Shop Imidazoleglycerol-phosphate dehydratase ELISA Kit, Recombinant Protein and Imidazoleglycerol-phosphate dehydratase Antibody at MyBioSource. Custom ELISA Kit, Recombinant Protein and Antibody are available.
p>The checksum is a form of redundancy check that is calculated from the sequence. It is useful for tracking sequence updates.,/p> ,p>It should be noted that while, in theory, two different sequences could have the same checksum value, the likelihood that this would happen is extremely low.,/p> ,p>However UniProtKB may contain entries with identical sequences in case of multiple genes (paralogs).,/p> ,p>The checksum is computed as the sequence 64-bit Cyclic Redundancy Check value (CRC64) using the generator polynomial: x,sup>64,/sup> + x,sup>4,/sup> + x,sup>3,/sup> + x + 1. The algorithm is described in the ISO 3309 standard. ,/p> ,p class="publication">Press W.H., Flannery B.P., Teukolsky S.A. and Vetterling W.T.,br /> ,strong>Cyclic redundancy and other checksums,/strong>,br /> ,a href="http://www.nrbook.com/b/bookcpdf.php">Numerical recipes in C 2nd ed., pp896-902, Cambridge University Press (1993),/a>),/p> Checksum:i ...
4.2.1.1 Carbonic anhydrase 4.2.1.2 Fumarate hydratase 4.2.1.3 Aconitate hydratase 4.2.1.4 Transferred entry: 4.2.1.3 4.2.1.5 Arabinonate dehydratase 4.2.1.6 Galactonate dehydratase 4.2.1.7 Altronate dehydratase 4.2.1.8 Mannonate dehydratase 4.2.1.9 Dihydroxy-acid dehydratase 4.2.1.10 3-dehydroquinate dehydratase 4.2.1.11 Phosphopyruvate hydratase 4.2.1.12 Phosphogluconate dehydratase 4.2.1.13 Transferred entry: 4.3.1.17 4.2.1.14 Transferred entry: 4.3.1.18 4.2.1.15 Transferred entry: 4.4.1.1 4.2.1.16 Transferred entry: 4.3.1.19 4.2.1.17 Enoyl-CoA hydratase 4.2.1.18 Methylglutaconyl-CoA hydratase 4.2.1.19 Imidazoleglycerol-phosphate dehydratase 4.2.1.20 Tryptophan synthase 4.2.1.21 Transferred entry: 4.2.1.22 4.2.1.22 Cystathionine beta-synthase 4.2.1.23 Deleted entry 4.2.1.24 Porphobilinogen synthase 4.2.1.25 L-arabinonate dehydratase 4.2.1.26 Transferred entry: 4.3.1.9 4.2.1.27 Acetylenecarboxylate hydratase 4.2.1.28 Propanediol dehydratase 4.2.1.29 Transferred entry: 4.99.1.6 4.2.1.30 Glycerol ...
p>The checksum is a form of redundancy check that is calculated from the sequence. It is useful for tracking sequence updates.,/p> ,p>It should be noted that while, in theory, two different sequences could have the same checksum value, the likelihood that this would happen is extremely low.,/p> ,p>However UniProtKB may contain entries with identical sequences in case of multiple genes (paralogs).,/p> ,p>The checksum is computed as the sequence 64-bit Cyclic Redundancy Check value (CRC64) using the generator polynomial: x,sup>64,/sup> + x,sup>4,/sup> + x,sup>3,/sup> + x + 1. The algorithm is described in the ISO 3309 standard. ,/p> ,p class="publication">Press W.H., Flannery B.P., Teukolsky S.A. and Vetterling W.T.,br /> ,strong>Cyclic redundancy and other checksums,/strong>,br /> ,a href="http://www.nrbook.com/b/bookcpdf.php">Numerical recipes in C 2nd ed., pp896-902, Cambridge University Press (1993),/a>),/p> Checksum:i ...
This gene encodes pterin-4 alpha-carbinolamine dehydratase, an enzyme involved in phenylalanine hydroxylation. A deficiency of this enzyme leads to hyperphenylalaninemia. The enzyme regulates the homodimerization of the transcription factor hepatocyte nuclear factor 1 (HNF1 ...
This enzyme is involved in naphthalene degradation. The enzyme catalyses a retro-aldol reaction in vitro, and it accepts a broad range of aldehydes and 4-substituted 2-ox
Imidazoleglycerol-phosphate dehydratase, catalyzes the sixth step in histidine biosynthesis; mutations cause histidine auxotrophy and sensitivity to Cu, Co, and Ni salts; transcription is regulated by general amino acid control via ...
This HMM represents a small and phylogenetically curious clade of sequences. Sequences are found from Halobacterium (an archaeon), Nostoc and Synechococcus (cyanobacteria) and Phytophthora (a stramenophile eukaryote). These appear to be members of the haloacid dehalogenase (HAD) superfamily of aspartate-nucleophile hydrolases by general homology and the conservation of all of the recognized catalytic motifs [1]. The variable domain is found in between motifs 1 and 2, indicating membership in subfamily I and phylogeny and prediction of the alpha helical nature of the variable domain (by PSI-PRED) indicate membership in subfamily IA. All but the Halobacterium sequence currently found are annotated as "Imidazoleglycerol-phosphate dehydratase", however, the source of the annotation could not be traced and significant homology could not be found between any of these sequences and known IGPDs ...
SWISS-MODEL Repository entry for A0A0M3GRS2 (A0A0M3GRS2_9RHIZ), Imidazoleglycerol-phosphate dehydratase. Rhizobium phaseoli Ch24-10
rdf:RDF xmlns:dcterms="http://purl.org/dc/terms/" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" xmlns:bibo="http://purl.org/ontology/bibo/" xmlns:dspace="http://digital-repositories.org/ontologies/dspace/0.1.0#" xmlns:foaf="http://xmlns.com/foaf/0.1/" xmlns:void="http://rdfs.org/ns/void#" xmlns:xsd="http://www.w3.org/2001/XMLSchema#" , ,rdf:Description rdf:about="https://kops.uni-konstanz.de/rdf/resource/123456789/8022", ,dcterms:available rdf:datatype="http://www.w3.org/2001/XMLSchema#dateTime",2011-03-24T17:39:20Z,/dcterms:available, ,dc:creator,Rebrin, Igor,/dc:creator, ,dc:format,application/pdf,/dc:format, ,dcterms:bibliographicCitation,First publ. in: Journal of inherited metabolic disease 15 (1992), 3, pp. 405-408,/dcterms:bibliographicCitation, ,dc:contributor,Curtius, Hans-Christoph,/dc:contributor, ,void:sparqlEndpoint rdf:resource="http://localhost/fuseki/dspace/sparql"/, ,dcterms:issued,1992,/dcterms:issued, ...
Accepted name: (S)-2-methylmalate dehydratase. Reaction: (S)-2-methylmalate = 2-methylfumarate + H2O. Other name(s): mesaconate hydratase; (+)-citramalate hydro-lyase; L-citramalate hydrolase; citramalate dehydratase; (+)-citramalic hydro-lyase; mesaconate mesaconase; mesaconase; (S)-2-methylmalate hydro-lyase. Systematic name: (S)-2-methylmalate hydro-lyase (2-methylfumarate-forming). Comments: Also hydrates fumarate to (S)-malate.. Links to other databases: BRENDA, EXPASY, GTD, KEGG, Metacyc, CAS registry number: 9027-94-5. References:. 1. Blair, A.H. and Barker, H.A. Assay and purification of (+)-citramalate hydro-lyase components from Clostridium tetanomorphum. J. Biol. Chem. 241 (1966) 400-408. [PMID: 5903732]. 2. Wang, C.C. and Barker, H.A. Purification and properties of L-citramalate hydrolyase. J. Biol. Chem. 244 (1969) 2516-2526. [PMID: 5769987]. ...
Accepted name: methylglutaconyl-CoA hydratase. Reaction: (S)-3-hydroxy-3-methylglutaryl-CoA = trans-3-methylglutaconyl-CoA + H2O. For diagram click here.. Other name(s): methylglutaconyl coenzyme A hydratase; 3-methylglutaconyl CoA hydratase; methylglutaconase; (S)-3-hydroxy-3-methylglutaryl-CoA hydro-lyase. Systematic name: (S)-3-hydroxy-3-methylglutaryl-CoA hydro-lyase (trans-3-methylglutaconyl-CoA-forming). Links to other databases: BRENDA, EXPASY, KEGG, Metacyc, PDB, CAS registry number: 9024-24-2. References: 1. Hilz, H., Knappe, J., Ringelmann, E. and Lynen, F. Methylglutaconase, eine neue Hydratase, die am Stoffwechsel verzweigter Carbonsäuren beteiligt ist. Biochem. Z. 329 (1958) 476-489. [PMID: 13535602]. ...
Informace k epizodě A Dolls Story ze seriálu Sabrina - mladá čarodějnice - Hilda a Zelda odjíždějí do lázní, aby si od sebe odpočinuly. Sabrina hlídá svou sestřenici Amandu....
Purchase Recombinant Streptococcus pneumoniae serotype 19F Dihydroxy-acid dehydratase(ilvD) ,partial. It is produced in Yeast. High purity. Good price.
The cloned 9.4-kb insert of plasmid pNHJ20L containing low-molecular-massnitrile hydratase (L-NHase) gene from Rhodococcus rhodochrous J1[Kobayashi, M. et al. (1991) Biochim. Biophys. Acta 1129, 23-33] wasdigested with various restriction enzymes, and the trimmed fragments wereinserted into pUC18 or pUC19. A 1.96-kb EcoRI-SphI region located 1.9-kbdownstream of the L-NHase gene was found to be essential for theexpression of amidase activity in Escherichia coli; the gene arrangementof the amidase and the NHase in R. rhodochrous J1 differed from those inRhodococcus species including N-774 and Pseudomonas chlororaphis B23. Thenucleotide-determined sequence indicated that the amidase consists of 515amino acids (54626 Da) and the deduced amino acid sequence of the amidasehad high similarity to those of amidases from Rhodococcus speciesincluding N-774 and P. chlororaphis B23 and to indole-3-acetamidehydrolase from Pseudomonas savastanoi. The amidase gene modified in thenucleotide sequence upstream ...
ID HIS7_LISMF Reviewed; 194 AA. AC Q722Y4; DT 15-FEB-2005, integrated into UniProtKB/Swiss-Prot. DT 05-JUL-2004, sequence version 1. DT 08-MAY-2019, entry version 84. DE RecName: Full=Imidazoleglycerol-phosphate dehydratase {ECO:0000255,HAMAP-Rule:MF_00076}; DE Short=IGPD {ECO:0000255,HAMAP-Rule:MF_00076}; DE EC=4.2.1.19 {ECO:0000255,HAMAP-Rule:MF_00076}; GN Name=hisB {ECO:0000255,HAMAP-Rule:MF_00076}; GN OrderedLocusNames=LMOf2365_0595; OS Listeria monocytogenes serotype 4b (strain F2365). OC Bacteria; Firmicutes; Bacilli; Bacillales; Listeriaceae; Listeria. OX NCBI_TaxID=265669; RN [1] RP NUCLEOTIDE SEQUENCE [LARGE SCALE GENOMIC DNA]. RC STRAIN=F2365; RX PubMed=15115801; DOI=10.1093/nar/gkh562; RA Nelson K.E., Fouts D.E., Mongodin E.F., Ravel J., DeBoy R.T., RA Kolonay J.F., Rasko D.A., Angiuoli S.V., Gill S.R., Paulsen I.T., RA Peterson J.D., White O., Nelson W.C., Nierman W.C., Beanan M.J., RA Brinkac L.M., Daugherty S.C., Dodson R.J., Durkin A.S., Madupu R., RA Haft D.H., Selengut J., Van ...
Objective: The purpose of this experiment was to complete the dehydration reaction of 2-methylcyclohexanol and to identify b...
TY - JOUR. T1 - Discovery of function in the enolase superfamily. T2 - D-mannonate and d-gluconate dehydratases in the d-mannonate dehydratase subgroup. AU - Wichelecki, Daniel J.. AU - Balthazor, Bryan M.. AU - Chau, Anthony C.. AU - Vetting, Matthew W.. AU - Fedorov, Alexander A.. AU - Fedorov, Elena V.. AU - Lukk, Tiit. AU - Patskovsky, Yury V.. AU - Stead, Mark B.. AU - Hillerich, Brandan S.. AU - Seidel, Ronald D.. AU - Almo, Steven C.. AU - Gerlt, John A.. PY - 2014/4/29. Y1 - 2014/4/29. N2 - The continued increase in the size of the protein sequence databases as a result of advances in genome sequencing technology is overwhelming the ability to perform experimental characterization of function. Consequently, functions are assigned to the vast majority of proteins via automated, homology-based methods, with the result that as many as 50% are incorrectly annotated or unannotated (Schnoes et al. PLoS Comput. Biol. 2009, 5 (12), e1000605). This manuscript describes a study of the d-mannonate ...
Do You Have Hyperphenilalaninemia Due To Pterin-4-alpha-carbin? Join friendly people sharing true stories in the I Have Hyperphenilalaninemia Due to Pterin-4-alpha-carbin group. Find support forums, advice and chat with groups who share this life exp...
Recombinant human GMDS protein, fused to His-tag at N-terminus, was expressed in E.coli and purified by using conventional chromatography.
View Notes - Bild 1 week2 problems from BILD 1 at UCSD. 1 Kang Ko OH: Wed., 11am-11:50am at CLICS 2 nd floor [email protected] II. The following picture shows a dehydration reaction of nucleotides. 1.
Arogenate dehydratases (ADTs) perform the final step of phenylalanine (Phe) biosynthesis in plants. As one of twenty protein-coding amino acids, Phe is essential in all living organisms, and in plants it is also a precursor ...
Lence, E., Tizón, L., Otero, J.M., Peón, A., Prazeres, V.F.V., Llamas-Saiz, A.L., Fox, G.C., van Raaij, M.J., Lamb, H., Hawkins, A.R. and González-Bello, C. (2012) Mechanistic basis of the inhibition of type II dehydroquinase by (2S)- and (2R)-2-benzyl-3-dehydroquinic acids. ACS Chem. Biol., in press ...
putative dTDP-glucose 4,6-dehydratase [dNDP-glucose 4,6-dehydratase] ATGAACATCCTGGTCACCGGCGCGGCCGGTTTCATCGGCTCGCACTTCGTCCGCAGCCTG CTGGCCGACACCTACTCCGGCTGGGAGGGAGCCCGGGTCACTGCCCTGGACAAACTGACC TACGCGGGCAACCGGAACAACCTGCCGCCCTCAAACCCGCGCCTGGAGTTCGTGCGGGGC GACGTGTGCGACCGCGCCCTGCTCCGCGAGCTGCTGCCCGGGCACCACGCCGTGGTCCAT TTCGCGGCGGAATCCCACGTGGACCGCTCCCTCGAAGGCGCGGGCGAGTTCTTCCGCACG AACGTCCTCGGTACGCAGACACTCCTCGACGCCGTACTGGACAGCGGAGTCGAGCGGGTC GTTCACGTCTCCACCGACGAGGTGTACGGCTCGATCGAGCAAGGCTCCTGGACCGAGGAC TGGCCGCTGCAGCCCAATTCTCCGTACGCCGCCTCGAAGGCATGCTCGGACCTGGTCGCG CGAGCCTACTGCGCACCCACGGAGGTGGACCTCTCCATCACCCGCTGCTCCAACAACTAC GGCCCGCACCAGCACCCTGAGAAGGTCATTCCCAGGTTCGTCACGAACCTCCTCGAAGGA CGCCAGGTCCCGCTGTACGGCGACGGCCGCAATGTGCGCGAGTGGCTCCACGTGGAGGAC CACTGCCGCGGTATCCACCTGGTGCTCAACAAGGGGCAGGCCGGCGAGATCTACAACATC GGCGGGGGCAACGAGTACACCAACCTCGCCCTCACCGAGAAACTGCTCGAACTGACGGGT GCCGGCCCGGAGATGATCCGCCGCGTCCCCGACCGCAAGGCGCACGACCTGCGGTACTCG ATCGACGAGTCCAAGATCCGCGAGAAGCTCGGCTACGCCCCGCGGATCAGCTTCGAACAG ...
Fachgruppe Bioinformatik (FaBI) - die gemeinsame Fachvertretung Bioinformatik der Fachgesellschaften DECHEMA, GBM, GDCh, GI, und GMDS.
Fachgruppe Bioinformatik (FaBI) - die gemeinsame Fachvertretung Bioinformatik der Fachgesellschaften DECHEMA, GBM, GDCh, GI, und GMDS.
MetabolismEnergy metabolismAmino acids and aminesL-serine dehydratase, iron-sulfur-dependent, beta subunit (TIGR00719; EC 4.3.1.17; HMM-score: 170.8) ...
TY - JOUR. T1 - Identification and expression of the genes encoding a reactivating factor for adenosylcobalamin-dependent glycerol dehydratase. AU - Tobimatsu, Takamasa. AU - Kajiura, Hideki. AU - Yunoki, Michio. AU - Azuma, Muneaki. AU - Toraya, Tetsuo. PY - 1999/7. Y1 - 1999/7. N2 - Adenosylcobalamin-dependent glycerol dehydratase undergoes inactivation by glycerol, the physiological substrate, during catalysis. In permeabilized cells of Klebsiella pneumoniae, the inactivated enzyme is reactivated in the presence of ATP, Mg2+, and adenosylcobalamin. We identified the two open reading frames as the genes for a reactivating factor for glycerol dehydratase and designated them gdrA and gdrB. The reactivation of the inactivated glycerol dehydratase by the gene products was confirmed in permeabilized recombinant Escherichia coli cells coexpressing GdrA and GdrB proteins with glycerol dehydratase.. AB - Adenosylcobalamin-dependent glycerol dehydratase undergoes inactivation by glycerol, the ...
Hence, this enzyme has one substrate, 6-phospho-D-gluconate, and two products, 2-dehydro-3-deoxy-6-phospho-D-gluconate and H2O. This enzyme belongs to the family of lyases, specifically the hydro-lyases, which cleave carbon-oxygen bonds. The systematic name of this enzyme class is 6-phospho-D-gluconate hydro-lyase (2-dehydro-3-deoxy-6-phospho-D-gluconate-forming). Other names in common use include 6-phosphogluconate dehydratase, 6-phosphogluconic dehydrase, gluconate-6-phosphate dehydratase, gluconate 6-phosphate dehydratase, 6-phosphogluconate dehydrase, and 6-phospho-D-gluconate hydro-lyase. This enzyme participates in Entner-Doudoroff pathway. ...
ID HIS7_OCHA4 Reviewed; 202 AA. AC A6WX56; DT 15-JAN-2008, integrated into UniProtKB/Swiss-Prot. DT 21-AUG-2007, sequence version 1. DT 07-JUN-2017, entry version 59. DE RecName: Full=Imidazoleglycerol-phosphate dehydratase {ECO:0000255,HAMAP-Rule:MF_00076}; DE Short=IGPD {ECO:0000255,HAMAP-Rule:MF_00076}; DE EC=4.2.1.19 {ECO:0000255,HAMAP-Rule:MF_00076}; GN Name=hisB {ECO:0000255,HAMAP-Rule:MF_00076}; GN OrderedLocusNames=Oant_0838; OS Ochrobactrum anthropi (strain ATCC 49188 / DSM 6882 / JCM 21032 / NBRC OS 15819 / NCTC 12168). OC Bacteria; Proteobacteria; Alphaproteobacteria; Rhizobiales; OC Brucellaceae; Ochrobactrum. OX NCBI_TaxID=439375; RN [1] RP NUCLEOTIDE SEQUENCE [LARGE SCALE GENOMIC DNA]. RC STRAIN=ATCC 49188 / DSM 6882 / JCM 21032 / NBRC 15819 / NCTC 12168; RX PubMed=21685287; DOI=10.1128/JB.05335-11; RA Chain P.S., Lang D.M., Comerci D.J., Malfatti S.A., Vergez L.M., RA Shin M., Ugalde R.A., Garcia E., Tolmasky M.E.; RT "Genome of Ochrobactrum anthropi ATCC 49188 T, a versatile RT ...
There are 10 known putative pseudouridine synthase genes in Escherichia coli. The products of six have been previously assigned, one to formation of the single pseudouridine in 16S RNA, three to the formation of seven pseudouridines in 23S RNA, and three to the formation of three pseudouridines in tRNA (one synthase makes pseudouridine in 23S RNA and tRNA). Here we show that the remaining four putative synthase genes make bona fide pseudouridine synthases and identify which pseudouridines they make. RluB (formerly YciL) and RluE (formerly YmfC) make pseudouridine2605 and pseudouridine2457, respectively, in 23S RNA. RluF (formerly YjbC) makes the newly discovered pseudouridine2604 in 23S RNA, and TruC (formerly YqcB) makes pseudouridine65 in tRNA(Ile1) and tRNA(Asp). Deletion of each of these synthase genes individually had no effect on exponential growth in rich media at 25 degrees C, 37 degrees C, or 42 degrees C. A strain lacking RluB and RluF also showed no growth defect under these ...
This gene encodes bifunctional mitochondrial protein that has both RNA-binding and hydratase activities. The encoded protein is a methylglutaconyl-CoA hydratase that catalyzes the hydration of 3-methylglutaconyl-CoA to 3-hydroxy-3-methyl-glutaryl-CoA, a critical step in the leucine degradation pathway. This protein also binds AU-rich elements (AREs) found in the 3 UTRs of rapidly decaying mRNAs including c-fos, c-myc and granulocyte/ macrophage colony stimulating factor. ARE elements are involved in directing RNA to rapid degradation and deadenylation. This protein is localizes to the mitochondrial matrix and the inner mitochondrial membrane and may be involved in mitochondrial protein synthesis. Mutations in this gene are the cause of 3-methylglutaconic aciduria, type I. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
Nicotiana tabacum cDNA encoding a bifunctional protein having catalytic domains for dehydroquinase and shikimate dehydrogenase was cloned and sequenced. Complementation of Escherichia coli aroD and aroE auxotrophs was successful. Amino acid sequencing located the N-terminus of the mature protein. The two catalytic domains exhibited greater amino acid identity with prokaryote homologues than with yeast and fungal homologues. ...
In enzymology, an oleate hydratase (EC 4.2.1.53) is an enzyme that catalyzes the chemical reaction (R)-10-hydroxystearate ⇌ {\displaystyle \rightleftharpoons } oleate + H2O Hence, this enzyme has one substrate, (R)-10-hydroxystearate, and two products, oleate and H2O. This enzyme belongs to the family of lyases, specifically the hydro-lyases, which cleave carbon-oxygen bonds. The systematic name of this enzyme class is (R)-10-hydroxystearate 10-hydro-lyase (oleate-forming). This enzyme is also called (R)-10-hydroxystearate 10-hydro-lyase. Davis EN, Wallen LL, Goodwin JC, Rohwedder WK, Rhodes RA (1969). "Microbial hydration of cis-9-alkenoic acids". Lipids. 4 (5): 356-62. doi:10.1007/BF02531006. PMID 5823715. Gotouda H, Takatori T, Terazawa K, Nagao M, Tarao H (1988). "The mechanism of experimental adipocere formation: hydration and dehydrogenation in microbial synthesis of hydroxy and oxo fatty acids". Forensic Sci. Int. 37 (4): 249-57. doi:10.1016/0379-0738(88)90233-2. PMID 3410394. Jr; ...
SWISS-MODEL Template Library (SMTL) entry for 3hij.1. Crystal structure of dihydrodipicolinate synthase from Bacillus anthracis in complex with its substrate, pyruvate
This enzyme belongs to the family of hydrolases, specifically those acting on ether bonds (ether hydrolases). The systematic name of this enzyme class is cis-stilbene-oxide hydrolase. Other names in common use include epoxide hydratase (ambiguous), microsomal epoxide hydratase (ambiguous), epoxide hydrase, microsomal epoxide hydrase, arene-oxide hydratase (ambiguous), benzo[a]pyrene-4,5-oxide hydratase, benzo(a)pyrene-4,5-epoxide hydratase, aryl epoxide hydrase (ambiguous), cis-epoxide hydrolase, and mEH. This enzyme participates in metabolism of xenobiotics by cytochrome p450 ...
A free platform for explaining your research in plain language, and managing how you communicate around it - so you can understand how best to increase its impact.
This HMM describes PoyD and its homologs. These are divergent putative radical SAM enzymes, with the classical CxxxCxxC motif but with few members approaching the cutoff score of Pfam model PF04055. PoyD appears responsible for catalyzing a unidirectional L-to-D epimerization of 18 the 48 residues in the core peptide of the first characterized polytheonamide. The RiPP (ribosomally translated natural product) precursor, and peptides encoded near many other members of this family, belong to the nitrile hydratase leader peptide (NHLP) family ...
David Eichhorn Professor and ChairDepartment of Chemistry Wichita State University Synthesis of Model Complexes for Nitrile Hydratase (2004-2007)
Qute Balance Forskolin Extract is a natural formula that improves metabolism and weight loss without the requirement of changing diet or exercise routine.
Pcbd1 (GFP-tagged) - Mouse pterin 4 alpha carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 1 (Pcbd1),, 10 µg.
Journal Article: In Human Pseudouridine Synthase 1 (hPus1), a C-Terminal Helical Insert Blocks tRNA from Binding in the Same Orientation as in the Pus1 Bacterial Homologue TruA, Consistent with Their Different Target Selectivities ...
4IUO: Crystal structures of type I dehydroquinate dehydratase in complex with quinate and shikimate suggest a novel mechanism of schiff base formation.
NOTE: Text or symbols not renderable in plain ASCII are indicated by [...]. Abstract is included in .pdf document. PART I. Use of a mixture of non- and tetradeutero-beta-methylaspartate with coenzyme B12 dependent beta-methylaspartate-glutamate mutase has shown that the hydrogen that migrates becomes one of three equivalent hydrogens during the reaction. Kinetic isotope effects suggest that cleavage of the bond in the substrate from carbon to that hydrogen which migrates is an important component of the rate determining step. The evidence also supports the existence of an intermediate which can partition with similar probabilities to beta-methylaspartate or to glutamate. Some possible mechanistic implications of these findings are discussed. PART II. The mechanism and the kinetics of the action of diol dehydrase on 3-fluoro-1,2-propanediol, a new substrate for diol dehydrase, were examined. The results of this study lead to a reexamination of the kinetic behavior of the natural substrate, ...
Take advantage of free CureHunter research engine access to explore the best drug and treatment options for any disease. Find out why thousands of doctors, pharma researchers and patient activists around the world use CureHunter every day ...
2dd5: Structure of thiocyanate hydrolase: a new nitrile hydratase family protein with a novel five-coordinate cobalt(III) center.
Each amino acid has a carboxyl group and an amine group. Amino acids link to one another to form a chain by a dehydration reaction which joins the amine group of one amino acid to the carboxyl group of the next. Thus polypeptide chains have an end with an unbound carboxyl group, the C-terminus, and an end with an unbound amine group, the N-terminus. Proteins are naturally synthesized starting from the N-terminus and ending at the C-terminus. ...
Each amino acid has a carboxyl group and an amine group. Amino acids link to one another to form a chain by a dehydration reaction which joins the amine group of one amino acid to the carboxyl group of the next. Thus polypeptide chains have an end with an unbound carboxyl group, the C-terminus, and an end with an unbound amine group, the N-terminus. Proteins are naturally synthesized starting from the N-terminus and ending at the C-terminus.. ...
The worlds first wiki where authorship really matters. Due credit and reputation for authors. Imagine a global collaborative knowledge base for original thoughts.
Reactivity: Cow, Human, Mouse and more. Compare 12 different SDS ELISA Kits & buy the right one directly at antibodies-online.com!