Shop rRNA 2-O-methyltransferase fibrillarin ELISA Kit, Recombinant Protein and rRNA 2-O-methyltransferase fibrillarin Antibody at MyBioSource. Custom ELISA Kit, Recombinant Protein and Antibody are available.
Shop Flavonoid 4-O-methyltransferase ELISA Kit, Recombinant Protein and Flavonoid 4-O-methyltransferase Antibody at MyBioSource. Custom ELISA Kit, Recombinant Protein and Antibody are available.
Thiopurine S-methyltransferase (TPMT) catalyzes the S-methylation of aromatic and heterocyclic sulfhydryl compounds including thiopurine drugs such as 6-mercaptopurine, 6-thioguanine and azathioprine. TPMT activity exhibits genetic variation and show
The enzyme acts on the hydroxy group in the 4-position of some flavones, flavanones and isoflavones. Kaempferol, apigenin and kaempferol triglucoside are substrates, as
Wheat (Triticum aestivum) O-methyltransferase (TaOMT2) catalyzes the sequential methylation of the flavone,tricetin (5,7,3,4,5-pentahydroxyflavone) to its 3-methyl-(selgin), 3,5-dimethyl-(tricin) and 3,4,5-trimethyl ether derivatives, although tricin is the major product of this reaction. The novelty of TaOMT2 to perform three sequential methylations of tricetin as a substrate, the chemopreventive properties of its major product, tricin, and the compelling interest in the proteins structure-function relationships, prompted us to further investigate this novel protein at the biochemical, molecular and structural levels. A 3-D model of this protein was constructed using the crystal structure of the highly homologous Medicago sativa caffeic acid/5-hydroxyferulic acid O-methyltransferase (MsCOMT) as a template with the aim of proposing a mechanism for multiple methyl transfer reactions in wheat. Homology modeling experiments in which each of the substrates tricetin, selgin and tricin, was ...
We investigated 16S rRNA methyltransferases in 38 blaNDM-1-positive Pseudomonas aeruginosa isolates and found RmtC in 3 isolates, 1 of which also harbored RmtF. The isolates were clonally unrelated; rmtC and rmtF genes were located on a chromosome with the blaNDM-1 gene. Strategies are needed to limit the spread of such isolates ...
In this study, we demonstrated first that QUA2 is required for normal synthesis of HG in Arabidopsis, and second that QUA2 is a predicted type II membrane protein with a lumenal putative MT domain, which, consistent with a role in the synthesis of HG, accumulates in the Golgi apparatus.. qua1 and qua2 mutants have similar phenotypes: both mutants are dwarfed, with reduced cell adhesion, and show a reduced GalA content and very similar FT-IR profiles. QUA1 - also referred to as GAUT8 (Sterling et al., 2006) - is a member of GT family 8. So far, attempts to demonstrate the enzyme activity for QUA1 expressed in a heterologous system have failed. Recently, however, GalAT activity has been observed for a protein of the same family, GAUT1, expressed in human embryonic kidney cells (Sterling et al., 2006). Given the mutant phenotype and the similarity to GAUT1, it is likely that QUA1 also encodes a GalAT. Concerning QUA2, despite several attempts, we have not been able to produce a soluble version of ...
S-Adenosylmethionine (AdoMet) is a commonly used cofactor, second only to ATP in the variety of reactions in which it participates. It is the methyl donor in the majority of methyl transfer reactions, including methylation of DNA, RNA, proteins and small molecules. Almost all structurally characterised methyltransferases share a conserved AdoMet-dependent methyltransferase fold, in which AdoMet is bound in the same orientation. Although potential interactions between the cofactor and methyltransferases have been inferred from crystal structures, there has not been a systematic study of the contributions of each functional group to binding. To explore the binding interaction we synthesised a series of seven analogues of the methyltransferase inhibitor S-adenosylhomocysteine (AdoHcy), each containing a single modification, and tested them for the ability to inhibit methylation by HhaI and HaeIII DNA methyltransferase. Comparison of the Ki values highlights the structural determinants for cofactor ...
Catalysis of the reaction: S-adenosyl-L-methionine + protein L-beta-aspartate = S-adenosyl-L-homocysteine + protein L-beta-aspartate methyl ester.
RNA (guanine-7-)methyltransferase, the enzyme responsible for methylating the 5 cap structure of eukaryotic mRNA, was isolated from extracts of Saccharomyces cerevisiae. The yeast enzyme catalyzed methyl group transfer from S-adenosyl-L-methionine to the guanosine base of capped, unmethylated poly(A). Cap methylation was stimulated by low concentrations of salt and was inhibited by S-adenosyl-L-homocysteine, a presumptive product of the reaction, but not by S-adenosyl-D-homocysteine. The methyltransferase sedimented in a glycerol gradient as a single discrete component of 3.2S. A likely candidate for the gene encoding yeast cap methyltransferase was singled out on phylogenetic grounds. The ABD1 gene, located on yeast chromosome II, encodes a 436-amino-acid (50-kDa) polypeptide that displays regional similarity to the catalytic domain of the vaccinia virus cap methyltransferase. That the ABD1 gene product is indeed RNA (guanine-7-)methyltransferase was established by expressing the ABD1 protein ...
Precisely tuned gene expression is critical for normal cellular functions as well as a variety of normal mammalian developmental processes. Histone methylation...
1N2X: Crystal complexes of a predicted S-adenosylmethionine-dependent methyltransferase reveal a typical AdoMet binding domain and a substrate recognition domain
Efficient translation of mitochondrial-derived transcripts requires proper assembly of the large subunit of the mitochondrial ribosome. Central to the biogenesis of this large subunit is the A-loop of mitochondrial 16S rRNA, which is modified by three rRNA methyltransferases located near mtDNA nucleoids. The protein encoded by this gene methylates G(1370) of 16S rRNA, and this modification is necessary for proper ribosomal large subnit assembly. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015 ...
This gene encodes a member of the non-histone lysine methyltransferases. It interacts with its substrate, Kin17, which is involved in DNA repair and replication and mRNA processing. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016 ...
Identification of yeast tRNA Um(44) 2-O-methyltransferase (Trm44) and demonstration of a Trm44 role in sustaining levels of specific tRNA(Ser) species ...
Multiple genotype tests can be performed on a single specimen after a single extraction. See Multiple Genotype Test List in Special Instructions for a list of tests that can be ordered together.. Submit only 1 of the following specimens:. Specimen Type: Whole blood. Container/Tube: Lavender top (EDTA). Specimen Volume: 3 mL. Collection Instructions:. 1. Invert several times to mix blood.. 2. Send specimen in original tube.. Specimen Stability Information: Ambient (preferred) 9 days/Refrigerated 30 days. Specimen Type: Saliva. Patient Preparation: Patient should not eat, drink smoke, or chew gum 30 minutes prior to collection.. Supplies: Saliva Swab Collection Kit (T786). Specimen Volume: One swab. Collection Instructions: Collect and send specimen per kit instructions.. Specimen Stability Information: Ambient 30 days. Specimen Type: DNA. Container/Tube: 2 mL screw top tube. Specimen Volume: 100 mcL. Collection Instructions:. 1. The preferred volume is 100 mcL at a concentration of 50 ...
Methylation of MP by TPMT is a critical step in thiopurine metabolism. It was first noted in the 1980s that differences in TPMT activity help account for the variability in tolerance to thiopurines. Rare and common genetic polymorphisms influence enzyme function resulting in a trimodal population distribution of activity. In Caucasians, complete TPMT deficiency occurs in 1 in 300 individuals. Carriers of a deficiency-associated allele (heterozygotes) have around 50% enzyme activity and occur at an approximate frequency of 1 in 10 of the population.10 The majority of cases of TPMT deficiency (∼95%) are associated with three alleles, TPMT*2, TPMT*3A and TPMT*3C.11 The frequency of these variants depends on ethnicity with TPMT*3A being more common in Caucasian populations.12 Individuals with complete TPMT deficiency who receive standard doses of AZA or MP are highly likely to develop severe and potentially fatal myelosuppression. There is a small case series of patients with IBD treated with ...
hypothetical protein [putative methyltransferase] GTGAACCAGCCCACCCTGACCTCCGAAGCCCAGCAGCCGCCCGGCCCGCCGGGGCAGTTG GACATGTCCGCGCTGATGGCCTTCATGCAGCGTTTCGTCGGCGACGTGTCGGCGGCCGGC GTGGTCGTCATGTGCGCCCTCGGCAGCCGGCTCGGCCTCTTCGCCGACCTGGCCCGCTCG GGGCCGGCCACCGCCGGGGAACTCGCCCGCCGCACCGGCAACCACGAGCGGTACGTCCGC GAGTGGGCGCTGGCCCTGGCCAGCGCCGCCTACCTCACCCGGGACGCCGAGGGCCGGTAC GCCCTGCCGCCCGGCCCGGCCGCCGCCCTCGGTGACGAGAACGGGCCGTTCTACATGGGG GACATGGCCCAGCTCGTGCCCGCGCTGTCGGCGGTGCTGGACGGTGTGATCGAGGGCTTC CGCACCGGCTCCGGGCTGCACCCCGAGGAGTACCCGGCGGAGCTGTTCGAGACCATCTGG CACAAGGACGCCAACCGCCTCGGCAAGGTGCTCGTCCCGCAGTGGGTGGTCGCGGTGGAC GGGCTCACCGAGCAGCTCACCGTCGGCGGGCGGGTGGCGCAGGTGCACTGCGGCGACGGC CGGGCGCTGATCCTGCTCGCCCAGGCCTTCCCGAAGCTCGAACTCGTCGGATACGACCCA GTCGAGATCAACGTCCGCCGGGCCCGCGCCGAGGCGGCGGCGGCCGGCGTGGCGGACCGG ATCCGGTTCAGCACCGCCGACCCGGCCGAGGACCTCGACGGCGGGCTGGCGCTCGTGCTG GCGATCGACGTGCTGCACGAGGCGCCCGACCCGGCCGCGCTGCTGCGCCGCATCCACGAC TCCCTCCAGTCGCACGGGGTGTTCCTGCTGCTGGCCACCAACGGCGAGGACGTGCCGCTG ...
Adult male testis cDNA RIKEN full-length enriched library clone:4930562C03 product:hypothetical S-adenosyl-L-methionine- dependent methyltransferases structure containing protein full insert sequence (Adult male olfactory brain cDNA RIKEN full- ...
Members of the Prdm family are characterized by an N-terminal PR domain that is related to the SET methyltransferase domain, and multiple zinc fingers that mediate sequence-specific DNA binding and protein-protein interactions. Prdm factors either act as direct histone methyltransferases or recruit a suite of histone-modifying enzymes to target promoters. In this way, they function in many developmental contexts to drive and maintain cell state transitions and to modify the activity of developmental signalling pathways. Here, we provide an overview of the structure and function of Prdm family members and discuss the roles played by these proteins in stem cells and throughout development ...
Accepted name: 16S rRNA (adenine1408-N1)-methyltransferase. Reaction: S-adenosyl-L-methionine + adenine1408 in 16S rRNA = S-adenosyl-L-homocysteine + N1-methyladenine1408 in 16S rRNA Other name(s): kanamycin-apramycin resistance methylase; 16S rRNA:m1A1408 methyltransferase; KamB; NpmA; 16S rRNA m1A1408 methyltransferase. Systematic name: S-adenosyl-L-methionine:16S rRNA (adenine1408-N1)-methyltransferase. Comments: The enzyme provides a panaminoglycoside-resistant nature through interference with the binding of aminoglycosides toward the A site of 16S rRNA through N1-methylation at position adenine1408 [4]. Links to other databases: BRENDA, EXPASY, KEGG, Metacyc, PDB, CAS registry number: References:. 1. Beauclerk, A.A. and Cundliffe, E. Sites of action of two ribosomal RNA methylases responsible for resistance to aminoglycosides. J. Mol. Biol. 193 (1987) 661-671. [PMID: 2441068]. 2. Koscinski, L., Feder, M. and Bujnicki, J.M. Identification of a missing sequence and functionally important ...
File Title: Physiological, biochemical, and genetic studies on the [delta]24 sterol methyltransferase of Saccharomyces cerevisiae ...
A recent study (ALT Ma et al. J Pediatr 2016; 179: 216-8) reaches a conclusion that questions the cost-effectiveness of pretreatment TPMT activity in pediatric patients. In my opinion, this retrospective study is ridiculous. Heres why: The authors examined thiopurine transmethyltransferase (TPMT level) in 228 children before starting a thiopurine. They found the following: Only 2…
Location of the mutation sites associated with altered fidelity in WNV NS5.A. Shown are the crystal structures of the N-terminal methyltransferase domain (MTase
Ou commander 18 mg Strattera pas cher. Le Moins Cher Strattera 25 mg Generique. . . ordonner 10 mg Strattera le moins cher sans ordonnance
FOR CHER ONLY I DON'T REALLY KNOW THE CORRECT EXAM # Exam: 088053RR - SKELETAL AND MUSCULAR SYSTEMS When you have - Answered by a verified Tutor
Rntgendiagnostik-des-Zentralnervensystems-Roentgen-Diagnosis-of-the-Central-Nervous-System-Handbuch-der-medizinischen-Radiologie-Encyclopedia-of-Medical-Radiology-14-1-1A 54,99 EUR* ...
Production-of-Protease-from-Bacillus-spisolated-from-Natural-Habitats-Production-of-Alkaline-Protease-from-Bacillus-sp-isolated-from-Natural-Habitats 49,00 EUR* ...
The-Encyclopedia-of-Mass-Spectrometry-Volume-2-Biological-Applications-Part-A-The-Encyclopedia-of-Mass-Spectrometry-Ten-Volume-Set 508,25 EUR* ...
The tyrosine residue present at position 158 in the human O6-alkylguanine-DNA alkyltransferase is one of 22 amino acid residues that are conserved in all known alkyltransferase protein sequences. The importance of this amino acid in the reactions brought about by the alkyltransferase was studied by changing this residue to alanine or to phenylalanine. The control and mutant alkyltransferase proteins were expressed in an Escherichia coli strain lacking alkyltransferase activity and the proteins purified to near homogeneity and their activities measured using both methylated DNA and O6-benzylguanine (BG) as substrates. The alteration to alanine led to a very large decrease in activity towards both substrates but removal of O6-methylguanine from DNA and the conversion of BG to guanine could still be detected when large amounts of the protein were used. The activity of the Y158A mutant was at least 800 times less than that of the control alkyltransferase. The change of tyrosine-158 to phenylalanine reduced
2-O-methyl RNA methyltransferase:The 2-O-methylation of ribosomal RNA is one of the most common ways bacteria can obtain antibiotic resistance. The structure of the 2-O-methyl RNA methyltransferase from B. pseudomallei (BupsA.00072.a) contains a 31 (trefoil) protein knot. According to the protein knot server (http://knots.mit.edu/), which confirmed that this structure has a knot, there are only 40 similar structures in the PDB, including several SpoU-like RNA methyltransferases. The fold of these RNA methyltransferases is quite different from the classical methyltransferase fold, although related to the other SpoU-like RNA methyltransferases. The ribbon diagram in the figure shows it to be a dimer and the thread of the knot can be seen as the orange-red section passing through the yellow-green section in the bottom dimer. Most SpoU-like RNA methyltransferases also contain an RNA binding domain (RBD), but this RNA methyltransferase does not contain this domain, suggesting it may bind an accessory
Escherichia coli ribosomal RNA (rRNA) is post-transcriptionally modified by site-specific enzymes. The role of most modifications is not known and little is known about how these enzymes recognize their target substrates. In this thesis, we have structurally and functionally characterized two S-adenosyl-methionine (SAM) dependent 23S rRNA methyltransferases (MTases) that act during the early stages of ribosome assembly in E. coli.. RlmM methylates the 2O-ribose of C2498 in 23S rRNA. We have solved crystal structures of apo RlmM at 1.9Å resolution and of an RlmM-SAM complex at 2.6Å resolution. The RlmM structure revealed an N-terminal THUMP domain and a C-terminal catalytic Rossmann-fold MTase domain. A continuous patch of conserved positive charge on the RlmM surface is likely used for RNA substrate recognition. The SAM-binding site is open and shallow, suggesting that the RNA substrate may be required for tight cofactor binding. Further, we have shown RlmM MTase activity on in vitro ...
TY - JOUR. T1 - Synthesis of Cyclopropane Fatty Acids by C(sp3)−C(sp3) Cross-Coupling Reaction and Formal Synthesis of α-Mycolic Acid. AU - Iwasaki, Takanori. AU - Terahigashi, Shohei. AU - Wang, Yufei. AU - Tanaka, Arisa. AU - Zhao, Hanqing. AU - Fujimoto, Yukari. AU - Fukase, Koichi. AU - Kambe, Nobuaki. PY - 2018/10/4. Y1 - 2018/10/4. N2 - An iterative Ni-catalyzed C(sp3)−C(sp3) cross-coupling reaction of a novel cis-cyclopropane containing bifunctional building blocks with alkyl halides and alkyl Grignard reagents enabled the introduction of a cyclopropane ring into the desired position(s) of saturated carbon frameworks, providing a straightforward synthetic route to cyclopropane fatty acids. The present method creates a direct route for the construction of saturated carbon frameworks, and can avoid the tedious multistep operations based on unsaturated functional group manipulations that are often employed in conventional synthetic routes. This method could be applicable to the ...
Background and Aims: It has been demonstrated that homozygote and heterozygote mutant allele carriers for thiopurine S-methyltransferase (TPMT) are at high risk of developing myelosuppression after receiving standard doses of 6-mercaptopurine (6-MP). The aim of this study was to determine the frequency of TPMT deficient alleles in children with acute lymphoblastic leukemia (ALL) in Jordan and to compare it with other ethnic groups. Methods: We included 52 ALL childhood cases from King Hussein Cancer Research Center in Jordan. Genotyping of the rs1800460, rs1800462, and rs1142345 SNPs was performed by polymerase chain reaction (PCR) followed by sequencing. Comparisons were made with historical data for controls and for both volunteers and cases from other middle-eastern countries. Results: Mutant TPMT alleles were present in 3.8% (2/52) of patients. Allelic frequencies were 1.0% for both TPMT*B and TPMT*C. None of the patients were heterozygous or homozygous for TPMT*3A or TPMT *2. We did not find
Approximately 0.3% of the population has a profound genetic deficiency of thiopurine methyltransferase, the major route for detoxification of thiopurines used in immunosuppression and oncology.. These patients develop severe marrow suppression if given usual doses of a thiopurine drug or prodrug. The condition is inherited as an autosomal recessive trait, and about 11% of the population are carriers.. Carriers may also show decreased tolerance to the drugs, although not as severely as the severely deficient patients.. ...
... is an enzyme that breaks down a class of drugs called thiopurines. TPMT tests are used to identify people at risk of developing severe side effects from thiopurine treatment.
Measurement of TPMT activity is encouraged prior to commencing the treatment of patients with thiopurine drugs such as azathioprine, 6-mercaptopurine and 6-thioguanine. Patients with low activity (10% prevalence) or especially absent activity (prevalence 0.3%) are at a heightened risk of drug-induced bone marrow toxicity due to accumulation of the unmetabolised drug. Reuther et al. found that about 5% of all thiopurine therapies will fail due to toxicity. This intolerant group could be anticipated by routine measurement of TPMT activity. There appears to be a great deal of variation in TPMT mutation, with ethnic differences in mutation types accounting for variable responses to 6MP.[9][12] Genetic variants of TPMT have also been associated with cisplatin-induced ototoxicity in children.[13] TPMT is now listed as a pharmacogenomic biomarker for adverse drug reactions to cisplatin by the FDA.[14] ...
Dictyostelium and human MidA are homologous proteins that belong to a family of proteins of unknown function called DUF185. Using yeast two-hybrid screening and pull-down experiments, we showed that both proteins interact with the mitochondrial complex I subunit NDUFS2. Consistent with this, Dictyostelium cells lacking MidA showed a specific defect in complex I activity, and knockdown of human MidA in HEK293T cells resulted in reduced levels of assembled complex I. These results indicate a role for MidA in complex I assembly or stability. A structural bioinformatics analysis suggested the presence of a methyltransferase domain; this was further supported by site-directed mutagenesis of specific residues from the putative catalytic site. Interestingly, this complex I deficiency in a Dictyostelium midA− mutant causes a complex phenotypic outcome, which includes phototaxis and thermotaxis defects. We found that these aspects of the phenotype are mediated by a chronic activation of AMPK, revealing ...
TY - JOUR. T1 - Structural studies of the S-adenosyl-L-methionine binding proteins. AU - Raju, Deepa K.M.. AU - Ajees, A. Abdul. PY - 2017/1/1. Y1 - 2017/1/1. N2 - The post-genomic era produces an overwhelming amount of experimental data, but majority of such data lacks the characterization of its functions. Structure based approaches are useful to understand and characterize the functional aspects of proteins. Given the burgeoning requirement of understanding the functional aspects of various enzymes, we report a systematic structure based study of methyltransferases bound with S-adenosyl-L-methionine (SAM). Through this work, we identified the conserved amino acids of methyltransferase, which are interacting with SAM.. AB - The post-genomic era produces an overwhelming amount of experimental data, but majority of such data lacks the characterization of its functions. Structure based approaches are useful to understand and characterize the functional aspects of proteins. Given the burgeoning ...
S-adenosyl-L-methionine-dependent methyltransferase. Involved in glucosinolate metabolism and defense against phytopathogens (By similarity).
Ribosomally synthesized and post-translationally modified peptides (RiPPs) are a novel class of natural products including several antibiotics and bacterial toxins. In countless RiPP biosynthetic pathways, cobalamin-dependent radical SAM (B12/rSAM) enzymes play a pivotal role. In the biosynthetic pathway of the antibiotic and anti-cancer agent thiostrepton A, TsrM, a B12/rSAM enzyme, catalyses the transfer of a methyl group to an electrophilic carbon atom of tryptophan. Here we show that methylcob(III)alamin is the probable physiological enzyme cofactor, and cob(II)alamin rather than cob(I)alamin is a key reaction intermediate. Furthermore, we establish that TsrM and a triple-alanine mutant alkylate cob(II)alamin efficiently leading to the synthesis of MeCbl. Exploiting TsrM substrate ambiguity, we demonstrate that TsrM does not catalyse substrate H-atom abstraction like most radical SAM enzymes. Based on these data, we propose an unprecedented radical-based C-methylation mechanism, which further
TY - JOUR. T1 - Analytical Py-GC/MS of Genetically Modified Poplar for the Increased Production of Bio-aromatics. AU - SriBala, Gorugantu. AU - Toraman, Hilal Ezgi. AU - Symoens, Steffen. AU - Déjardin, Annabelle. AU - Pilate, Gilles. AU - Boerjan, Wout. AU - Ronsse, Frederik. AU - Van Geem, Kevin M.. AU - Marin, Guy B.. PY - 2019. Y1 - 2019. N2 - Genetic engineering is a powerful tool to steer bio-oil composition towards the production of speciality chemicals such as guaiacols, syringols, phenols, and vanillin through well-defined biomass feedstocks. Our previous work demonstrated the effects of lignin biosynthesis gene modification on the pyrolysis vapour compositions obtained from wood derived from greenhouse-grown poplars. In this study, field-grown poplars downregulated in the genes encoding CINNAMYL ALCOHOL DEHYDROGENASE (CAD), CAFFEIC ACID O-METHYLTRANSFERASE (COMT) and CAFFEOYL-CoA O-METHYLTRANSFERASE (CCoAOMT), and their corresponding wild type were pyrolysed in a Py-GC/MS. This work ...
A spout gland is provided for a vapor recovery fuel dispensing nozzle assembly having a nozzle body and a nozzle spout assembly. The nozzle body includes a body fuel flow path having an inlet and an outlet and a body vapor recovery path, and a venturi valve in the body fuel flow path. The spout assembly is connected to the body and defines a spout fuel flow path and a spout vapor recovery path in communication with the respective flow paths in the nozzle body. The spout assembly includes a spout tube defining the spout fuel flow path, the spout gland, and a vapor guard. The spout gland has a diameter, in part, that is larger than the diameter of said spout tube to define a generally forwardly opening annular channel around the spout tube. The gland has at least one opening in a wall thereof to place the channel in communication with an area external of said spout gland and the body vapor flow path. The vapor guard is secured to the spout gland so that the channel defined by the vapor guard and the spout
S-adenosyl-L-methionine-dependent methyltransferase that specifically methylates the N(7) position of a guanine in 18S rRNA (PubMed:25851604). Requires the methyltransferase adapter protein TRM112 for full rRNA methyltransferase activity (PubMed:25851604). Involved in the pre-rRNA processing steps leading to small-subunit rRNA production independently of its RNA-modifying catalytic activity (PubMed:25851604). Important for biogenesis end export of the 40S ribosomal subunit independent on its methyltransferase activity (PubMed:24086612). Locus-specific steroid receptor coactivator. Potentiates transactivation by glucocorticoid (NR3C1), mineralocorticoid (NR3C2), androgen (AR) and progesterone (PGR) receptors (PubMed:24488492). Required for the maintenance of open chromatin at the TSC22D3/GILZ locus to facilitate NR3C1 loading on the response elements (PubMed:24488492). Required for maintenance of dimethylation on histone H3 Lys-79 (H3K79me2), although direct histone methyltransferase activity ...
A rat O6-alkylguanine-DNA-alkyltransferase (ATase) cDNA has been isolated from a rat liver cDNA library by hybridization with the human homologue. The candidate 806 bp cDNA was sequenced and shown to contain a 630 bp open reading frame that could encode a protein of 22.2 kd. Fluorography of labelled ATase indicates a 24 kd protein which is consistent with several previous reports. The derived amino acid sequence demonstrated 81% similarity with the human ATase and 94% identity over a 67 residue region encompassing the putative alkyl acceptor site. Peptide sequences derived from cleaved homogeneous rat ATase have been located in the predicted protein providing additional confirmation of the identity of the cDNA. A 1.05 kb mRNA has been detected in rat liver by Northern analysis; treatment of adult rats with 2-acetylaminofluorene causes an approximately 10-fold induction of this message in liver. Following site directed mutagenesis of the 806 bp cDNA, the 630 bp protein coding sequence has been ...
The worlds first wiki where authorship really matters. Due credit and reputation for authors. Imagine a global collaborative knowledge base for original thoughts.
11181344] An ATP-binding cassette transporter and two rRNA methyltransferases are involved in resistance to avilamycin in the producer organism Streptomyces viridochromogenes Tu57. (Antimicrob Agents Chemother. , 2001 ...
After collecting the full set of RNA MTases acting in both rRNAs and tRNAs from Escherichia coli (see Table 1), we recovered homologs for each family of RNA MTases by using this set of proteins as a query in a Blastp-based searching. Thus, we recovered almost 3,000 different sequences, which represent a high level of diversity for these MTases in Eubacteria. We built a UPGMA-based dendrogram using the phylogenetic information obtained from RNA MTases across bacterial species (Figure 1). This dendrogram reflects relationships among RNA MTase families according to their distribution in major bacteria phyla. Globally, two major groups of MTases are observed, considered to be those enzymes with a mid to low conservation across species and those that are very well-conserved. In this latter group, a core of enzymes required for the proper ribosome function is distinguished. Consequently, 16S rRNA MTases RsmG, RsmH/I, and RsmE emerge as the highly conserved accessory proteins of the prokaryote ...
2017. Zhou F, Liu Y, Rohde C, Pauli C, Gerloff D, Köhn M, Misiak D, Bäumer N, Cui C, Göllner S, Oellerich T, Serve H, Garcia-Cuellar MP, Slany R, Maciejewski JP, Przychodzen B, Seliger B, Klein HU, Bartenhagen C, Berdel WE, Dugas M, Taketo MM, Farouq D, Schwartz S, Regev A, Hébert J, Sauvageau G, Pabst C, Hüttelmaier S, Müller-Tidow C. AML1-ETO requires enhanced C/D box snoRNA/RNP formation to induce self-renewal and leukaemia. Nat Cell Biol. 2017 Jul;19(7):844-855. doi: 10.1038/ncb3563. Epub 2017 Jun 26. PubMed PMID: 28650479.. Wong M, Tee AE, Milazzo G, Bell JL, Poulos RC, Atmadibrata B, Sun Y, Jing D, Ho N, Ling D, Liu PY, Zhang XD, Hüttelmaier S, Wong JW, Wang J, Polly P, Perini G, Scarlett CJ, Liu T. The histone methyltransferase DOT1L promotes neuroblastoma by regulating gene transcription. Cancer Res. 2017 Feb 16. pii: canres.1663.2016. doi: 10.1158/0008-5472.CAN-16-1663. [Epub ahead of print] PubMed PMID: 28209620. 2016 Wurth L, Papasaikas P, Olmeda D, Bley N, Calvo GT, Guerrero ...
A variety of RNA methyltransferases act during ribosomal RNA maturation to modify nucleotides in a site-specific manner. However, of the 10 base-methylated nucleotides present in the small ribosomal subunit of Escherichia coli, only three enzymes responsible for modification of four bases are known. Here, we show that the protein encoded by yggJ, a member of the uncharacterized DUF558 protein family of predicted alpha/beta (trefoil) knot methyltransferases is responsible for methylation at U1498 in 16S rRNA. The gene is well-conserved across bacteria and plants, and likely performs the same function in other organisms. A yggJ deletion strain lacks the methyl group at U1498 as well as the specific methyltransferase activity. Moreover, purified recombinant YggJ specifically methylates m3U1498 in vitro. The deletion strain was unaffected in exponential growth in rich or minimal media at multiple temperatures, but it was defective when grown in competition with isogenic wild-type cells. Based on ...