Glucosuria Predicts the Severity of Puumala Hantavirus Infection<...
TY - JOUR. T1 - Glucosuria Predicts the Severity of Puumala Hantavirus Infection. AU - Tietäväinen, J.. AU - Mantula, P.. AU - Outinen, T.. AU - Huhtala, H.. AU - Pörsti, I.H.. AU - Niemelä, O.. AU - Vaheri, A.. AU - Mäkelä, S.. AU - Mustonen, J.. PY - 2019. Y1 - 2019. KW - Myyräkuume. KW - Puumala virus. KW - Puumalavirus. KW - acute kidney injury. KW - glucosuria. KW - glukosuria. KW - hantavirus. KW - munuaisvaurio. KW - thrombocytopenia. KW - trombosytopenia. KW - Myyräkuume. KW - Puumala virus. KW - Puumalavirus. KW - acute kidney injury. KW - glucosuria. KW - glukosuria. KW - hantavirus. KW - munuaisvaurio. KW - thrombocytopenia. KW - trombosytopenia. U2 - 10.1016/j.ekir.2019.05.770. DO - 10.1016/j.ekir.2019.05.770. M3 - Article. VL - 4. SP - 1296. EP - 1303. IS - 9. ER - ...
Human Puumala hantavirus infection in northern Sweden; increased seroprevalence and association to risk and health factors |...
The rodent borne Puumala hantavirus (PUUV) causes haemorrhagic fever with renal syndrome in central and northern Europe. The number of cases has increased and northern Sweden has experienced large outbreaks in 1998 and 2006-2007 which raised questions regarding the level of immunity in the human population. A randomly selected population aged between 25 and 74 years from northern Sweden were invited during 2009 to participate in a WHO project for monitoring of trends and determinants in cardiovascular disease. Health and risk factors were evaluated and sera from 1,600 participants were available for analysis for specific PUUV IgG antibodies using a recombinant PUUV nucleocapsid protein ELISA. The overall seroprevalence in the investigated population was 13.4 %, which is a 50 % increase compared to a similar study only two decades previously. The prevalence of PUUV IgG increased with age, and among 65-75 years it was 22 %. More men (15.3 %) than women (11.4 %) were seropositive (p | 0.05). The identified
Complete gene sequence of a human Puumala hantavirus isolate, Puumala Umeå/hu: sequence comparison and characterisation of...
Puumala virus is a member of the hantavirus genus in the Bunyaviridae family, and the major causative agent of haemorrhagic fever with renal syndrome in Europe. This study was conducted with a human Puumala virus isolate (PUUV Umeå/hu), and contains the determination of the first complete PUUV sequence from a human source. When the relationship to other Puumala viruses was analysed, a possible RNA segment exchange between two local strains of PUUV was noticed. Furthermore, the coding regions of PUUV Umeå/hu S- and M-segments were cloned, and a large set of gene products were expressed in mammalian cells. In addition, postulated N- and O-linked glycosylation sites in the two envelope proteins (Gn and Gc) were investigated individually by site-directed mutagenesis followed by gel-shift analysis. Our data demonstrate that N-linked glycosylation occurs at three sites in Gn (N142, N357 and N409), and at one site in Gc (N937). Also, one possible O-glycosylation site was identified in Gc (T985). We conclude
Welcome to CDC stacks | Outbreak of Puumala Virus Infection, Sweden - 17020 | Emerging Infectious Diseases
An unexpected and large outbreak of Puumala virus infection in Sweden resulted in 313 nephropathia epidemica patients/100,000 persons in Västerbotten County during 2007. An increase in the rodent population, milder weather, and less snow cover probably contributed to the outbreak ...
Figure 3 - Behavioral, Physiologic, and Habitat Influences on the Dynamics of Puumala virus Infection in Bank Voles ...
Populations of bank voles (Clethrionomys glareolus) were monitored during a 4-year study in southern Belgium to assess the influence of agonistic behavior, reproductive status, mobility, and distribution of the rodents on the dynamics of Puumala virus (abbreviation: PUUV; genus: Hantavirus) infection. Concordance was high between data from serologic testing and results of viral RNA detection. Wounds resulting from biting or scratching were observed mainly in adult rodents. Hantavirus infection in adults was associated with wounds in the fall, i.e., at the end of the breeding season, but not in spring. In addition, sexually active animals were significantly more often wounded and positive for infection. Hantavirus infection was associated with higher mobility in juvenile and subadult males. Seroconversions observed 6 months apart also occurred more frequently in animals that had moved longer distances from their original capture point. During nonepidemic years, the distribution of infection was patchy,
Figure 2 - Behavioral, Physiologic, and Habitat Influences on the Dynamics of Puumala virus Infection in Bank Voles ...
Populations of bank voles (Clethrionomys glareolus) were monitored during a 4-year study in southern Belgium to assess the influence of agonistic behavior, reproductive status, mobility, and distribution of the rodents on the dynamics of Puumala virus (abbreviation: PUUV; genus: Hantavirus) infection. Concordance was high between data from serologic testing and results of viral RNA detection. Wounds resulting from biting or scratching were observed mainly in adult rodents. Hantavirus infection in adults was associated with wounds in the fall, i.e., at the end of the breeding season, but not in spring. In addition, sexually active animals were significantly more often wounded and positive for infection. Hantavirus infection was associated with higher mobility in juvenile and subadult males. Seroconversions observed 6 months apart also occurred more frequently in animals that had moved longer distances from their original capture point. During nonepidemic years, the distribution of infection was patchy,
Expansion of spatial and host range of Puumala virus in Sweden: an increasing threat for humans?
Hantaviruses are globally distributed and cause severe human disease. Puumala hantavirus (PUUV) is the most common species in Northern Europe, and the only hantavirus confirmed to circulate in Sweden, restricted to the northern regions of the country. In this study, we aimed to further add to the natural ecology of PUUV in Sweden by investigating prevalence, and spatial and host species infection patterns. Specifically, we wanted to ascertain whether PUUV was present in the natural reservoir, the bank vole (Myodes glareolus) further south than Dalalven river, in south-central Sweden, and whether PUUV can be detected in other rodent species in addition to the natural reservoir. In total, 559 animals were collected at Grimso (59 degrees 43 N; 15 degrees 28 E), Sala (59 degrees 55 N; 16 degrees 36 E) and Bogesund (59 degrees 24 N; 18 degrees 14 E) in south-central Sweden between May 2013 and November 2014. PUUV ELISA-reactive antibodies were found both in 2013 (22/295) and in 2014 (18/264), and ...
Accumulation of point mutations and reassortment of genomic RNA segments are involved in the microevolution of Puumala...
The genetic diversity of Puumala hantavirus (PUUV) was studied in a local population of its natural host, the bank vole (Myodes glareolus). The trapping area (2.5x2.5 km) at Konnevesi, Central Finland, included 14 trapping sites, at least 500 m apart; altogether, 147 voles were captured during May and October 2005. Partial sequences of the S, M and L viral genome segments were recovered from 40 animals. Seven, 12 and 17 variants were detected for the S, M and L sequences, respectively; these represent new wild-type PUUV strains that belong to the Finnish genetic lineage. The genetic diversity of PUUV strains from Konnevesi was 0.2-4.9% for the S segment, 0.2-4.8% for the M segment and 0.2-9.7% for the L segment. Most nucleotide substitutions were synonymous and most deduced amino acid substitutions were conservative, probably due to strong stabilizing selection operating at the protein level. Based on both sequence markers and phylogenetic clustering, the S, M and L sequences could be assigned ...
GP - Envelopment polyprotein precursor - Puumala virus (strain Sotkamo/V-2969/81) - GP gene & protein
Glycoprotein N and Glycoprotein C interact with each other and are present at the surface of the virion. They are able to attach the virion to host cell receptors. This attachment induces virion internalization predominantly through clathrin-dependent endocytosis. Also promotes fusion of viral membrane with host endosomal membrane after endocytosis of the virion. Glycoprotein N contains an ITAM motif which is likely to dysregulate normal immune and endothelial cell responses and contribute to virus pathogenesis (By similarity).
ISEE Conference | ISEE - International Society for Environmental Ethics
ISEE 2021 International Society for Environmental Ethics 2021 Annual Meeting (Virtual) Organized from Turku, Finland by this years conference team: Mikko Puumala, Laura Puumala, Helena Siipi, and Elisa Aaltola June 30th - July 3rd Keynote: Teea Kortetmäki CLICK HERE TO ACESS CONFERENCE PADLET CLICK HERE TO ACCESS ZOOM Shared Session Room [Meeting ID: 613 0221…
Relating land cover and spatial distribution of nephropathia epidemica and Lyme borreliosis in Belgium. - Prohealth
Lyme borreliosis (LB) and nephropathia epidemica (NE) are zoonoses resulting from two different transmission mechanisms and the action of two different pathogens: the bacterium Borrelia burgdorferi and the Puumala virus, respectively. The landscape configuration is known to influence the spatial spread of both diseases by affecting vector demography and human exposure to infection. Yet, the connections between landscape and disease have rarely been quantified, thereby hampering the exploitation of land cover data sources to segment areas in function of risk. This study implemented a data-driven approach to relate land cover metrics and an indicator of NE/LB risk at different scales of observation of the landscape. Our results showed the suitability of the modeling approach (r² | 0.75, ? | 0.001) and highlighted the relevance of the scale of observation in the set of landscape attributes found to influence disease risk as well as common and specific risk factors of NE and LB.
Welcome to CDC stacks
Puumala hantavirus is present in bank voles (Myodes glareolus) and is believed to be spread mainly by contaminated excretions. In this study, we subcutaneously inoculated 10 bank voles with Puumala virus and sampled excretions until day 133 postinfection. Levels of shed viral RNA peaked within 11-28, 14-21, and 11-28 days postinfection for saliva, urine, and feces, respectively. The latest detection of viral RNA was 84, 44, and 44 days postinfection in saliva, urine, and feces, respectively. In contrast, blood of 5 of 6 animals contained viral RNA at day 133 postinfection, suggesting that bank voles secrete virus only during a limited time of the infection. Intranasal inoculations with bank vole saliva, urine, or feces were all infectious for virus-negative bank voles, indicating that these 3 transmission routes may occur in nature and that rodent saliva might play a role in transmission to humans ...
DiVA - Search result
BACKGROUND: Hantavirus infections cause potentially life-threatening disease in humans world-wide. Infections with American hantaviruses may lead to hantavirus pulmonary syndrome characterised by severe cardiopulmonary distress with high mortality. Pulmonary involvement in European Puumala hantavirus (PUUV) infection has been reported, whereas knowledge of potential cardiac manifestations is limited. We aimed to comprehensively investigate cardiopulmonary involvement in patients with PUUV-infection.. METHODS: Twenty-seven hospitalised patients with PUUV-infection were examined with lung function tests, chest high-resolution CT (HRCT), echocardiography including speckle tracking strain rate analysis, ECG and measurements of cardiac biomarkers N-terminal pro-B-type natriuretic peptide (NT-ProBNP) and troponin T. Patients were re-evaluated after 3 months. Twenty-five age and sex-matched volunteers acted as controls for echocardiography data.. RESULTS: Two-thirds of the patients experienced ...
Local variation in endoparasite intensities of bank voles (Clethrionomys glareolus )from ecologically similar sites:...
Much interest has centred recently on the role of adaptive trade-offs between the immune system and other components of life history in determining resistance and parasite intensities among hosts. Steroid hormones, particularly glucocorticoids and sex steroids, provide a plausible mechanism for mediating such trade-offs. A basic assumption behind the hypothesis, however, is that steroid activity will generally correlate with reduced resistance and thus greater parasite intensities. Here, we present some findings from a field study of bank voles (Clethrionomys glareolus ) in which we have looked at associations between parasite intensities, anatomical and morphometric measures relating to endocrine function and life history variation in three local populations inhabiting similar but mutually isolated woodland habitats. In general, sites with greater parasite intensities were those in which male C. glareolus had significantly larger adrenal glands, testes and seminal vesicles for their age and ...
Factsheet: Hemorrhagic Fever with Renal Syndrome | CDC Special Pathogens Branch
Symptoms of HFRS usually develop within 1 to 2 weeks after exposure to infectious material, but in rare cases, they may take up to 8 weeks to develop. Initial symptoms begin suddenly and include intense headaches, back and abdominal pain, fever, chills, nausea, and blurred vision. Individuals may have flushing of the face, inflammation or redness of the eyes, or a rash. Later symptoms can include low blood pressure, acute shock, vascular leakage, and acute kidney failure, which can cause severe fluid overload. The severity of the disease varies depending upon the virus causing the infection. Hantaan and Dobrava virus infections usually cause severe symptoms, while Seoul and Puumala virus infections are usually more moderate. Complete recovery can take weeks or months.. ...
Productivity investigation of an island population of Clethrionomys glareolus (Schreber, 1780). I. Dynamics of cohorts -...
Materiały zawarte w niniejszej pracy pochodzą z badań nad izolowaną populacją Clethrionomys glareolus (Schreber, 1780), żyjącą na 4 ha wyspie na jez. Bełdany. W ciągu roku (IV. 1966 - IV. 1967) przeprowadzono 6-krotną ocenę liczebności gryzoni metodą CMR (Tabela 1, Ryc. 1). Wskazano, że każdorazowa ocena wiernie oddaje liczbę osobników obecnych na powierzchni (Tabela 2)
Productivity investigation of an island population of Clethrionomys glareolus (Schreber, 1780). I. Dynamics of cohorts -...
Materiały zawarte w niniejszej pracy pochodzą z badań nad izolowaną populacją Clethrionomys glareolus (Schreber, 1780), żyjącą na 4 ha wyspie na jez. Bełdany. W ciągu roku (IV. 1966 - IV. 1967) przeprowadzono 6-krotną ocenę liczebności gryzoni metodą CMR (Tabela 1, Ryc. 1). Wskazano, że każdorazowa ocena wiernie oddaje liczbę osobników obecnych na powierzchni (Tabela 2)
Novel OBP genes similar to hamster Aphrodisin in the bank vole, Myodes glareolus | Springer for Research & Development
Background Chemical communication in mammals involves globular lipocalins that protect and transport pheromones during their passage out of the body. Efficient communication via this protein -...
Designing a new DNA metabarcode for fish
AC seq_length taxid rank species species_name ## 1 NC_013146 16960 100858 species 100858 Threskiornis aethiopicus ## 2 NC_016427 16379 82464 species 82464 Myodes regulus ## genus genus_name family family_name superkingdom ## 1 100857 Threskiornis 33574 Threskiornithidae 2759 ## 2 447134 Myodes 337677 Cricetidae 2759 ## superkingdom_name strand forward_match forward_mismatch forward_tm ## 1 Eukaryota D ATACCGCCCGTCACCCTC 2 45.64 ## 2 Eukaryota D ACACCGCCCGTCACCCTC 1 53.84 ## reverse_match reverse_mismatch reverse_tm amplicon_length ## 1 CTAAGTGCACATTCCGGT 2 45.55 74 ## 2 CCAAGCACACTTTCCAGT 4 16.28 79 ## sequence ## 1 CTCATAAGCTACTGACTCCCATAACTAATACCCTAATTAGCCGAAGATGAGGTAAGTCGTAACAAGGTAAGTGT ## 2 CTCAAACTAAATAAATGAGATCTATACATAATTACATCAAACTTTTACGAGAGGAGATAAGTCGTAACAAGGTAAGCAT ## definition ## 1 Threskiornis aethiopicus mitochondrion, complete genome ## 2 Myodes regulus mitochondrion, complete ...
Predicting high risk for human hantavirus infections, Sweden.
An increased risk for hemorrhagic fever with renal syndrome caused by Puumala hantavirus was forecast for Sweden in 2007. The forecast was based on a predicted increase in the number of Myodes glareolus rodents (reservoir hosts). Despite raised aware
Gentaur Molecular :AIC \ Hemorrhagic fever with renal syndrome virus, Puumala strain antibody \ 5-CCV
Gentaur molecular products has all kinds of products like :search , AIC \ Hemorrhagic fever with renal syndrome virus, Puumala strain antibody \ 5-CCV for more molecular products just contact us
Hantavirus Infection With Renal Failure and Proteinuria Hantavirus Infection With Renal Failure and Proteinuria
This report describes a case of hantavirus-associated acute renal failure and proteinuria. How was this case ultimately diagnosed?Emerging Infectious Diseases...
Hantavirus Infection - Infectious Diseases - Merck Manuals Professional Edition
Hantavirus Infection - Etiology, pathophysiology, symptoms, signs, diagnosis & prognosis from the Merck Manuals - Medical Professional Version.
Revues à comité de lecture international(2002-2003) - [TIMC-IMAG]
2003
Bicout DJ and Sache I. Persistent Walk and Spore Dispersal Density Function. Phys. Rev. E. 2003, vol. 67, n° 0319131 - 0319137.
Billecocq A, Coudrier D, Boué F, Combes B, Zeller H, Artois M and Bouloy M. Expression of the nucleoprotein of the Puumala virus from the recombinant Semliki Forest virus replicon : characterization and use as a potential diagnostic tool. Clinical and diagnostic laboratory immunology. 2003, vol. 10, n° 4, pp. 658-663.
Hours M, Anzivino-Viricel L, Maître A, (...)
Most recent papers with the keyword Bank vole | Read by QxMD
To get a deeper insight into the function of estrogen-related receptors (ERRs) and dissect underlying mechanism in Leydig cells, ERRs (type α, β and γ) were blocked or activated in testes of adult bank voles (Myodes glareolus) which show seasonal changes in the intratesticular sex hormones level. Both actively reproducing animals (long day conditions; LD) and those with regression of the reproductive system (short day conditions; SD) received intraperitoneal injections of selective ERRα antagonist 3-[4-(2,4-Bis-trifluoromethylbenzyloxy)-3-methoxyphenyl]-2-cyano-N-(5-trifluoromethyl-1,3,4-thiadiazol-2-yl)acrylamide (XCT 790) or selective ERRβ/ERRγ agonist N-(4-(Diethylaminobenzylidenyl)-N-(4-hydroxybenzoyl)-hydrazine (DY131) (50 μ/kg bw; six doses every other day ...
LOTTE HOTEL SAMARA Location, Transportation | LOTTE HOTEL SAMARA
Check the route from the Russia Kurumoch Airport to LOTTE HOTEL SAMARA. View LOTTE HOTEL SAMARA location, transportation | | LOTTE HOTEL SAMARA Official Website
Foto měsíce (Photo of the month)
Not all of the experiences in nature and moments spent with animals can be labelled with name „expedition. I decided to post the one most interesting photo every month to describe a particular moment. The May will be represented by the close observation of the bank vole (Myodes glareolus) in the Beskydy mountains near Nový Hrozenkov. This young animal behaved very friendly and had no problem with photographing from a very small distance. What a nice encounter! ...
Samara - 443000.ru
Samara - 443000.ru: For overhaul can now be paid in the offices of Mail of Russia, The Russian Government is ready to extend the grace period for the system Platon, Samara activists of the popular front in Day of workers of housing and communal services held the Good neighbors, N. And.Merkushin: Over the past four years the salary of cultural workers in the region grew more...
Lada | 2108 Samara Beige | 1:18 | Premium Scale Models | PSM18003Ebg | Toms Modelautos
Lada | 2108 Samara Beige | 1:18 | Premium Scale Models | PSM18003Ebg | Toms Modelautos - Street cars - Lada Samara 2108 *Diecast Series*, beige with brown interior
Treatment
Treatment for HantavirusThe earlier Hantavirus infection is treated, the better the chances are for recovery.The disease can become life threatening within a few days of early symptoms, so its very important to get medical treatment right away. Patients are usually admitted to hospital and given oxygen to help them breathe.
World Tram & Trolleybus Systems:: Russia:: SAMARA TRAM AND TROLLEYBUS NETWORK:: Trolleybus Network:\\Gubernskiy Rynok - Polyana...
This trolleybus commemorates the 60 years of Samara trolleybuses (1942-2002). The same trolleybus is seeing in the photo above as the leading car in the train 870+871, 2 years earlier ...
Samara Hotels from £14 | Cheap Hotels | lastminute.com
Looking for a cheap hotel in Samara? Check out our amazing selection of hotels to match your budget & save with our Price Match Guarantee.
Samara Saraiva- Shocking Claims From Damon Wayans Jr Wife? | VergeWiki
Samara Saraiva is a very humbler person, and she is not much into fame and paparazzi. She likes to live a quiet life. She is famous as she is the wife of Damon Wayans Jr. Her husband is a popular actor and has appeared in huge movies and TV shows to date. Know more about married life and husband. Net worth is amazing.
Urinary Neutrophil Gelatinase-Associated Lipocalin (NGAL) and proteinuria predict severity of acute kidney injury in Puumala...
Nephropathia epidemica (NE) is a mild form of hemorrhagic fever with renal syndrome (HFRS) that is caused by the Puumala virus. Periodic outbreaks have been described in endemic areas, with a substantial number of previously healthy individuals developing acute kidney injury (AKI). There is a considerable diversity in the clinical course of the disease, and few patients require renal replacement therapy. We tested whether urinary neutrophil gelatinase associated lipocalin (uNGAL), urine albumin/creatinine ratio (uACR), urine protein/creatinine ratio (uPCR), urine dipstick protein, C-reactive protein, procalcitonin, leukocyte and platelet count, determined on admission to the hospital, can predict the severity of AKI. Sixty-one patients were analyzed during admission in the emergency department. The variables most strongly associated with peak plasma creatinine concentration were uNGAL (β = 0.70, p |0.0001), uPCR (β = 0.64, p = 0.001), uACR (β = 0.61, p = 0.002), and dipstick proteinuria (β = 0.34, p
A Case-Control Study after a Hantavirus Infection Outbreak in the South of Belgium: Who Is at Risk? : Clinical Infectious...
Puumala is the most common hantavirus serotype in Europe and is spread mainly by the red bank vole. Between 1 July 1992 and 31 January 1994, an outbreak of Puumala virus-induced nephropathia epidemica (NE) occurred in the Belgian Ardennes. Serologically confirmed cases (n = 41) were compared with two groups of asymptomatic seronegative controls. Risks identified included sighting of living rodents, exposure to rodent droppings, and trapping rodents during the 4 weeks preceding onset of symptoms. Activities during this 4-week period that presented the greatest risk were woodcutting, reopening of a nonaerated room, and strenuous physical effort. This is the first case-control study on risk factors for NE in Europe. In comparison with the American form of hantavirus pulmonary syndrome, which is spread by deer mice, professional activity appears to be a more important risk factor for acquisition of hantavirus in Europe.. ...
Selective Predation of Tawny Owls (Strix aluco) on Yellow-Necked Mice (Apodemus flavicollis) and Bank Voles (Myodes glareolus) ...
Differential predation on certain classes of individuals within prey populations might make owls strong selective agents on their prey. We investigated selective predation of tawny owls (Strix aluco) on yellow-necked mice (Apodemus flavicollis, A.f.) and bank voles (Myodes glareolus, M.g.) for two years by comparing prey from owl nests with live-trapped individuals. The owls killed significantly more male M.g. (73%) than females, but not more than expected from traps (57%). For A.f., owls selected adults in favour of subadults, and for adults, individuals with longer femurs. Adult males of A.f. killed by owls had significantly heavier testes in relation their size than the trapped males. Prey selection did not correlate with size-adjusted body or spleen mass. Owl-killed A.f. had higher prevalences of the intestinal helminth Heligmosomoides sp. than trapped individuals, but hosted similar numbers of parasite species. Differential predation of tawny owls on yellow-necked mice and bank voles seems ...
Hantavirus RNA in saliva from patients with hemorrhagic fever with renal syndrome.
Hantavirus är en grupp av virus som finns hos gnagare som bär på viruset utan att själva bli märkbart sjuka. Varje hantavirus har anpassat sig till sin egen art av gnagare som de infekterar (kallas virusets reservoar). Hantaviruset kan överföras till människor från gnagare och kallas då för en zoonos eftersom detsprids från djur till människa. I människa orsakar hantavirus blödarfeber med njurpåverkan i Eurasien och blödarfeber med med hjärt och lungpåverkan i Nord- och Sydamerika.. I Sverige har vi bara ett hantavirus som är sjukdomsframkallande hos människor, Puumala-viruset som även finns i delar av övriga Europa. Det framkallar en relativt mild form av blödarfeber, som kallas sorkfeber eller Nephropathia epidemica. Puumala-virusets reservoar är skogssorken (Myodes glareolus).. Människor smittas oftast av hantavirus när de andas in infekterat damm som innehåller utsöndringar (avföring, urin eller saliv) från gnagare som har torkat in och sedan blivit luftburet. ...
Unterwegs in der Schweiz - von Menschen, Mäusen und Zecken - Zurich Open Repository and Archive
Tick-borne infections are endemic in Switzerland with borreliosis being the most frequent one, followed by the vaccine-preventable tick-borne encephalitis and more rarely by anaplasmosis, rickettsioses and babesiosis. Short characteristics of these infections are presented. The main preventive measures for stays in endemic regions include not leaving forest tracks and wearing closely fitted clothes and shoes, impregnated with an insecticide. Following at-risk activities, clothes as well as the body should be searched for ticks and they have to be removed using a tick removing tool. The body area of the tick bite has to be observed and a physician visit is strongly urged in case of rising fever and/or of erythema migrans. Hantavirus infections: Nephropathia epidemica is a zoonosis caused by the Puumala type of hantavirus and transmission occurs by inhaling aerolized excretions of the bank vole. There is no known human to human transmission. The incidence of this infection varies in a cyclic ...
puuvõõrik - Eesti Entsüklopeedia
puuvõõrik (Viscum), puudel nugivate igihaljaste lehtpõõsaste perekond; umbes 70 liiki peamiselt Aafrikas, vähesed ka Euraasias ja Austraalias. Tuntuim on harilik puuvõõrik (Viscum album), selle levila põhjapiir on Lätis. Puuvõõrikut kasutatakse mõnel maal jõuludekoratsiooniks (ingl mistletoe). ...
Protection against hantavirus infection by dams immunity transferred vertically to neonates | SpringerLink
Antibodies to hantavirus, Seoul type B-1 strain, vertically transferred to rat neonates prevented lethal as well as persistent infection. When relatively high titer viruses were inoculated into neonat
I Have Radio Renal Syndrome
Do You Have Radio Renal Syndrome? Join friendly people sharing true stories in the I Have Radio Renal Syndrome group. Find support forums, advice and chat with groups who share this life experience. A Radio Renal Syndrome anonymous support group with...
Hantavirus Infection, Non-Hantavirus Pulmonary Syndrome | Summary | NNDSS
Note: Javascript is disabled or is not supported by your browser. For this reason, some items on this page will be unavailable. For more information about this message, please visit this page: About CDC.gov ...
hantavirus infection map - Corona
One of the complicating factors associated with remote sensing. In the semi-arid, like the Southwest US, the reading of the satellite does not fit well with the actual amount of vegetation. The image shows both the vegetation and soil bare, and depending on the the type of soil, you can get false readings, says Glass. Another factor that makes it difficult is the vegetation. I visited the Four Corners region during El Niño next in 1998 and 1999 and realize that the risk of disease does not depend on the vegetation, per se. Broad categories of vegetation for the high and low risk areas, but it was not simple matter said pinon juniper forests of high risk or low-lying salt bush low risk ...
What is Hantavirus? | Passport Health
After two recent deaths in different states, hantavirus is slowly making its way across the United States. What is the deadly virus? Largely spread by rodents, hantavirus presents much like the flu. But, with a 40 percent death rate and a history in foreign countries, hantavirus shouldnt be taken lightly.
Seasonal Forcing on the Dynamics of Clethrionomys rufocanus: Modeling the Geographic Gradient in Population Dynamics -...
N.C. Stenseth, O.N. Bjørnstad and T. Saitoh: Seasonal forcing on the dynamics of Clethrionomys rufocanus - modeling geographic gradients in population dynamics
ORBi: Browsing ORBi
in Revue Médicale de Liège (1997), 52(8), 515-519. LEntre-Sambre-et-Meuse a été le siège dune épidémie de néphropathie épidémique à Hantavirus (NE) en 199293. Cinq cas ont été rencontrés au CHU de Liège en moins dun an. Le virus responsable de cette ... [more ▼]. LEntre-Sambre-et-Meuse a été le siège dune épidémie de néphropathie épidémique à Hantavirus (NE) en 199293. Cinq cas ont été rencontrés au CHU de Liège en moins dun an. Le virus responsable de cette affection appartient à la famille dès Hantavirus dont il existe huit sérotypes aux caractéristiques propres en terme de vecteur (rongeurs), de distribution géographique et de pathogénicité. Les pathologies induites chez lhomme vont de la néphropathie épidémique à Hantavirus - dévolution le plus souvent bénigne- au syndrome pulmonaire à Hantavirus (SPH) - fréquemment mortel - en passant par la fièvre hémorragique avec syndrome rénal (FHSR) de sévérité intermédiaire. Dans nos ...
Cellular receptors and hantavirus pathogenesis. - MyScienceWor...
Cellular receptors and hantavirus pathogenesis.: Hantaviruses cause two potentially lethal diseases, HPS and HFRS, and both diseases result in defects in vascul
Doctors CV and past experiences - Dr Dimitrios Samaras
The Curriculum Vitae as welll as all professionnal and extra-professionnal experiences of Doctor Dimitrios Samaras, nutrition specialist.
Thanos Samaras » 2013 » February
Good evening Mr Samaras,. I am very sorry for the loss of your cat. The animal arrived at my clinic with severe pulmonary edema and thromboembolism and unfortunately, despite my efforts, died.. Although many causes may lead to such situation, cardiac dysfunction and thrombosis might me the most likely one. On the other hand, the disease cannot be predicted since it is an acute phenomenon.. Warm regards with all my sympathy,. Dr E. I. Papadogiannakis. ...
Thomas T. Samaras, Reventropy Associates - The Truth about Your Height - Online Publications
Thomas Samaras TT reviews the interrelations of human body size, height, birth weight, childhood growth, longevity, obesity, BMI, nutrition, protein, intelligence, physical performance, cancer, heart disease, diabetes, and caloric restriction.
Thomas T. Samaras, Reventropy Associates - The Truth about Your Height - Publications
Thomas Samaras TT reviews the interrelations of human body size, height, birth weight, childhood growth, longevity, obesity, BMI, nutrition, protein, intelligence, physical performance, cancer, heart disease, diabetes, and caloric restriction.
Photo Release -- Cornelia Samara Appointed General Manager, Andaz 5th Avenue
NEW YORK, Dec. 6, 2012 (GLOBE NEWSWIRE) -- Today, Andaz 5th Avenue announces the appointment of Cornelia Samara to the position of General Manager.
Shop Yasel Style Diamond Engagement Ring from Samara James
Yasel Style Diamond Engagement Ring designed with cushion cut diamond clustered by a border of grain set round brilliant diamonds. Shop from Samara James.
Cows with human chromosomes enlisted to fight hantavirus | Science | AAAS
Researchers have genetically engineered cows to produce human antibodies against the deadly hantavirus and possibly other diseases
120724943
Les gouverneurs face à leur région la politique de décentralisation et son rôle dans la régulation des relations centre-périphérie (1990-2010) : étude des régions de Samara et ...
Loraine James, Running Like That Ft Eden Samara - Rory Lee Design
Really enjoy this track. The underpinning chords are a sick motif. So simple but drive it forward and marry well to the erratic staccato beats. ...