TY - JOUR. T1 - Cryptosporidium parvum mixed genotypes detected by PCR-restriction fragment length polymorphism analysis. AU - Reed, C.. AU - Sturbaum, G. D.. AU - Hoover, P. J.. AU - Sterling, Charles R. PY - 2002. Y1 - 2002. N2 - Combinations of 10 Cryptosporidium parvum oocysts, with various ratios of genotype I to genotype II, were isolated and subjected to PCR-restriction fragment length polymorphism analysis. Amplification of both genotypes in these samples ranged from 31 to 74% and yielded no information about the genotype proportions. In addition, since both genotypes were not always detected, amplification of a single genotype is not conclusive evidence that the sample contains only a single genotype.. AB - Combinations of 10 Cryptosporidium parvum oocysts, with various ratios of genotype I to genotype II, were isolated and subjected to PCR-restriction fragment length polymorphism analysis. Amplification of both genotypes in these samples ranged from 31 to 74% and yielded no information ...
Background: Onychomycosis is a fungal infection of one or more units of the nail caused by dermatophytes, or mold and nondermatophytes yeast. Investigations are needed to establish the diagnosis of onychomycosis before starting treatment. Several investigations methods for diagnosing onychomycosis such as microscopic examination with 20% KOH, fungal culture, histopathology examination with PAS staining (Periodic acid Schiff) and PCR (Polymerase Chain Reaction), for culture methods require a long time about 4 weeks to identify fungal that cause onychomycosis. A molecular technology such as PCR is a sensitive and specific test for the diagnosis of a variety of microorganisms including fungal pathogens. Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) is a method with the addition of the enzyme after PCR amplification allowing more specific results. Objective: To determine the diagnostic value of Polymerase Chain Reaction-Restriction Fragment Length Polymorphism ...
The present investigation was undertaken to study the genetic polymorphism of the DRB3 exon 2 in 75 crossbred cattle by the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique. Five genotypes i.e. HaeIII-a, HaeIII-b, HaeIII-e, HaeIII-ab and HaeIII-ae were observed when the 284 bp PCR products were digested with HaeIII restriction enzyme. The corresponding frequencies of these patterns were 0.53, 0.04, 0.01, 0.38 and 0.04, respectively. Digestion with RsaI restriction enzyme resolved 24 different restriction patterns. The frequencies of these patterns ranged from 0.013 (RsaI-f, RsaI-k and RsaI-c/n) to 0.120 (RsaI-n). The results revealed that the crossbred cows belonged to the RsaI patterns namely b, k, l, a/l, d/s, l/n, l/o and m/n, whose corresponding frequencies were 0.027, 0.013, 0.040, 0.027, 0.040, 0.067, 0.027 and 0.067, respectively. Digestion of the 284 bp PCR product of DRB3.2 gene with PstI in the crossbred cattle did not reveal any restriction site. ...
Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) Analysis of Three Lipooligosaccharide-Associated Genes of Campylobacter jejuni and Campylobacter coli Isolated From Animal Samples ...
Several high frequency restriction fragment length polymorphisms (RFLPs) associated with the human gene for apolipoprotein B have been previously reported by Priestly et al. The EcoRI RFLP here was shown to be very strongly associated with the Ag(t/z) immunochemical polymorphism of human low density lipoproteins, allowing correct Ag(t/z) phenotyping of 17 (out of 17 tested) unrelated individuals. The Xbal RFLP was associated with the Ag(g/c) immunochemical polymorphism, permitting correct phenotyping of 14 (out of 17 tested) unrelated individuals. Its close association with an RFLP permitted localization of the Ag(t/z) polymorphism to the C-terminal end of the apolipoprotein B peptide, and allowed detailed discussion of its probable molecular basis. ...
Terminal restriction fragment length polymorphism (TRFLP or sometimes T-RFLP) is a molecular biology technique for profiling of microbial communities based on the position of a restriction site closest to a labelled end of an amplified gene. The method is based on digesting a mixture of PCR amplified variants of a single gene using one or more restriction enzymes and detecting the size of each of the individual resulting terminal fragments using a DNA sequencer. The result is a graph image where the x-axis represents the sizes of the fragment and the y-axis represents their fluorescence intensity. TRFLP is one of several molecular methods aimed to generate a fingerprint of an unknown microbial community. Other similar methods include DGGE, TGGE, ARISA, ARDRA, PLFA, etc. These relatively high throughput methods were developed in order to reduce the cost and effort in analyzing microbial communities using a clone library. The method was first described by Liu and colleagues in 1997 which employed ...
TY - JOUR. T1 - Quantitative real-time polymerase chain reaction (qRT-PCR) restriction fragment length polymorphism (RFLP) method for monitoring highly conserved transgene expression during gene therapy. AU - Bruzzone, Carol M.. AU - Belcher, John D.. AU - Schuld, Nathan J.. AU - Newman, Kristal A.. AU - Vineyard, Julie. AU - Nguyen, Julia. AU - Chen, Chunsheng. AU - Beckman, Joan D.. AU - Steer, Clifford J.. AU - Vercellotti, Gregory M.. PY - 2008/12. Y1 - 2008/12. N2 - Evaluation of the transfer efficiency of a rat heme oxygenase-1 (HO-1) transgene into mice requires differentiation of rat and mouse HO-1. However, rat and mouse HO-1 have 94% homology; antibodies and enzyme activity cannot adequately distinguish HO-1. We designed a quantitative real-time polymerase chain reaction (qRT-PCR) method to monitor HO-1 transcription relative to a housekeeping gene, GAPDH. The ratio of rat and mouse HO-1 mRNA could be estimated through restriction fragment length polymorphism (RFLP) analysis of the PCR ...
Synonyms for restriction fragment length polymorphism at Thesaurus.com with free online thesaurus, antonyms, and definitions. Dictionary and Word of the Day.
A typing method was developed for Neisseria meningitidis serogroup A by analysis of restriction fragment length polymorphisms (RFLP) of the class 1 outer membrane protein gene (porA). By using appropriate primers, an approximately 1,116-bp fragment of the porA gene was amplified by PCR and then was digested with the restriction endonuclease MspI. The digestion products were separated on 10% polyacrylamide gels and were stained with silver. One hundred three clinical isolates of group A N. meningitidis from 17 provinces of China collected over a 26-year period were analyzed. Results of MspI-generated RFLP profiles of PCR-amplified porA genes were compared with those obtained by conventional serosubtyping. There was a band of about 400 bp common to all strains examined, and the 103 strains of serogroup A resulted in 22 unique RFLP patterns. The differences in bands could be observed mainly in the range of 120 to 280 bp. The smaller fragments were useful in distinguishing meningococci with the same ...
RFLP (Restriction Fragment Length Polymorphism) RFLP RFLP was developed at the late 70 s due to the discovery of restriction enzymes (REs; or called as restriction ... – A free PowerPoint PPT presentation (displayed as a Flash slide show) on PowerShow.com - id: 425ce8-OTc2N
TY - JOUR. T1 - Restriction maps and restriction fragment length polymorphisms of the human 21-hydroxylase genes. AU - Donohoue, Patricia A.. AU - Jospe, Nicholas. AU - Migeon, Claude J.. AU - McLean, Robert H.. AU - Bias, Wilma B.. AU - White, Perrin C.. AU - Van Dop, Cornelis. N1 - Funding Information: ACKNOWLEDGEMENTS: We thank Dr. M. C. Carroll of Harvard pK4 clone, Ms. S. F. Klupt for assistance in preparation Ms. C. Schaefer for C4 phenotyping, Drs. E. Fleischnick, Crigler, Jr., for aid in obtaining blood samples from Bw47-linked CAH, and Ms. D. Qgorzalek for preparation work was supported in part by NIH grants AM-00180 AM-31920 (R.H.M.), AM-36085 (C.V.D.) and CA-22507 University for the of restriction blots, L. Key, and J. F. two patients with HLA-of this manuscript. This (C.J.M.), AM-07116 (C.J.M.), (P.C.W.).. PY - 1986/4/29. Y1 - 1986/4/29. N2 - Restriction maps were constructed for the two human 21-hydroxylase genes (21-OHA and 21-OHB) by using DNA from subjects homozygous for a ...
OBJECTIVE: The relationship between response to dietary fat and cholesterol, and the EcoRI restriction fragment length polymorphism (RFLP) of the apolipoprotein B(apoB) gene was examined. DESIGN: Forty-nine free-living subjects took part in a prospective double-blind crossover dietary intervention study. The apoB EcoRI cutting site was present in five women and 18 men (E+) and absent in 15 women and 11 men (E-). INTERVENTION: Subjects consumed a low fat (25% energy), low cholesterol (less than 200 mg/day) diet. After two weeks on this background diet (baseline) subjects were randomly assigned to consume a liquid supplement for three weeks which was either fat and cholesterol free or which contained fat (30 to 36 g) and cholesterol (650 to 780 mg). After the first three-week period subjects switched to the other supplement. Blood samples were collected for plasma lipid analysis after an overnight fast on two consecutive days at the end of baseline and on three consecutive days after each ...
PubMed comprises more than 30 million citations for biomedical literature from MEDLINE, life science journals, and online books. Citations may include links to full-text content from PubMed Central and publisher web sites.
The Hallman et al. [8] definition of endophytic bacteria requires surface-disinfested plant tissue or extraction from the plant. Disinfestation by killing all the epiphytic bacteria may be effective when culture-dependent protocols are used, but is not appropriate in culture-independent protocols, such as the present one, since the DNA or RNA of dead epiphytes, if not removed, would still be amplified by bacteria-specific PCR. For those organs, like tubers, whose outer layers can be easily peeled off, endophytic bacteria can be isolated from inside of the plants unambiguously. However, peeling the epidermis off leaves, while possible, is not practical for a study like the present one. Therefore, to study leaf endophytic bacterial communities, it is critical to dislodge epiphytic bacteria from the leaf surfaces as far as possible. We have dislodged epiphytes using methods similar to those reported by others [13, 26-28]. Since we did not test the rinse water for rDNA amplicons, we cannot be ...
Cnr (Colourless non-ripening) is a dominant pleiotropic ripening mutation of tomato (Lycopersicon esculentum) which has previously been mapped to the proximal region of tomato chromosome 2. We describe the fine mapping of the Cnr locus using both linkage analysis and fluorescence in situ hybridisation (FISH). Restriction fragment length polymorphism (RFLP)-, amplified restriction fragment polymorphism (AFLP)-, and cleaved amplified polymorphic sequence (CAPS)- based markers, linked to the Cnr locus were mapped onto the long arm of chromosome 2. Detailed linkage analysis indicated that the Cnr locus was likely to lie further away from the top of the long arm than previously thought. This was confirmed by FISH, which was applied to tomato pachytene chromosomes in order to gain an insight into the organisation of hetero- and euchromatin and its relationship to the physical and genetic distances in the Cnr region. Three molecular markers linked to Cnr were unambiguously located by FISH to the long arm of
Peripheral blood (2 ml) was taken from all subjects and genomic DNA was extracted from peripheral blood using the TIANamp Blood DNA kit (Tiangen Biotech, Beijing, China) according to manufacturers instructions. The quality and concentration of extracted DNA was measured in two OD wavelength 260 and 280 nm using NanoDrop (Thermo Scientific, U.S.A.). SNP genotyping was performed using polymerase chain reaction-restriction fragment length polymorphism method. The primers used for the nucleotide extension reaction were AACAAGTAAGAATGAAAAGAGGACATGGT (forward) and CCCCCAATGAGGTCATAGAAGAATC (reverse) for rs2275913 and ACCAAGGCTGCTCTGTTTCT (forward) and GGTAAGGAGTGGCATTTCTA (reverse) for rs763780 polymorphism. For PCR, 25 μl reaction mixture contained as follows: 2.5 μl of 10× reaction buffer (with 1.5 mM MgCl2), 2 μl of deoxynucleotide triphosphate (dNTP; 2.5 mM), 2 μl of each pair primer, 50 ng DNA template, 1 μl of 0.4U Taq polymerase (Applied Biosystems, Evry, France) and 14.5 μl ddH2O. The ...
PubMed comprises more than 30 million citations for biomedical literature from MEDLINE, life science journals, and online books. Citations may include links to full-text content from PubMed Central and publisher web sites.
Infertility affects 1 in 6 couples and approximately 1 in 25 men. Male factor infertility is a major cause of spermatogenic anomalies, the causes of which are largely unknown. Impaired repro-ductive functions in men might result from physiological, genetic, and/or environmental factors such as xenobiotics. The multi-drug re-sistance1 (MDR1) gene encodes a P-glycoprotein which has a role in the active transport of various substrates providing protection of somatic cells from potentially toxic substances, including xenobi-otics. MDR1 is highly expressed at the luminal surface of capillary endothelial cells, and is expressed in Leydig cells, testicular mac-rophages, and Sertoli cells. We performed genotype and haplotype analyses of MDR1 in 192 infertile and 102 fertile Turkish men for the genetic markers C1236T and C3435T, using polymerase chain reaction-restriction fragment length polymorphism analysis. In the overall population, correlations were analyzed in all genotype mod-els. We found that ...
An evaluation of the utility of rep PCR typing compared to the 15 loci discriminatory set of MIRU-VNTR was undertaken. Twenty-nine isolates of Mycobacterium tuberculosis from patients were examined. Genomic DNA was extracted from the isolates by standard method. The number of copies of tandem repeats of the 15 MIRU-VNTR loci was determined by PCR amplification and agarose gel electrophoresis of the amplicons. M. tuberculosis outbreak-related strains were distinguished from other isolates. MIRU-VNTR typing identified 4 major clusters of strains. The same isolates clustered together after RFLP typing, but rep-PCR identified only 3 of them. The concordance between RFLP and MIRU-VNTR typing was complete, with the exception of two isolates with identical RFLP patterns that differed in the number of tandem repeat copies at two MIRU-VNTR alleles. A further isolate, even sharing the same RFLP pattern, differed by one repeat from the rest of its cluster. We also tested the use of an automated rep-PCR for ...
Aims: Several studies indicated that CYP2C19 loss-of-function polymorphisms have a higher risk of stent thrombosis (ST) after percutaneous coronary interventions (PCIs). However, this association has not been investigated thoroughly in Chinese population. In this study, we aimed to determine the effect of CYP2C19 loss-of-function polymorphisms on the occurrence of ST and other adverse clinical events in Chinese population.. Methods: The study population included 1 068 consecutive patients undergoing intracoronary stent implantation after pre-loading with 600mg of clopidogrel. CYP2C19*2 and CYP2C19*3 were genotyped by use of polymerase chain reaction-restriction fragment length polymorphism analysis. The adverse clinical events recorded were ST, death, myocardial infarction, and bleeding events. The primary end point of the study was the incidence of cumulative ST within 1 year following PCI. The secondary end point was other adverse clinical outcomes 1 year after the procedure.. Results: The ...
Proliferative diabetic retinopathy is an important cause of visual impairment. We investigated whether the polymorphism of the β3-adrenoreceptor (β3-AR) gene, which is associated with insulin resistance and an earlier onset of NIDDM, was associated with proliferative diabetic retinopathy (PDR) in 215 Japanese NIDDM patients with a duration of diabetes of ,10 years. The polymorphism of the β3-AR gene was determined by polymerase chain reaction-restriction fragment length polymorphism analysis. The Trp64Arg allele of the β3-AR gene was significantly more frequent in the NIDDM patients with PDR (P = 0.002), but not in those with non-PDR (P = 0.151), than in NIDDM patients without diabetic retinopathy. Those with the mutation had an earlier onset of diabetes, a longer duration of diabetes, and higher current and maximal BMI values, compared with those without the mutation. Moreover, this mutation was also associated with higher serum triglyceride and decreased HDL-cholesterol levels. When ...
Molecular identification of larval stages of Otiorhynchus (Coleoptera: Curculionidae) species based on polymerase chain reaction-restriction fragment length polymorphism analysis Journal of Applied Entomology (2008) 132, 230-238 ...
Salmonella spp. is the major bacterial pathogen in poultry and is responsible for significant economic losses of the poultry industry in many parts of the world. Among Salmonella spp., Salmonellagallinarum and S.pullorum are the most common causative agents of chicken salmonellosis resulting in high mortality and morbidity.The aim of this study was to identify S. gallinarum and S. pullorum by using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method.In this study, 13 samples of Salmonella, isolated from local poultry, were obtained from Razi Type Culture Collection (RTCC). For the PCR-RFLP method based on the fliC gene, extracted DNA was used as a template for amplifying of the fliC gene (197bp) using specific primers. PCR products were subjected to digestion using Hinp1I restriction endonuclease.For the PCR, 197 bp fliC fragment was amplified from all 13 isolates. Ten out of 13 were S.gallinarum and the other three were S. pullorum. As part of the PCR-RFLP, two
A quantitative molecular technique was developed for rapid analysis of microbial community diversity in various environments. The technique employed PCR in which one of the two primers used was fluorescently labeled at the 5 end and was used to amplify a selected region of bacterial genes encoding 16S rRNA from total community DNA. The PCR product was digested with restriction enzymes, and the fluorescently labeled terminal restriction fragment was precisely measured by using an automated DNA sequencer. Computer-simulated analysis of terminal restriction fragment length polymorphisms (T-RFLP) for 1,002 eubacterial sequences showed that with proper selection of PCR primers and restriction enzymes, 686 sequences could be PCR amplified and classified into 233 unique terminal restriction fragment lengths or ribotypes. Using T-RFLP, we were able to distinguish all bacterial strains in a model bacterial community, and the pattern was consistent with the predicted outcome. Analysis of complex ...
The technique for RFLP analysis is, however, slow and cumbersome. It requires a large amount of sample DNA, and the combined process of probe labeling, DNA fragmentation, electrophoresis, blotting, hybridization, washing, and autoradiography can take up to a month to complete. A limited version of the RFLP method that used oligonucleotide probes was reported in 1985.[1] The results of the Human Genome Project have largely replaced the need for RFLP mapping, and the identification of many single-nucleotide polymorphisms (SNPs) in that project (as well as the direct identification of many disease genes and mutations) has replaced the need for RFLP disease linkage analysis (see SNP genotyping). The analysis of VNTR alleles continues, but is now usually performed by polymerase chain reaction (PCR) methods. For example, the standard protocols for DNA fingerprinting involve PCR analysis of panels of more than a dozen VNTRs. RFLP is still used in marker-assisted selection. Terminal restriction fragment ...
|i |Aim.|/i| The aim of this study was to evaluate the role of the Lys751Gln (rs13181) |i |ERCC2|/i| gene polymorphism in clinical parameters and the risk for development of ovarian cancer. |i |Material and Methods.|/i| The study consisted of 430 patients with ovarian cancer (mean age: 53.2 ± 10.11) and 430 healthy subjects (mean age: 50.31 ± 18.21). Analysis of the gene polymorphisms was performed using the PCR-based restriction fragment length polymorphism (PCR-RFLP). The odds ratios (ORs) and 95% confidence intervals (CIs) for each genotype and allele were calculated. |i |Results.|/i| The results obtained indicate that the genotype Gln/Gln is associated with an increased risk of ovarian cancer (OR 5.01; 95% CI 3.37–7.43; |svg xmlns:xlink=http://www.w3.org/1999/xlink xmlns=http://www.w3.org/2000/svg style=vertical-align:-3.42938pt id=M1 height=11.7782pt version=1.1 viewBox=-0.0498162 -8.34882 57.0529 11.7782 width=57.0529pt||g transform=matrix(.013,0
Angiotensin converting enzyme (ACE) is a membrane-bound dipeptidyl carboxy-peptidase that generates vasoconstricting angiotensin II and inactivates vasodilating bradykinin. The ACE gene encodes two isozymes: the somatic isozyme (sACE) is found in many tissues including vascular endothelial cells, whereas the testis-specific isozyme (tACE) is expressed exclusively in developing spermatids and mature sperm. Thus, ACE might have physiological functions in addition to blood pressure regulation. Male mice lacking tACE activity show reduced fertility, indicating its importance in male fertility. In this study, we screened five recently defined tACE gene polymorphisms in 90 Singapore Chinese men with infertility and 84 fertile controls using PCR-based restriction fragment length polymorphism and DNA sequencing. However, only one of these polymorphisms was identified in both patient and control groups, the frequency of which was not significantly different in patients and controls. Thus, these ACE gene ...
Widespread use of DNA restriction fragment length polymorphism (RFLP) to differentiate strains of Mycobacterium tuberculosis to monitor the transmission of tuberculosis has been hampered by the need to culture this slow-growing organism and by the level of technical sophistication needed for RFLP typing. We have developed a simple method which allows simultaneous detection and typing of M. tuberculosis in clinical specimens and reduces the time between suspicion of the disease and typing from 1 or several months to 1 or 3 days. The method is based on polymorphism of the chromosomal DR locus, which contains a variable number of short direct repeats interspersed with nonrepetitive spacers. The method is referred to as spacer oligotyping or spoligotyping because it is based on strain-dependent hybridization patterns of in vitro-amplified DNA with multiple spacer oligonucleotides. Most of the clinical isolates tested showed unique hybridization patterns, whereas outbreak strains shared the same ...
TY - JOUR. T1 - Loss of Heterozygosity for Loci on the Long Arm of Chromosome 6 in Human Malignant Melanoma. AU - Millikin, D.. AU - Trent, J.. PY - 1991/10/15. Y1 - 1991/10/15. N2 - Malignant melanoma has been documented to display recurring abnormalities of chromosome 6, particularly the long arm (6q). Restriction fragment length polymorphism analysis was used as a molecular genetic approach to examine loci on chromosome 6q for loss of constitutional heterozygosity (LOH). Five DNA markers that recognize restriction fragment length polymorphisms along 6q and one polymorphic DNA marker for 6p were used to screen 20 autologous pairs of tumor DNA and normal DNA to determine the tumor and constitutional genotypes of each patient. LOH on chromosome 6q was identified at 21 of S3 inform ative loci (40%). Five patients with more than one informative locus had allele losses consistent with the loss of the entire long arm (or of an entire copy) of chromosome 6, while four other patients demonstrated ...
Background: Peroxisome proliferator-activated receptor gamma (PPAR gamma) is a ligand dependent transcription factor involved in various processes, including carcinogenesis. We aimed to investigate any possible association of the PPAR gamma Pro12Ala (rs1801282) polymorphism with risk of developing gastric cancer (GC). Patients and Methods: A hospital based case control study was designed covering 50 patients with GC and 120 healthy controls. The frequencies of PPAR gamma Pro12Ala (rs1801282) were determined using a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay. Results: The Ala12 allele of the PPAR gamma Pro12Ala G gene was associated with a 1.95 fold increased risk of GC development (p: 0.022; 95% CI: 1.58-2.40). Subgroup analyses showed that the same allele was also associated with metastasis (p: 0.000; OR: 4.09; 95% CI: 2.273-7.368) and differentiation (p: 0.004; OR: 1.95; 95% CI: 1.335-2.875) in patients with GC. Conclusion: This study suggests that the ...
Aims: IL-1b-3953 C,T and MMP-9-1562C,T variants have been shown to be linked to the development of myocardial infarction (MI), although previous studies have reported inconsistent results. The aim of the present study was to determine whether these genetic variations are associated with MI susceptibility in an Iranian population. Methods: In the current study, 117 patients with MI and 120 control group members were selected as participants. Peripheral blood samples were taken from all the subjects for genomic DNA extraction. Single nucleotide polymorphism (SNP) genotyping was performed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assays. Results: Multiple logistic regression analysis revealed that the TT genotype of the IL-1b-3953 C,T polymorphism is associated with a significant MI protective effect in: the homozygote model after adjustment for MI risk factors (odds ratio OR]: 0.18, confidence interval 95% CI] = 0.04-0.72; p = 0.01); and also in the recessive ...
Despite the rapid development of pharmacogenetic testing and the frequencies of medication related emergencies increasing, pharmacogentic testing is not yet implemented extensively in clinical practice. Several studies document that polymorphic Cytochrome P450 isoenzymes CYP2C9, CYP2C19 and CYP2D6 are responsible for the metabolism of many clinically important drugs and xenobiotics. These polymorphisms contribute to inter-individual and interethnic variation in drug metabolism which may lead to differences in drug response, suggesting that common dose regimen will not always equivocate to efficacious dosing. The CYP2D6*2, CYP2D6*4 and CYP2D6*10 variants were studied in four Indian populations (Gujarati, Punjabi, Bengali and Koya tribe). Genotypes at individual alleles were identified using Polymerase Chain Reaction Restriction Fragment Length Polymorphism (PCR-RFLP) method. Differences in frequencies of CYP2D6 genotypes/ alleles were compared at regional and global level. CYP2D6*2 variant ...
Background: Polymorphism of NFKB1 and NFKB1A are highly associated with cancer. We have assessed polymorphism in the promoter region of NFKB1 -94 del/ins ATTG (rs28362491) and NFKB1A -826 C/T (rs2233406) with the risk of HNSCC in Indian population. Methods: Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method was used for the genotyping NFKB1 -94 del/ins ATTG and NFKB1A -826 C/T. Sequencing was done to validate the results of PCR-RFLP. Statistical analysis of data was done by Stata/SE-14.0 software. Results: ins/ins genotype was observed to be a risk factor of HNSCC as compared del/del genotype of NFKB1 -94 ATTG. Interactive effects of smoking and chewing on ins/ins genotype showed 13.96 and 10.92 fold increased risk of HNSCC. NFKB1A -826 C/T polymorphism, TT genotype showed no association with the risk of HNSCC as compared to wild type CC genotype. Conclusion: Our results showed NFKB1 -94 del/ins ATTG with smoking and tobacco chewing may increase the risk of HNSCC
After immunoflurescent microscopy DNA mutational analysis is the final step in elucidating the underlying molecular defect, and in most cases, it reduces the number of genes to be screened. DNA is extracted from blood of the patient and family members. Initial mutation screening is performed by restriction fragment-length polymorphism analysis, hotspot analysis, and finally, direct DNA sequencing ...
INTRODUCTION: Asthma is a common respiratory childhood disease that results from an interaction between genetic, environmental and immunologic factors. The implication of nucleotide-binding and oligomerization domain 1 and 2 (NOD1/CARD4, NOD2/CARD15) was highlighted in many inflammatory diseases.. METHODS: In this case-control study, we analyzed the association of three NOD2 polymorphisms and one NOD1 variant, in 338 Tunisian asthmatic children and 425 healthy Controls, using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. We also assessed NOD1 and NOD2 mRNA and protein levels by qRT-PCR and ELISA techniques.. RESULTS: The homozygous AA genotype of rs2075820 was a risk factor for asthma (OR 2.39). The influence of the E266K variant in the presence of the heterozygous AG genotype was higher in male than female groups. The homozygous AA genotype was a risk factor associated with asthma, for patients aged between 6 and 18 years OR 2.39, IC95% (1.04-5.49) p , ...
The vitamin D receptor (VDR) was the first candidate gene to be studied in relation to osteoporosis, and most attention has focused on polymorphisms situated near the 3 flank of VDR. The aim of this study was to investigate the association about VDR gene Apa I polymorphism with bone mineral density (BMD) in postmenopausal women with osteoporosis. We studied a total of 136 postmenopausal women with a mean age of 56.36 +/- 10.29 years. Among them, a total of 75 had osteoporosis, 37 had osteopenia, and 24 had normal BMD. Venous blood samples were obtained for evaluation of bone metabolism and genotyping. The VDR Apa I genotype was determined by polymerase chain reaction-restriction fragment length polymorphism. BMDs at the lumbar spine and hip were measured by dual-energy X-ray absorptiometry. Postmenopausal women with aa genotype had significantly lower BMD values (grams per centimeter square) at lumbar spines compared to persons with AA genotype. Also, postmenopausal women with AA genotype had ...
Molecular analysis of the CYP21A2 gene was performed for the detection of the six most common point mutations (p.P30L, p.I172N, p.V281L, p.Q318X, the splice site mutation Int2 [IVS2-13A/C,G], and the cluster of three mutations [p.I236N, p.V237E, and p.M239K] designed as CL6). Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method was performed on 47 unrelated Egyptian 21α-OH deficiency patients and their available parents to detect the presence of the six most common point mutations. ...
Genome-wide association studies (GWAS) have proved the association of IKZF1 polymorphisms with childhood acute lymphoblastic leukemia (ALL). In the present study, we aimed to inspect the impact of IKZF1 gene polymorphisms and childhood ALL in a sample of Iranian population who live in south east of Iran. This case-control study was done on 110 children diagnosed with ALL and 120 healthy children. The IKZF1 (rs4132601 T > G, rs11978267 A > G, rs11980379 T > C, and rs10272724 T > C) polymorphisms were determined using polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP). The results showed that rs4132601 T > G polymorphism increased the risk of ALL in the codominant (OR = 2.96, 95 % CI = 1.58-5.54, p = 0.0008, TG vs TT; and OR = 2.75, 95 % CI = 1.31-5.76, p = 0.0094, GG vs TT) and dominant (OR = 2.89, 95 % CI = 1.61-5.19, p = 0.0004, TG + GG vs TT) inheritance models. On the other hand, the rs4132601 G allele increased the risk of ALL (OR = 1.86, 95 % CI = 1.28-2.96; p = ...
Penelitian ini bertujuan untuk membandingkan konsentrasi, tingkat kemurnian, visualisasi elektroforesis, dan penggunaan DNA hasil isolasi untuk polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) dari delapan spesies ikan laut. Sampel DNA yang diperoleh dari daging dan sirip ikan baronang (Siganus javus), kerapu (Epinephelus sp), ekor kuning (Caesionidae sp), kakap merah (Lutjanus campechanus), kurisi (Nemipterus nematophorus), kue (Caranx melampygus), bawal hitam (Parastromateus niger), dan selar (Selaroides leptolepis) diisolasi menggunakan metode presipitasi amonium asetat. Primer universal sitokrom b digunakan untuk mengamplifikasi mtDNA menggunakan PCR. Amplikon dipotong menggunakan enzim restriksi Hinf I. Hasil menunjukkan bahwa konsentrasi dan kemurnian DNA sampel daging dan sirip tidak berbeda nyata (P,0.05) yaitu berturut-turut 22.01±20.29 dan 1.44±0.27 untuk konsentrasi dan kemurnian DNA sampel daging, serta 52.86±41.37 dan 1.54±0.23 untuk konsentrasi dan ...
Background Assess the relation between the presence of PVUII and XBAI polymorphisms in the estrogen receptor alpha gene and mammographic density in postmenopausal women.. Methods For the present analysis, 189 postmenopausal women who had never used hormonal therapy and who did not have clinical or mammographic features were selected. Based on the ACR-BIRADSâ 2003 classification, the mammographic density was determined by three independent readers (two subjective ratings and one computerized - Adobe Photoshop â 7.0 software). Blood samples were available to extract DNA according to KIT GFX â protocol. PCR-RFLP (Polymerase Chain Reaction - Restriction Fragment Length Polymorphism) was then used to identify the polymorphisms.. Results There was a high degree of agreement among the three readers to determine the mammographic density (Kappa,0.75). Sixty women (32%) had dense breasts and 129 (68%) had non-dense breasts. The PVUII polymorphism was found in 132 (69.8%) of 189 women, while the XBAI ...
OBJECTIVE: To determine whether transforming growth factor beta1 (TGFbeta1) gene DNA polymorphism is associated with pathogenesis in the fibrosis of patients with systemic sclerosis (SSc). METHODS: Eighty-seven Japanese patients with SSc including 30 with diffuse type and 57 with limited type together with 110 unrelated controls were investigated. Pulmonary fibrosis was determined in 34 SSc patients using high-resolution chest computed tomography. TGFbeta1 genetic polymorphisms were analyzed in 2 loci; T869C (Leu10Pro) in codon 10 at exon 1, and C-509T in the promoter region using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). RESULTS: Neither the genotype of T/C polymorphism in T869C nor C/T polymorphism in C-509T revealed any difference in distribution between SSc and controls. In the group of SSc patients with pulmonary fibrosis, a weak but significantly high frequency (p = 0.05) of TC+CC (the presence of C allele) in T869C, and CT+TT (the presence of T allele) ...
Gly1057Asp polymorphism in insulin receptor substrate (IRS)-2 is related to insulin resistance and diabetes mellitus (DM), which both contribute to the pathogenesis of coronary artery disease (CAD). Hence, we hypothesize that Gly1057Asp polymorphism in IRS-2 is associated with CAD. Patients receiving elective coronary angiography were enrolled. Significant stenosis is defined as a luminal diameter stenosis greater than 50%. Patients without significant stenosis were defined as group A, and those with significant stenosis in at least one major coronary artery were defined as group B. Genotypes were determined by polymerase chain reaction/restriction fragment length polymorphism. Chi-square test and multivariate logistic regression were used to evaluate the relationship between Gly1057Asp polymorphism in IRS-2 and CAD. The homeostasis model assessment of insulin resistance (HOMA-IR) index was calculated as a representative of insulin resistance. Multiple linear regression was used to analyze the
P53 can bind to the promoter of miR-34a/b/c, inducing their expression at the transcriptional level. Previous reports have shown that TP-53 and miR-34b/c may play crucial roles in carcinogenesis. We conducted a case-control study to investigate the association between miR-34b/c rs4938723 and TP-53 Arg72Pro polymorphisms and the risk of breast cancer (BC) in Chinese women. We genotyped the two polymorphisms in 228 BC patients and 307 healthy controls using polymerase chain reaction-restriction fragment length polymorphism and DNA sequencing assay. We found that the miR-34b/c rs4938723 CT genotype and C allele were associated with significantly increased risks of BC compared with the TT genotype and T allele (CT vs. TT: OR = 1.81, 95 % CI, 1.24 - 2.65, P = 0.002; C vs. T: OR = 1.36, 95 % CI, 1.06 - 1.74, P = 0.016, respectively). Moreover, a significant association between the cases and controls was also observed in a dominant model (OR = 1.75; 95 % CI, 1.22 - 2.51, P = 0.002). Stratified analysis ...
Background: Interleukin (IL)-23 has an important role in tumor immune regulation. Objective: To investigate the possible association of interleukin-23 receptor (IL23R) gene variants rs1884444, rs10889677 and rs11209026 with development of acute lymphoblastic leukemia (ALL). Methods: The IL23R variants were studied in 164 ALL patients and compared to 175 healthy controls by polymerase chain reaction-restriction fragment length polymorphism. The relationship between these variants and clinical and laboratory features of the patients and response to therapy were evaluated. Results: No significant differences in genotype and allele frequencies existed between patients and controls. The rs1884444TG genotype was significantly lower in patients who relapsed (24.2%) compared to those without relapse (55.9%, p=0.006). Fewer patients who relapsed had evidence of the G allele (P=0.034). The TG genotype was associated with a longer complete remission at1804±116 days compared to other genotypes (|1217 days, p=0.028
CALLAS, Ney et al. Genetic polymorphism of the E apolipoprotein in school age children: comparison with levels of plasma lipids and apolipoproteins. Biomédica [online]. 2007, vol.27, n.4, pp.526-536. ISSN 0120-4157.. Introduction. Research in laboratories around the world has documented the contribution of the E apolipoprotein alleles to structural variations of lipids and apolipoproteins. Objective. The gene frequencies of the E apolipoprotein alleles were compared with the lipid and apolipoprotein levels in school age children. Materials and methods. Six hundred and ninety one 5 to 15 years old school age children from the Colombian departments of Cundinamarca, Boyacá, Meta, Santander and Norte de Santander, were evaluated.The genotypes of the E apolipoprotein were identified by polymerase chain reaction-restriction fragment length polymorphism. Plasma levels for the following 5 lipids and lipoproteins were assayed: total cholesterol, HDL (high density lipoprotein) cholesterol, LDL (low ...
In a group of 50 randomly selected case-matched patients from 1999, the positive blood cultures were concomitant with fever in 98%, intravenous phlebitis in 44%, and recurrent bacteremia in 20%. Fever disappeared approximately 6 hours after intravenous catheter removal. Polymerase chain reaction-restriction fragment length polymorphism revealed strain homogeneity in patient, water, and alcohol isolates. Contaminated tap water had been used to dilute alcohol for skin antisepsis and for decontamination of the caps of heparin vials. Only sporadic cases directly attributable to breach of protocol were reported after single-use alcohol swabs were substituted ...
The knowledge about microorganisms-activity and diversity under hop production is still limited. We assumed that, different systems of hop production (within the same soil and climatic conditions) significantly influence on the composition of soil microbial populations and its functional activity (metabolic potential). Therefore, we compared a set of soil microbial properties in the field experiment of two hop production systems (a) ecological based on the use of probiotic preparations and organic fertilization (b) conventional-with the use of chemical pesticides and mineral fertilizers. Soil analyses included following microbial properties: The total number microorganisms, a bunch of soil enzyme activities, the catabolic potential was also assessed following Biolog EcoPlates®. Moreover, the abundance of ammonia-oxidizing archaea (AOA) was characterized by terminal restriction fragment length polymorphism analysis (T-RFLP) of PCR ammonia monooxygenase α-subunit (amoA) gene products. Conventional and
This study aimed at investigating the genetic diversity of a panel of Candida africana strains recovered from vaginal samples in different countries. All fungal strains were heterozygous at the mating type-like locus and belonged to the genotype A of Candida albicans. Moreover, all examined C. africana strains lack N-acetylglucosamine assimilation and sequence analysis of the HXK1 gene showed a distinctive polymorphism that impair the utilization of this aminosugar in this yeast.Multilocus sequencing of seven housekeeping genes revealed a substantial genetic homogeneity among the strains, except for the CaMPIb and VPS13 loci which contributed significantly to the classification of our set of C. africana strains into 6 existing diploid sequence types. Amplified fragment length polymorphism (AFLP) fingerprint analysis yielded greater genotypic heterogeneity among the C. africana strains. Overall the data reported here show that in C. africana genetic diversity occurs and the existence of this intriguing
This dataset contains the 5 TRFLP fragment data.. T4-like myovirus communities were analyzed by terminal restriction fragment length polymorphism (TRFLP) of g23, which encodes the major capsid protein (Chow and Fuhrman, 2012). Viral fingerprints were obtained from both terminal fragments (5 and 3). g23-TRFLP products were run in duplicate on non-adjacent lanes on an ABI377 by slab gel electrophoresis with internal size standards (Bioventures, Murfreesboro, TN, USA) every 25 bp (50-900 bp) or 50 bp (900-1400 bp). Peaks were identified in DAx (van Mierlo, Inc, Eindhoven, The Netherlands). Fragments (50-500 bp) were rounded to the nearest 0.1 bp and dynamically binned (Ruan, et al., 2006b; Chow and Fuhrman, 2012). The resulting bins were manually curated to merge bins ,0.1 bp wide with the nearest neighbor. Terminal fragments from in silico analysis of publicly available T4-like viral genomes were used to assign identities to environmental g23-TRFLP OTUs. Unique fragment lengths were considered ...
RFLP Lets generate a restriction map for a region of human X-chromosome 5kb 3kb The restriction map in the same region of the X chromosome of a second individual may appear as 8kb Normal GAATTC Mutant GAGTTC