14-3-3 gamma is a member of the 14-3-3 family which consists of 30 kDa proteins that are involved in multiple protein kinase signalling pathways,…
14-3-3 gamma is a member of the 14-3-3 family which consists of 30 kDa proteins that are involved in multiple protein kinase signalling pathways,…
ooh-almost forgot...we had such a great 4th of july here. the weather was great--not too steamy hot and definitely not to cool. we enjoyed an afternoon at paul and mjs--paul made ribs, steaks, burgers, hotdogs and a boston butt. holy crap! can you say C-A-R-N-I-V-O-R-E-S?? everything was great. we all went out on the boat and watched the fireworks. they were literally all around us. it was gorgeous. bryce got to captain the boat and isaac had a hand in choosing what we listened to on the iPod (mostly Bob Marley and Frankie Vallie...hes got great taste!) with all of the great things going on, it was easy to lose focus of why we were out celebrating in the first place, but i was reminded of it when i saw a big american flag on our way home ...
Bscl2 plays a role in browning adipose tissue. Many of us have gone on diets to decrease body fat. But what if you needed to put on fat? People born with Berardinelli-Seip congenital lipodystrophy would do anything to gain just a few pounds. Patients suffering from the disease have mutations in their BSCL2 gene that result in a lack of fatty tissue in the body and a lack of functioning adipoctyes for lipid storage. They develop insulin resistance, accumulate fat in both muscle and the liver, and are prone to type 2 diabetes. Recently, the role of Bscl2 regulation in mature adipocyte maintenance was investigated and the results described in the Journal of Lipid Research.. Two primary forms of adipose tissue are present in the body: white and brown. White adipose tissue, or WAT, mainly functions as energy storage, releasing fatty acids into the bloodstream to feed the body, while brown adipose tissue, or BAT, acts to generate heat by consuming fat stores and is predominant in infants, who cannot ...
The Arabidopsis thaliana heterotrimeric G protein complex is encoded by single canonical Galpha and Gbeta subunit genes and two Ggamma subunit genes (AGG1 and AGG2), raising the possibility that the two potential G protein complexes mediate different cellular processes. Mutants with reduced expression of one or both Ggamma genes revealed specialized roles for each Ggamma subunit. AGG1-deficient mutants, but not AGG2-deficient mutants, showed impaired resistance against necrotrophic pathogens, reduced induction of the plant defensin gene PDF1.2, and decreased sensitivity to methyl jasmonate. By contrast, both AGG1- and AGG2-deficient mutants were hypersensitive to auxin-mediated induction of lateral roots, suggesting that Gbetagamma1 and Gbetagamma2 synergistically inhibit auxin-dependent lateral root initiation. However, the involvement of each Ggamma subunit in this root response differs, with Gbetagamma1 acting within the central cylinder, attenuating acropetally transported auxin signaling, ...
Summary is not available for the mouse gene. This summary is for the human ortholog.] The scaffolding protein encoded by this gene is the main component of the caveolae plasma membranes found in most cell types. The protein links integrin subunits to the tyrosine kinase FYN, an initiating step in coupling integrins to the Ras-ERK pathway and promoting cell cycle progression. The gene is a tumor suppressor gene candidate and a negative regulator of the Ras-p42/44 mitogen-activated kinase cascade. Caveolin 1 and caveolin 2 are located next to each other on chromosome 7 and express colocalizing proteins that form a stable hetero-oligomeric complex. Mutations in this gene have been associated with Berardinelli-Seip congenital lipodystrophy. Alternatively spliced transcripts encode alpha and beta isoforms of caveolin 1.[provided by RefSeq, Mar 2010 ...
Mouse polyclonal antibody raised against a partial recombinant BSCL2. BSCL2 (NP_116056, 263 a.a. ~ 354 a.a) partial recombinant protein with GST tag. (H00026580-A02) - Products - Abnova
Complete information for YWHAG gene (Protein Coding), Tyrosine 3-Monooxygenase/Tryptophan 5-Monooxygenase Activation Protein Gamma, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene Compendium
Extruded polystyrene (XPS) is a rigid polystyrene foam board with small, closed cells (bubbles). Polystyrene has a high insulating factor of R4 to R5 per inch.
Mutations in the BSCL2 gene underlie human type 2 Berardinelli-Seip congenital lipodystrophy (BSCL2) disease. Global Bscl2-/- mice recapitulate human BSCL2 lipodystrophy and results in the development of insulin resistance and hypertrophic cardiomyopathy. The pathological mechanisms underlying the development of lipodystrophy and cardiomyopathy in BSCL2 are controversial. Here we report that Bscl2-/- mice develop cardiac hypertrophy because of increased basal IGF1 receptor-mediated (IGF1R-mediated) PI3K/AKT signaling. Bscl2-/- hearts exhibited increased adipose triglyceride lipase (ATGL) protein stability and expression causing drastic reduction of glycerolipids. Excessive fatty acid oxidation was overt in Bscl2-/- hearts, partially attributing to the hyperacetylation of cardiac mitochondrial proteins. Intriguingly, pharmacological inhibition or genetic inactivation of ATGL could rescue adipocyte differentiation and lipodystrophy in Bscl2-/- cells and mice. Restoring a small portion of fat mass ...
Metabolic & Genetic Information Center Inborn erros of metabolism LIPODYSTROPHY, CONGENITAL GENERALIZED, TYPE 2 CGL2 BERARDINELLI-SEIP CONGENITAL LIPODYSTROPHY, TYPE 2
Mutations in BSCL2 gene underlie human Congenital Generalized Lipodystrophy type 2 (CGL2) diseases. CGL2 is an autosomal recessive disorder characterized by a ...
Humrich J، Bermel C، Bünemann M، وآخرون. (2005). "Phosducin-like protein regulates G-protein betagamma folding by interaction with tailless complex polypeptide-1alpha: dephosphorylation or splicing of PhLP turns the switch toward regulation of Gbetagamma folding.". J. Biol. Chem. 280 (20): 20042-50. PMID 15745879. doi:10.1074/jbc.M409233200. ...
Congenital generalized lipodystrophy (also called Berardinelli-Seip congenital lipodystrophy) is a rare condition characterized by an almost total lack of fatty (adipose) tissue in the body and a very muscular appearance. Adipose tissue is found in many parts of the body, including beneath the skin and surrounding the internal organs. It stores fat for energy and also provides cushioning. Congenital generalized lipodystrophy is part of a group of related disorders known as lipodystrophies, which are all characterized by a loss of adipose tissue. A shortage of adipose tissue leads to the storage of fat elsewhere in the body, such as in the liver and muscles, which causes serious health problems.. The signs and symptoms of congenital generalized lipodystrophy are usually apparent from birth or early childhood. One of the most common features is insulin resistance, a condition in which the bodys tissues are unable to recognize insulin, a hormone that normally helps to regulate blood sugar levels. ...
... is a putative modulator of heterotrimeric G proteins. The protein shares extensive amino acid sequence homology with phosducin, a phosphoprotein expressed in retina and pineal gland. Both phosducin-like protein and phosphoducin have been shown to regulate G-protein signaling by binding to the beta-gamma subunits of G proteins. [provided by RefSeq, Jul 2008 ...
Amino Acid SequenceMGSSHHHHHH SSGLVPRGSH MGSMPALHIE DLPEKEKLKM EVEQLRKEVK LQRQQVSKCS EEIKNYIEER SGEDPLVKGI PEDKNPFKEK GSC.DescriptionGNG11 Human Recombinant produced in E. coli is. a single polypeptide chain containing 93 amino acids (1-70) and having a molecular mass of 10.6kDa. GNG11 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.FormulationThe GNG11 solution (1mg/ml) contains 20mM Tris-HCl buffer (pH 8.0), 0.15M NaCl, 10% glycerol and 1mM DTT.Physical AppearanceSterile Filtered clear solution.PurityGreater than 90% as determined by SDS-PAGE.SourceEscherichia Coli.StabilityStore at 4°C if entire vial will be used within 2-4 weeks. Store frozen at -20°C for longer periods of time. For long term storage it is recommended to add a carrier protein (0.1% HSA or BSA).Avoid multiple freeze-thaw cycles.SynonymsGNGT11, Guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-11, GNG11.Linkhttp://www.prospecbio.com/GNG11_Human_10
GNG12 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 92 aa (1-69 a.a) and having a molecular mass of 10.1kDa.
The phosphorylation of heptahelical receptors by heterotrimeric guanine nucleotide-binding protein (G protein)-coupled receptor kinases (GRKs) is a universal regulatory mechanism that leads to desensitization of G protein signaling and to the activation of alternative signaling pathways.We determined the crystallographic structure of bovine GRK2 in complex with G protein beta1gamma2 subunits.Our results show how the three domains of GRK2-the RGS (regulator of G protein signaling) homology, protein kinase, and pleckstrin homology domains-integrate their respective activities and recruit the enzyme to the cell membrane in an orientation that not only facilitates receptor phosphorylation, but also allows for the simultaneous inhibition of signaling by Galpha and Gbetagamma subunits ...
Reaktivität: Rind (Kuh), Pferd, Human and more. 68 verschiedene SIRPG Antikörper vergleichen. Alle direkt auf antikörper-online bestellbar!
SIRPG - SIRPG (untagged)-Human signal-regulatory protein gamma (SIRPG), transcript variant 1 available for purchase from OriGene - Your Gene Company.
Build: Wed Jun 21 18:33:50 EDT 2017 (commit: 4a3b2dc). National Center for Advancing Translational Sciences (NCATS), 6701 Democracy Boulevard, Bethesda MD 20892-4874 • 301-435-0888. ...
Use Bio-Rads PrimePCR assays, controls, templates for your target gene. Every primer pair is optimized, experimentally validated, and performance guaranteed.
Use Bio-Rads PrimePCR assays, controls, templates for your target gene. Every primer pair is optimized, experimentally validated, and performance guaranteed.
... is a disorder characterized by loss of adipose tissue and, usually, metabolic disturbance due to deficiency of hormones derived from these tissues, most importantly leptin. Generalized lipodystrophy (GL) may be divided in congenital GL, also known as Berardinelli-Seip syndrome and acquired GL, referred to as Lawrence syndrome.… Generalized Lipodystrophy (Berardinelli Seip Syndrome): Read more about Symptoms, Diagnosis, Treatment, Complications, Causes and Prognosis.
This gene encodes a member of the 1-acylglycerol-3-phosphate O-acyltransferase family. The protein is located within the endoplasmic reticulum membrane and converts lysophosphatidic acid to phosphatidic acid, the second step in de novo phospholipid biosynthesis. Mutations in this gene have been associated with congenital generalized lipodystrophy (CGL), or Berardinelli-Seip syndrome, a disease characterized by a near absence of adipose tissue and severe insulin resistance. Alternate transcriptional splice variants, encoding different isoforms, have been characterized ...
Ric-8A and Ric-8B are positive regulators of heterotrimeric G protein a subunit function. We have recently defined the cellular action of Ric-8 proteins towards...
Thank you for your interest in spreading the word about Biochemical Society Transactions.. NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address.. ...
Complete information for GNG3 gene (Protein Coding), G Protein Subunit Gamma 3, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene Compendium
Lipodystrophies are disorders of adipose tissue (fat) characterized by selective loss of fat from various parts of the body. There are several different types of lipodystrophies and the degree of fat loss may vary from very small depressed areas to near complete absence of adipose tissue. The extent of fat loss may determine the severity of metabolic complications related to insulin resistance, such as diabetes mellitus and high levels of serum triglycerides. Some patients may have only cosmetic problems while others may also have severe metabolic complications.. Inherited lipodystrophies are caused by mutations (alterations or blips) in a gene. Several genes responsible for different types of inherited lipodystrophies have been identified. These include AGPAT2 (1-acylglycerol-3-phosphate-O-acyltransferase 2), BSCL2 (Berardinelli-Seip congenital lipodystrophy 2) in Congenital Generalized Lipodystrophy (CGL), Lamin A/ C (LMNA) gene in Familial Partial Lipodystrophy Dunnigan variety (Familial ...
We identified the transcription factor E2F8 in the course of a screen for novel activators of heterotrimeric G proteins. In S. cerevisiae, E2F8 was able to activate a G protein/MAP kinase reporter pathway; this activity was specific for particular G protein isoforms, mapped epistatically to the level of heterotrimers, and was antagonized by a GTPase-accelerating protein. The amino-terminus of the protein appeared to be most important for G protein activation. The most parsimonious interpretation of these results is that E2F8 stimulates nucleotide exchange on the α subunit of heterotrimeric G proteins. Since E2F8 did not reduce the maximal receptor-mediated signal (Figure 2), but rather caused a left-shift in the receptors dose-response curve, E2F8 does not compete with receptors for G proteins. Instead, E2F8 and receptors may be complementary to one another in their mode of action, using different molecular mechanisms to activate Gα.. G protein activation would be a novel function for an E2F ...
Reactome is pathway database which provides intuitive bioinformatics tools for the visualisation, interpretation and analysis of pathway knowledge.
Extensive DNA sequencing analysis has shown the following: The three babies have a normal chromosome with a normal Ggamma gene and a normal Agamma gene. The Ggamma gene of the second chromosome of the Hb F-Charlotte baby is also normal, but that of the Hb F-Waynesboro baby is mutated at codon 75 (GgammaX with ATA->ACA or Ile->Thr). Thus, the total Ggamma level in the Hb F from the Hb F-Charlotte baby is normal at 72.5%, and that in the Hb F-Waynesboro baby is also normal [Ggamma (43.0%) + gammaX (29.2%) = 72.2%]. The sequences of the Agamma genes in both babies suggest a limited gene conversion by replacing a segment of the Agamma gene by that of a Ggamma gene, which makes the 3 end of the gene different from that of a normal Agamma gene. Both hybrid genes have an ATA->ACA mutation at codon 75 (Ile->Thr), while that in the Hb F-Charlotte baby has an additional GCA->GGA mutation at codon 136. The products of these hybrid genes will occupy different positions in the chromatogram ...
AGPAT1兔多克隆抗体(ab125874)可与人样本反应并经WB实验严格验证。中国75%以上现货,所有产品均提供质保服务,可通过电话、电邮或微信获得本地专属技术支持。
AGPAT5兔多克隆抗体(ab82783)可与人样本反应并经WB, ELISA实验严格验证,被1篇文献引用并得到3个独立的用户反馈。所有产品均提供质保服务,中国75%以上现货。
Introduction: Congenital generalized lipodystrophies (CGL); autosomal recessive disorders characterized by dyslipidemia and almost complete absence of body fat associated with insulin resistance. It develops due to mutations in AGPAT2, BSCL2, CAV1, PTRF, PCYT1A and PPAR, genes.CGL type 4 results from PTRF-CAVIN gene mutation. Unlike classical CGL, myopathy, flat and skeletal muscle hypertrophy, heart rhythm disorders (sudden death) and skeletal abnormalities are seen.. Case: 9 years and 4 months old male patient. She presented with weakness, muscle weakness, difficulty in walking, and elevation of blood fat. The patients history revealed a 34-weeks age of 2800 g, birth, pyloric stenosis at 40 days of age and a 5-years-old undescended testis surgery. The mother and father were cousins of the 1st degree and he received LT4 treatment in the other center from 7 months to 6 years of age due to hypothyroidism. Physical examination weight: 31.7 kg (50-75p), Height: 143.5 cm (75-90p), dysmorphic ...
Combining with an extracellular amine and transmitting the signal across the membrane by activating an associated G-protein; promotes the exchange of GDP for GTP on the alpha subunit of a heterotrimeric G-protein complex.
Order GNG11 ELISA Kits for many Reactivities. and more. Compare GNG11 ELISA Kits and find the right product on antibodies-online.com.
pFN21AE3002 4909 bp TCAATATTGGCCATTAGCCATATTATTCATTGGTTATATAGCATAAATCAATATTGGCTA TTGGCCATTGCATACGTTGTATCTATATCATAATATGTACATTTATATTGGCTCATGTCC AATATGACCGCCATGTTGGCATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGG GTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCC GCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCAT AGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGC CCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTCCGCCCCCTATTGACGTCAATGA CGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTACGGGACTTTCCTACTTG GCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACAC CAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGT CAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAATAACCC CGCCCCGTTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGC TGGTTTAGTGAACCGTCAGATCACTAGAAGCTTTATTGCGGTAGTTTATCACAGTTAAAT TGCTAACGCAGTCAGTGCTTCTGACACAACAGTCTCGAACTTAAGCTGCAGAAGTTGGTC GTGAGGCACTGGGCAGGTAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAA ACTGGGCTTGTCGAGACAGAGAAGACTCTTGCGTTTCTGATAGGCACCTATTGGTCTTAC ...
Berlin, S., Hadad, E., Heled, Y., and Moran, D.S. (2004). The Efficacy of Nutritional Supplements upon Physical Exercise. Journal of Israeli Military Medicine 1(2), 72-80.. Berlin, S., Shalit, L., Yarom, Y., and Moran, D.S. (2007). Metabolic rate prediction by massless actigraphy for outdoor activities. Mil Med 172, 882-887.. Eliyahu, U., Berlin, S., Hadad, E., Heled, Y., and Moran, D.S. (2007). Psychostimulants and military operations. Mil Med 172, 383-387.. Rubinstein, M., Peleg, S., Berlin, S., Brass, D., and Dascal, N. (2007). Galphai3 primes the G protein-activated K+ channels for activation by coexpressed Gbetagamma in intact Xenopus oocytes. J Physiol 581, 17-32.. Berlin S. (2009). Do bigger and "better" labs have easier access to high impact factor journals? Science signaling. December 9th, E-letter. http://stke.sciencemag.org/content/2/99/eg15.e-letters (Addition to Living by The Numbers- Michael B. Yaffe; 01 Dec 2009: Vol. 2, Issue 99, pp. eg15, doi: 10.1126/scisignal.299eg15).. Lvov, ...
Cells usually activate the cyclic AMP (cAMP, or adenosine 3′,5′-monophosphate)-dependent protein kinase through G protein (heterotrimeric guanine nucleotide-binding protein)-coupled receptors, which activate G proteins, which in turn control the activity of adenylyl cyclase, the enzyme that makes cAMP. Peeters et al., however, report that in yeast, and just maybe in mammalian cells as well, there appears to be a more direct route to activation of the cAMP-dependent protein kinase (PKA). Peeters et al. studied the roles of Krh1 (kelch-repeat homologue 1, also called Gpb2) and Krh2 (also called Gpb1). Krh1 and Krh2 associate with the yeast G protein α subunit Gpa2, which appears not to interact with canonical G protein β-γ subunits. Interestingly, the Krh1 and Krh2 proteins have the seven-bladed β-propeller structure characteristic of Gβ proteins. Deletion of Krh1 and Krh2 resulted in a phenotype indicative of high PKA activity, but there was no associated increase in the abundance of ...
We have been addressing this issue for the last few years. There are no simple answers unfortuantely. The cause of this type of wasting - lipodystrophy or LD - is not clearly tied to the HIV...
These researchers developed a therapy to lower blood sugar in type 1 diabetic mice. They conducted gene microarray analysis under various conditions to test their hypotheses and to attempt to develop novel candidates for anti-diabetes therapies. They used the BSCL and CGL for their research.. ...
Gi/o-coupled G-protein coupled receptors (GPCRs) can exert an inhibitory effect on vesicle release through several G-protein driven mechanisms, more than one of which may be concurrently present in individual presynaptic terminals. The synaptosomal-associated protein of 25 kDa (SNAP25) is a key downstream effector of G protein betagamma (Gβγ) subunits. It has previously been shown that proteolytic cleavage of SNAP25 by botulinum toxin A (BoNT/A) reduces the ability of Gβγ to compete with the calcium sensor synaptotagmin 1 (Syt1) for binding to SNAP25 in a calcium-dependent manner. These truncated SNAP25 proteins sustain a low level of exocytosis but are unable to support serotonin-mediated inhibition of exocytosis in lamprey spinal neurons. Here, we generate a SNAP-5 extreme C-terminal mutant that is deficient in its ability to bind Gβγ while retaining normal calcium-dependent Syt1 binding to SNARE and vesicle release. The SNAP25Δ3 mutant, in which residue G204 is replaced by a stop ...
The KOMP Repository is located at the University of California Davis and Childrens Hospital Oakland Research Institute. Question? Comments? For Mice, Cells, and germplasm please contact us at [email protected], US 1-888-KOMP-MICE or International +1-530-752-KOMP, or for vectors [email protected] or +1-510-450-7917 ...
Information transfer from activated heterotrimeric guanine nucleotide-binding proteins (G proteins) to downstream effectors occurs through noncovalent protein-protein interactions. Such interactions involve multiple regions of contact between the G protein and the effector. Some of these regions mediate information transfer, as defined by their ability to change the activity of their downstream binding partners, whereas other interactions appear to contribute solely to binding affinity. Such modular configurations occur in functionally diverse proteins such as myosin and a regulator of the double-stranded DNA stimulated protein kinase (PKR) called PACT. In most cases, it appears that both charge complementarity and the architecture of the interacting surfaces provide the appropriate balance between specificity of interactions and their reversibility. Information transfer regions appear to display conformational flexibility in interactions. Such flexible interactions may be essential for the ...
Regulation of low-voltage activated T-type Ca2+ channel activity by kinases and heterotrimeric G-proteins and their roles in physiological responses.. ...
Thanks for being a loyal reader! One survey in Germany suggested that over 3 years of treatment (generally with d4T or AZT and a PI) about one third of patients had some signs. More recent studies...