Digestive Enzyme - Multi-Enzyme Complex - 75mg - Support Digestive Hea
- HealthyHey Nutrition
This is a Vegetarian product. DIGESTIVE BLEND : HealthyHey Multi-Enzyme Complex is made of Amylase, Protease, Lipase, Cellulase and Lactase, that supports digestive health. 100% VEGAN : HealthyHey Multi-Enzyme Complex is made from plant derived enzymes, mean it is not an animal derived enzyme. 60 DAY MONEY BACK : Healt
Experts and Doctors on multienzyme complexes in Brazil
Publications, Genomes and Genes, Species, Scientific Experts, Research Topics, Locale about Experts and Doctors on multienzyme complexes in Brazil
Post-translational modification in the archaea: structural characterization of multi-enzyme complex lipoylation - Equipment ...
Powered by Pure, Scopus & Elsevier Fingerprint Engine™ © 2020 Elsevier B.V. We use cookies to help provide and enhance our service and tailor content. By continuing you agree to the use of cookies. Log in to Pure. ...
Differential trafficking of soluble and integral membrane secretory granule-associated proteins | JCB
The posttranslational processing enzyme peptidylglycine alpha-amidating monooxygenase (PAM) occurs naturally in integral membrane and soluble forms. With the goal of understanding the targeting of these proteins to secretory granules, we have compared the maturation, processing, secretion, and storage of PAM proteins in stably transfected AtT-20 cells. Integral membrane and soluble PAM proteins exit the ER and reach the Golgi apparatus with similar kinetics. Biosynthetic labeling experiments demonstrated that soluble PAM proteins were endoproteolytically processed to a greater extent than integral membrane PAM; this processing occurred in the regulated secretory pathway and was blocked by incubation of cells at 20 degrees C. 16 h after a biosynthetic pulse, a larger proportion of soluble PAM proteins remained cell-associated compared with integral membrane PAM, suggesting that soluble PAM proteins were more efficiently targeted to storage granules. The nonstimulated secretion of soluble PAM ...
Knockdown of AMP-Activated Protein Kinase Alpha 1 and Alpha 2 Catalyti by Larissa Tangeman, Christopher N. Wyatt et al.
AMP-activated protein kinase (AMPK) is a master metabolic regulator that responds to the AMP: ATP ratio and promotes ATP production when the cell is low on energy. There are two isoforms of the catalytic alpha subunit, AMPKα1 and AMPKα2. Here, we describe the production of a small interfering RNA (siRNA) and a short hairpin RNA (shRNA) targeting both catalytic isoforms of AMPK in human, mouse, and rat. Multiple loop sequences were tested to generate the most effective shRNA. The shRNA causes significant knockdown of both isoforms of AMPKα in mouse and human cells. The shRNA effectively knocked down AMPKα1 and AMPKα2 protein levels, compared to a five basepair mismatch-control shRNA in mouse fibroblast NIH3T3 cells and significantly knocked down AMPKα1 (63%) and AMPKα2 (72%) levels compared to control in human embryonic kidney cells, HEK293s. The shRNA also causes a significant reduction in AMPK activity, measured as phosphorylation of acetyl-CoA carboxylase (ACC), a direct phosphorylation target.
Plus it
C.1 Purification and Proteomic Mapping of Murine Liver 19S Proteasome Complexes D. Wang, M.-C. Koag, C. Zong, X. Li, A. Gomes, and P. Ping Department of Physiology and Medicine, Division of Cardiology, University of California, Los Angeles, CA Proteasome complexes play an indispensable role in maintaining cell homeostasis. 19S proteasome complexes, also known as the regulatory particles, are critical components of the 26S proteasome system by governing substrates entry and tuning the catalytic activities of the 20S proteasomes. Multiple studies on proteasome functions reported accumulatively a total of 22 mammalian 19S subunits forming two sub-complexes, the base and the lid. Unfortunately, a comprehensive proteomic blueprint of mammalian 19S complexes remains scarce; which has made it difficult to advance our understanding of the dynamics of proteasome function and substrate specificity. A key limitation is the technology challenges encountered in order to obtain purified 19S proteasome ...
Recombinant Human PAM protein (ab116776) References
References for Abcams Recombinant Human PAM protein (ab116776). Please let us know if you have used this product in your publication
Assay Solution. rat PSMA2 ELISA Kit
Proteasome subunit alpha type-2 is a protein that in humans is encoded by the PSMA2 gene. This protein is one of the 17 essential subunits (alpha subunits 1-7, constitutive beta subunits 1-7, and inducible subunits including beta1i, beta2i, beta5i) that contributes to the complete assembly of 20S proteasome complex ...
Active multienzyme assemblies for long-chain olefinic hydrocarbon biosynthesis - Fingerprint
- [email protected]
Fingerprint Dive into the research topics of Active multienzyme assemblies for long-chain olefinic hydrocarbon biosynthesis. Together they form a unique fingerprint. ...
BIOC 450 | 2013-2014 Programs, Courses and University Regulations - McGill University
Biochemistry : Primary, secondary, tertiary and quaternary structure of enzymes. Active site mapping and site-specific mutagenesis of enzymes. Enzyme kinetics and mechanisms of catalysis. Multienzyme complexes. Terms: Fall 2013 Instructors: Bhushan Nagar, Thomas Martin Schmeing, Matthias Gotte (Fall) ...
Peptidylglycine alpha-Amidating Monooxygenase/PAM Overexpression Lysate (Native) (NBP2-05619): Novus Biologicals
Peptidylglycine alpha-Amidating Monooxygenase/PAM Overexpression Lysate (Native). Tested Reactivity: Hu. Validated: WB. Backed by our 100% Guarantee.
Anti-peptidylglycine alpha-amidating monooxygenase L homeolog Antibody Products | Biocompare
Compare Anti-peptidylglycine alpha-amidating monooxygenase L homeolog Antibody Products from leading suppliers on Biocompare. View specifications, prices, citations, reviews, and more.
Proteasome activator complex subunit 3
The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. The immunoproteasome contains an alternate regulator, referred to as the 11S regulator or PA28, that replaces the 19S regulator. Three subunits (alpha, beta and gamma) of the 11S regulator have been identified. This gene encodes the gamma subunit of the 11S regulator. Six ...
AMP-activated protein kinase and hepatic genes involved in glucose metabolism | Biochemical Society Transactions
Mammalian AMP-activated protein kinase presents strong structural and functional similarities with the yeast sucrose non-fermenting 1 (Snf1) kinase involved in the derepression of glucose-repressed genes. It is now clearly established that AMP-activated protein kinase in the liver decreases glycolytic/lipogenic gene expression as well as genes involved in hepatic glucose production. This is achieved through a decreased transcriptional efficiency of transcription factors such as sterol-regulatory-element-binding protein-1c, carbohydrate-response-element-binding protein, hepatocyte nuclear factor 4α or forkhead-related protein. Clearly, the long-term consequences of AMP-activated protein kinase activation have to be taken into account if activators of this enzyme are to be designed as anti-diabetic drugs.. ...
LKB1 is the upstream kinase in the AMP-activated protein kinase cascade
Inactivating mutations in the protein kinase LKB1 lead to a dominantly inherited cancer in humans termed Peutz-Jeghers syndrome. The role of LKB1 is unclear, and only one target for LKB1 has been identified in vivo [3]. AMP-activated protein kinase (AMPK) is the downstream component of a protein kin …
PSME3 - Wikipedia
Proteasome activator complex subunit 3 is a protein that in humans is encoded by the PSME3 gene. The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. The immunoproteasome contains an alternate regulator, referred to as the 11S regulator or PA28, that replaces the 19S regulator. Three subunits (alpha, beta and gamma) of the 11S ...
26S proteasome non-ATPase regulatory subunit 5
The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. This gene encodes a non-ATPase subunit of the 19S regulator base that functions as a chaperone protein during 26S proteasome assembly. [provided by RefSeq, Jul 2012 ...
PSMC5 - Gemini Genomics
Description: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the ATPase subunits, a member of the triple-A family of ATPases which have a chaperone-like activity. In addition to participation in proteasome functions, this subunit may participate in transcriptional regulation since it has been ...
Psmb11 - Proteasome subunit beta type-11 precursor - Mus musculus (Mouse) - Psmb11 gene & protein
The proteasome is a multicatalytic proteinase complex which is characterized by its ability to cleave peptides with Arg, Phe, Tyr, Leu, and Glu adjacent to the leaving group at neutral or slightly basic pH. The proteasome has an ATP-dependent proteolytic activity. Incorporated instead of PSMB5 or PSMB8, this unit reduces the chymotrypsin-like activity of the proteasome. Plays a pivotal role in development of CD8-positive T-cells.
PSMA2 proteasome 20S subunit alpha 2 [Homo sapiens (human)] - Gene - NCBI
The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the peptidase T1A family, that is a 20S core alpha subunit. [provided by RefSeq, Jul 2008 ...
PAD1 - Proteasome subunit alpha type-7-A - Arabidopsis thaliana (Mouse-ear cress) - PAD1 gene & protein
The proteasome is a multicatalytic proteinase complex which is characterized by its ability to cleave peptides with Arg, Phe, Tyr, Leu, and Glu adjacent to the leaving group at neutral or slightly basic pH. The proteasome has an ATP-dependent proteolytic activity. Mediates the association of the SCF(TIR1) E3 ubiquitin ligase complex with the proteasome.
Plus it
Cell growth and viability are dependent on the function of the multicatalytic proteinase complex (proteasome), a multisubunit particle that affects progression through the mitotic cycle by degradation of cyclins. Exposure of rodent fibroblasts and human lymphoblasts in culture to benzyloxycarbonyl-leucyl-leucyl-phenylalaninal (Z-LLF-CHO), a cell-permeable peptidyl aldehyde inhibitor of the chymotrypsin-like activity of the proteasome, resulted in the induction of apoptosis in a rapid, dose-dependent fashion. Fibroblasts transformed with ras and myc, lymphoblasts transformed by c-myc alone, and a Burkitts lymphoma (BL) cell line that overexpresses c-Myc were up to 40-fold more susceptible to apoptosis than were either primary rodent fibroblasts or immortalized nontransformed human lymphoblasts, respectively. To determine whether such preferential apoptosis could impact upon tumor growth in vivo, toxicological studies were performed in mice with severe combined immunodeficiency and showed that ...
PSMD14 - Wikipedia
26S proteasome non-ATPase regulatory subunit 14, also known as 26S proteasome non-ATPase subunit Rpn11, is an enzyme that in humans is encoded by the PSMD14 gene. This protein is one of the 19 essential subunits of a complete assembled 19S proteasome complex. Nine subunits Rpn3, Rpn5, Rpn6, Rpn7, Rpn8, Rpn9, Rpn11, SEM1(Yeast analogue for human protein DSS1), and Rpn12 form the lid sub complex of 19S regulatory particle for proteasome complex. The gene PSMD14 encodes one of 26S proteasome non-ATPase subunit. The human gene PSMD14 has 12 Exons and locates at chromosome band 2q24.2. The human protein 26S proteasome non-ATPase regulatory subunit 14 is 34.6 kDa in size and composed of 310 amino acids. The calculated theoretical pI of this protein is 6.06. 26S proteasome complex is usually consisted of a 20S core particle (CP, or 20S proteasome) and one or two 19S regulatory particles (RP, or 19S proteasome) on either one side or both side of the barrel-shaped 20S. The CP and RPs pertain distinct ...
PSMA3 antibodies | Antibodypedia
The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the peptidase T1A family, that is a 20S core alpha subunit. Two alternative transcripts encoding different isoforms have been identified. [provided by RefSeq, Jul 2008] ...
Search Results | Biochemical Journal | Portland Press
Proteasomes can exist in several different molecular forms in mammalian cells. The core 20S proteasome, containing the proteolytic sites, binds regulatory complexes at the ends of its cylindrical structure. Together with two 19S ATPase regulatory complexes it forms the 26S proteasome, which is involved in ubiquitin-dependent proteolysis. The 20S proteasome can also bind 11S regulatory complexes (REG, PA28) which play a role in antigen processing, as do the three variable γ-interferon-inducible catalytic β-subunits (e.g. LMP7). In the present study, we have investigated the subcellular distribution of the different forms of proteasomes using subunit specific antibodies. Both 20S proteasomes and their 19S regulatory complexes are found in nuclear, cytosolic and microsomal preparations isolated from rat liver. LMP7 was enriched approximately two-fold compared with core α-type proteasome subunits in the microsomal preparations. 20S proteasomes were more abundant than 26S proteasomes, both in ...
Solyc11g069150.1.1 protein (Solanum lycopersicum) - STRING network view
Proteasome subunit beta type ; The proteasome is a multicatalytic proteinase complex which is characterized by its ability to cleave peptides with Arg, Phe, Tyr, Leu, and Glu adjacent to the leaving group at neutral or slightly basic pH. The proteasome has an ATP-dependent proteolytic activity (245 aa ...
Strukturelle und biochemische Analyse der 20S Proteasom-Subtypen aus humanen Zellen
The Ubiquitin-proteasome system is responsible for the regulated protein degradation in eucaryotic cells. The 20S proteasome is as a multicatalytic protease the central complex of these system. This study has shown that it is possible to separate 20S proteasome subtypes from HeLa cells by chromatography. 20s proteasome subtypes differ in structure and proteolytic activity. The subtype-pattern and the activity are significantly changed after an induction of the cells with gamma-Interferon (gamma-IFN) under formation of immuno proteasomes. After gamma-IFN induction mainly mixed complexes have been formed with both constitutive and immuno subunits. Further it has been shown that in cell compartements cytoplasm, microsomes and nucleus of HeLaS3 cells different 20S proteasome subtypes are located. Among other things glycosylation of some subunits is responsible for that phenomenon. With regard to new strategies in diagnostic and therapy of human diseases the exactly knowledge of structure and ...
Base-CP proteasome can serve as a platform for stepwise lid formation<...
TY - JOUR. T1 - Base-CP proteasome can serve as a platform for stepwise lid formation. AU - Yu,Zanlin. AU - Livnat-Levanon,Nurit. AU - Kleifeld,Oded. AU - Mansour,Wissam. AU - Nakasone,Mark A.. AU - Castaneda,Carlos A.. AU - Dixon,Emma K.. AU - Fushman,David. AU - Reis,Noa. AU - Pick,Elah. AU - Glickman,Michael H.. PY - 2015. Y1 - 2015. N2 - 26S proteasome, a major regulatory protease in eukaryotes, consists of a 20S proteolytic core particle (CP) capped by a 19S regulatory particle (RP). The 19S RP is divisible into base and lid sub-complexes. Even within the lid, subunits have been demarcated into two modules: module 1 (Rpn5, Rpn6, Rpn8, Rpn9 and Rpn11), which interacts with both CP and base sub-complexes and module 2 (Rpn3, Rpn7, Rpn12 and Rpn15) that is attached mainly to module 1. We now show that suppression of RPN11 expression halted lid assembly yet enabled the base and 20S CP to pre-assemble and form a base-CP. A key role for Regulatory particle non-ATPase 11 (Rpn11) in bridging lid ...
peptidylglycine monooxygenase
Summary Report | CureHunter
peptidylglycine monooxygenase: forms alpha-amide from C-terminal glycine precursor of peptide hormones by oxidation of hydrogen & spontaneous hydrolysis of resulting imino linkage; posseses both an alpha-hydroxylation domain (PHM) and an alpha-amidation domain (PAL); PAM refers to the bifunctional enzyme; may be the same as bovine Somatotropin; RefSeq NM_013626 (mouse), NM_013000 (rat), NM_138822 (human)
Chains & Extension Chain - Shop Cheap Chains & Extension Chain from China Chains & Extension Chain Suppliers at St.kunkka...
Shopping for Cheap Chains & Extension Chain at St.kunkka Official Store and more from on Aliexpress.com ,the Leading Trading Marketplace from China - 5m/lot Gold 1.3mm 1.6mm 2.0mm Link Chain Plated Brass Materials Bulk Necklace Chains For Jewelry Making Findings Supplies,5 Meter Copper Twisted Chains Beaded Cable Link Clip Beads Chain for DIY Anklet Necklaces Bracelet Jewelry Making Supplies
AMPK alpha 1 + AMPK alpha 2抗体[34.2]|Anti-AMPK alpha 1 + AMPK alpha 2抗体[34.2]
AMPK alpha 1 + AMPK alpha 2小鼠单克隆抗体[34.2](ab80039)可与小鼠, 大鼠, 人, 果蝇样本反应并经WB, IP, ELISA, IHC, ICC/IF实验严格验证,被4篇文献引用并得到5个独立的用户反馈。
GNE Myopathy and Cell Apoptosis: A Comparative Mutation Analysis | SpringerLink
In a number of genetic disorders such as GNE myopathy, it is not clear how mutations in target genes result in disease phenotype. GNE myopathy is a progres
PA700 proteasome activator
Summary Report | CureHunter
PA700 proteasome activator: high MW, ATP-dependent activator of 20 S proteasome; MW 700 kDa; composed of 16 peptides ranging in MW from 20-100 kDa
Sabinsas Multi-Enzyme Complex DigeZyme® Demonstrated Efficacy in Management of Dyspeptic Symptoms with Functional Dyspepsia:...
A randomized, double-blind, placebo-controlled study published in the peer reviewed Journal of Medicinal Foods* provided clinical evidence supporting the
Tetrn 00150 : CDS information --- DoBISCUIT
polyketide synthase [type I polyketide synthase] ATGGCCGAGGAAGACAAGCTGCGCGACTACCTCAAACGGCTCACCGTCGACCTGCGCCGG ACCACGCGCAGGCTGCGGGAGGTGGAGGAGCAGCGGCGGGAGCCGGTCGCGGTCGTCGGC ATGGCCTGCCGCCTCCCCGGCGGCGTACGGAGCCCCGAGGAACTGTGGGAGCTGCTGCGG GACGGCCGGGACGCCATCTCCGCCATGCCCGCGAACCGGGACTGGCACCTGGACGACCAC TTCGACCCGGACCTCGGCCGGCCCGGCACGTCGTACGTGCGCGAGGGCGGCTTCCTCGAC GACGTCGCCGGCTTCGACGCGGCGTTCTTCGGCATCTCCCCGCGCGAGGCGCTGGCGATG GACCCGCAGCAGCGGCTCCTGCTGGAGCTGGCATGGGAGAGCGTGGAGCGGGCCGGGATC GACGCGCACGCGCTGCGCGGCTCGCGTACCGGCGTGTTCGTGGGCAGCAACCCCACCGAG TACGGCGGTCTGCTCGGTGATGCCGCCGCGCAGGTCGGCGGGCACCTGCTCACCGGCACG GTCCTCAGCGTGCTGTCCGGCCGGCTCGCGTACACCCTCGGTCTCGAGGGCCCGGCGGTG AGCGTGGACACCGCGTGCTCCACGTCGCTGACGGCGGTGCACCTCGCGGTGCAGGCGCTG CGCCGCGGCGAGTGCACGATGGCGCTGGCCGGCGGGGCGACGGTGTTCTCCACGGTCGGT CCGTTCACCGAGATGAGCCGGCAGCGGGTGCTGGCCGCCGACGGGCGCTGCAAGGCGTTC GGCGCGGGCGCCGACGGCATGGGCATGTCCGAGGGCGCGGGCGTCGTGCTGCTGGAGCCG CTCAGCGCGGCCCGCCGCAACGGCCACCGCGTGCTCGCCGTGATCCGCGGCAGCGCCGTC ...
Halsto 00060 : CDS information --- DoBISCUIT
polyketide synthase [type I polyketide synthase] ATGGTTAACGACGAGACACTTGTCAAGTACCTGCGGCAGGTTACTGCCGACCTTCGGGAG AGTCGCCGCCAGGTGACGGAGATGGCGGAGCGGTCGGCGGAGCCACTGGCGATCGTCGGA ATGGCCTGCCGTCTCCCCGGAGGAGTGAGTTCGCCGGACGAGCTGTGGCGGCTGGCCCTC GAAGGCCGGGAAGGGATATCCGGCTTCCCCACCAACCGTGGCTGGGACGTGGACGGGCTC TACGACCCGGACCCGGACCAGCAGGGCACCTCGTACACCTGCGAGGGCGGCTTCCTCCAC GAGGCCGGTGACTTCGACCCCGCCTTCTTCGGGATCTCCCCGCGCGAGGCCCTGGCCATG GACCCGCAGCAGCGGCTCCTCCTGGAGACCTCCTGGGAAGCGGTGGAAAGCGCGGGCATC GACCCCCAGACCCTCAAGGGCGCCGGCGTCGGTGTGTTCACCGGCATGAGCTACCACGAC TACATATCCCAGATCGACACCGTGCCCGACGGCCTGGAGGGCTATCTCGGCACCGGTAAC GCGGGCAGTGTGGTCTCCGGTCGGATCGCCTATGTGATGGGACTCGAAGGCCCGGCGGTG ACCATCGACACGGCGTGTTCGTCGTCGCTGGTCGCAATGCATCTGGCGGGTCAGGCCCTG CGCCAGGGCGAGTGCTCGATGGCCCTCGCCGGTGGCGTGACCGTGATGGCGACGGCGGCC ACGTTCGTGGACTTCAGCCGTCAGCGCGGACTGGCGCCCGACGGGCGTTGCAAGTCCTTC GCCGCCGCTGCGGACGGCACCGGCTGGGCCGAGGGCGCCGGAATGCTCCTCCTGGAGCGA CTCTCGGACGCCCAGCGGCTCGGCCACCCCATCCTGGCCGTGATTCGGTCCAGCGCCGTC ...
The testis-specific proteasome subunit Prosα6T of D. melanogaster is required for individualization and nuclear maturation...
Dive into the research topics of The testis-specific proteasome subunit Prosα6T of D. melanogaster is required for individualization and nuclear maturation during spermatogenesis. Together they form a unique fingerprint. ...
SMART: AMPKBI domain annotation
The mammalian 5-AMP-activated protein kinase (AMPK) is a heterotrimericprotein consisting of alpha-, beta-, and gamma-subunits. The alpha-subunitis the catalytic subunit and is related to the yeast Snf1p kinase. In thisstudy, we report the cloning of full-length cDNAs for the non-catalyticbeta- and gamma-subunits. The rat liver AMPK beta-subunit clone predicts aprotein of 30,464 Da, which is related to the Sip1p, Sip2p, and Gal83psubfamily of yeast proteins that interact with Snf1p and are involved inglucose regulation of gene expression. The AMPK beta-subunit, whenexpressed in bacteria and in mammalian cells, migrates anomalously on SDSgels at an apparent molecular mass of 40 kDa. Rat and human liver AMPKgamma-subunit clones predict a protein of 37,577 Da (AMPK-gamma1), whichis related to the yeast Snf4p protein that copurifies with Snf1p and to alarger family of other human AMPK gamma-isoforms. The mRNAs for both AMPK-beta and AMPK-gamma1 are widely expressed in rat tissues, consistent witha ...
Evidence for a role of immunoproteasomes in regulating cardiac muscle mass in diabetic mice - Fingerprint - Johns Hopkins...
Fingerprint Dive into the research topics of Evidence for a role of immunoproteasomes in regulating cardiac muscle mass in diabetic mice. Together they form a unique fingerprint. ...
Gentaur Molecular :QED \ AMPK alpha 2 \ 13010
Gentaur molecular products has all kinds of products like :search , QED \ AMPK alpha 2 \ 13010 for more molecular products just contact us
AMPK alpha 2抗体|Abcam中国|Anti-AMPK alpha 2抗体
AMPK alpha 2山羊多克隆抗体(ab105028)可与小鼠, 大鼠, 人样本反应并经WB, sELISA实验严格验证。所有产品均提供质保服务,中国75%以上现货。
Switch to Europe/Worldwide website
The 26S proteasome is a multicatalytic proteise complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator.The…
DRP1 inhibition induces AMPK activity in BTICsa. Lysate | Open-i
DRP1 inhibition induces AMPK activity in BTICsa. Lysates of 387 and 3565 BTICs expressing NT control shRNA, shDrp1#1, or shDrp1#2 were immunoblotted with the in
Human 5-AMP-activated protein kinase catalytic subunit alpha-2 (PRKAA2) ELISA Kit - ELISA Genie
Human 5-AMP-activated protein kinase catalytic subunit alpha-2 (PRKAA2) ELISA Kit can measure Human 5-AMP-activated protein kinase catalytic subunit alpha-2 in serum, blood, plasma, cell culture supernatant and other related supernatants and tissues.
Sequence Similarity
- 1K8M: Solution Structure of the Lipoic Acid-Bearing Domain of the E2 component of Human,...
1K8M: Solution structure and dynamics of the lipoic acid-bearing domain of human mitochondrial branched-chain alpha-keto acid dehydrogenase complex
Autoantibodies against the multicatalytic proteinase in patients with systemic lupus erythematosus. | JEM
Sera from patients with systemic lupus erythematosus contain specific autoantibodies directed against different polypeptide components of the multicatalytic proteinase (also known as proteasome or prosome). These human autoantibodies, in contrast to polyclonal antibodies obtained in rabbits against the purified enzyme, recognize highly conserved epitopes of the multicatalytic proteinase polypeptides from yeast to human. ...
Prediction of substrate-specific pockets in cyclosporin synthetase<...
TY - JOUR. T1 - Prediction of substrate-specific pockets in cyclosporin synthetase. AU - Husi, Holger. AU - Schörgendorfer, Kurt. AU - Stempfer, Günter. AU - Taylor, Paul. AU - Walkinshaw, Malcolm D.. PY - 1997/9/1. Y1 - 1997/9/1. N2 - Amino acid sequence comparisons between domains of cyclosporin synthetase have been used to identify regions of the sequence which are responsible for the recognition and binding of the individual amino acids. Using a limited set of selection rules it was possible to identify three amino acid positions in the subdomain sequences which are responsible for amino acid specificity. Homology with the firefly luciferase protein shows that these three key residues are close to each other and line the surface of a putative specific substrate binding pocket located on the amino acyl-adenylation subdomain. These results allow us to predict a large number of cyclosporin synthetase mutants which could be used to synthesise alternative cyclosporin-like peptides.. AB - Amino ...
The C terminus of Rpt3, an ATPase subunit of PA700 (19 S) regulatory complex, is essential for 26 S proteasome assembly but not...
TY - JOUR. T1 - The C terminus of Rpt3, an ATPase subunit of PA700 (19 S) regulatory complex, is essential for 26 S proteasome assembly but not for activation. AU - Kumar, Brajesh. AU - Kim, Young Chan. AU - DeMartino, George N.. N1 - Copyright: Copyright 2011 Elsevier B.V., All rights reserved.. PY - 2010/12/10. Y1 - 2010/12/10. N2 - PA700, the 19 S regulatory subcomplex of the 26 S proteasome, contains a heterohexameric ring of AAA subunits (Rpt1 to -6) that forms the binding interface with a heteroheptameric ring of α subunits (α1 to -7) of the 20 S proteasome. Binding of these subcomplexes is mediated by interactions of C termini of certain Rpt subunits with cognate binding sites on the 20 S proteasome. Binding of two Rpt subunits (Rpt2 and Rpt5) depends on their last three residues, which share an HbYX motif (where Hb is a hydrophobic amino acid) and open substrate access gates in the center of the α ring. The relative roles of other Rpt subunits for proteasome binding and activation ...
26S Proteasome regulatory subunit p55 - NBP1-56980 | acris-antibodies.com
26S Proteasome regulatory subunit p55, 50 µg. The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator.
Functional and biochemical characterization of the 20S proteasome in a yeast temperature-sensitive mutant, rpt6-1 | BMC...
Rpt6-1 is a thermosensitive yeast mutant with a deletion of a gene encoding a regulatory subunit of the 26S proteasome, RPT6, which is able to grow at 25°C but not at 37°C. In this study, peptidase activities, activation profiles, and the subunit composition of the 20S proteasome purified from the rpt6-1 mutant was characterized. The 20S proteasome purified from rpt6-1 exhibited low levels of peptidase activities in the absence of activators, but nearly same activated activities in the presence of activators, suggesting a gating defect in the proteasome channel. Detailed analyses of the composition of the 20S proteasome through separation of all subunits by two-dimensional gel electrophoresis followed by identification of each subunit using MALDI-TOF-MS revealed that two subunits, α1 and α7, differed from those of wild-type cells in both electrophoretic mobility and pI values. The changes in these two α-subunits were apparent at the permissive temperature, but disappeared during stress response at
Phosphorylation of C/EBP Homologous Protein (CHOP) by the AMP-Activated Protein Kinase Alpha 1 in Macrophages Promotes CHOP...
Rationale: Elevated levels of C/EBP homologous protein (CHOP), a member of the C/EBP transcription factor family, in advanced atherosclerotic plaques is reported to be associated with atherosclerotic plaque rupture in humans. However, the molecular mechanism by which CHOP accumulation occurs is poorly defined. Objective: The aim of this study was to investigate if (1) macrophage AMP-activated kinase (AMPK) regulates cellular CHOP accumulation and (2) whole-body Ampk deletion leads to neointimal disruption. Methods and Results: In isolated or cultured macrophages, Ampkα1 deletion markedly increased apoptosis and CHOP, whereas pharmacological activation of AMPK dramatically reduced CHOP protein level via promoting CHOP degradation by proteasome. In addition, co-transfection of Chop-specific siRNA, but not control siRNA, markedly reduced apoptosis in macrophages transfected with Ampkα1-specific siRNA. Mechanistically, AMPKα1 was found to co-immunoprecipitate with CHOP and phosphorylate CHOP at ...
AMP-activated protein kinase: ancient energy gauge provides clues to modern understanding of metabolism
The AMP-activated protein kinase (AMPK) is an evolutionarily conserved sensor of cellular energy status, and recent data demonstrate that it also plays a critical role in systemic energy balance. AMPK integrates nutritional and hormonal signals in peripheral tissues and the hypothalamus. It mediates …
KAKEN - Research Projects | The Function of B Cytochrome in Complex II (Succinate-Ubiquinone Oxidoreductase) (KAKENHI-PROJECT...
Principal Investigator:KITA Kiyoshi, Project Period (FY):1989 - 1990, Research Category:Grant-in-Aid for General Scientific Research (C), Research Field:General medical chemistry
Age-related decrease in proteasome expression contributes to defective nuclear factor-κB activation during hepatic ischemia...
Huber, N., Sakai, N., Eismann, T., Shin, T., Kuboki, S., Blanchard, J., Schuster, R., Edwards, M. J., Wong, H. R. and Lentsch, A. B. (2009), Age-related decrease in proteasome expression contributes to defective nuclear factor-κB activation during hepatic ischemia/reperfusion. Hepatology, 49: 1718-1728. doi: 10.1002/hep.22840 ...
A 769662 | AMP-activated protein kinase (AMPK) activator | Hello Bio
Buy A 769662 - an affordable, high quality AMP-activated protein kinase (AMPK) activator from Hello Bio, a trusted supplier for life science researchers worldwide
RCSB PDB - 1FFU: CARBON MONOXIDE DEHYDROGENASE FROM HYDROGENOPHAGA PSEUDOFLAVA WHICH LACKS THE MO-PYRANOPTERIN MOIETY OF THE...
As a member of the wwPDB, the RCSB PDB curates and annotates PDB data according to agreed upon standards. The RCSB PDB also provides a variety of tools and resources. Users can perform simple and advanced searches based on annotations relating to sequence, structure and function. These molecules are visualized, downloaded, and analyzed by users who range from students to specialized scientists.
AMP-activated protein kinase activators can inhibit the growth of prostate cancer cells by multiple mechanisms - Fingerprint ...
Dive into the research topics of AMP-activated protein kinase activators can inhibit the growth of prostate cancer cells by multiple mechanisms. Together they form a unique fingerprint. ...
Research programme: AMP-activated protein kinase stimulants - Connexios/Boehringer Ingelheim - AdisInsight
Connexios Life Sciences and Boehringer Ingelheim are collaborating on the development of AMP-activated protein kinase (AMPK) stimulants for the treatment of
PROSITE
ADOK_MYCTO (P9WID4 ), ADOK_MYCTU (P9WID5 ), FRUK_MYCGE (Q49396 ), FRUK_MYCPN (P75038 ), HEPPK_BORBR (Q7WGU8 ), HLDE_ACICJ (A5FVE7 ), HLDE_ACTP2 (A3MZC0 ), HLDE_ACTPL (Q8GLU7 ), HLDE_ACTSZ (A6VP06 ), HLDE_AERHH (A0KPL4 ), HLDE_AERS4 (A4SIG6 ), HLDE_ALCBS (Q0VM60 ), HLDE_ALISL (B6ELZ7 ), HLDE_ALKEH (Q0A4T7 ), HLDE_ARCB4 (A8EVR4 ), HLDE_AZOVD (C1DGT9 ), HLDE_BLOFL (Q7VQQ6 ), HLDE_BLOPB (Q493X3 ), HLDE_BRASB (A5EN78 ), HLDE_BRASO (A4YYB6 ), HLDE_CAMC1 (A7ZE26 ), HLDE_CAMC5 (A7GZF6 ), HLDE_CAMFF (A0RQR9 ), HLDE_CAMJ8 (A8FMK8 ), HLDE_CAMJD (A7H2L7 ), HLDE_CAMJE (Q6TG09 ), HLDE_CAMJJ (A1W0D6 ), HLDE_CAMJR (Q5HTW1 ), HLDE_CAUCR (Q9A2C5 ), HLDE_CAUSK (B0T663 ), HLDE_CHRSD (Q1R1M6 ), HLDE_CITK8 (A8APT1 ), HLDE_COXBN (A9KDJ2 ), HLDE_COXBR (A9N9S2 ), HLDE_COXBU (Q83B60 ), HLDE_CROS8 (A7MP93 ), HLDE_DESAA (B8FB71 ), HLDE_DICNV (A5EWS4 ), HLDE_ECO24 (A7ZRT3 ), HLDE_ECO27 (B7UIW0 ), HLDE_ECO45 (B7MAC8 ), HLDE_ECO55 (B7LGY7 ), HLDE_ECO57 (Q7AAQ7 ), HLDE_ECO5E (B5YR91 ), HLDE_ECO7I (B7NJR5 ), HLDE_ECO81 (B7N0K1 ...
Prediction Algorithm for proteasomal cleavages
BioResearch is a gateway to internet resources in the basic biological and biomedical sciences, based at the University of Nottingham ( http://bioresearch.ac.uk/browse/mesh/detail/C0026741L0026741.html ...
Protein kinase G positively regulates proteasome-mediated degradation of misfolded proteins - Fingerprint - Augusta...
Dive into the research topics of Protein kinase G positively regulates proteasome-mediated degradation of misfolded proteins. Together they form a unique fingerprint. ...
Tieno[2,3-B]pyridíndiónové aktivátory AMPK a ich terapeutické použitie - 28.12.2010 - E 15669 - Databáza patentov Slovenska
0001 Vynález sa týka zlúčenin, ktoré sú priamymi aktivátormi AMPK (AMPaktivovanej proteínkinázy) a ich použitia pri liečení porúch regulovaných deaktiváciou AMPK. Napríklad zlúčeniny podľa vynálezu sú použiteľné naDoterajší stav techniky a úvod vynálezu0002 AMPK je dobre zavedený ako senzor a regulátor homeostázy bunkovej energie (Hardie D. G. a Hawley S. A., AMP-activated protein kinase the energy charge hypothesis revisited Bioassays, 23, 1112, (2001), Kemp B. E. a kol. AMP-activated protein kinase, super metabolic regulator, Biochem Soc. Transactions, 31. 162 (2003. Alosterická aktivácia tejto kinázy vdaka zvýšeniu množstva AMP vedie k stavom svyčerpaním bunkovej energie. Výsledná fosforylácia serínu/treoninu cieľových enzýmov vedie kadaptácii bunkového metabolizmu na nízkoenergetický stav. Celkový efekt zmien vyvolaných aktiváciou AMPK je inhibícia procesov spotrebovávajúcich ATP a aktivácia metabolických ciest vytvárajúcich ATP, a ...
SDHA QuickView - Correlation Engine
This gene encodes a major catalytic subunit of succinate-ubiquinone oxidoreductase, a complex of the mitochondrial respiratory chain. The complex is composed of four nuclear-encoded subunits and is localized in the mitochondrial inner membrane. Mutations …
20s Proteasome - Pipeline Review, H2 2016
Summary
Global Markets Directs, 20s Proteasome - Pipeline Review, H2 2016, provides in depth analysis on 20s Proteasome targeted pipeline therapeutics.
The report provides comprehensive information on the 20s Proteasome , targeted therapeutics, complete with analysis by indications, stage of development, mechanism of action (MoA), route of administration (RoA) and molecule type. The
MG-115 | 1831 | BioVision, Inc.
MG-115 is a potent, reversible proteasome inhibitor with Ki of 21 nM for 20S proteasome and 35 nM for 26S proteasome. The inhibition of proteasome was through specific inhibition of chymotrypsin-like activity of the proteasome. Also shown to induce apopto
MULTI-ENZYME FORMULA - 100 tabs
Buy MULTI-ENZYME FORMULA - 100 tabs Online.MULTI-ENZYMES FORMULA by Good ´n Natural is a powerful formula of digestive enzymes that are in charge of decomposing proteins, fats and carbohydrates in our body, these nutrients will help you
Proteases/Proteasome
Proteasomes are protein complexes which degrade unneeded or damaged proteins by proteolysis, a chemical reaction that breaks peptide bonds. Enzymes that help such reactions are called proteases. ...
Proteasome beta 1 Research Products: Novus Biologicals
Proteasome beta 1 products available through Novus Biologicals. Browse our Proteasome beta 1 product catalog backed by our Guarantee+.
Ixazomib (MLN2238) | 购买Proteasome 抑制剂 - Selleck
Ixazomib (MLN2238)抑制20S proteasome的糜蛋白酶样蛋白水解(β5)位点,无细胞试验中IC50和Ki分别为3.4 nM和0.93 nM,也抑制胱天蛋白酶样(β1)和胰蛋白酶样(β2)蛋白水解位点,IC50分别为31和3500 nM。Ixazomib (MLN2238)可诱导自噬。Phase 3。
ampk indicaciones y contraindicaciones | eXiire
Contraindicaciones del ampk. adversos, si bien la píldora del día después no presenta particulares indicaciones de uso, ni muchos efectos particulares,.