RNA 3-terminal phosphate cyclase, RNA 2-O-methyltransferase, RNA, Rn, Online Electronic Medical Dictionary Terminology, Articles, Glossary
Comparison of the initial 3H/14C ratios in specifically labelled d-glucose 6-phosphates with the final ratios in myo-inositol produced by glucose 6-phosphate-d-myo-inositol 1-phosphate cyclase from rat testis showed that, during the conversion, the hydrogen atoms at C-1 and C-3 were fully retained, one hydrogen atom was lost from C-6, and that at C-5 was apparently retained to the extent of 80-90%. The loss of 3H could not be stimulated by addition of unlabelled NADH, and when unlabelled substrate was used 3H from [3H]NADH and [3H]water was not incorporated. Treatment of the enzyme with charcoal abolished the activity, and this was restored to 25-50% of the original activity by NAD+. The charcoal-treated enzyme again apparently gave 85% retention of hydrogen with [5−3H]glucose 6-phosphate as substrate in the presence of NAD+ alone, but the retention was decreased to 65% with excess of NADH. The results are interpreted as indicating that the cyclization proceeds by an aldol condensation in ...
Does not have cyclase activity. Plays a role in 40S-ribosomal-subunit biogenesis in the early pre-rRNA processing steps at sites A0, A1 and A2 that are required for proper maturation of the 18S RNA (By similarity).
Kit Component:- KN222877G1, RFPL4B gRNA vector 1 in pCas-Guide vector- KN222877G2, RFPL4B gRNA vector 2 in pCas-Guide vector- KN222877D, donor vector…
Thank you for your interest in spreading the word about Biochemical Society Transactions.. NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address.. ...
ubiquitin carrier protein kinase: a 300 kDa kinase consisting of 3 subunits of MWs 70, 105 & 120; requires Mg2+ but inhibited by high concentration; from HeLa cells
Accepts ubiquitin from the E1 complex and catalyzes its covalent attachment to other proteins. Specifically monoubiquitinates the N-terminus of various substrates, including ATXN3, MAPT/TAU, POLR2H/RPB8 and STUB1/CHIP, by recognizing backbone atoms of disordered N-termini. Involved in degradation of misfolded chaperone substrates by mediating monoubiquitination of STUB1/CHIP, leading to recruitment of ATXN3 to monoubiquitinated STUB1/CHIP, and restriction of the length of ubiquitin chain attached to STUB1/CHIP substrates by ATXN3. After UV irradiation, but not after mitomycin-C (MMC) treatment, acts as a specific E2 ubiquitin-conjugating enzyme for the Fanconi anemia complex by associating with E3 ubiquitin-protein ligase FANCL and catalyzing monoubiquitination of FANCD2, a key step in the DNA damage pathway. In vitro catalyzes Lys-11-linked polyubiquitination. UBE2W-catalyzed ubiquitination occurs also in the presence of inactive RING/U-box type E3s, i.e. lacking the active site cysteine residues to
Reagents for the antigen UBE2I / ubiquitin-conjugating enzyme E2I / UBC9 stained with APC-Cy7™ in the Antibody Database
... , Authors: Dessen P. Published in: Atlas Genet Cytogenet Oncol Haematol.
Compare mindbomb E3 ubiquitin protein ligase 1 ELISA Kits from leading suppliers on Biocompare. View specifications, prices, citations, reviews, and more.
E3 ubiquitin-protein ligase which binds polysumoylated chains covalently attached to proteins and mediates Lys-6-, Lys-11-, Lys-48- and Lys-63-linked polyubiquitination of those substrates and their subsequent targeting to the proteasome for degradation. Regulates the degradation of several proteins including PML and the transcriptional activator PEA3. Involved in chromosome alignment and spindle assembly, it regulates the kinetochore CENPH-CENPI-CENPK complex by targeting polysumoylated CENPI to proteasomal degradation. Regulates the cellular responses to hypoxia and heat shock through degradation of respectively EPAS1 and PARP1. Alternatively, it may also bind DNA/nucleosomes and have a more direct role in the regulation of transcription for instance enhancing basal transcription and steroid receptor-mediated transcriptional activation ...
UBE1C - UBE1C (untagged)-Human ubiquitin-activating enzyme E1C (UBA3 homolog, yeast) (UBE1C), transcript variant 3 available for purchase from OriGene - Your Gene Company.
Réactivité: Roussette (Chauve-souris), Poulet, Boeuf (Vache) and more. Comparez 113 UBE2K Anticorps. Commandez directement chez anticorps-enligne.fr.
Reaktivität: Huhn, Rind (Kuh), Hund and more. 54 verschiedene UBE2D3 Antikörper vergleichen. Alle direkt auf antikörper-online bestellbar!
Regulator of Notch signaling, a signaling pathway involved in cell-cell communications that regulates a broad spectrum of cell-fate determinations (By similarity). Functions as a ubiquitin ligase protein in vivo, mediating Lys48-linked polyubiquitination and promoting degradation of TBK1, targeting to TBK1 requires interaction with NLRP4 ...
Albert, T.K.; Hanzawa, H.; Legtenberg, Y. I.A.; de Ruwe, M.J.; van den Heuvel, F.A.J.; Collart, M.A.; Boelens, R.; Timmers, H.T.M ...
Opens the Highlight Feature Bar and highlights feature annotations from the FEATURES table of the record. The Highlight Feature Bar can be used to navigate to and highlight other features and provides links to display the highlighted region separately. Links in the FEATURES table will also highlight the corresponding region of the sequence. More... ...
SpecificityC TerminusStorage/StabilityAliquot and store at -20°C Minimize freezing and thawing More InformationImmunogenThe immunogen was a 12-residue peptide matching a sequence from the C Terminus of RFPL2 See Accession Number s NP_006596 2 NP_001091997 2 NP_001153017 1 NP_001153018 1
En ubiquitin-conjugating enzym som regulerer cellesyklus fremmer kromosom missegregation og tumordannelse, ifølge van Ree et al. i januar 11 Utgave av Journal of Cell Biology (www.jcb.org)
UBE2D3 overexpression lysate, 0.1 mg. Transient overexpression lysate of ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) (UBE2D3), transcript variant 1
Complete information for UBR1 gene (Protein Coding), Ubiquitin Protein Ligase E3 Component N-Recognin 1, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene Compendium
UBE2D1 antibody (ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast)) for ICC/IF, IHC-P, WB. Anti-UBE2D1 pAb (GTX109257) is tested in Human, Mouse samples. 100% Ab-Assurance.
ARIH1 antibody (ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila)) for WB. Anti-ARIH1 pAb (GTX23891) is tested in Human, Mouse samples. 100% Ab-Assurance.
Complete information for NEURL4 gene (Protein Coding), Neuralized E3 Ubiquitin Protein Ligase 4, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene Compendium
Cullin 1) is a Protein Coding gene. Diseases associated with CUL1 include Vaccinia and Weaver Syndrome. Among its related pathways are Apoptosis-related network due to altered Notch3 in ovarian cancer and Signaling by NOTCH1. Gene Ontology (GO) annotations related to this gene include ubiquitin protein ligase binding. An important paralog of this gene is CUL2 ...
Ubiquitin-activating enzymes, also known as E1 enzymes, catalyze the first step in the ubiquitination reaction, which (among other things) can target a protein for degradation via a proteasome. This covalent attachment of ubiquitin or ubiquitin-like proteins to targeted proteins is a major mechanism for regulating protein function in eukaryotic organisms. Many processes such as cell division, immune responses and embryonic development are also regulated by post-translational modification by ubiquitin and ubiquitin-like proteins. Ubiquitin-activating enzyme (E1) starts the ubiquitination process (Figure 1). The E1 enzyme along with ATP binds to the ubiquitin protein. The E1 enzyme then passes the ubiquitin protein to a second protein, called Ubiquitin carrier or conjugation protein (E2). The E2 protein complexes with a Ubiquitin protein ligase (E3). This Ubiquitin protein ligase recognizes which protein needs to be tagged and catalyzes the transfer of ubiquitin to that protein. This pathway ...
The activities of two lipogenic enzymes, acetyl-CoA carboxylase and fatty acid synthase, were determined in two transplantable mammary adenocarcinomas (13762 and R3230AC) carried by non-pregnant, pregnant and lactating rats, and in mammary tissue of control animals (non-tumour-carrying) of comparable physiological states. During mammary-gland differentiation of control or tumour-carrying animals, the activities of acetyl-CoA carboxylase and fatty acid synthase in the lactating gland increased by about 40-50-fold over the values found in non-pregnant animals. On the other hand, in tumours carried by lactating dams there were only modest increases (1.5-2-fold) in acetyl-CoA carboxylase and fatty acid synthase compared with the neoplasms carried by non-pregnant animals. On the basis of the Km values for different substrates and immunodiffusion and immunotitration data, the fatty acid synthase of neoplastic tissues appeared to be indistinguishable from the control mammary-gland enzyme. However, a ...
ID RTCA_SULIM Reviewed; 337 AA. AC C3MU91; DT 22-SEP-2009, integrated into UniProtKB/Swiss-Prot. DT 16-JUN-2009, sequence version 1. DT 25-OCT-2017, entry version 52. DE RecName: Full=RNA 3-terminal phosphate cyclase {ECO:0000255,HAMAP-Rule:MF_00200}; DE Short=RNA cyclase {ECO:0000255,HAMAP-Rule:MF_00200}; DE Short=RNA-3-phosphate cyclase {ECO:0000255,HAMAP-Rule:MF_00200}; DE EC=6.5.1.4 {ECO:0000255,HAMAP-Rule:MF_00200}; GN Name=rtcA {ECO:0000255,HAMAP-Rule:MF_00200}; GN OrderedLocusNames=M1425_0235; OS Sulfolobus islandicus (strain M.14.25 / Kamchatka #1). OC Archaea; Crenarchaeota; Thermoprotei; Sulfolobales; Sulfolobaceae; OC Sulfolobus. OX NCBI_TaxID=427317; RN [1] RP NUCLEOTIDE SEQUENCE [LARGE SCALE GENOMIC DNA]. RC STRAIN=M.14.25 / Kamchatka #1; RX PubMed=19435847; DOI=10.1073/pnas.0808945106; RA Reno M.L., Held N.L., Fields C.J., Burke P.V., Whitaker R.J.; RT "Biogeography of the Sulfolobus islandicus pan-genome."; RL Proc. Natl. Acad. Sci. U.S.A. 106:8605-8610(2009). CC -!- FUNCTION: ...
TY - JOUR. T1 - The ubiquitin-conjugating enzyme UBCH7 acts as a coactivator for steroid hormone receptors. AU - Verma, Seema. AU - Ismail, Ayesha. AU - Gao, Xiuhua. AU - Fu, Guilian. AU - Li, Xiaotao. AU - OMalley, Bert W.. AU - Nawaz, Zafar. PY - 2004/10/1. Y1 - 2004/10/1. N2 - We investigated the role of the ubiquitin-conjugating enzyme UBCH7 in nuclear receptor transactivation. Using transient transfection assays, we demonstrated that UBCH7 modulates the transcriptional activity of progesterone receptor (PR) and glucocorticoid, androgen, and retinoic acid receptors in a hormone-dependent manner and that the ubiquitin conjugation activity of UBCH7 is required for its ability to potentiate transactivation by steroid hormone receptors (SHR). However, UBCH7 showed no significant effect on the transactivation functions of p53 and VP-16 activation domain. Depletion of endogenous UBCH7 protein by small interfering RNAs suggests that UBCH7 is required for the proper function of SHR. Furthermore, a ...
The RAD6 gene of Saccharomyces cerevisiae is required for DNA repair, DNA damage-induced mutagenesis, and sporulation. RAD6 protein is a ubiquitin-conjugating enzyme (E2) that has been shown to attach multiple molecules of ubiquitin to histones H2A and H2B. We have now examined whether the E2 activity of RAD6 is involved in its various biological functions. Since the formation of a thioester adduct between E2 and ubiquitin is necessary for E2 activity, the single cysteine residue (Cys-88) present in RAD6 was changed to alanine or valine. The mutant proteins were overproduced in yeast cells and purified to near homogeneity. We show that the rad6 Ala-88 and rad6 Val-88 mutant proteins lack the capacity for thioester formation with ubiquitin and, as a consequence, are totally devoid of any E2 activity. The rad6 Ala-88 and rad6 Val-88 mutations confer a defect in DNA repair, mutagenesis, and sporulation equivalent to that in the rad6 null allele. We suggest that the biological functions of RAD6 ...
The worlds first wiki where authorship really matters. Due credit and reputation for authors. Imagine a global collaborative knowledge base for original thoughts.
Read "Over-expression of tobacco UBC1 encoding a ubiquitin-conjugating enzyme increases cadmium tolerance by activating the 20S/26S proteasome and by decreasing Cd accumulation and oxidative stress in tobacco (Nicotiana tabacum), Plant Molecular Biology" on DeepDyve, the largest online rental service for scholarly research with thousands of academic publications available at your fingertips.
E3 Ubiquitin-Protein Ligase XIAP (Baculoviral IAP Repeat-Containing Protein 4 or IAP-Like Protein or X-Linked Inhibitor Of Apoptosis Protein or XIAP or EC
Muona M, Ishimura R, Laari A, Ichimura Y, Linnankivi T, Keski-Filppula R, Herva R, Rantala H, Paetau A, Pöyhönen M, Obata M, Uemura T, Karhu T, Bizen N, Takebayashi H, McKee S, Parker MJ, Akawi N, McRae J, Hurles ME, Kuismin O, Kurki MI, Anttonen AK, Tanaka K, Palotie A, Waguri S, Lehesjoki AE, Komatsu M. Biallelic Variants in UBA5 Link Dysfunctional UFM1 Ubiquitin-like Modifier Pathway to Severe Infantile-Onset Encephalopathy. Am J Hum Genet. 2016 09 01; 99(3):683-694 ...
Abstract. Despite the promise of targeting B-cell receptor-associated signaling kinases in indolent lymphomas, new agents in this class show limited activity i
... ,Acetyl CoA Carboxylase Antibody,biological,biology supply,biology supplies,biology product
The worlds first wiki where authorship really matters. Due credit and reputation for authors. Imagine a global collaborative knowledge base for original thoughts.
Acetyl-CoA Carboxylase alpha/ACACA products available through Novus Biologicals. Browse our Acetyl-CoA Carboxylase alpha/ACACA product catalog backed by our Guarantee+.
left-handed. Box 6-1 DNA Has 10.5 Base Pairs per Turn of the Helix in Solution: The Mica Experiment. This value of 10 base pairs per turn vanes somewhat under different conditions. A classic experiment that was earned out in the 1970s demonstrated that DNA absorbed on a surface has somewhat greater than 10 base pairs per turn. Short segments of DNA were allowed to btnd to a mica surface. The presence of 5-terminal phosphates on the DNAs field them in a fixed orientation on the mica. The mica-bound DNAs were then exposed to DNAse I, an enzyme (a rieoxyrifconude-ase) that deaves the phosphodiester bonds in the DNA backbone. Because the enzyme is bulky, it t5 onfy able to deave phosphodiester bonds on the DNA surface furthest from the mica (think of the DNA as a cylinder lying down on a flat surface) due to the stenc difficulty of reaching the sides or bottom, surface of the DNA. As a result, the length of the resulting fragments should reflect the periodicity of the DNA, the number Of base pairs ...
Rabbit monoclonal antibody raised against a human RFPL1 peptide using ARM Technology. A synthetic peptide of human RFPL1 is used for rabbit immunization.Customer or Abnova will decide on the preferred peptide sequence. (H00005988-K) - Products - Abnova
M.R. Munday; Regulation of mammalian acetyl-CoA carboxylase. Biochem Soc Trans 1 October 2002; 30 (5): A101. doi: https://doi.org/10.1042/bst030a101c. Download citation file:. ...
Smurf2 - Smurf2 (untagged ORF) - Rat SMAD specific E3 ubiquitin protein ligase 2 (Smurf2), (10 ug) available for purchase from OriGene - Your Gene Company.
pep:known chromosome:VEGA66:11:106822025:106920470:-1 gene:OTTMUSG00000003584 transcript:OTTMUST00000007723 gene_biotype:protein_coding transcript_biotype:protein_coding gene_symbol:Smurf2 description:SMAD specific E3 ubiquitin protein ligase 2 ...
Gentaur molecular products has all kinds of products like :search , ARP \ Antigens Elongin B, 1-118aa, Human, Recombinant, E.coli \ 01-2008 for more molecular products just contact us
Use Bio-Rads PrimePCR assays, controls, templates for your target gene. Every primer pair is optimized, experimentally validated, and performance guaranteed.
Use Bio-Rads PrimePCR assays, controls, templates for your target gene. Every primer pair is optimized, experimentally validated, and performance guaranteed.
HsCD00329761 ------------------------------------------------------------ NM_006605.3 ------------------------------------------------------------ NM_021026.2 ------------------------------------------------------------ NM_006604.2 ------------------------------------------------------------ XM_005261310.1 ------------------------------------------------------------ NM_001098527.2 ATGGAGGTGGCTGAATTAGGCTTCCCAGAGACTGCAGTGTCCCAATCCAGGATCTGTCTA NM_001159545.1 ------------------------------------------------------------ NM_001098535.1 ------------------------------------------------------------ NM_001159546.1 ------------------------------------------------------------ HsCD00329761 ------------------------------------------------------------ NM_006605.3 ------------------------------------------------------------ NM_021026.2 ------------------------------------------------------------ NM_006604.2 ------------------------------------------------------------ XM_005261310.1 ...
Zaradi pogoste uporabe betalaktamskih zdravil so nekatere bakterije razvile odpornost proti njim. Nekatere bakterije proizvajajo prej omejeni encim betalaktamazo, ki izniči učinek betalaktamskega antibiotika, ker cepi betalaktamski obroč.. Za preprečitev tovrstne odpornosti bakterij so na trgu kombinacije betalaktamskih antibiotikov z zaviralci betalaktamaze. Takšna kombinacija je npr. amoksicilin + klavulanska kislina. Klavulanska kislina je zaviralec betalaktamaze, ker se nepovratno veže na encim in slednji se več ne more vezati na betalaktamsko učinkovino (v tem primeru amoksicilin).. ...
Next, we engineered a cell line that expressed VHL under the control of a tetracyclin-dependent promoter. VHL-negative A498 cells were lentivirally transduced to express a tet repressor together with a tet-dependent VHL construct. Incubation of the cells in the presence of doxycycline resulted in pVHL expression already at very low doxycycline concentrations (Fig. 2 d). Several independent clones of cells were generated, plated at high density, and grown on cell culture inserts in the absence and presence of 500 ng/ml doxycycline for 5 d. As demonstrated in the previous paragraph, VHL-negative cells did not show cilia formation under the conditions chosen (unpublished data). In contrast, doxycyclin-treated cells displayed the formation of monocilia (∼10% of cells). These monocilia again stained positive for pVHL (as demonstrated by stainings with an anti-V5 antibody; Fig. 2 d).. To further study a role for pVHL in the formation of cilia, we next searched for short hairpin RNAs (shRNAs) to ...
The eukaryotic ubiquitin-conjugation system sets the turnover rate of many proteins and includes activating enzymes (E1s), conjugating enzymes (UBCs/E2s), and ubiquitin-protein ligases (E3s), which are responsible for activation, covalent attachment and substrate recognition, respectively. There are also ubiquitin-like proteins with distinct functions, which require their own E1s and E2s for attachment. We describe the results of RNA interference (RNAi) experiments on the E1s, UBC/E2s and ubiquitin-like proteins in Caenorhabditis elegans. We also present a phylogenetic analysis of UBCs. The C. elegans genome encodes 20 UBCs and three ubiquitin E2 variant proteins. RNAi shows that only four UBCs are essential for embryogenesis: LET-70 (UBC-2), a functional homolog of yeast Ubc4/5p, UBC-9, an ortholog of yeast Ubc9p, which transfers the ubiquitin-like modifier SUMO, UBC-12, an ortholog of yeast Ubc12p, which transfers the ubiquitin-like modifier Rub1/Nedd8, and UBC-14, an ortholog of Drosophila Courtless.