Results Significant hypomethylation of two CpG sites within IFI44L promoter, Site1 (Chr1: 79 085 222) and Site2 (Chr1: 79 085 250; cg06872964), was identified in patients with SLE compared with HCs, patients with RA and patients with pSS. In a comparison between patients with SLE and HCs included in the first validation cohort, Site1 methylation had a sensitivity of 93.6% and a specificity of 96.8% at a cut-off methylation level of 75.5% and Site2 methylation had a sensitivity of 94.1% and a specificity of 98.2% at a cut-off methylation level of 25.5%. The IFI44L promoter methylation marker was also validated in an European-derived cohort. In addition, the methylation levels of Site1 and Site2 within IFI44L promoter were significantly lower in patients with SLE with renal damage than those without renal damage. Patients with SLE showed significantly increased methylation levels of Site1 and Site2 during remission compared with active stage. ...
Gao, L., Smit, M. A., van den Oord, J. J., Goeman, J. J., Verdegaal, E. M. E., van der Burg, S. H., Stas, M., Beck, S., Gruis, N. A., Tensen, C. P., Willemze, R., Peeper, D. S. and van Doorn, R. (2013), Genome-wide promoter methylation analysis identifies epigenetic silencing of MAPK13 in primary cutaneous melanoma. Pigment Cell & Melanoma Research, 26: 542-554. doi: 10.1111/pcmr.12096 ...
We have characterized the 5′ region of the human alpha 1(V) collagen gene (COL5A1). The transcriptional promoter is shown to have a number of features characteristic of the promoters of housekeeping and growth-control-related genes. It lacks obvious TATA and CAAT boxes, has multiple transcription start sites, has a high GC content, lies within a well-defined CpG island and has a number of consensus sites for the potential binding of transcription factor Sp1. This type of promoter structure, while unusual for a collagen gene, is consistent with the broad distribution of expression of COL5A1 and is reminiscent of the promoter structures of the genes encoding type VI collagen, which has a similarly broad distribution of expression. Stepwise deletion of COL5A1 5′ sequences, placed upstream of a heterologous reporter gene, yielded a gradual decrease in promoter activity, indicating that the COL5A1 promoter is composed of an array of cis-acting elements. A minimal promoter region contained ...
Our products have been quoted by publications of Association of CnB 5I/5D promoter gene polymorphism and serum calcineurin levels in early onset of coronary artery disease of south Indian cohort from Gene .
Our results establish that the extent of stable DNA wrapping in RPo depends on the sequence of the promoter and, in particular, on sequence determinants in the upstream region of the promoter (UP elements). The presence of αCTD and an intact α‐linker is required to maintain extensive stable DNA wrapping. Our results further indicate that the sequence of the upstream region of the promoter can affect DNA wrapping even in the absence of αCTD and thus even in the absence of αCTD-DNA interactions. For example, RPo prepared using ΔαCTDI/ΔαCTDII RNAP shows an apparent DNA compaction of 13±0.6 nm at lacUV5(UPfull) but only 4±0.8 nm at lacUV5(ICAP) (Fig 3E,F). We infer that the sequence of the upstream region of the promoter can affect compaction not only through effects on αCTD-DNA interaction but also through other effects. We suggest that these other effects involve intrinsic DNA curvature, noting that UP‐element subsites and UP elements are A/T‐rich sequences (Fig 1A; Ross et al, ...
Dual Luciferase Assay - posted in Molecular Cloning: I am planning to do a dual luciferase assay using the firefly and renilla luciferase vectors. Can someone suggest me a ratio for the co-reporter vectors to be added to the transfection mix. Regards Sankella
The present study describes a novel cell type-specific mechanism of transcriptional regulation of TSP-1 in vascular cells in response to glucose. We report here that unlike our recently identified short promoter region (−280/+66) responsible for the increased THBS1 transcription in ECs, a longer promoter fragment (−1270/+66) is required for THBS1 regulation in HASMCs, as was described for specialized pericytes and mesangial cells.27 Interestingly, glucose responsiveness in ECs was in fact inhibited by the distal fragment of the promoter,10 suggesting the presence of an inhibitory element in this region, which is not active in either VSMCs or mesangial cells.27 The longer promoter region, −1270/+66, responsible for the increased THBS1 transcription in HASMCs contained distinctly different binding elements, as identified by MatInspector, located in the distal end of the promoter. These binding elements had no similarity to those in the EC-specific THBS1 promoter fragment, −280/+66, ...
In this article, we review some of the expression systems that are available for Metabolic Control Analysis and Metabolic Engineering, and examine their advantages and disadvantages in different contexts. In a recent approach, artificial promoters for modulating gene expression in micro-organisms were constructed using synthetic degenerated oligonucleotides. From this work, a promoter library was obtained for Lactococcus lactis, containing numerous individual promoters and covering a wide range of promoter activities. Importantly, the range of promoter activities was covered in small steps of activity change. Promoter libraries generated by this approach allow for optimization of gene expression and for experimental control analysis in a wide range of biological systems by choosing from the promoter library promoters giving, e.g., 25%, 50%, 200%, and 400% of the normal expression level of the gene in question. If the relevant variable (e.g., the flux or yield) is then measured with each of these ...
No. The Promoter Selection Plate is not meant to be used to establish fundamental lentiviral transduction conditions, such as optimal cell density, in your cells of interest. The purpose of the Promoter Selection Plate is to visually assess relative promoter activity. Basic experimental conditions (such as cell density, with or without serum, Polybrene concentration) should be established prior to transduction of viral particles using the SMARTchoice Promoter Selection Plate. The Promoter Selection Plate contains duplicate wells of serially diluted lentiviral particles representing each promoter so that two separate conditions can be tested simultaneously. After identification of the optimal promoter for your cells of interest, additional transduction optimization should be performed to identify appropriate MOIs for optimal shRNA performance ...
An accurate identification of gene promoters remains an important challenge. Computational approaches for this problem rely on promoter sequence attributes that are believed to be critical for transcription initiation. Here we report a probabilistic model that captures two important properties of promoters, not used by previous methods, viz., the location preference and co-occurrence of promoter elements. Additionally, we found that many of the position-specific DNA elements are strongly linked with the function of the gene product. For instance, a highly conserved motif CCTTT at -1 position is strongly associated with protein synthesis, cellular and tissue development. Our comparative analysis of promoter classes reveals that the promoters devoid of CpG islands are more conserved and have fewer alternative transcription start sites. The discovered links between promoter elements and gene function allows us to infer genetic networks from promoter elements. The web server for the PSPA promoter ...
The expression of recombinant proteins in eukaryotic cells requires the fusion of the coding region to a promoter functional in the eukaryotic cell line. Viral promoters are very often used for this purpose. The preceding cloning procedures are usually performed in Escherichia coli and it is therefore of interest if the foreign promoter results in an expression of the gene in bacteria. In the case molecules toxic for humans are to be expressed, this knowledge is indispensable for the specification of safety measures. We selected five frequently used viral promoters and quantified their activity in E. coli with a reporter system. Only the promoter from the thymidine kinase gene from HSV1 showed no activity, while the polyhedrin promoter from baculovirus, the early immediate CMV promoter, the early SV40 promoter and the 5 LTR promoter from HIV-1 directed gene expression in E. coli. The determination of transcription start sites in the immediate early CMV promoter and the polyhedrin promoter confirmed the
Fibulin-1 is a multifunctional extracellular protein involved in diverse biological processes including cardiovascular development, haemostasis and cancer. To investigate the transcriptional regulation of the gene encoding fibulin-1 we cloned and analysed about 4.0kb of the 5′-flanking regions of both the human and mouse fibulin-1 genes. The human and mouse fibulin-1 promoters share little sequence similarity except for a short region of approx. 150-170bp immediately upstream of the translation start site. The conserved region contains a TATA-like sequence (ATAATT) and multiple consensus binding sites for Sp1 and activator protein 2 (AP-2). That the short conserved region in each gene confers basal promoter activity is demonstrated by transient transfections of promoter deletion constructs for both the human and mouse genes into cells that express fibulin-1 constitutively. Co-transfections of promoter constructs with expression plasmids for Sp1, Sp3 and Sp4 into Drosophila SL2 cells indicate ...
The mdm2 gene is a target for transcriptional activation by the p53 tumor suppressor gene product. Previous work has revealed that the mouse mdm2 gene contains two promoters: one is located upstream to the gene and is active in the absence of p53, the other resides within the first intron and requires p53 for transcriptional activity. To determine whether this unique promoter activation pattern is biologically important, we investigated the structure and function of the corresponding region of the human mdm2 (hmdm2) gene. We report here that the hmdm2 gene also contains an intronic, p53-dependent promoter. The structural features of this promoter are highly conserved between mouse and man, as opposed to the lack of conservation of the first exon. This promoter is triggered in vivo in the presence of activated wild type p53, leading to the production of novel mRNA species. The intronic hmdm2 promoter contains two tandem p53 binding elements. Deletion analysis suggests that optimal promoter
IL-6 induces PAI-1 mRNA and protein accumulation.13,19 Although several transcription factor binding sites were identified in PAI-1 promoter, no classic inflammatory response element was found. Because promoter activity was increased by IL-6, the IL-6-responsive region was explored. The deletion and site mutation of the region from −239 to −210 bp decreased ,80% of the IL-6-inducible promoter activity, indicating that the region is critical for response. A computer-based database analysis indicated there is a putative C/EBP binding site (−226 to −212 bp). The promoters of most IL-6-inducible acute-phase protein genes have been characterized with C/EBP binding motifs.11 Using competition experiments, EMSA supershift analysis, and DNase I footprinting analysis, a C/EBP motif on PAI-1 promoter was verified, and 3 members of C/EBP family including α, β, and δ were involved in the DNA-protein complex formation. C/EBPβ was involved in the formation of 3 complexes because single-copy ...
Core promoter element analysis is performed in order to investigate the quality of the promoter collection. It exploits the fact that certain DNA motifs preferentially occur at characteristic distances from a TSS. For instance, the TATA-box occurs in a narrow region centered about 28 bp upstream of the TSS whereas the CCAAT-box occurs in a much wider area with a peak frequency at position −80. Based on these observations, we would expect a high-quality promoter collection to show high peaks for both sequence motifs. In addition, a narrow TATA-box peak at −28 would indicate precise TSS mapping. This analysis has been performed using OProf. Readers are encouraged to repeat this anlysis and perform others in order to check for the quality of the promoter list. TATA-box: this core promoter element is normally found 28 bp upstream the transcription start site. The following plot shows that EPDnew promoter collection has a more focused TATA-box distribution compared to Gramene annotation ...
Several mutants derived from transformed human B cell lines are defective in expressing major histocompatibility complex (MHC) class II genes. The failure to express a class II gene in at least one such mutant line has been mapped to the MHC class II X box, a conserved transcriptional element in the promoter region. A complementary DNA encoding a DNA-binding protein (human X box binding protein, hXBP-1) whose target is the human DR alpha X box and the 3 flanking region has now been cloned. This complementary DNA encoded a protein with structural similarities to the c-jun proto-oncogene product, and its target sequence was closely related to the palindromic target sequence of c-jun. Mutation of the hXBP-1 DNA target sequence decreased DR alpha promoter activity in vivo. These studies suggest that the hXBP-1 protein acts as a transcription factor in B cells. ...
REHOVOT, Israel and CUIABÁ, Brazil, Oct. 19, 2016-- Evogene Ltd., a leading biotechnology company for the improvement of crop productivity, and Instituto Mato-grossense do Algodão, a leading developer and marketer of cotton seeds, announced today a collaboration for the discovery and validation of novel genomic promoters to support IMAmts product...
Binding of transcriptional activators to a promoter is a prerequisite process in transcriptional activation. It is well established that the efficiency of activator binding to a promoter is determined by the affinity of direct interactions between the DNA-binding domain of an activator and its specific target sequences. However, I describe here that activator binding to a promoter is augmented in vivo by the effects of two other determinants that have not been generally appreciated: (i) the number of activator binding sites present in a promoter and (ii) the potency of activation domains of activators. Multiple sites within a promoter can cooperatively recruit cognate factors regardless of whether they contain an effective activation domain. This cooperativity can result in the synergistic activation of transcription. The second effect is the enhancement of activator binding to a promoter by the presence of activation domains. In this case, activation domains are not simply tethered to the ...
Fig. 4. Analysis of the 5′ region of FEZ1 gene. A, primer extension analysis of the transcriptional start site of human FEZ1 gene. Poly(A)+ RNAs from human brain (Lane 1) and breast (Lane 2) were reverse-transcribed with a 5′-radiolabeled, gene-specific primer corresponding with the 1524-1499-bp upstream region from the first translatable methionine. Arrow, TSS, which is 69 bp upstream from the 3′-end of the primer. B, analysis of the human FEZ1 gene 5′ region. Bold bar at the top of the figure indicates the FEZ1 gene locus, in which exons are depicted in boxes. Cross-hatched boxes, deletion mutants used for the luciferase reporter assay. The 5′-end positions of the deleted promoter are indicated as nucleotide numbers from the TSS. C, luciferase reporter assay of the deleted FEZ1 promoter regions. Luciferase reporter plasmids were transfected into Fez1-positive 293 cells to identify the positive regulatory region for FEZ1 transcription. Left, 5′-end positions of the deleted promoter ...
A promoter is a region of DNA that facilitates the transcription of a particular gene. "Promoters can be about 100-1000 [nucleotides] long.[1]. A promoter is on the template strand for the gene and near the gene in numbers of nucleotides (nts) along the DNA template strand. Usually, the promoter lies within the string of nucleotides between genes. Some promoters are called constitutive as they are active in all circumstances in the cell, while others are regulated becoming active in response to specific stimuli. These specific stimuli for a gene find a receptive portion within that genes promoter. In the case of genes that are used to produce proteins, the RNA polymerase II holoenzyme that actually performs the transcription from the template strand needs to find chemical cues for attachment to the DNA and where to begin transcription. Preceding this are chemical cues for which DNA strand is the template strand and in what direction transcription is to be performed. A promoter contains cues for ...
A promoter is a region of DNA that facilitates the transcription of a particular gene. "Promoters can be about 100-1000 [nucleotides] long.[1]. A promoter is on the template strand for the gene and near the gene in numbers of nucleotides (nts) along the DNA template strand. Usually, the promoter lies within the string of nucleotides between genes. Some promoters are called constitutive as they are active in all circumstances in the cell, while others are regulated becoming active in response to specific stimuli. These specific stimuli for a gene find a receptive portion within that genes promoter. In the case of genes that are used to produce proteins, the RNA polymerase II holoenzyme that actually performs the transcription from the template strand needs to find chemical cues for attachment to the DNA and where to begin transcription. Preceding this are chemical cues for which DNA strand is the template strand and in what direction transcription is to be performed. A promoter contains cues for ...
This invention provides novel chimeric promoter/enhancers. The chimeric promoter/enhancers are particularly suitable for directing gene expression in mammalian cells.
The functionality of a 3422-base pair promoter fragment from the mouse α1B-adrenergic receptor (α1BAR) gene was examined. This fragment, cloned from a mouse genomic library, was found to have significant sequence homology to the known human and rat α1BAR promoters. However, the consensus motif of several key cis-acting elements is not conserved among the rat, human, and mouse genes, suggesting species specificity. Confirming fidelity of the murine promoter, robust in vitro expression of a chloramphenicol acetyltransferase (CAT) reporter was detected in known α1BAR-expressing BC3H1, NB41A3, and DDT1MF-2 cells transiently transfected with a promoter-CAT construct. Conversely, minimal CAT expression was detected in known α1BAR-negative RAT-1 and R3T3 cells. These findings were extended by transfecting the same promoter-CAT construct into various primary cell types. In support of the hypothesis that α1ARs are differentially expressed in the smooth muscle of the vasculature, primary cultures of ...
Transcription initiation is an important step in the process of gene regulation in prokaryotes. Promoters are stretches of DNA sequence that are present in the upstream region of transcription start sites (TSSs), where RNA polymerase and other transcription factors bind to initiate transcription. Recent advancement in sequencing technologies has resulted in huge amount of raw data in the form of whole genome sequences. This sequence data has to be annotated, in order to identify coding, non-coding and regulatory regions. Computational tools are useful for a quick and fairly reliable annotation of many genome sequences. Promoter prediction is an important step in genome annotation process which is needed, not only for the validation of predicted genes, but also for the identification of novel genes, especially those coding for non-coding RNA, which are missed by gene prediction programs. DNA sequence dependent structural properties such as DNA duplex stability, bendability and intrinsic ...
Diversity in rates of gene expression is essential for basic cell functions and is controlled by a variety of intricate mechanisms. Revealing general mechanisms that control gene expression is important for understanding normal and pathological cell functions and for improving the design of expression systems. Here we analyzed the relationship between general features of genes and their contribution to expression levels. Genes were divided into four groups according to their core promoter type and their characteristics analyzed statistically. Surprisingly we found that small variations in the TATA box are linked to large differences in gene length. Genes containing canonical TATA are generally short whereas long genes are associated with either non-canonical TATA or TATA-less promoters. These differences in gene length are primarily determined by the size and number of introns. Generally, gene expression was found to be tightly correlated with the strength of the TATA-box. However significant reduction
... software free downloads. Promoter Gene shareware, freeware, demos: Gene Inspector by Textco BioSoftware Inc, Page Promoter by NetPromoter, Meta Tag Promoter by NetPromoter etc...
I am currently studying the regulation of several mammalian (mouse and human) promoters. Of obvious interest are known transcription factor binding sites. Since I wouldnt know an AP-1 site from an EcoRI site, I was hoping there might be a computer program on the net that would analyze a submitted sequence for consensus recognition sites. Does anyone out there have any advice? At this point, even a simple list of known consensus sites would be better than nothing. Thanks in advance, Benjamin S. Braun UCLA ...
RESULTS: A percentage of 36.17% controls and 38.6% patients were heterozygosis, considering Amplification-refractory mutation system (ARMS)-PCR assay while 23% and 22.85% were heterozygosis using Mismatch Amplification Mutation Assay (MAMA)-PCR. On the contrary, 1.3% and 1.4% were homozygosis A, while 75.7% and 75.75% presented homozygosis G, taking into account the MAMA-PCR results. The two assays were significantly different (P=0.0004 at χ2 Test), but MAMA-PCR showed a better performance for TNF-α -308 G/A gene polymorphism investigation ...
Potential binding sites of transcription factors are an example of biological event sequences where co-occurrence patterns and burstiness occur. We applied our techniques on 10 Mbp regions from human chromosomes 1-10 [11] (NCBI 36 assembly), where we identified potential binding sites as matches to known transcription factor binding motifs. The regions 30 - 40 Mbp were used for chromosomes 1-9, and 20 - 30 Mbp for chromosome 10, to avoid the centromere region. This dataset contains genome regions with different characteristics (e.g., C+G and gene densities), while being compact enough to be efficiently studied with several null models and window sizes. The motifs we consider are from the Jaspar collection [12] (Jaspar Core), all 138 motifs in the 2008 build. In these sequences we identified all matches for each Jaspar transcription factor (TF) matrix by the PoSSuMsearch program [13]. The threshold for a match was set with p ≤ 10-5, yielding approximately 30000 matches for each 10 Mbp sequence. ...
In article ,310FF66A.A0A at ulam.generes.ca,, kalch ,kalch at ulam.generes.ca, wrote: , Hi, , we are trying to map promoter elements from known DNA sequence. , However, we find that the DNA analysis programs we have in the lab , (MacVector and GeneWorks) are not suitable for this analysis. Could , someone please post (or respond to me directly) where I can send (or , download) a program that will search for promoter elements (e.g. , Sp1, ERE, AP1, AP2, etc)? , , Thanks, , , Michael MacVector does do this (Im not saying that it does it well, but it has the ability). I think that the newer versions ship with a transcription factor subsequence file that has over 600 sites bound by proteins in promoter regions. You just have to do a nucleic acid subsequence search. I ran a test against the junD promoter and it found all the sites that had been mapped by Shaul etal when they cloned it (except the TATA box. Im not sure why it didnt find that as one of the subsequences is exactly the same sequence ...
Generation of mutant mice. In the strategy of IMCT (Kobayashi et al., 1995), transgenic (Tg) mice are generated that express the human interleukin-2 receptor α-subunit (IL-2Rα) under the control of a cell type-specific promoter. These mice are then treated with a recombinant immunotoxin (IT), which is composed of the variable regions of the anti-IL-2Rα monoclonal antibody and a bacterial exotoxin fragment. The transgene construct contained a 10 kb DNA fragment encoding the 5′-flanking region of the mouse neuropsin (NP) gene (Hirata et al., 2001), the second intron of the rabbit β-globin gene (Kobayashi et al., 1992), the gene cassette encoding IL-2Rα fused to green fluorescent protein (IL-2Rα/GFP) (Watanabe et al., 1998), and the polyadenylation signals of the rabbit β-globin gene and simian virus 40 early gene (Kobayashi et al., 1992). The construct was microinjected into fertilized mouse eggs, which were then implanted into pseudopregnant females. Tg mice were identified by Southern ...
Promoters. Oriane Broustal BIO 535. Promoters. About promoters ( structure, function,…) Two types of human promoters based on CG content Bidirectional promoters in human genome. Questions:. What are the differences between eukaryotic and prokaryotic promoters? Slideshow 5386988 by ivana
Promoter elements play important roles in isoform and cell type-specific expression. We surveyed the epigenomic promoter landscape of gastric adenocarcinoma, analyzing 110 chromatin profiles (H3K4me3, H3K4me1, H3K27ac) of primary gastric cancers, gastric cancer lines, and nonmalignant gastric tissues. We identified nearly 2,000 promoter alterations (somatic promoters), many deregulated in various epithelial malignancies and mapping frequently to alternative promoters within the same gene, generating potential pro-oncogenic isoforms (RASA3). Somatic promoter-associated N-terminal peptides displaying relative depletion in tumors exhibited high-affinity MHC binding predictions and elicited potent T-cell responses in vitro, suggesting a mechanism for reducing tumor antigenicity. In multiple patient cohorts, gastric cancers with high somatic promoter usage also displayed reduced T-cell cytolytic marker expression. Somatic promoters are enriched in PRC2 occupancy, display sensitivity to EZH2 ...
The hINV basal promoter, which encodes forty one nucleotides upstream of the transcription commence web site and no AP1 web sites, is not controlled by TAM67
Use this page to investigate EPDnew promoters for their chromatin status or motifs enrichment/distribution with our tools. If you want to restrict the analysis to a subset of promoters please use the promoter selection tool page. ...
The double truncation constructs, P3 and P4, are both lacking 449 nts immediately upstream the ATG translation start codon. The absence of this region does not seem to be critical for promoter functionality, since the activity was comparable to the full-length construct (Sps1) and other mutants (Sps2-Sps6) all of which include these initial 449 upstream nts at their 3 end. As concluded from P3, the removal of nts upstream 1167 from the 5 end did not reduce activity. Therefore a series of 5-truncations were made to narrow the critical promoter region. Up to construct Sps6 which includes nts 1-763 no significant reduction was observed whereas a dramatic loss near almost background levels was noticed for the shorter constructs Sps7 to Sps11. Since construct Sps5, containing 910 nts, exhibits full activity, this 5 end was considered critical and additional constructs were designed by successively truncating 3 nts (ds13-ds17). The four long constructs dS13 - dS16 showed fairly high promoter ...
I want to do a ChIP assay with an antibody against acetylated histone h3. I did a cDNA microarray before and now I want to check if the genes I found there are really regulated by histone acetylation. Thats why I want to do quantitative realtime PCR after the ChIP. The problem is (correct me if I am wrong) that I now have to design primer in the promoter region. And I have no idea how I can do this. Actually I do not even know how to search for the promoter region ...
PR is a classical estrogen-regulated gene (1, 2) and is frequently used as a surrogate marker for functional ERα activity. PR exists in 2 isoforms, PRA and PRB, which are the result of transcription from 2 alternative promoters, and initiation of translation at 2 different AUG codons (3). Structurally, PRB differs from PRA only in that the B receptor contains an additional 164 amino acids at the N-terminus of the protein (4). Despite structural similarities, PRA and PRB possess different functional activities. PRB has been found to be a stronger transcriptional activator than PRA, due in part to a third activation domain (AF-3) within the N-terminal 164 amino acids (5). On the other hand, PRA has been shown to act as a repressor which can inhibit other receptors, including ER and PRB (6). PRA and PRB regulate different sets of genes-of 94 progesterone-regulated genes, 65 were uniquely regulated by PRB, 4 uniquely by PRA, and only 25 by both (7). Moreover, the unliganded PR can regulate gene ...
As an anti-inflammatory mediator IL10 is beneficial in certain contexts and deleterious in others. As increased production of IL10 favours protection against inflammatory disease, whereas low production promotes elimination of foreign pathogens by the host, we investigated the possible influence of balancing selection at this locus. We began by resequencing 48 European and 48 African chromosomes across 2.2 kb of the IL10 promoter region, and compared this with four neighbouring gene regions: MK2, IL19, IL20 and IL24. Analysis of nucleotide diversity showed a positive Tajimas D-test for IL10 in Europeans, of borderline statistical significance (1.89, P=0.05). Analysis of F(st) values showed significant population divergence at MK2, IL19, IL20 and IL24 (P,0.01) but not at IL10. Taken together, these findings are consistent with the hypothesis that balancing selection has played a role in the evolution of polymorphisms in the IL10 promoter region.. ...
This interaction may be competed off with unlabelled oligo and supershifted making use of the YB one antibody. To further dissect YB one binding inside the 2a area we developed biotin labelled oligonucleotides during which the YB one responsive aspects had been mutated at 968, 940 or both web sites. Dropping either in the YREs resulted in significantly less YB 1 binding com pared with the wild form EGFR promoter sequence. These data verify that the 968 and 940 binding web sites are bona fide YREs. With each other these data demonstrate that YB 1 is ready to bind on the initial 1 kb with the EGFR promoter, and this leads to transactivation inside a phosphorylation dependent method. Offered on-line material 9 five R61 Figure five Y box binding protein 1 binds to distinct web pages inside the epidermal development aspect receptor promoter.. AVL292 Sequence of your EGFR2a oligonucleotide used in the gel shift assays. Highlighted sequences will be the possible YB 1 binding websites. The substitutions ...
All fusion proteins for the two types of a light-switchable promoter system has been finished (BBa_K801039, BBa_K801040 and BBa_K801041), also pTEF1 driven gene expression batteries coding for all components of each type of our light-switchable promoter system has been done (BBa_K801042 and BBa_K801043). GAL4 based light-switchable promoter system is working fine! LexA based light-switchable promoter system even works more efficient but reporter construct (BBa_K165031, iGEM08_BrownTwo) is extremly leaky due to suboptimal LexA binding elements, which contains the TATATAA sequence of the typical yeast TATA-Box. The solution to prevent high basal gene expression is to create a minimal promoter preceded by DNA motifs which are recognized by LexA but do not contain the TATA sequence (e. g.: BBa_K079039 or BBa_K079040). A general improvement to lower the basal activity and to get an higher S/N-ratio in both systems is to use low-copy yeast plasmids instead of high-copy plasmids. ...
Delezione 13q14.3 Subclinical chronic lymphocytic leukaemia associated with a 13q deletion presenting initially in the skin: apropos of a case. 2006. Human RFP2 gene promoter: unique structure and unusual strength.. Human gene RFP2 is a candidate tumor suppressor located at 13q14.3 and deleted in multiple tumor types. To explore regulation of RFP2, we determined structure of the 5-untranslated region of RFP2 gene and its promoter. RFP2 promoter area is TATA-less, highly enriched in G and C nucleotides, and contains multiple quadruplex forming GGGGA-repeats. Deletion analysis of 5-flanking sequences demonstrated that repeat containing fragment possesses activity seven times exceeding that of the combined SV40 promoter/enhancer. Other unusual features of the RFP2 promoter include anomalously high electrostatic fields induced by sequence-dependent dipoles and very low nucleosome forming potential. A "minimized" version of the RFP2 promoter could be used for overexpression of the various ...
PubMed comprises more than 30 million citations for biomedical literature from MEDLINE, life science journals, and online books. Citations may include links to full-text content from PubMed Central and publisher web sites.
Stable expression of a defense-related gene in wheat epidermis under transcriptional control of a novel promoter confers pathogen ...
Expression vectors usually contain a promoter that is recognized by the host organism and is operably linked to the gene of interest. Promoters are untranslated sequences located upstream (5) to the start codon of a structural gene (generally within about 100 to 1000 bp) that control the transcription and translation of a particular nucleic acid sequence to which they are operably linked. Such promoters typically fall into two classes, inducible and constitutive. Inducible promoters are promoters that initiate increased levels of transcription from DNA under their control in response to some change in culture conditions, e.g., the presence or absence of a nutrient or a change in temperature. At this time a large number of promoters recognized by a variety of potential host cells are well known in the art. These promoters are operably linked to the gene of interest by removing the promoter from the source DNA by restriction enzyme digestion and inserting the isolated promoter sequence into the ...
Sigma-Aldrich offers abstracts and full-text articles by [George E Liu, Matthew T Weirauch, Curtis P Van Tassell, Robert W Li, Tad S Sonstegard, Lakshmi K Matukumalli, Erin E Connor, Richard W Hanson, Jianqi Yang].
The human telomerase reverse transcriptase (T) is highly expressed in a majority of cancer types but not in normal cells, which allows it to be used as a tumor biomarker (15, 17, 18). Previously, we identified and validated the specificity of the T promoter in ovarian cancer and showed that its activity was enhanced by the VISA amplification system (15). In this study, our results further showed that the T promoter is specifically activated in breast cancer cells but had much weaker activity than the CMV promoter. Using the VISA system that was initially developed for pancreatic cancer (13), we have since then showed that this system is highly active in ovarian (15), lung (16), and liver (30) cancers. With the goal of further developing a robust and breast tumor-specific vector, we incorporated the T promoter into our VISA system and constructed T-VISA expression carrier. Our engineered T-VISA is a composite that contains 3three basic elements: the T promoter, the TSTA system, and the WPRE ...
The systematic prediction and categorisation of promoters, repressors, enhancers, etc., is not only essential to unravel the inner workings of biochemical networks, but also to engineer novel synthetic ones. Each putative regulatory region, however, has to be validated experimentally in order to be categorized as a fully defined functional element, which constitutes a significant bottleneck. In most studies, the promoter activity is illustrated as the amount of fluorescence divided by the optical density. These values are obtained from a coupled time-series experiment. With relatively simple mathematical reasoning, a tool that describes promoter activity in each time point has been implemented. The protein expression and the protein maturation process are modelled as a first order differential equations taking into account the degradation and the maturation rates which are to be known in advance. The promoter activity is then expressed based on the measured quantities of optical density and ...
I am trying to clone a promoter controlling the expression of a reporter gene. The promoter has never been cloned before so there arent plasmids aviable to perform a subcloning. I planned to amplify the promoter from genomic DNA. In order to know the secuence of the promoter I search my gene in the web site of the ensembl project (ensembl.org) and I designed degenerated primers (only 1 mismatch) to amplify 1200 pb from the first exon of the gene to the upstream sequence. I finaly got the amplificate of the exact size I expected, and I cut it with restriction enzimes to be sure that it was the promoter. However the cuts didnt appear where they were supposed to be. So I would like to ask ...
Monitor transcription from different promoter/enhancer combinations inserted into the MCS located upstream of the fluorescent protein coding sequence. Suitable for mammalian or bacterial expression.
The availability of high-density genotype data for mice has made it possible to quantify the relationship between haplotype structure and differential gene expression. A relationship between SNP in the 1 kb upstream region and differential expression was only observable when using a stringent test of differential expression (absolute log2 fold change , 0.5; pplr , 0.005). This was interpreted as evidence that the variance of expression of cis regulated genes is much lower than that of trans regulated genes. Although the 1 kb upstream region may contain the highest density of regulatory elements it does not contain all of them, they can be spread throughout the gene and its 3 region as well as going tens to hundreds of kilobases upstream. Therefore we are likely to have underestimated the numbers of cis regulated genes using this strategy. However SNP in the upstream region will frequently be markers for larger haplotypes that extend into or through the whole gene region so these regions will ...
Thread... Lets say that a highly-profitable, listed business is un-leveraged but its promoters are highly leveraged in their personal balance sheets. Lets also say that loans taken by the promoters are secured by the collateral of the promoters shares in the listed company. Lets further assume that the mistakes were made by the promoters with…
In order to test the activity of the hybrid promoters a reporter needed to be ligated. As the hybrid promoter did not already contain a ribosome binding site (RBS) both the RBS and the reporter were needed to be ligated to the promoter; in order to help improve experimental efficiency the parts registry was searched for relevant reporters that also contained an RBS. In week three two reporters were identified as BBa_E0420, a biobrick for enhanced CFP (eCFP) + RBS + terminators, and BBa_K081014, a biobrick for RFP + RBS + terminators. Once the B-M and M-B biobricks had been created in week six work began in earnest on the fluorescent proteins and ligating the promoters to them in order to begin characterisation. Due to many set-backs with low levels of DNA and having to order more biobricks from the registry, a successful ligation of the promoter to a fluorescent protein reporter was finally achieved in week ten. In order to carry out the ligation the promoter was first digested using Spe1 and ...
το κείμενο με τίτλο Automatic discovery of regulatory patterns in promoter regions ... σχετίζετε με Βιοτεχνολογία
We present experimental evidence for the existence of multiple activator-binding sites in the upstream sequence of the ompC promoter, the expression of which is activated by the positive regulator OmpR in response to the osmolarity of the medium. We also found that a single OmpR-binding site can activate the ompC promoter, providing that the binding site is close and placed stereospecifically with respect to the canonical-35 and -10 regions. ...
Promoter activities of genes in the FliA-FlgM module.The promoter activities of fliA (green), flgM (red), and tar (blue) measured by means of fluorescent report
View Test Prep - BMB400Test_2 from BMB 400 at University of Maine Orono. BMB 400 Dr. Keith Hutchison 12/18/07 Exam 2 1) Here is my sequence and the binding sites within it: My promoter region was
This gene encodes a protein that is conserved across metazoans. In vertebrates, this gene is linked in a head-to-head arrangement with the adjacent parkin gene, which is associated with autosomal recessive juvenile Parkinsons disease. These genes are co-regulated in various tissues and they share a bi-directional promoter. Both genes are associated with susceptibility to leprosy. The parkin co-regulated gene protein forms a large molecular complex with chaperones, including heat shock proteins 70 and 90, and chaperonin components. This protein is also a component of Lewy bodies in Parkinsons disease patients, and it suppresses unfolded Pael receptor-induced neuronal cell death. Multiple transcript variants encoding different isoforms have been found for this gene.
Our comprehensive collection contains more than 18,000 endogenous human promoter reporter GoClone® constructs that are transfection-ready with no DNA preparation required. Our reporters contain a novel luciferase gene for industry-leading sensitivity ...
Our comprehensive collection contains more than 18,000 endogenous human promoter reporter GoClone® constructs that are transfection-ready with no DNA preparation required. Our reporters contain a novel luciferase gene for industry-leading sensitivity ...
Inactivation of TSGs can occur at many levels. Most often, they occur genetically and epigenetically by affecting transcriptional, translational, and post-translational regulation. This governs the amount and activity of tumor suppressor proteins.. Genetic Mechanisms. At the molecular level, multiple mechanisms exist whereby a TSG may be inactivated (3).. 1. Mutations in the DNA can result in inactive/dysfunctional forms of TSGs.. Mutations in TSGs can result in decreased or non-fuctional proteins or can interfere with other functioning proteins, resulting in a cell that is more likely to escape control mechanisms in place and become cancerous. These mutations can occur within the coding regions of the gene or at splice sites. Mutations at the latter may cause splicing errors that render the protein functionally null.. 2. Mutations in cis-/trans-acting elements or in the promoter region of a TSG.. Cis/trans-acting elements and the promotor region of a TSG play critical roles in driving and ...
The present invention provides methods and systems for regulating delivery of therapeutic proteins and nucleic acids. Specifically, this involves using a genetically engineered electrically responsive promoter operably linked to a therapeutic gene sequence, wherein expression of said sequence is controlled by an electrical pulse generator
Assume we have a set of sequences upstream of genes that are involved in a pathway with a common function. Since these genes are to be regulated more or less simultaneously, common regulatory factors or CIS-acting elements are likely to be involved. We want to investigate if, among the set of sequences, certain motifs are responsible for the regulation. An indication for this would be if we can find motifs that are present very frequently.
Col10a1 promoter activity is up-regulated via RUNX2 binding elements in vitro. (A) Transactivation of Col10a1 via RUNX2-binding A and B elements. The RUNX2 expr
Plasmid HB401: pMVP (L1-L4) CMV promoter from Dr. Christopher Newgards lab contains the insert CMV promoter and is published in Nucleic Acids Res. 2018 Dec 27. pii: 5264291. doi: 10.1093/nar/gky1286. This plasmid is available through Addgene.
Promoters play a central role in transcription initiation and gene regulation, so it is necessary for these DNA regions to be differentiated from non-promoter sequences. Sequence motif based computational methods have not been able to identify these regio
Choose the promoter option that has been demonstrated, either by your own experimental observations or through references in the published literature, to actively express a transgene in your cells of choice. For optimal experimental confidence or if such information is not available, consider using multiple lentiviral promoter-Cas9 constructs or selecting the best promoter empirically using the Dharmacon SMARTchoice Promoter Selection Plate Cat #SP-001000-01 ...
Lentivirus with CMV promoter-driven expression of chromosome 17 open reading frame 76 (C17orf76), transcript variant 1 in pLenti vector with puromycin selection and C-terminal Myc and FLAG tags.
Lentivirus with CMV promoter-driven expression of potassium channel, subfamily K, member 17 (KCNK17), transcript variant 1 in pLenti vector with puromycin selection and C-terminal Myc and FLAG tags.
The vast non-coding portion of the human genome is full of functional elements and disease-causing regulatory variants. The principles defining the relationships between these elements and distal target genes remain unknown. Promoters and distal elements can engage in looping interactions that have …
To me, distance between two genes would be the distance between the two transcriptional start sites. So I would just take the two TSS and get the absolute differences between them. This makes sense if you are looking into transcriptional regulation as its about promoters ( even if its about enhancers, they usually loop to the gene promoters).. If you are looking for something else, I am not sure what would be the best to consider as ...
Customers can choose from the varied promoter types and fusion tags; and get their target genes cloned into these engineered vectors (refer the schematic representation image). These clones are ideal for protein over-expression studies in E. coli. ...
Cancer therapy that specifically targets malignant cells with minimal or no toxicity to normal tissue has been a long-standing goal of cancer research. Rad51 expression is elevated in a wide range of cancers and Rad51 promoter has been used to transcriptionally target tumor cells, however, a large s …
Table 1 Primer sequences used: A Homeobox-specific PCR: 1 #2606 HOX-A 5GT(GC)AA(GA)AT(CT)TGGTT(CT)CA(GA)AA3 2 #2607 HOX-B 5AA(GA)AT(CT)TGGTT(CT)CA(GA)AA(CT)CG3 3 #4661 T7-promoter sequence 5AATACGACTCACTATAGGG3 B Distal-less-specific: Set# 1 1. #3779 Sense 5AGCCCCAACAACAGCGATT3 2. #5731 4534 + T7 promoter 5AATACGACTCACTATAGGGTATTGACAGAGGTGTGGGC3 Set# 2 1. #4534 Antisense 5TATTGACAGAGGTGTGGGC3 2. #4416 3779 + T3 promoter 5AATTAACCCTCACTAAAGGGAGCCCCAACAACAGCGATT3 C Anterior neural fold-specific: Set#3 1. #3780 Sense 5TAATTCCACCTCCAGCCTG3 2. #5732 4659 + T7 promoter 5AATACGACTCACTATAGGGCCTCTCCCAGCAAATTAAG3 Set#4 1. #4659 Antisense 5CCTCTCCCAGCAAATTAAG3 2. #4657 3780 + T3 promoter 5AATTAACCCTCACTAAAGGGTAATTCCACCTCCAGCCTG3 ...
In silico cis -analysis. promoter analysis Promoters and cis -elements Searching for patterns Searching redundant patterns. What is a promoter?. and why care about it?. AAAAAAAA. CDS. A little about these. cis-elements - Transcription Factors (TF) often bind to them Slideshow 6988126...
JASPAR motifsSummary:Association of JASPAR motif to the promoter expression in this sample. Pearsons correlation between the number of TFBSs estimated by using the position-weight matrix for each promoter and its expression is expressed as Z-score by taking the ones based on random position-weight matrix, and the tail probability of the normal distribution corresponding to the Z-score is taken as the resulting P-value. Lower P-value indicates more (non-random) association of the motif to promoter ...
JASPAR motifsSummary:Association of JASPAR motif to the promoter expression in this sample. Pearsons correlation between the number of TFBSs estimated by using the position-weight matrix for each promoter and its expression is expressed as Z-score by taking the ones based on random position-weight matrix, and the tail probability of the normal distribution corresponding to the Z-score is taken as the resulting P-value. Lower P-value indicates more (non-random) association of the motif to promoter ...
NFAM1, 0.1 ml. . The protein encoded by this gene is a type I membrane receptor that activates cytokine gene promoters such as the IL-13 and TNF-alpha promoters.
To reap the greatest benefits from a tool, a company must embed it in its operations and ways of working, rather than bolting it on as a separate project or through a separate team. Embedding it is the only way to change behavior in the organization. For instance, embedding AI throughout a call center, which changes how agents work, will yield far greater results than piloting AI to automate sorting in the mail room.. Consider how sportswear giant Adidas has concentrated its resources on a few tools crucial to its business. The Net Promoter System®, for instance, has proven valuable on several fronts, such as aligning the senior team and the entire organization around the consumers priorities. In fact, Adidas ties part of all employee bonuses to the brands Net Promoter Score® relative to competitors. The company tracks its customer experience Net Promoter Score across the world to quickly identify topics of detraction, teasing out the business impact of the topic, strategic relevance and ...
Gentaur molecular products has all kinds of products like :search , Gene Link \ SP6 Promoter primer 24mer \ 26-3000-07 for more molecular products just contact us
The new AutoRegulatoryNetwork plugin keeps track of how the genetic parts, such as promoters, coding sequence, etc. are moved. Whenever coding parts are placed downstream of a promoter, the coding parts will receive an Assignment rule that sets the coding parts value equal to the promoter parts value. Remember that value refers to the the activity numerical attribute for genetic parts such as promoter, rbs, coding, etc ...
499 GTAGCCGTCA AGATTGTGTT GGGTCGTTGC TTTCTTGTTG TTTTAAATCA CGGTCATGTG -439 TTTGGCAAGG GTGCTGGTTA ACCGAAAATG TTGGTTCTAG AGCTAGAAGT ACTGGCATTC -379 AAATAAACAT ATTTGGGGGT TGGGGGTTGA TGAGCAAGGC TGGGAGGAGA CAAAAGAAGT -319 ATCTCGGCTC AGTCGTCAGA GACGCGCAAG GTGTAACGGA GAGAGCAATC TAGGTTGTGA -259 GAGTGGCTCC AAACATTGAG ACATGGAGCC AGGACCTTTG CTCCTGGGGG ATGGCCCTAG -199 TACTGATGCG CAGGACCTGG TCCTTGAAGG AGCTGACAAA ACTGCCGTTC ACCCGCGCGA -139 CCACCGGCAA AGCAGCTCCA CAGCCTGCCC CTCCCCTTGG CTGCTCCCCC ACCCATTTCC -79 CGCCTTGTCT TTCCTCTCTT CTCTCTCTCC CTCCTCCCTG CGCGAAGCGG AAGTGACGCG -19 AGGCGTAGCG GAAGTTACTG CAGCCGCGGT GTTGTGCTGT GGGGAAGGGA GAAGGATTTG , TSS 41 TAAACCCCGG AGCGAGGTTC TGCTTACCCG AGGCCGCTGC TGTGCGGAGA CCCCCGGGTG ...
Karpova T.S, Kim M.J, Spriet C, Nalley K, Stasevich T, Kherrouche Z, Heliot L, McNally J.G Concurrent Fast and Slow Cycling of a Transcriptional Activator at an Endogenous Promoter. Sciences (2008 ...
Using AngularJS within the Iconic Framework, you can build a quality mobile app by using special form elements. This online video will show you how to add two specific elements: ranges and select popups. You will learn how to code a range that has icons and colors, as well as how to create a popup list, from which you can pick elements to enrich your application.
To understand the effects of gp67 on worldwide transcription degrees, we searched for genes that had been differentially expressed in pRMC2-gp67 cells. gp67 is
We found that 7133 promoter we have been used has a sequence of 7113 promoter. Please read all g7133 h in this manual as g7113 h ...
TY - JOUR. T1 - ApoE -491A/T promoter polymorphism is not an independent risk factor, but associated with the ε4 allele in Hungarian Alzheimers dementia population. AU - Juhász, Anna. AU - Palotás, András. AU - Janka, Zoltán. AU - Rimanóczy, Ágnes. AU - Palotás, Miklós. AU - Bódi, Nikoletta. AU - Boda, Krisztina. AU - Zana, Marianna. AU - Vincze, Gábor. AU - Kálmán, János. PY - 2005/5/1. Y1 - 2005/5/1. N2 - Apolipoprotein E gene (Apoε) has three common alleles (ε2, ε3, and ε4), of which ε4 has been shown to be associated with an increased risk for Alzheimers disease (AD). Possible additional genetic factors, like the -491A variant of ApoE promoter may modify the development of AD, independently of the ApoE allele status. The objective of this study was to investigate whether A/T allelic polymorphism at site-491 of the ApoE promoter is associated with AD in a Hungarian population. The genomic DNA isolated from peripheral blood lymphocytes of 52 late-onset AD and 53 control ...
TY - JOUR. T1 - Assessment of gene promoter hypermethylation for detection of cervical neoplasia. AU - Wisman, G. Bea A.. AU - Nijhuis, Esther R.. AU - Hoque, Mohammad O.. AU - Reesink-Peters, Nathalie. AU - Koning, Alice J.. AU - Volders, Haukeline H.. AU - Buikema, Henk J.. AU - Boezen, H. Marike. AU - Hollema, Harry. AU - Schuuring, Ed. AU - Sidransky, David. AU - Van Der Zee, Ate G.J.. PY - 2006/10/15. Y1 - 2006/10/15. N2 - Current cervical cancer screening is based on morphological assessment of Pap smears and associated with significant false negative and false positive results. Previously, we have shown that detection of hypermethylated genes in cervical scrapings using quantitative methylation-specific PCR (QMSP) is a promising tool for identification of squamous cell cervical cancer. Aim of the present pilot-study was to evaluate presence of hypermethylated genes in cervical carcinogenesis, both in squamous cell as well as adenocarcinomas. Cervical scrapings were obtained from 30 ...
TY - JOUR. T1 - Exendin-4 as a stimulator of rat insulin I gene promoter activity via bZIP/CRE interactions sensitive to serine/threonine protein kinase inhibitor Ro 31-8220. AU - Chepurny, Oleg G.. AU - Hussain, Mehboob. AU - Holz, George G.. PY - 2002. Y1 - 2002. N2 - Signal transduction properties of exendin-4 (Ex-4) underlying its ability to stimulate rat insulin I gene promoter (RIP1) activity were assessed in the pancreatic β-cell line INS-1. Ex-4 acted via glucagon-like peptide-1 receptors to stimulate RIP1 in a glucose-dependent manner, as measured in cells transfected with a -410-bp RIP1-luciferase construct (RIP1-Luc). The action of Ex-4 was independent of cAMP and PKA because it was not blocked by cotransfection with dominant-negative Gαs, was unaffected by pretreatment with the membrane-permeant cAMP antagonist 8-Br-Rp-cAMPS, and remained apparent after treatment with PKA inhibitors H-89 or KT 5720. Similarly, cotransfection with a dominant-negative isoform of the type-2 ...
The vaccinia virus early transcription factor (VETF), in addition to the viral RNA polymerase, is required for efficient transcription of early genes in vitro. VETF is a heterodimeric protein that binds specifically to early gene promoters. In order to localize the VETF DNA binding domain, we have used photoreactive oligonucleotide probes with the sequence of the vaccinia virus growth factor promoter. The probes consisted of double-stranded oligonucleotides incorporating radiolabeled dAMP and 5-bromo-dUMP into sequences of the promoter known to contact VETF. Irradiation of a DNA probe having these nucleotides located upstream of the transcription start site in the presence of VETF resulted in the transfer of label to a polypeptide that comigrated with the small subunit of VETF. The label transfer reaction was shown to occur with the recombinant VETF small subunit in the absence of the large subunit. These results indicate that the small subunit comprises at least part of the VETF DNA binding ...
The physiological role of TFIIA was investigated by analyzing transcription in a yeast strain that contains a TATA-binding protein (TBP) mutant (N2-1) defective for interacting with TFIIA. In cells containing N2-1, transcription from a set of artificial his3 promoters dependent on different activators is generally reduced by a similar extent, indicating that TFIIA function is largely nonselective for activators. In addition, TATA element utilization, a core promoter function, is altered at his3 promoters dependent on weak activators. Genomic expression analysis reveals that 3% of the genes are preferentially affected by a factor of 4 or more. Chimeras of affected promoters indicate that the sensitivity to the TFIIA-TBP interaction can map either to the upstream or core promoter region. Unlike wild-type TBP or TFIIA, the N2-1 derivative does not activate transcription when artificially recruited to the promoter via a heterologous DNA binding domain, indicating that TFIIA is important for transcription
Succinoglycan (EPS I), the main acidic exopolysaccharide of Sinorhizobium meliloti, is required for the initiation and elongation of infection threads during nodulation of the host plant alfalfa. The gene products of the exoYFQ operon are involved in the first step of succinoglycan biosynthesis as well as in the polymerisation of subunits to the high-molecular-mass form of this exopolysaccharide. One promoter region that directs transcription of exoX and two promoter regions that drive transcription of exoY were mapped in the exoX-exoY intergenic region. The distal exoY promoter region containing three putative -10 promoter elements was active under standard growth conditions and was subject to ExoR-dependent regulation. Although this promoter region was stimulated in a phoB mutant, no PHO box-like sequences were found, suggesting an indirect regulatory effect of PhoB. The proximal promoter contains a PHO box-like sequence in the putative - 35 region and was affected by low and high phosphate ...
cytosol, nucleus, centromeric DNA binding, chromatin binding, DNA replication origin binding, RNA polymerase II core promoter proximal region sequence-specific DNA binding, sequence-specific DNA binding, transcriptional activator activity, RNA polymerase II core promoter proximal region sequence-specific binding, transcriptional repressor activity, RNA polymerase II core promoter proximal region sequence-specific binding, anatomical structure morphogenesis
Tumor‑specific promoter hypermethylation of large tumor suppressor, homolog 2 (LATS2), a tumor suppressor gene, has been investigated using methylation‑specific polymerase chain reaction (MSP) assays in different types of human cancer producing conflicting results. The aim of the present study was to evaluate the methylation status of the LATS2 promoter region using bisulfite sequencing with a next generation sequencer for breast cancer. In the 11 patients enrolled in the present study, the LATS2 promoter methylation index (MI) was uniformly high in tumor and normal tissues of the breast (median, 84.0 and 87.4%, respectively). The presence of LATS2 promoter hypermethylation was confirmed in isolated tumor cells and normal epithelial cells using the magnetic‑activated cell sorting method. In situ hybridization for LATS2 messenger RNA (mRNA) revealed that the mRNA expression of LATS2 was higher in normal epithelial cells, compared with tumor cells, however, it was not significantly ...
Transgenic techniques offer a valuable tool for determining gene functions. Although various promoters are available for use in gene overexpression, gene knockdown, and identification of transgenic individuals, there is nevertheless a lack of versatile promoters for such studies, and this dearth acts as a bottleneck, especially with regard to nonmodel organisms. Here, we succeeded in identifying a novel strong and ubiquitous promoter/enhancer in the silkworm. We identified a unique silkworm strain whose reporter gene showed strong and ubiquitous expression during the establishment of enhancer trap strains. In this strain, the transposon was inserted into the 5′UTR of hsp90, a housekeeping gene that is abundantly expressed in a range of tissues. To determine whether the promoter/enhancer of hsp90 could be used to induce strong gene expression, a 2.9-kb upstream genomic fragment of hsp90 was isolated (hsp90P2.9k), and its transcriptional activation activity was examined. Strikingly, hsp90P2.9k ...
In plant genetic engineering, the identification of gene promoters leading to particular expression patterns is crucial for the development of new genetically modified plant generations. This research was conducted in order to isolate and characterize several new promoters from cassava (Manihot esculenta Crantz) elongation factor 1 alpha (EF1A) gene family. Three promoters MeEF1A3, MeEF1A4 and MeEF1A5 were successfully isolated. Sequence analyses showed that all of the promoters contain three conserved putative cis-acting elements which are located upstream of the transcription start site. These elements are included a TEF1, a TELO and TATA boxes. In addition, all of the promoters also have the 5′UTR intron but with a different lengths. These promoters were constructed translationally with gusAreporter gene (promoter::gusA fusion) in pBI-121 binary vector to build a new binary vector using Overlap Extension PCR Cloning (OEPC) technique. Transient expression assay that was done by using ...
The tRNA(m5U54)methyltransferase, whose structural gene is designated trmA, catalyzes the formation of 5-methyluridine in position 54 of all tRNA species in Escherichia coli. The synthesis of this enzyme has previously been shown to be both growth rate dependent and stringently regulated, suggesting regulatory features similar to those of rRNA. We have determined the complete nucleotide sequence of the trmA operon in E. coli and the sequence of the trmA promoter region in Salmonella typhimurium and also analyzed the transcriptional regulation of the gene. The trmA and the btuB (encoding the vitamin B12 outer membrane receptor protein) promoters are divergent promoters separated by 102 bp between the transcriptional start sites. The trmA promoters of both E. coli and S. typhimurium share promoter elements with the rRNA P1 promoter. The sequence downstream from the -10 region of the trmA promoter is homologous to the discriminatory region found in stringently regulated promoters. Next to and ...
OBJECTIVE: Inactivating mutations in glucokinase (GCK) cause mild fasting hyperglycemia. Identification of a GCK mutation has implications for treatment and prognosis; therefore, it is important to identify these individuals. A significant number of patients have a phenotype suggesting a defect in glucokinase but no abnormality of GCK. We hypothesized that the GCK beta-cell promoter region, which currently is not routinely screened, could contain pathogenic mutations; therefore, we sequenced this region in 60 such probands. RESEARCH DESIGN AND METHODS: The beta-cell GCK promoter was sequenced in patient DNA. The effect of the identified novel mutation on GCK promoter activity was assessed using a luciferase reporter gene expression system. Electrophoretic mobility shift assays (EMSAs) were used to determine the impact of the mutation on Sp1 binding. RESULTS: A novel -71G|C mutation was identified in a nonconserved region of the human promoter sequence in six apparently unrelated probands. Family testing
Incubation of 3T3-L1 preadipocytes with isobutylmethylxanthine (IBMX), dexamethasone, and insulin, alone or in combination, demonstrated that IBMX, which increased cAMP-response element-binding protein (CREB) phosphorylation, was the predominant regulator of Pde3b expression. Real time PCR and immunoblotting indicated that in 3T3-L1 preadipocytes, IBMX-stimulated induction of Pde3b mRNA and protein was markedly inhibited by dominant-negative CREB proteins. By transfecting preadipocytes, differentiating preadipocytes, and HEK293A cells with luciferase reporter vectors containing different fragments of the 5- flanking region of the Pde3b gene, we identified a distal promoter that contained canonical cis-acting cAMP-response elements (CRE) and a proximal, GC-rich promoter region, which contained atypical CRE. Mutation of the CRE sequences dramatically reduced distal promoter activity; H89 inhibited IBMX-stimulated CREB phosphorylation and proximal and distal promoter activities. Distal promoter ...
Conventional wisdom holds that, owing to the dominance of features such as chromatin level control, the expression of a gene cannot be readily predicted from knowledge of promoter architecture. This is reflected, for example, in a weak or absent correlation between promoter divergence and expression divergence between paralogs. However, an inability to predict may reflect an inability to accurately measure or employment of the wrong parameters. Here we address this issue through integration of two exceptional resources: ENCODE data on transcription factor binding and the FANTOM5 high-resolution expression atlas. Consistent with the notion that in eukaryotes most transcription factors are activating, the number of transcription factors binding a promoter is a strong predictor of expression breadth. In addition, evolutionarily young duplicates have fewer transcription factor binders and narrower expression. Nonetheless, we find several binders and cooperative sets that are disproportionately associated