Nocardia farcinica - Wikipedia
Nocardia farcinica is a species of bacteria and a member of the genus Nocardia. This species is very similar in phenotype to Nocardia asteroides, to the degree that some isolates of N. asteroides were later found to be Nocardia farcinica. N. farcinica may be a causative agent of nocardiosis or of secondary infections in immunocompromised patients. Strains of this species have been isolated from human brain abscesses. N. farcinica contains a 6 million base pair genome with an average GC content of 70.8%. A sequenced strain, IFM 10152, is also known to contain two plasmids, pNF1 pNF2. The chromosome encodes 5,674 potential protein-coding open reading frames. This genome may have undergone numerous gene duplication events as a result of adapting to new environments. Parte, A.C. Nocardia. www.bacterio.net. Wallace RJ, Jr; Tsukamura, M; Brown, BA; Brown, J; Steingrube, VA; Zhang, YS; Nash, DR (December 1990). Cefotaxime-resistant Nocardia asteroides strains are isolates of the controversial ...
Clinical significance, antimicrobial susceptibility and molecular identification of Nocardia species isolated from children...
Nocardia is an opportunistic pathogen that causes respiratory infections in immunocompromised patients. The aim of this study was to analyze the epidemiology, clinical significance and antimicrobial susceptibility of Nocardia species isolated from eight children with cystic fibrosis. The isolated species were identified as Nocardia farcinica, Nocardia transvalensis, Nocardia pneumoniae, Nocardia veterana and Nocardia wallacei. N. farcinica was isolated in three patients and all of them presented lung affectation with a chronic colonization and pneumonia. N. farcinica showed resistance against gentamicin, tobramycin, cefotaxime, but was susceptible to trimethoprim-sulfamethoxazole and amikacin. N. transvalensis, which was isolated from two patients, showed an association with chronic colonization. N. transvalensis was resistant to tobramycin and amikacin, but susceptible to ciprofloxacin, trimethoprim-sulfamethoxazole and cefotaxime. N. veterana, N. pneumoniae and N. wallacei were isolated from three
Nocardia caishijiensis sp. nov., a novel soil actinomycete | Microbiology Society
A soil isolate, strain F829T, which had provisionally been assigned to the genus Nocardia, was subjected to a polyphasic taxonomic study. An almost complete 16S rDNA sequence was determined for this strain; the sequence was aligned with available sequences for nocardiae and phylogenetic trees were inferred using three tree-making algorithms. The organism showed a combination of phenotypic properties typical of nocardiae and formed a distinct phyletic line within the evolutionary radiation of species of the genus Nocardia, being most closely related to Nocardia asteroides ATCC 19247T. Strain F829T was readily distinguished from representatives of species of Nocardia with validly published names on the basis of phenotypic data, notably from the type strain of N. asteroides. It is proposed that the organism be recognized as a novel species of Nocardia, Nocardia caishijiensis sp. nov. The type strain is F829T (=AS 4.1728T =JCM 11508T).
Nocardia - Wikipedia
Nocardia is a genus of weakly staining Gram-positive, catalase-positive, rod-shaped bacteria. It forms partially acid-fast beaded branching filaments (acting as fungi, but being truly bacteria). It contains a total of 85 species. Some species are nonpathogenic, while others are responsible for nocardiosis. Nocardia species are found worldwide in soil rich in organic matter. In addition, they are oral microflora found in healthy gingiva, as well as periodontal pockets. Most Nocardia infections are acquired by inhalation of the bacteria or through traumatic introduction. Nocardia colonies have a variable appearance, but most species appear to have aerial hyphae when viewed with a dissecting microscope, particularly when they have been grown on nutritionally limiting media. Nocardia grow slowly on nonselective culture media, and are strict aerobes with the ability to grow in a wide temperature range. Some species are partially acid-fast (meaning a less concentrated solution of sulfuric or ...
Nocardia farcinica Brain Abscess: Epidemiology, Pathophysiology, and Literature Review.
Abstract Background: Infections caused by Nocardia farcinica are potentially lethal because of the organisms tendency to disseminate and resist antibiotics. Central nervous system involvement has been documented in 30% of infections caused N. farcin
Iconography : Disseminated subcutaneous Nocardia farcinica abscesses in a nephrotic syndrome patient - EM|consulte
Journal of the American Academy of Dermatology - Vol. 38 - N° 5S - p. 874-876 - Iconography : Disseminated subcutaneous Nocardia farcinica abscesses in a nephrotic syndrome patient - EM|consulte
Mechanism of Rifampicin Inactivation in Nocardia farcinica
A novel mechanism of rifampicin (Rif) resistance has recently been reported in Nocardia farcinica. This new mechanism involves the activity of rifampicin monooxygenase (RifMO), a flavin-dependent monooxygenase that catalyzes the hydroxylation of Rif, which is the first step in the degradation pathwa …
Public Domain Picture | Note the presence of the gram-positive acid-fast Nocardia brasiliensis bacteria using a modified Fite...
Free Public Domain Picture: Note the presence of the gram-positive acid-fast Nocardia brasiliensis bacteria using a modified Fite-Faraco stain. | ID: 13544697616669
Disseminated subcutaneous nocardiosis caused by Nocardia farcinica diagnosed by FNA biopsy and 16S ribosomal gene sequencing.
Nocardia is an infrequent but significant cause of infections in the immunocompromised host. Clinical syndromes are varied and ranges from pulmonary, disseminated, cutaneous, and CNS involvement. Here we describe a case of disseminated subcutaneous n
Advanced Radiology Teaching
Nocardia are weakly gram-positive, filamentous bacteria found worldwide in soils. Human disease from this microbe was first described by Eppinger in 1890, after bovine disease was described by Nocard in 1888. Pathogenic Nocardia are members of the family Nocardiaceae, the aerobic actinomycetes.. Dissemination is usually from a pulmonary source. Nocardia asteroides is the principal cause of systemic nocardiosis in the United States. A constellation of acute and chronic symptoms develops, ranging from headache to obtundation, pyuria, and right upper abdominal pain due to hepatic involvement.. CNS infection may have no signs or symptoms or may present with focal neurological deficits, seizures, and coma.. Imaging findings, particularly on MRI, can lead to the diagnosis of infection rather than tumor. T2 hypointense rings with corresponding ring enhancement and restricted diffusion are characteristic imaging features of suggestive of abscess. DW imaging has been shown to be superior to conventional ...
eNUFTIR: Intensification of biosurfactant synthesis by Nocardia vaccinii ІМV В-7405 on a glucose-glycerol mixture
The purpose of this study was to establish optimal molar glycerol to glucose ratio for enhanced biosurfactant synthesis by the cultivation of Nocardia vacсinii ІMV В-7405 on a mixture of energetically nonequivalent substrates (glucose and glycerol). Based on theoretical calculations of the energy requirements for biomass production and the synthesis of surface-active trehalose monomycolates on the energy-deficient substrate (glycerol), the concentration of the energy-excessive substrate (glucose), which increased the efficiency of the substrate carbon conversion to biosurfactant, was determined. It was found that the synthesis of extracellular biosurfactant on a mixture of glucose and glycerol at molar ratio of 1.0:2.5 increased 2.0-2.3-fold compared to that on corresponding monosubstrates. The increased level of biosurfactant on the mixed substrate is determined by intensification of surface-active trehalose monomycolate synthesis, confirmed by 1.2-5.7-fold increase in activity of the ...
UniProt: Q5YY91 NOCFA
ID Q5YY91_NOCFA Unreviewed; 315 AA. AC Q5YY91; DT 23-NOV-2004, integrated into UniProtKB/TrEMBL. DT 23-NOV-2004, sequence version 1. DT 07-JUN-2017, entry version 56. DE SubName: Full=Putative channel protein {ECO:0000313,EMBL:BAD56850.1}; GN OrderedLocusNames=NFA_20040 {ECO:0000313,EMBL:BAD56850.1}; OS Nocardia farcinica (strain IFM 10152). OC Bacteria; Actinobacteria; Corynebacteriales; Nocardiaceae; Nocardia. OX NCBI_TaxID=247156 {ECO:0000313,EMBL:BAD56850.1, ECO:0000313,Proteomes:UP000006820}; RN [1] {ECO:0000313,EMBL:BAD56850.1, ECO:0000313,Proteomes:UP000006820} RP NUCLEOTIDE SEQUENCE [LARGE SCALE GENOMIC DNA]. RC STRAIN=IFM 10152 {ECO:0000313,EMBL:BAD56850.1, RC ECO:0000313,Proteomes:UP000006820}; RX PubMed=15466710; DOI=10.1073/pnas.0406410101; RA Ishikawa J., Yamashita A., Mikami Y., Hoshino Y., Kurita H., Hotta K., RA Shiba T., Hattori M.; RT The complete genomic sequence of Nocardia farcinica IFM 10152.; RL Proc. Natl. Acad. Sci. U.S.A. 101:14925-14930(2004). CC ...
Sudan University of Science and Technology - Proteomics of Nocardia africana (SD769) recently isolated from patients with...
Author. By Mogahid M. El Hassan, Kanury V.S. Rao, Zaved Siddique, Dinesh S. Kumar, Rashmi Tickoo, Nageeb S. Saeed, Moawia M. Mukhtar, Mohamed E. Hamid .. Abstracts. Nocardia africana is a pulmonary pathogen which has been recently isolated from human in Sudan. There is great need for proteomic investigations but they are sparse at present. First attempts on N. africana SD 769 (DSM44491) visualized 74 protein of molecular weights between 10 -250 kDa and isoelectric points between 4 7. Due to the limited database information, identified proteins were assigned by homology to sequences from the other bacterial species such as Staphylococcus aureus, Oceanobacillus iheyensis, N. farcinica and Yersinia pestis References. FULL Text ...
KEGG PATHWAY: Citrate cycle (TCA cycle) - Nocardia farcinica IFM 10152
The citrate cycle (TCA cycle, Krebs cycle) is an important aerobic pathway for the final steps of the oxidation of carbohydrates and fatty acids. The cycle starts with acetyl-CoA, the activated form of acetate, derived from glycolysis and pyruvate oxidation for carbohydrates and from beta oxidation of fatty acids. The two-carbon acetyl group in acetyl-CoA is transferred to the four-carbon compound of oxaloacetate to form the six-carbon compound of citrate. In a series of reactions two carbons in citrate are oxidized to CO2 and the reaction pathway supplies NADH for use in the oxidative phosphorylation and other metabolic processes. The pathway also supplies important precursor metabolites including 2-oxoglutarate. At the end of the cycle the remaining four-carbon part is transformed back to oxaloacetate. According to the genome sequence data, many organisms seem to lack genes for the full cycle [MD:M00009], but contain genes for specific segments [MD:M00010 M00011 ...
Final Diagnosis -- Case 226
N. brasiliensis, N. otitidiscaviarum, and N. transvalensis represent the remaining 10% of infections. Of these, N. brasiliensis is the most important in tropical areas; it is most often seen as a cutaneous infection that can affect individuals with normal immune function (although 70% of cases of N. brasiliensis are seen in immunocompromised individuals).. In general, nocardiosis is a disease that affects primarily the cell- or humorally-immunocompromised population: transplant recipients, patients on high-dose steroids, and patients with cancer, AIDS, or other leukocyte deficiencies. Nocardia may also colonize the respiratory tract of immunocompetent individuals with compromised pulmonary function, such as those with asthma or chronic obstructive pulmonary disease (COPD). Once established, nocardial pneumonia will usually disseminate hematologically, with kidney, skin, GI tract, and brain being common targets; brain abscess (33% of cases) is the most common presentation. Sulfonamides, alone or ...
Bacteremic pneumonia caused by Nocardia veterana in an HIV-infected patient | NTU Scholars
臺大位居世界頂尖大學之列,為永久珍藏及向國際展現本校豐碩的研究成果及學術能量,圖書館整合機構典藏(NTUR)與學術庫(AH)不同功能平台,成為臺大學術典藏NTU scholars。期能整合研究能量、促進交流合作、保存學術產出、推廣研究成果。. To permanently archive and promote researcher profiles and scholarly works, Library integrates the services of NTU Repository with Academic Hub to form NTU Scholars.. ...
Nocardia A review of the pathogen by Mark Crislip MD Made available through a generous donation by Mr Eugene Minkler and Legacy...
Classification gram-positive bacteria. on microscopy have branching filamentous cells. Members of the group are often only distantly related phylogenetically. Part of a subgroup, the aerobic nocardiform actinomycetes that includes Mycobacterium, Corynebacterium, Nocardia, Rhodococcus, Gordona, and Tsukamurella and the cause of Whipples disease (Tropheryma whippeli).
Nocardia jinanensis sp. nov., an amicoumacin B-producing actin...
Nocardia jinanensis sp. nov., an amicoumacin B-producing actinomycete.: A novel actinomycete, strain 04-5195(T), that produces amicoumacin B, which targets bone
Draft genome sequence of Nocardia jinanensis, an opportunistic bacterial pathogen that causes cellulitis | DR-NTU
The draft genome sequence of Nocardia jinanensis, an opportunistic pathogen that can cause skin infections, reveals genes that may contribute to the lifestyle and pathogenicity of N. jinanensis. The genome also reveals the biosynthetic capacity of N. jinanensis in producing mycolic acids, siderophores, and other polyketide and nonribosomal peptide-derived secondary metabolites ...
https://www.thefreelibrary.com/First+Report+of+the+Isolation+of+Nocardia+thailandica+from+the...-a0556468922
Free Online Library: First Report of the Isolation of Nocardia thailandica from the Bronchoalveolar Lavage of a Patient in Iran.(Case Report) by Iranian Journal of Medical Sciences; Health, general Antibacterial agents Health aspects Bronchitis RNA
Nocardia | Johns Hopkins ABX Guide
Nocardia answers are found in the Johns Hopkins ABX Guide powered by Unbound Medicine. Available for iPhone, iPad, Android, and Web.
nocS4 - NocS4 - Nocardia sp. ATCC 202099 - nocS4 gene & protein
p>The checksum is a form of redundancy check that is calculated from the sequence. It is useful for tracking sequence updates.,/p> ,p>It should be noted that while, in theory, two different sequences could have the same checksum value, the likelihood that this would happen is extremely low.,/p> ,p>However UniProtKB may contain entries with identical sequences in case of multiple genes (paralogs).,/p> ,p>The checksum is computed as the sequence 64-bit Cyclic Redundancy Check value (CRC64) using the generator polynomial: x,sup>64,/sup> + x,sup>4,/sup> + x,sup>3,/sup> + x + 1. The algorithm is described in the ISO 3309 standard. ,/p> ,p class=publication>Press W.H., Flannery B.P., Teukolsky S.A. and Vetterling W.T.,br /> ,strong>Cyclic redundancy and other checksums,/strong>,br /> ,a href=http://www.nrbook.com/b/bookcpdf.php>Numerical recipes in C 2nd ed., pp896-902, Cambridge University Press (1993),/a>),/p> Checksum:i ...
nocS1 - NocS1 - Nocardia sp. ATCC 202099 - nocS1 gene & protein
p>The checksum is a form of redundancy check that is calculated from the sequence. It is useful for tracking sequence updates.,/p> ,p>It should be noted that while, in theory, two different sequences could have the same checksum value, the likelihood that this would happen is extremely low.,/p> ,p>However UniProtKB may contain entries with identical sequences in case of multiple genes (paralogs).,/p> ,p>The checksum is computed as the sequence 64-bit Cyclic Redundancy Check value (CRC64) using the generator polynomial: x,sup>64,/sup> + x,sup>4,/sup> + x,sup>3,/sup> + x + 1. The algorithm is described in the ISO 3309 standard. ,/p> ,p class=publication>Press W.H., Flannery B.P., Teukolsky S.A. and Vetterling W.T.,br /> ,strong>Cyclic redundancy and other checksums,/strong>,br /> ,a href=http://www.nrbook.com/b/bookcpdf.php>Numerical recipes in C 2nd ed., pp896-902, Cambridge University Press (1993),/a>),/p> Checksum:i ...
Ricky Smith (rickysmithrs) | Pearltrees
Human biofield. Nocardia Otitidis Antimicrobial Susceptibility Analysis. Human Energy Treatment & Phylogenetic Analysis of Nocardia Otitidis. Nocardia Otitidis
Disseminated Nocardiosis Associated with Treatment with Infliximab in a Patient with Ulcerative Colitis.
BACKGROUND Opportunistic infections may occur when patients with inflammatory bowel disease (IBD) are treated with tumor necrosis factor (TNF)-alpha inhibitors. With the increasing use of new immunosuppressant drugs, the incidence of opportunistic or atypical infections is also increasing, including with Nocardia spp. A high level of awareness of atypical infections is warranted in immunosuppressed patients. CASE REPORT A 57-year-old female African American, with a past medical history of ulcerative colitis (UC) and arthritis, was treated with infliximab and prednisone. She presented to the emergency department with acute onset of chest pain, shortness of breath, and a two-week history of a productive cough. Examination showed hypoxia, tachypnea, decreased and coarse bilateral breath sounds, and fluctuant, tender, erythematous masses on her trunk and groin. Laboratory investigations showed a leukocytosis with a left shift. She was initially treated for presumed community-acquired pneumonia (CAP).
Blast transformation of rabbit B-derived lymphocytes by a mito...
Blast transformation of rabbit B-derived lymphocytes by a mitogen extracted from Nocardia.: Nocardia water soluble mitogen (NWSM) is known to stimulate mouse an
Figure: Nocardia bacteria can often be found in soil, compost, or decaying vegetation. - Merck Veterinary Manual
Merck & Co., Inc., Kenilworth, NJ, USA is a global healthcare leader working to help the world be well. From developing new therapies that treat and prevent disease to helping people in need, we are committed to improving health and well-being around the world. The Merck Veterinary Manual was first published in 1955 as a service to the community. The legacy of this great resource continues as the Merck Veterinary Manual in the US and Canada and the MSD Manual outside of North America.. ...
Opportunistic Infections in Transplant Patients - McCarthy - Family Practice Faculty Notes
Our case: 2015 renal transplant, nocardia diagnosed shortly after immunosuppressive therapy, possible hx of CMV. Common infections: URI and UTI - are still common in the immunosuppressed. Common things are common. Opportunistic infections: Viral: CMV, JC, HBV, HCV, VZV, EBV, HSV Bacterial: PCP, Listeria, Nocardia Fungal: Aspergillus, TB Early Post-Transplantation: Immediately post-op to 1 month…
MMLRG - Performance: Antimicrobial Susceptibility, Acid-Fast Bacilli, Rapidly Growing
MMLRG : The method employed in this assay is broth microtiter dilution using a commercially available plate from Trek Diagnostics, Inc. Antimicrobials included in the assay are tested according to the Clinical and Laboratory Standards Institute (CLSI) guidelines.(CLSI. Susceptibility Testing of Mycobacteria, Nocardiae, and Other Actinomycetes; Approved Standard. CLSI document M24-A2. CLSI, Wayne, PA, 2011; Woods GL, Lin S-Y G, Desmond EP: Susceptibility test methods: Mycobacteria, Nocardia, and Other Actinomycetes. In Manual of Clinical Microbiology. Vol 1. Eleventh edition. Edited by JH Jorgensen, MA Pfaller, KC Carroll, et al. Washington, DC, ASM Press, 2015, pp 1356-1378)
Phyllocoptes vaccinii - Plant Parasites of Europe
Buhr (1965a), Dauphin & Aniotsbehere (1997a), Davis, Flechtmann, Boczek & Barké (1982a), Farkas (1965a), Goosmann (1933a), Jočić & Petanović (2012a), Máca (2012a), Petanović & Stanković (1999a), Redfern & Shirley (2011a), Roivainen (1947a, 1950a, 11051a), Roskam (2009a), Skoracka, Lewandowski & Boczek (2005a). ...
Plus it
Primary growth of AMC 60 fibrosarcoma inoculated into the hind leg of ACI/N rats resulted in occasional generation of concomitant resistance to growth of a second graft of the same tumor cells in the peritoneal or pleural cavity. Using this syngeneic tumor-host system, experiments were carried out to elucidate the effect of intratumoral injections of an immunomodulator, Nocardia rubra cell wall skeleton (N-CWS), on concomitant immunity. Rats bearing a solid tumor into which N-CWS was repeatedly injected showed a significant inhibitory effect on the proliferation of the tumor cells inoculated secondarily into the peritoneal cavity, i.e., concomitant immunity, as compared to control groups of normal, N-CWS-treated and solid tumor-bearing rats. Peritoneal macrophages, when harvested after i.p. tumor inoculation into the N-CWS treated solid tumor-bearing rats, were found to be significantly potentiated for tumoricidal activity against [5-125I]iodo-2′-deoxyuridine-labeled AMC tumor cells. These ...
Plus it
The purpose of this study was to determine whether the presence of progressively growing pulmonary metastases influences the number and function of alveolar macrophages (AM). Female F344 rats were given i.v. injections of cells from a metastatic variant line of the syngeneic adenocarcinoma MADB-105. At Days 7, 14, 21, and 28 after injection, normal and tumor-bearing animals (3/group) were killed, and their AM were harvested by lavage. The functional integrity of AM was determined by their capacity to phagocytose opsonized erythrocytes and by their ability to respond to a variety of activating agents in vitro. Normal and metastasis-bearing rats were given i.v. injections of Nocardia rubra cell wall skeleton to determine whether the presence of large pulmonary metastases would interfere with AM activation in situ. The data demonstrated that the presence of progressively growing lung metastases led to a slight increase in the number of harvested AM and that these cells from tumor-bearing rats were ...
March 2021 - lun
Objective: To explore the clinical efficacy and immune effect of Nocardia rubra Cell Wall Skeleton for External Use (Nr-CWS) in the treatment of high-risk human papillomavirus (HPV) persistent infection. Methods: From May 2019 to May 2020, 80 patients with high-risk HPV persistent cervical infection who were diagnosed and treated at Qingdao Women and Childrens Hospital were collected, and they were randomly divided into a study group and a control group with 40 cases in each group. The study group was treated with Nr-CWS, and the control group was treated with recombinant human interferon 2b vaginal effervescent tablets combined with Baofukangshuan. We compared the HPV conversion rate and effective rate of treatment in the two groups. We also analyze the changes of immune cell levels in peripheral blood and immune factor concentrations in vaginal lavage fluid, and the occurrence of adverse reactions. Results: The total effective rate was 76.92% in the study group and 47.37% in the control ...
Welcome to CDC stacks | Central Venous Catheter-associated Nocardia Bacteremia in Cancer Patients - 23675 | Emerging Infectious...
Central venous catheters, often needed by cancer patients, can be the source of Nocardia bacteremia. We evaluated the clinical characteristics and outcomes of 17 cancer patients with Nocardia bacteremia. For 10 patients, the bacteremia was associated with the catheter; for the other 7, it was a disseminated infection. N. nova complex was the leading cause of bacteremia. Nocardia promoted heavy biofilm formation on the surface of central venous catheter segments tested in an in vitro biofilm model. Trimethoprim- and minocycline-based lock solutions had potent in vitro activity against biofilm growth. Patients with Nocardia central venous catheter-associated bloodstream infections responded well to catheter removal and antimicrobial drug therapy, whereas those with disseminated bacteremia had poor prognoses ...
Nocardia brasiliensis Mycetoma: Treatment With Co-trimoxazole | JAMA Dermatology | JAMA Network
To the Editor.-A recent study documents the efficacy of dapsone in the treatment of Nocardia asteroides mycetoma.1 Reference was made to successful treatment of
Nocardiosis - Causes, Symptoms, Treatment, Complications and Pictures
Nocardiosis Definition It is a rare infectious disorder which affects the lungs or the entire body. Bacterium from the genus Nocardia, especially Nocardia asteroides and Nocardia brasiliensis, is mainly responsible for the occurrence of this condition. Individuals with a weakened immunity due to some health problem are
Theileriosis ikeda spa.
Unsubscribe from Ikeda Spa? JS - nca Nosema ceranae - nce Nitrosomonas communis - nco Neurospora crassa - ncr Naumovozyma castellii - ncs Nocardia cyriacigeorgica - ncy Nocardiopsis dassonvillei - nda Nitrospira defluvii - nde Naumovozyma dairenensis - ndi Candidatus Nasuia deltocephalinicola - ndl Nonlabens dokdonensis - ndo Neisseria elongata - nel Nanoarchaeum equitans - neq Nitrosomonas eutropha - net Nitrosomonas europaea - neu Candidatus Nitrososphaera evergladensis - nev Nocardia farcinica - nfa Neosartorya fischeri - nfi Candidatus Nitrososphaera gargensis - nga Nannochloropsis gaditana - ngd Natronobacterium gregoryi - nge Neorhizobium galegae bv.. CC - syd Synechococcus sp. Lost your model?. ...
Nocardiosis (Nocardia Infection)
Diagnosis may be difficult. In the clinical laboratory, routine cultures may be held for insufficient time to grow nocardiae, and referral to a reference laboratory may be needed for species identification. Recently, N. farcinica and N. nova have been removed from N.asteroides complex. N. farcinica frequently is more resistant to antimicrobial agents, including trimethoprim-sulfamethoxazole (TMP-SMX) (the drug of choice), and has been shown to be more virulent in an animal model. TMP-SMX therapy for HIV-infected patients may be complicated by frequent occurrence of side effects and drug resistance ...
中国科学院南海海洋研究所机构知识库(SCSIO OpenIR): Contribution to deterioration of polymeric materials by a slow-growing bacterium Nocardia...
Bacteria capable of degrading polymeric products were isolated from several sources including tap water, sediment, and a deteriorated polymeric product. Alcaligenes xylosoxidans; T2, Pseudomonas aeruginosa GP10, and Nocardia corynebacterioides S3 were able to utilize rubber products as a sole source of carbon and energy. These microorganisms showed different growth patterns in mineral salt media (MSM) supplemented with rubber strips or with the rubber extract. A. xylosoxidans T2, P. aeruginosa GP10 and N. corynebacterioides S3 reduced the weight of the rubber product by approximately 2.0, 4.0 and 5.3%, respectively, after 70 days of incubation with the rubber product in MSM. On average, 0.45 mg (water-soluble carbon) g(-1) of the rubber product was released into solution phase after 7 days of incubation. Growth of N. corynebacterloides S3 was initially slower but exceeded the other two bacteria upon colonization of the polymer products. N. corynebacterioides S3 formed a dense biofilm on surfaces ...
Pathogen Safety Data Sheets: Infectious Substances - Nocardia spp. - Canada.ca
These Pathogen Safety Data Sheets, regulated under Workplace Hazardous Materials Information System (WHMIS) legislation, are produced for personnel working in the life sciences as quick safety reference material relating to infectious micro-organisms.
Brain abscess with lung infection? Think Nocardia | MDedge Emergency Medicine
A brain abscess in the presence of a lung infection should raise suspicion for Nocardia whether patients are immunocompromised or not,
Evaluation of the Combined Therapy of DA-7218, a New Oxazolidinone, and Trimethoprim/ Sulfamethoxazole in the Treatment of...
Title: Evaluation of the Combined Therapy of DA-7218, a New Oxazolidinone, and Trimethoprim/ Sulfamethoxazole in the Treatment of Experimental Actinomycetoma by Nocardia brasiliensis. VOLUME: 7 ISSUE: 3. Author(s):N.A. Espinoza-Gonzalez, O. Welsh, J. Ocampo-Candiani, S. Said-Fernandez, G. Lozano-Garza, S.H. Choi and L. Vera-Cabrera. Affiliation:Servicio de Dermatologia, Hospital Universitario Dr. Jose E. Gonzalez, Ave. Francisco I. Madero y Ave. Dr. Jose Eleuterio Gonzalez S/N, Colonia Mitras Centro, Monterrey, N.L. 64460 Mexico.. Keywords:Actinomycetoma, oxazolidinones, torezolid, DA-7157, DA-7218. Abstract: Objectives: Currently, for actinomycetoma, combined antimicrobial therapy is preferred to the use of a single compound. This is in order to provide a broader-spectrum coverage due to a combinatory or synergistic effect between the drugs, and to decrease the possibility of emergence of natural resistant strains. A new oxazolidinone pro-drug, DA-7218 ...
Nocardia mikamii a Novel Species Causing Disseminated Nocardiosis: A Literature Review of Disseminated Nocardiosis
International Scholarly Research Notices is a peer-reviewed, Open Access journal covering a wide range of subjects in science, technology, and medicine. The journals Editorial Board as well as its Table of Contents are divided into 108 subject areas that are covered within the journals scope.
ATCC 19296 Strain Passport - StrainInfo
Nocardia brasiliensis genes for two putative non-ribosomal peptide synthetases, hypothetical protein, putative condensation domain protein, putative thioesterase, putative polyketide synthase, putative thioesterase, putative dehydrogenase, putative non-ribosomal peptide synthetase, complete cds, strain: NBRC ...
ATCC 27863 Strain Passport - StrainInfo
Division of Nocardia asteroides sensu stricto into two species and descriptions of Nocardia paratuberculosis sp nov Tsukamura (formerly the Kyoto-I group of Tsukamura ...
Chronic granulomatous pleuritis caused by nocardia: PCR based diagnosis by nocardial 16S rDNA in pathological specimens |...
A 59 year old Japanese plumber was referred to the Hirosaki Central Hospital because of pyothorax and sustained high fever. He had a history of repeated bouts of pyothorax, but no possible causative agent was discovered. He had been treated with wide spectrum antibiotics and drainage. Previously, he was once diagnosed as having diabetes, but no medical treatment was undertaken. His family history was not remarkable. The peripheral white blood cell count was 9070/mm3 (neutrophils, 84.3%; eosinophils, 2.6%; basophils, 0.2%; monocytes, 5.2%; and lymphocytes, 7.7%). Red blood cell and platelet counts were normal. The erythrocyte sedimentation rate was increased to 38 mm at one hour, and C reactive protein was increased to 3.99 (normal, , 3.0 mg/litre). The blood glucose concentration was normal, as was the oral glucose tolerance test. A skin test for tuberculin was negative. There was no evidence of immunocompromised status. Computed tomography of the chest revealed thickening of the pleura with ...
Microbiology, epidemiology, and pathogenesis of nocardiosis
Nocardiosis is an uncommon gram-positive bacterial infection caused by aerobic actinomycetes in the genusNocardia.Nocardiaspp have the ability to cause localized or systemic suppurative disease in humans and animals. Nocardiosis is typically regarded
Rothia, gen. nov. an aerobic genus of the family Actinomycetaceae | Microbiology Society
SUMMARY
Rothia gen. nov. (Actinomycetaceae) is proposed as the name of a monotypic genus with the species Rothia dentocariosus comb. nov. (basionym Actinomyces dentocariosus Onisi 1949), synonyms Nocardia dentocariosus (Onisi) Roth 1957; Nocardia salivae Davis and Freer 1960, No strain of Onisi's original isolates is extant. ATCC 17931 is described and proposed as the neotype strain of Rothia dentocariosus (Onisi) Georg and Brown 1967.
Reprint Order Form | Bentham Science
Article Title : Evaluation of the Combined Therapy of DA-7218, a New Oxazolidinone, and Trimethoprim/ Sulfamethoxazole in the Treatment of Experimental Actinomycetoma by Nocardia ...
Nocardiosis - Infectious Diseases - MSD Manual Professional Edition
Nocardiosis - Etiology, pathophysiology, symptoms, signs, diagnosis & prognosis from the MSD Manuals - Medical Professional Version.
Potentially Lethal Airborne Fungus May Spread to ... ( Unlike typical strains new pathogen c...)
Health,...Unlike typical strains new pathogen can attack healthy people resear...THURSDAY April 22 (HealthDay News) -- A strain of potentially lethal ...Several people in Oregon have died after being infected with the new V... This novel fungus is worrisome because it appears to be a threat to o...,Potentially,Lethal,Airborne,Fungus,May,Spread,to,California,medicine,medical news today,latest medical news,medical newsletters,current medical news,latest medicine news
ASMscience | Regulation of Envelope S
This chapter discusses some of the stressors likely to target the cell envelope of Mycobacterium tuberculosis during infection, and the corresponding regulatory elements expressed by the bacterium to counteract this stress. Phylogenetically, M. tuberculosis is a member of the phylum Actinobacteria, which also includes several notable human pathogens, including species of the genera Streptomyces, Corynebacterium, Nocardia, and Rhodococcus. M. tuberculosis is a facultative intracellular pathogen, and its host range is restricted to humans. The bacterium is not normally found free within the environment, so its continued survival within the human population requires that it be transmitted directly from an infected individual with active disease to one that is susceptible to infection. Posttranslational phosphorylation of proteins was traditionally thought to be limited to eukaryotic cells. However, the discovery of two-component signal transduction systems (TCSSs) in bacteria shifted this paradigm to
The cytochromes of some hydrogen bacteria | SpringerLink
Eight strains of hydrogen bacteria belonging to the genera Hydrogenomonas, Pseudomonas, Nocardia, and to coryneform bacteria have been analyzed with respect to the cytochrome patterns. All strains...
blogorrhea: April 2014
IVET is a powerful gene manipulation strategy for discovering which genes in an organism (a pathogen, usually) are up-regulated or turned on during host infection. Lets say youre studying a new pathogen and you want to get an idea of which genes, in the pathogen, are turned on during the infection process. First, you need a strain of the organism thats disabled by virtue of lacking a working copy of a particular metabolic enzyme, say an enzyme needed for purine metabolism, e.g. purA. Secondly, you need a vector for inserting a promoterless copy of the working gene into the bacterium. What this usually means is, you need a plasmid (a small extra chromosome; many bacteria have them, and they can often be manipulated in the lab) on which to place a functional purA gene. The gene wont be expressed, however, if it lacks a suitable promoter region on the DNA upstream of the gene. Thats good; thats what you want. You want to put a promoterless copy of the good gene on the plasmid, along with ...
blogorrhea: April 2014
IVET is a powerful gene manipulation strategy for discovering which genes in an organism (a pathogen, usually) are up-regulated or turned on during host infection. Lets say youre studying a new pathogen and you want to get an idea of which genes, in the pathogen, are turned on during the infection process. First, you need a strain of the organism thats disabled by virtue of lacking a working copy of a particular metabolic enzyme, say an enzyme needed for purine metabolism, e.g. purA. Secondly, you need a vector for inserting a promoterless copy of the working gene into the bacterium. What this usually means is, you need a plasmid (a small extra chromosome; many bacteria have them, and they can often be manipulated in the lab) on which to place a functional purA gene. The gene wont be expressed, however, if it lacks a suitable promoter region on the DNA upstream of the gene. Thats good; thats what you want. You want to put a promoterless copy of the good gene on the plasmid, along with ...
May 2020 - TDMod.Net
Modelling COVID-19 transmission: from data to intervention Zhongwei Jia Zuhong Lu Published:April 01, 2020DOI:https://doi.org/10.1016/S1473-3099(20)30258-9 The speed and scope of detection of an infectious disease, in particular, timely identification and reporting of a new pathogen, is a major indicator of a countrys ability to control infectious diseases. Findings of the Global Health Security (GHS) index 1 […]. ...
The Order of Battle | In the Pipeline
Among the many drug-discovery lessons that this pandemic is highlighting is the difficulty of meeting the challenges of a new target, a new pathogen, a new
Rubra 00300 : CDS information --- DoBISCUIT
putative ligase [putative acid AMP ligase] ATGGATCTCGGTCAGGCTCAGACCAGGAAGAGTCTCGTGAACCGCACCTCAGCCCGGTAT ACCGACCACGTTTCCGCCGACCAGCGCCAGGCCTGGGCCGCCGCGGGCCACTACCCGGGC CAGGACCTGTACTCCCTGTTCCGTGGCCACGTCCAGCGCACGCCTCAGGCGCCGGCCGTG CTGGACGCCGAGGGTACGGTCAGCTACGGCGAACTGGACCAGGCAGCCCGGCGCCTGGCC GCGGGACTGGTGCAGCTCGGCATCGTCCCCGGCGACGTCGTGGCGGTCCAGCTGCCCAAC GCCCGTCTCGCGTGTGCCGTCGACCTCGCCGTCGCCGCGGTGGGCGCCGTCGTGCTGCCG TTTCCGCTCGGCCGGGGCGACCGGGACGCGGTCAGCCTGCTACGCCGCTCCGAGGCGGTC GCGGTGATCACCGTCGCCGATCATCACGGCTATCCCTGCGCCGAGCGGATCCGGAAACAC GCCGACGCCCTGCCGATGCTGCGTGCCGTCATCGTCGCCGGGGACGGTGCCGCCAAGACG CCGGACTGCGTGCCGATCGAGGCCCTGGCCGCCGCCACCGCCGACGAGTTCGTGCCGCGG GAATCCGACCCCGACGCACCGGCACGGATCCTGGTCACCTCCGGGTCCGAGGCGGAACCG AAGATGGTCCTGTACTCGCACAACGCGCTGGCCGGTGGCCGCGGTGCCATGATGGCCGGC CTGCACCGAGGTTCCCCGGCCACGATGCGCAACCTCTTCCTCGTCCCGCTGGCGTCGGCC TTCGGCTCCAGCGGGACGCCGGTCACCCTCGCGACCCTGGGCGGAACCCTCGTGCTGAGG CCGTCCTTCGACGCTGCCGGGACGCTGCGGACCATCGCCGAAACCCGGCCCACCCACCTG ...