Distamycin is a polyamide-antibiotic, which acts as a minor groove binder, binding to the small furrow of the double helix. Distamycin is a pyrrole-amidine antibiotic and analogous to netropsin and the class of lexitropsins. As opposed to netropsin, distamycin contains three N-methyl-pyrrole units. It is harvested from Streptomyces netropsis that also produces netropsin. Distamycin prefers AT-rich DNA-sequences and tetrades of [TGGGGT]4. Distamycin inhibits the transcription and increases the activity of the topoisomerase II. Derivates from distamycin are used as alkylating antineoplastic agents to combat tumours. Derivates with fluorophores are used as fluorescent tags for double-stranded DNA. The compound is hygroscopic, and sensible to light, freeze and hydrolysis. Its molar attenuation coefficient is 37.000 M−1 cm−1 at a wavelength of 303 nm. Lexitropsin Netropsin Hoechst 33258 DAPI M. P. Barrett, C. G. Gemmell, C. J. Suckling: Minor groove binders as anti-infective agents. In: ...
Streptomyces netropsis two component response regulator-like gene, partial cds; netropsin resistance protein subunit 1 (netP1) and netropsin resistance protein subunit 2 (netP2) genes, complete cds; and acyl-CoA synthetase-like gene, partial ...
Chemistry & Physics of DNA-Ligand Interactions Hardcover 1990 Editor: Neville R. Kallenbach ISBN 0-940030-25-X Editorial Review From Book News, Inc. Directed toward researchers and graduate students interested in the structural dynamics
194D: X-ray structures of the B-DNA dodecamer d(CGCGTTAACGCG) with an inverted central tetranucleotide and its netropsin complex.
2) M. Sriram, van der G. A. Marel, H. L. Roelen, van J. H. Boo and A. H. Wang, Structural Consequences of a Carcinogenic Alkylation Lesion on DNA: Effect of O6-ethylguanine on the Molecular Structure of the d(CGC[e6G]AATTCGCG)-netropsin Complex, Biochemistry, 1992, 31(47), 11823. ...
1D86: Structural consequences of a carcinogenic alkylation lesion on DNA: effect of O6-ethylguanine on the molecular structure of the d(CGC[e6G]AATTCGCG)-netropsin complex.
must match at least 50 times, so if there is AATT after say 25th character, it cannot stop there and must match a larger string. Use YAPE::Regex::Explain to see what your regular expresions mean. Moreover, you are replying to a node that is not related to your question ...
Proteins are essential components in most processes in living organisms. The detection and quantification of specific proteins can be used e.g. as measures of certain physiological conditions, and are therefore of great importance. This thesis focuses on development of affinity-based bioassays for specific protein detection. The use of Affibody molecules for specific molecular recognition has been central in all studies in this thesis. Affibody molecules are affinity proteins developed by combinatorial protein engineering of the 58-residue protein A-derived Z domain scaffold. In the first paper, solid phase peptide synthesis is investigated as a method to generate functional Affibody molecules. Based on the results from this paper, chemical synthesis has been used throughout the following papers to produce Affibody molecules tailored with functional groups for protein detection applications in vitro and in vivo.. In paper I, an orthogonal protection scheme was developed to enable site-specific ...
Proteins are essential components in most processes in living organisms. The detection and quantification of specific proteins can be used e.g. as measures of certain physiological conditions, and are therefore of great importance. This thesis focuses on development of affinity-based bioassays for specific protein detection. The use of Affibody molecules for specific molecular recognition has been central in all studies in this thesis. Affibody molecules are affinity proteins developed by combinatorial protein engineering of the 58-residue protein A-derived Z domain scaffold. In the first paper, solid phase peptide synthesis is investigated as a method to generate functional Affibody molecules. Based on the results from this paper, chemical synthesis has been used throughout the following papers to produce Affibody molecules tailored with functional groups for protein detection applications in vitro and in vivo.. In paper I, an orthogonal protection scheme was developed to enable site-specific ...
Engineered antibodies are key players in therapy, diagnostics and research. In addition to full size immunoglobulin gamma (IgG) molecules, smaller formats of recombinant antibodies, such as single-chain variable fragments (scFv) and antigen binding fragments (Fab), have emerged as promising alternatives since they possess different advantageous properties. Cell-based production technologies of antibodies and antibody fragments are well-established, allowing researchers to design and manufacture highly specific molecular recognition tools. However, as these technologies are accompanied by the drawbacks of being rather time-consuming and cost-intensive, efficient and powerful cell-free protein synthesis systems have been developed over the last decade as alternatives. So far, prokaryotic cell-free systems have been the focus of interest. Recently, eukaryotic in vitro translation systems have enriched the antibody production pipeline, as these systems are able to mimic the natural pathway of antibody
High mobility group (HMG)I proteins bind preferentially to the minor groove of A.T-rich regions in double-stranded DNA [1,2]. DNA-binding of these, and several related, proteins is effected by an 11-residue domain known as an A.T-hook [1]. Within known HMG-I proteins are found three highly conserved regions, closely related to the consensus sequence TPKRPRGRPKK [1]. A synthetic oligopeptide with this sequence specifically binds to substrate DNA in a manner reminiscent of intact HMG-I proteins. Structure predictions suggest that the peptide has a secondary structure similar to the anti-tumour and anti-viral drugs netropsin and distamycin, and to the dye Hoechst 33258 [1]. These ligands, which also preferentially bind to A.T-rich DNA, effectively compete with both the synthetic peptide and the HMG-I proteins for DNA binding [1]. The peptide also contains novel structural features such as a predicted Asx bend, or "hook", at its N-terminus, and laterally-projecting cationic Arg/Lys "bristles", which ...
Open Science is a Research Accelerator, M. Woelfle, P. Olliaro and M. H. Todd, Nature Chemistry 2011, 3, 745-748. Paper (mentioned on the cover) Discussed here Resolution of Praziquantel, M. Woelfle, J.-P. Seerden, J. de Gooijer, K. Pouwer, P. Olliaro and M. H. Todd, PLoS Negl. Trop. Dis. 2011, 5(9): e1260. Paper Picked up on the WHO website Polyamide-scorpion Cyclam Lexitropsins Selectively Bind AT-rich DNA Independently of the Nature of the Coordinated Metal, A. T. S. Lo, N. K. Salam, D. E. Hibbs, P. J. Rutledge and M. H. Todd, PLoS One 2011 6(5): e17446. Paper Chemical Sensors that Incorporate Click-Derived Triazoles, Y. H. Lau, P. J. Rutledge, M. Watkinson and M. H. Todd, Chem. Soc. Rev. 2011 40, 2848-2866. Paper A DDQ-mediated Oxidative Carbon-carbon Bond Forming Reaction Proceeds via an Isolable Iminium Ion A. S.-K. Tsang, P. Jensen, J. M. Hook, A. S. K. Hashmi and M. H. Todd, Pure Appl. Chem. 2011, 83, 655-665. Paper A Treasure Hunt for Chemistry, A. J. Bridgeman, R. Connor, P. J. ...
Biology serves as a major inspiration for the assembly of ordered structures at the nanoscale. Two main directions for the development of bio-inspired nanomaterials are based either on the use of protein and peptide building blocks or, alternatively, on the use of DNA. Polypeptide structures have the advantage of structural integrity and robustness while nucleic acids have the advantage of specific molecular recognition between complementary bases.. Our group has been extensively involved in the study of molecular self-assembly by extremely short peptide fragments. We demonstrated in 2003 that simple dipeptides contain all the molecular information needed to form ordered nanostructures [1]. Furthermore, peptide assemblies have been shown to exhibit remarkable physical properties including high mechanical rigidity, luminescence, piezoelectricity, and semiconductivity [2]. The dipeptide assemblies act as supramolecular polymers including a clear phase transition governed by Ostwalds rule of ...
Benzimidazoles are heterocyclic compounds. Symmetrical and unsymmetrical benzimidazoles/oligomers are minor groove DNA sequence selective binding compounds. Distamycin A and netropsin are examples of naturally occurring DNA binders. Hoechst 33258 (Bis-benzimidazole) is a synthetic minor groove A-T sequence selective reagent and has in vivo activity by inhibiting the topoisomerase II enzyme. The targets in this research work were to synthesise extended analogues of Hoechst with structural modifications (amide bond) or amide-linked dimers with a view to identifying new potential ligands. To synthesise a library of novel bis-benzimidazoles (analogues of Hoechst) several methods were used. For C5-C2 direct linkage aldehyde synthesis via ester, Weinreb amide reduction, condensation of acids with diamine by Eatons reagent were applied. Cyclization of amide-linked benzimidazoles (amide bond between carboxylic acid of C5 benzimidazole and diamine), an indirect method of bis-benzimidazole synthesis was ...
Ismail, Matthew Arif (1998) DNA-ligand interactions : a biophysical study of 9-hydroxyellipticine, Hoechst 33258 and a meso-substituted porphyrin derivative binding to DNA. PhD thesis, University of Warwick. ...
The introduction of the bioisosteric nitrogen at position 9 of the anthrapyrazole ring structure and the concomitant removal of ring hydroxy substituents cause a number of physicochemical effects that are likely to be relevant in terms of biological activity.. The presence of the aza substituent abolishes self-aggregation phenomena occurring both for MX and LX. This is interesting, because self-aggregated species tend to precipitate from aqueous media causing obvious undesired consequences upon administration (Powis and Kovach, 1983). In addition, the aggregation phenomena subtract part of the drug from the pharmacologically relevant interactions. The reason for lack of aggregation probably rests in the protonation equilibria involving the pyridine nitrogen, which are significant at physiological pH. In fact, although the carbocyclic analogs can easily stack their neutral planar portion one onto the other with the charged side-chains oriented in opposite directions, the same process cannot occur ...
Abstract: The design of compounds that form cytotoxic, non-mutagenic 3-methyladenine adducts in pancreatic ß-cells is being studied in this project for potential applications in the treatment of diseases such as diabetes and cancer. These compounds are composed of three components: 1) a cell-targeting moiety, glucosamine, which targets the insulin producing pancreatic ß-cells by way of the GLUT-2 transporters present on these cells 2) a site-specific DNA methylating agent, Me-Lex, which has been shown to selectively produce cytotoxic, non-mutagenic N3- methyladenine adducts 3) a linker component that connects the two other components together. The linker is a critical component because it has to be such that the cell-targeting and DNAmethylating properties of the two functional components are maintained. A synthetic route was explored, which enables the easy introduction of various linkers into the molecules. Fluorescent compounds were also designed to bind weakly to DNA at the same positions ...
TY - JOUR. T1 - Replication past a trans-4-hydroxynonenal minor-groove adduct by the sequential action of human DNA polymerases ι and κ. AU - Wolfle, William T.. AU - Johnson, Robert E.. AU - Minko, Irina G.. AU - Lloyd, R. Stephen. AU - Prakash, Satya. AU - Prakash, Louise. PY - 2006/1. Y1 - 2006/1. N2 - The X-ray crystal structure of human DNA polymerase ι (Polι) has shown that it differs from all known Pols in its dependence upon Hoogsteen base pairing for synthesizing DNA. Hoogsteen base pairing provides an elegant mechanism for synthesizing DNA opposite minor-groove adducts that present a severe block to synthesis by replicative DNA polymerases. Germane to this problem, a variety of DNA adducts form at the N2 minor-groove position of guanine. Previously, we have shown that proficient and error-free replication through the γ-HOPdG (γ-hydroxy-1,N2-propano- 2′-deoxyguanosine) adduct, which is formed from the reaction of acrolein with the N2 of guanine, is mediated by the sequential ...
Define carbocyclic. carbocyclic synonyms, carbocyclic pronunciation, carbocyclic translation, English dictionary definition of carbocyclic. adj. Having a ring composed exclusively of carbon atoms, as benzene. adj containing a closed ring of carbon atoms Adj. 1. carbocyclic - having or relating...
The (+)- and (-)-enantiomers of the carbocyclic analogues of (E)-5-(2-bromovinyl)-2-deoxyuridine (C-BVDU) and 5-iodo-2-deoxyuridine (C-IDU) were synthesized by separate routes. Both the (+)- and (-)-enantiomers of C-BVDU and C-IDU were markedly inhibitory to herpes simplex virus type 1 (HSV-1) replication. (+)-C-BVDU and (+)-C-IDU were as inhibitory to HSV-1 as the racemic (+/-)-C-BVDU and (+/-)-C-IDU, respectively, whereas the (-)-enantiomers were only 10-fold less active. Also, the (+)- and (-)-enantiomers of C-BVDU were equally inhibitory to the growth of murine mammary carcinoma cells transformed by the HSV-1 or HSV-2 thymidine kinase (TK) gene (designated FM3A TK-/HSV-1 TK+ and FM3A TK-/HSV-2 TK+). The (+)- and (-)-enantiomers of C-BVDU and the (+)- and (-)-enantiomers of C-IDU had a remarkably similar affinity for HSV-1 TK [Ki, 0.09 and 0.19 microM for (+)-C-BVDU and (+)-C-IDU and 0.16 and 0.19 microM for (-)-C-BVDU and (-)-C-IDU, respectively]. The inhibition of HSV-1 TK by BVDU, IDU, ...
Biosearch Technologies is a trusted manufacturer of custom oligos and qPCR probes for research and a GMP service provider for clinical and diagnostic markets.
seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.3937.2. Start End Strand Enzyme_name Restriction_site 5prime 3prime 5primerev 3primerev 32 35 + TspEI AATT 31 35 . . 48 51 + SetI ASST 51 47 . . 49 53 + HphI GGTGA 61 60 . . 64 69 + ApoI RAATTY 64 68 . . 65 68 + TspEI AATT 64 68 . . 75 80 + SspI AATATT 77 77 . . 79 82 + MseI TTAA 79 81 . . 103 108 - TsoI TARCCA 93 91 . . 134 139 + NspI RCATGY 138 134 . . 135 138 + FatI CATG 134 138 . . 135 138 + NlaIII CATG 138 134 . . 135 138 + CviAII CATG 135 137 . . 141 144 + MseI TTAA 141 143 . . 157 162 + SspI AATATT 159 159 . . 164 169 + NlaIV GGNNCC 166 166 . . 165 169 + BmgT120I GGNCC 166 167 . . 165 169 + AsuI* GGNCC 165 168 . . 166 169 + CviJI RGCY 167 167 . . 166 169 + HaeIII GGCC 167 167 . . 167 171 + TauI GCSGC 170 167 . . 167 171 + BlsI GCNGC 169 168 . . 167 171 + BisI GCNGC 168 169 . . 168 173 + NspBII* CMGCKG 170 170 . . 168 171 + AciI CCGC 168 170 . . 189 192 + MseI TTAA 189 191 . . 205 208 + FatI CATG 204 208 . . 205 208 + NlaIII CATG 208 204 . ...
The three-dimensional structure of a ternary complex of the purine repressor, PurR, bound to both its corepressor, hypoxanthine, and the 16-base pair purF operator site has been solved at 2.7 A resolution by x-ray crystallography. The bipartite structure of PurR consists of an amino-terminal DNA-binding domain and a larger carboxyl-terminal corepressor binding and dimerization domain that is similar to that of the bacterial periplasmic binding proteins. The DNA-binding domain contains a helix-turn-helix motif that makes base-specific contacts in the major groove of the DNA. Base contacts are also made by residues of symmetry-related alpha helices, the "hinge" helices, which bind deeply in the minor groove. Critical to hinge helix-minor groove binding is the intercalation of the side chains of Leu54 and its symmetry-related mate, Leu54, into the central CpG-base pair step. These residues thereby act as "leucine levers" to pry open the minor groove and kink the purF operator by 45 degrees. ...
A set of aminoalkylamine substituted anthraquinones (AAQs) was successfully synthesised by aminating 1- or 1,5-chloroanthraquinones in a single reaction step. These substituted anthraquinones, 1C3 or 1,5C3, were tethered to minor groove binding polyamides with between 1 - 3 N-methyl pyrrole units (Py) to produce a library of Py-AAQ compounds. It was envisaged that these compounds could improve cytotoxicity through bimodal damage to DNA relative to the individual polyamide or AAQ moieties. A set of py-AAQ platinum complexes was also successfully synthesised by a platinum-mediated alkylamine to nitrile addition. The additional conjugation of a platinum nitrile complex to Py-AAQ conjugates was predicted to generate agents that are more cytotoxic than the Py-AAQ conjugates by damaging DNA via a minor groove binding (MGB)-intercalation-platination mechanism. All newly synthesised Py-AAQs and associated imino coordinated platinum(II) complexes were examined for cytotoxic activity in DLD-1 colon and ...
The use of a mesogenic compound having a terminal end chain comprising carbon, oxygen, or sulphur, which has at least one pendent C¿1-4?alkyl, C¿1-4?alkoxy or a cycloalkyl ring, arranged no more than 6 atoms from the end of the chain e ...
What is described is a compound of formula I wherein X is an ethene, or an unsubstitiited or substituted arene or heteroarene; Y is a bond, an ethene, or an unsubstituted or substituted arene or heteroarene; Z is S or O; L is a linear or ...
Binding agents with differential activity can be provided, whereby certain activities of a first part of the binding agent are reduced or prevented until binding to a target occurs. This is useful if the binding agent is intended to bind both an effector cell and a target to be destroyed, because the effector cell can be protected from significant cell damage that might otherwise occur (e.g. due to premature activation of complement and/or ADCC). Such binding agents are useful in the treatment of cancer, for example.
Introduction to Genetic Analysis 8th Edition, Anthony J.F. Griffiths, Susan R. Wessler, Richard C. Lewontin, William M. Gelbart, David T. Suzuki, Jeffrey H. Miller ...
Richard Keene and colleagues report an inert dinuclear polypyridylruthenium(II) groove binding metal complex that exhibits slow exchange DNA binding in this HOT article. Such compounds have potential as anti-microbial agents as they can block the interaction of important proteins with DNA.. For more details, download the article which is free to access for 4 weeks ...
When it comes to losing your motivation, there are several sabatogers out there. Which ones have effected you, and do you know how to combat them?
Kazuo Nakamoto pioneered the use of metal isotopes to elucidate the involvement of metals in low-frequency vibrations in metallic complexes and was among the first to use matrix isolation techniques to prepare and characterize unstable specie. He is the author of Infrared and Raman Spectra of Inorganic and Coordination compounds, Fifth Edition (Wiley). Masamichi Tsuboi studies DNA and RNA structures, drug-DNA interaction, protein conformation, protein-nucleic acid recognition, and virus structure using a variety of physicochemical and biomedical techniques including X-ray diffraction, UV-Visible, IR/Raman , and NMR spectroscopy.. Gary D. Strahan uses physico-chemical techniques to understand biological systems relevant to pharmaceutical discovery and agricultural and natural product analyses. His work has emphasized spectroscopic methods, NMR, and computational modeling to determine the structures and properties of multistranded DNA, drug-DNA complexes, carbohydrates, and other biomolecules, as ...
Bhakta, Sanjib and Guzman, Juan David and Evangelopoulos, Dimitrios and Munshi, Tulika and Mcmahon, Eleanor (2016) DNA sequence-selective C8-linked pyrrolobenzodiazepine(PBD)-heterocyclic polyamide conjugates show anti-tubercular specific activities. The Journal of Antibiotics 69 , pp. 843-849. ISSN 0021-8820. Brucoli, F. and Guzman, Juan David and Basher, M.A. and Evangelopoulos, Dimitrios and Mcmahon, Eleanor and Munshi, Tulika and McHugh, T.D. and Fox, K.R. and Bhakta, Sanjib (2016) DNA sequence-selective C8-linked pyrrolobenzodiazepine-heterocyclic polyamide conjugates show anti-tubercular-specific activities. The Journal of Antibiotics 69 , pp. 843-849. ISSN 0021-8820. Guzman, Juan D. and Pesnot, T. and Barrera, D.A. and Davies, H.M. and McMahon, E. and Evangelopoulos, Dimitrios and Mortazavi, Parisa Nakhostin and Munshi, Tulika and Maitra, Arundhati and Lamming, E.D. and Angell, R. and Gershater, M.C. and Redmond, J.M. and Needham, D. and Ward, J.M. and Cuca, L.E. and Hailes, H.C. and ...
Short-range Si-Al order in leucite and analcime: Determination of the configurational entropy from 27Al and variable-temperature 29Si NMR spectroscopy of leucite, its Cs- and Rb-exchanged derivatives, and ...
Functional Modules Determined for Zfhx3Sci/+ SCN Expression(A) The consensus AT motif derived from published AT sequences of genes regulated by Zfhx3 (see Exper
Heterocyclic compound - Comparison with carbocyclic compounds: The molecules of organic chemical compounds are built up from a framework or backbone of carbon atoms to which are attached hydrogen (H), oxygen, or other heteroatoms. Carbon atoms have the unique property of being able to link with one another to form chains of atoms. When the ends of the chains are joined together into a ring, cyclic compounds result; such substances often are referred to as carbocyclic or alicyclic compounds. Substitution of one or more of the ring carbon atoms in the molecules of a carbocyclic compound with a heteroatom gives a heterocyclic compound. A typical carbocyclic compound
In biochemistry and pharmacology, a ligand is a substance that forms a complex with a biomolecule to serve a biological purpose. In protein-ligand binding, the ligand is usually a molecule which produces a signal by binding to a site on a target protein. The binding typically results in a change of conformational isomerism (conformation) of the target protein. In DNA-ligand binding studies, the ligand can be a small molecule, ion,[1] or protein[2] which binds to the DNA double helix. The relationship between ligand and binding partner is a function of charge, hydrophobicity, and molecular structure. The instance of binding occurs over an infinitesimal range of time and space, so the rate constant is usually a very small number. Binding occurs by intermolecular forces, such as ionic bonds, hydrogen bonds and Van der Waals forces. The association of docking is actually reversible through dissociation. Measurably irreversible covalent bonding between a ligand and target molecule is atypical in ...
A class of binding ligands for cocaine receptors and otherreceptors in the brain. Specifically, a novel family of compoundsshows high binding specificity and activity, and, in a radiolabeledform, can be used to bind to these receptors, for biochemicalassays and imaging techniques. Such imaging is useful fordetermining effective doses of new drug candidates in humanpopulations.
Lib=9[Plasmodium_falciparum,,,,,] Length=346 Length = 346 Plus Strand HSPs: Score = 184 (27.6 bits), Expect = 0.028, P = 0.028 Identities = 130/206 (63%), Positives = 130/206 (63%), Strand = Plus / Plus Query: 22 TTACA-ATATTTTGTGAATAAACTTTTTGGTGATTTGCCATCAAGTTTTAATTATATGAT 80 TTA A AT TTTTGTGA T A TT TG T TG A AAG AATT T GA Sbjct: 4 TTATACATCTTTTGTGATTTAGGTTAAAA-TG-TATGTTA--AAGAAGAAATTGTG-GAG 58 Query: 81 -AGGCAAAACGATA-GAG-T-ATGA-TATAAAGATTAGTTATTATGAAATATATGAAGGG 135 A G AAAAC AT GA T AT A TA AAAGA AG A AT AAATATATGAA GG Sbjct: 59 GAAGAAAAACTATCTGATATTATCAATAAAAAGAA-AGAAAACATAAAATATATGAAAGG 117 Query: 136 CATGNTAAAAATGGTGAAGAGGTTTGTGT-ATTT-ATATATGAGAAGAA--TAATAAAGA 191 ATG AAAA T TGAA A TT G ATTT A A TGA A GAA TA T A GA Sbjct: 118 AATG--AAAATTCCTGAAAATATTCTAGCCATTTCAAACTTGA-AGGAAGTTATTGATGA 174 Query: 192 AACGAGTTTTGTAAAANGATATATAAA-ACNCCATT 226 C AG TTTGT AA T TAT A AC CCA T Sbjct: 175 TGC-AGATTTGTTAATATTTGTATTACCACACCAAT 209 cbil,dbest,1133595">>cbil,dbest,1133595 AA488925 aa55b10.r1 5 ...
A shaped porous body for filtering and drying gases and liquids is formed of a solid adsorptive drying agent or adsorbent and about between 10 and 0.3 percent of a binding agent relative to the weight of said drying agent or adsorbent, the said binding agent consisting essentially of the reaction product between a di- or polyisocyanate and a polyester or polyetherpolyol which reaction product is hardened to a polyurethane.
Sigma-Aldrich offers abstracts and full-text articles by [Yang Liu, Catharine J Collar, Arvind Kumar, Chad E Stephens, David W Boykin, W David Wilson].
Groove is Arizonas best lingerie and adult gift stores. Shop Groove in-store or online for beautiful lingerie, sex toys, bachelorette gifts, and other romantic