suppliers on Biocompare. View specifications, prices, citations, reviews, and more.

Higher level of protein from the gene called brain-derived neurotrophic factor may provide a buffer for the brain and protect it against the effects of the plaques.

Human BDNF (Brain Derived Neurotrophic Factor) ELISA Kit assay has a sensitivity of |2pg/ml. Measure BDNF (Brain Derived Neurotrophic Factor) in serum, blood, plasma, cell supernatant samples.