Hepatitis C virus (HCV) genotyping is a tool used to optimize antiviral treatment regimens. The newly developed Versant HCV genotype assay (LiPA) 2.0 uses sequence information from both the 5 untranslated region and the core region, allowing distinction between HCV genotype 1 and subtypes c to l of genotype 6 and between subtypes a and b of genotype 1. HCV-positive samples were genotyped manually using the Versant HCV genotype assay (LiPA) 2.0 system according to the manufacturers instructions. For the comparison study, Versant HCV genotype assay (LiPA) 1.0 was used. In this study, 99.7% of the samples could be amplified, the genotype of 96.0% of samples could be determined, and the agreement with the reference method was 99.4% when a genotype was determined. The reproducibility study showed no significant differences in performance across sites (P = 0.43) or across lots (P = 0.88). In the comparison study, 13 samples that were uninterpretable or incorrectly genotyped with Versant HCV genotype ...
© 2014 The Authors. Hepatitis C virus (HCV) exhibits high genetic diversity, characterized by regional variations in genotype prevalence. This poses a challenge to the improved development of vaccines and pan-genotypic treatments, which require the consideration of global trends in HCV genotype prevalence. Here we provide the first comprehensive survey of these trends. To approximate national HCV genotype prevalence, studies published between 1989 and 2013 reporting HCV genotypes are reviewed and combined with overall HCV prevalence estimates from the Global Burden of Disease (GBD) project. We also generate regional and global genotype prevalence estimates, inferring data for countries lacking genotype information. We include 1,217 studies in our analysis, representing 117 countries and 90% of the global population. We calculate that HCV genotype 1 is the most prevalent worldwide, comprising 83.4 million cases (46.2% of all HCV cases), approximately one-third of which are in East Asia. Genotype 3 is
Genotype Genotype_name UNIQUE ?Text // e.g. unc-1(e103);unc-2(e234) Genotype_component Gene ?Gene XREF Component_of_genotype #Evidence Variation ?Variation XREF Component_of_genotype UNIQUE Text // Zygosity Rearrangement ?Rearrangement XREF Component_of_genotype UNIQUE Text // Zygosity Transgene ?Transgene XREF Component_of_genotype UNIQUE Text // Zygosity // Zygosity text entry should be one of the following: // Homozygous, Heterozygous_with_wildtype, or Heteroallelic_combination Other_component UNIQUE ?Text // Free text components including RNAi Is_genotype_for_strain ?Strain XREF Genotype Has_background_strain UNIQUE ?Strain XREF Is_background_for // Only use when NOT N2 Relation_to_other_genotypes Has_maternal_genotype UNIQUE ?Genotype XREF Is_maternal_genotype_for Has_paternal_genotype UNIQUE ?Genotype XREF Is_paternal_genotype_for Is_maternal_genotype_for ?Genotype XREF Has_maternal_genotype Is_paternal_genotype_for ?Genotype XREF Has_paternal_genotype Disease_info Models_disease ...
The diagnosis of mixed genotype hepatitis C virus (HCV) infection is rare and information on incidence in the UK, where genotypes 1a and 3 are the most prevalent, is sparse. Considerable variations in the efficacies of direct-acting antivirals (DAAs) for the HCV genotypes have been documented and the ability of DAAs to treat mixed genotype HCV infections remains unclear, with the possibility that genotype switching may occur.. In order to estimate the prevalence of mixed genotype 1a/3 infections in Scotland, a cohort of 512 samples was compiled and then screened using a genotype-specific nested PCR assay. Mixed genotype 1a/3 infections were found in 3.8% of samples tested, with a significantly higher prevalence rate of 6.7% (p,0.05) observed in individuals diagnosed with genotype 3 infections than genotype 1a (0.8%). An analysis of the samples using genotypic-specific qPCR assays found that in two-thirds of samples tested, the minor strain contributed ,1% of the total viral load. The potential ...
Hepatitis C virus (HCV) genotype and other host and viral factors influence treatment outcome in chronic HCV infection. We evaluated the effect of race and genotype on interferon and ribavirin treatment outcome in 70 Southeast Asian (SEA) and 50 white patients. Genotype was based on the 5 untranslated region (5UTR) with a commonly used line probe assay (INNO-LiPA HCV II) that may mistype genotype 7, 8, or 9 as 1b. HCV core region sequencing resulted in reclassification of 8 genotype 1 and 25 genotype 1b SEA subjects as genotype 7, 8, or 9. Twenty-six SEA genotype 7, 8, and 9 (79%) and 10 SEA true genotype 1b (59%) patients achieved a sustained virologic response (SVR) compared with 15 (34%) white genotype 1b patients. Logistic regression analysis showed that SEA patients with genotype 7, 8, or 9 were more likely to achieve a SVR than white genotype 1b patients (OR 16.56; 95%CI 4.16, 65.91) as were SEA true genotype 1b patients compared with white genotype 1b patients (OR 4.63; 95%CI 1.19, ...
Probing gene-environment interactions that affect neural processing is crucial for understanding individual differences in behavior and disease vulnerability. Here, we tested whether the current environmental context, which affects the acute brain state, modulates genotype effects on brain function
The goal of the present study was to examine the hypothesis of the physical association of multiple genotypes in a single OB for the maintenance of virus diversity. Previous studies have demonstrated that during the systemic phase of infection, single cells in an insect can be co-infected by multiple BV particles, each carrying a single genotype (Godfray et al. 1997; Bull et al. 2001). To maintain genetic diversity during between-host transmission, it is necessary that the larva acquire different genotypes at the moment of primary infection. As the number of OBs required to kill a larva is usually low, the occurrence of multiple genotype infection would be improbable for highly susceptible larvae that can be infected by a single or very few OBs. Under these conditions, maintaining diversity within a larva could be compromised if genotypes are segregated among different OBs, except perhaps during the course of an epizootic, when unusually high densities of OBs may be present briefly in the ...
Find all HIV Genotype Assay Labs in Gurgaon Sector 54,Gurgaon. Now View Prices, Normal Range, Sample Results & Book Online for HIV Genotype Assay Labs in Gurgaon Sector 54 Gurgaon only on | Practo
Find all HIV Genotype Assay Labs in Gurgaon Sector 52,Gurgaon. Now View Prices, Normal Range, Sample Results & Book Online for HIV Genotype Assay Labs in Gurgaon Sector 52 Gurgaon only on | Practo
PCR-Based Genotyping Methods. An introduction to PCR-RFLP/CAPS, and dCAPS. Common PCR-based Genotyping Methods for SNP Analysis. SNPs can have up to 4 alleles (A/C/G/T), but two alleles are most common . These methods can only positively detect one allele. PCR -RFLP / CAPS Slideshow 6726805 by tatiana-stanley
The relationships among isolates of bacterial species typically are displayed with a clustering algorithm, which identifies closely related genotypes but, in the absence of a realistic model of clonal expansion, provides no information about the founding genotypes or the likely patterns of evolutionary descent within the clusters. We address this important problem by using a new implementation of an algorithm that extracts this information from MLST data (or, in principle, other multilocus data). A full description of the features of eBURST is available in the documentation provided at http://eburst.mlst.net . The BURST algorithm was also recently incorporated as a set of priority rules into the minimum-spanning-tree method within the latest BioNumerics cluster analysis module (Applied Maths, Sint-Martens-Latem, Belgium).. The S. pneumoniae example is a very simple one, because the selected clonal complex is less than 50 years old and all isolates (except for a single DLV) are SLVs of the ...
Background: Hepatic steatosis in HCV patients has been postulated as a risk factor associated with a higher frequency of fibrosis and cirrhosis. A single genetic variant, PNPLA3 I148M, has been widely associated with increased hepatic steatosis. Previous studies of the PNPLA3 I148M sequence variant in HCV infected individuals have reported an association between this variant and prevalence of steatosis, fibrosis, and cirrhosis. To evaluate the impact of PNPLA3 I148M variant on metabolic traits and treatment response in HCV genotype 2 and 3 infected patients.. Methods. Three hundred and eighty-two treatment naïve HCV genotype 2 or 3 infected patients were included in a phase III, open label, randomized, multicenter, investigator-initiated trial (the NORDynamIC study), in which pretreatment liver biopsies were mandatory. PNPLA3I148M genotyping was performed in a total of 359 Caucasian patients.. Results: In HCV genotype 2 infected patients carrying the PNPLA3 148M allele, there was significantly ...
A variety of molecular typing techniques have been developed to investigate the clonal relationship among bacterial isolates, including those associated with nosocomial infections. In this study, the authors evaluated whole-genome mapping as a tool to investigate the genetic relatedness between Pseu …
Genotype frequency is the proportion or frequency of any particular genotype among the individuals of a population. Genotype frequencies are a function of gene frequencies. Genotype is the sum total of the genetic information (genes) contained in the linkage structures (chromosomes) of the pro- and eukaryotes, as distinguished from their phenotype. The genotype determines not a unique phenotype, but a range of phenotypic capacities referred to as an individuals norm of reaction to the environment (Rieger et al., 1976 ...
For example, there is 70% penetrance if only 700 individuals express red phenotype out of 1,000 HairredHairred individuals. If penetrance of a phenotype is not 100%, then it has reduced penetrance. Mechanisms of reduced penetrance are not always clear. Expressivity is another important concept in describing genotype-phenotype correlation. Expressivity describes the severity of a phenotype among individuals with the same genotype. For example, if a condition has variable expressivity then one individual might have mild symptoms while another might have severe symptoms (although they have the same genotype). If a trait has constant expressivity then individuals with the same genotype will have the same degree of symptoms.. Mechanisms of variable expressivity are not always clear. Although there is typically a clear genotype-phenotype correlation that associates a specific allele with a specific phenotype, this link is frequently muddled. Even individuals with identical genotypes can have different ...
Of the 170 million patients who are chronically infected with HCV worldwide, approximately half have HCV genotypes other than genotype 1, including about one third of patients with HCV in the United States.17 Currently approved regimens of direct-acting antiviral agents are not equally effective across all genotypes, which means that testing to determine genotype and subtype is required before treatment can be initiated.6,7 A single combination regimen that is effective in all patients regardless of HCV genotype would obviate the need for pretreatment testing, which is an obstacle to treatment in resource-limited settings and may limit treatment uptake outside of specialty clinics.18 In this international, randomized, double-blind, placebo-controlled phase 3 study, treatment with sofosbuvir-velpatasvir for 12 weeks resulted in high rates of sustained virologic response in patients with HCV genotype 1, 2, 4, 5, or 6, including those with cirrhosis and those who had received previous treatment and ...
ANOVA is a tool that can be used to test for differences among treatment means when the independent variable is categorical (e.g., genotypes could be AA, Aa, aa) and the dependent variable is continuous (e.g., yield measured in tons/acre). How does this work?. In ANOVA, the total variance of all samples is calculated. Portions of the total variance can be attributed to known causes (e.g., genotype). This leaves a residual portion of the variance that is uncontrolled or unexplained and is referred to as experimental error. Then the between-treatment variation (e.g., AA genotype variation vs. Aa genotype variation vs. aa genotype variation) is compared to the within-treatment variation (experimental error) (e.g., variation within the aa genotype) to assess whether differences in mean value between treatments are due to the treatment effects or chance.. In the simplest case, linear equations can be developed to describe the relationship between a trait and treatment. The question can then be asked, ...
The single-nucleotide polymorphism SLC39A6 rs1050631 is strongly implicated in esophageal squamous cell carcinoma, leading us to question whether it may also play a role in gastric adenocarcima (GA). We genotyped the SLC39A6 rs1050631 in 512 patients who underwent GA resection. All study subjects lived in an area of China with high GA incidence. Genotypes were examined for possible correlation with survival and recurrence. The potential involvement of SLC39A6 in gastric cancer was explored in clinical samples and cell culture studies. Multivariable analysis showed that patients with the CT + TT genotype at SLC39A6 rs1050631 were at greater risk of recurrence (hazard ratio, HR 1.387, p = 0.004) and death (HR 1.429, p = 0.002) than patients with CC genotype. Median recurrence-free and overall survival were significantly shorter in patients with the CT + TT genotype (20, 27 months) than in patients with the CC genotype (36, 43 months, p = 0.001, p | 0.001). Patients with the CT + TT genotype who were male
Analysis of rare variants is currently a major focus of genetic studies of human disease. Single-nucleotide polymorphism (SNP) genotypes can be assayed using microarray genotyping or by sequencing, but neither technology produces perfect genotype calls, especially at rare SNPs. Studies that collect both types of data are becoming increasingly common, so it may be possible to combine data types to increase accuracy. We present a method, called Chiamante, which calls genotypes on individuals with either array data, sequence data, or both. The model adapts to data quality and can estimate when either the array or the sequence data should be ignored when calling the genotypes at each SNP. As a special case, our method will call genotypes from only array data and outperforms existing methods in this scenario. We have applied our method to array and sequence data from Phase I of the 1000 Genomes Project and show that it provides improved performance, especially at rare SNPs. This method provides a foundation
Supplement The genotype refers to the entire set of genes in a cell, an organism, or an individual. A gene for a particular character or trait may exist in two allelic forms; one is dominant (e.g. A) and the other is recessive (e.g. a). Based on this, there could be three possible genotypes for a particular character. For instance, a genotype of AA delineates homozygous dominance whereas a genotype of Aa is an example of heterozygous dominance. A genotype of aa is an instance of homozygous recessive. The genotype is a major factor that determines the phenotype of an organism. For example, the genotype determines the color of the petal of a pea plant. ...
The shared genotyping facility is expected to increase throughput ten-fold and reduce costs by about 75-80% in comparison to current procedures. Lowering the genotyping cost will enable CGIAR and other public sector breeders to utilize marker-based selection in forward breeding and also change their current breeding procedures to take advantage of low-cost genotyping. It will be then possible to generate several-fold higher numbers of lines and select them with diagnostic markers for key traits before phenotyping, increasing selection intensity for yield and selection accuracy for other traits. This will accelerate genetic gains in CGIAR mandate crops. The genotyping data demand across from all/leading CGIAR Centers can be aggregated, the costs can be brought down in the range of US$ 1-5 per sample (with 10-100 markers). ...
Results. For the CD4 -11743A/C polymorphism, patients with RA demonstrated significantly higher frequency of the C allele (p = 0.048); patients with SLE had significantly higher frequency of the CC genotype (p = 0.026), and lower frequency of the AC genotype (p = 0.013) compared with controls. For the CD4 -10845A/G polymorphism, patients with RA had significantly higher frequencies of the AA genotype (p = 0.047) and the A allele (p = 0.026); patients with SLE had significantly higher frequency of the AA genotype (p = 0.011) and A allele (p = 0.001), and lower frequency of the GG genotype (p = 0.003) compared with controls. A comparison of genotype groups according to different clinical variables revealed the association of the respective polymorphisms with mucosal ulcer lesions among patients with SLE ...
RESULTS: We found that the most prevalent genotype was Apo Eε3/3, followed in order by Apo Eε3/4 and Apo Eε2/2. The estimated ApoE allelic frequencies in individuals with SD were 0.095, 0.560, and 0.345 for ε2, ε3, and ε4, respectively. In controls, the corresponding Apo E allelic frequencies were 0.146, 0.699, and 0.155. The percentage of ε4 allele carriers in SD group was significantly higher than that in control group ( ...
22 Genome-wide association studies of complex traits are often complicated by relatedness 23 among individuals. Ignoring or inappropriately accounting for relatedness often results in 24 inflated type I error rates. Either genotype or pedigree data can be used to estimate relat25 edness for use in mixed-models when undertaking QTL mapping. We performed simulations 26 to investigate methods for controlling type I error and optimizing power considering both 27 full and partial pedigrees and, similarly, both sparse and dense marker coverage; we also ex28 amined real data sets. 1) When marker density was low, estimating relatedness by genotype 29 data alone failed to control the type I error rate; 2) this was resolved by combining both 30 genotype and pedigree data. 3) When sufficiently dense marker data was used to estimate 31 relatedness, type I error was well controlled and power increased; however, 4) this was only 32 true when the relatedness was estimated using genotype data that excluded genotypes on
The sensitivity of genotype-based diagnostics that predict antimicrobial susceptibility is limited by the extent to which they detect genes and alleles that lead to resistance. As novel resistance variants are expected to emerge, such sensitivity is expected to decline unless the new variants are detected and incorporated into the diagnostic. Here, we present a mathematical framework to define how many diagnostic failures may be expected under varying surveillance regimes and thus quantify the surveillance needed to maintain the sensitivity of genotype-based diagnostics. ...
We use cookies to ensure that we give you the best experience on our website. If you click Continue well assume that you are happy to receive all cookies and you wont see this message again. Click Find out more for information on how to change your cookie settings ...
lane 1 represents homozygous CC genotypes, lane 2 and 5 represents heterozygous AC genotypes and lane 3, 4, 6, and 7 represents homozygous AA genotypes of A20C
Recently with the rapid improvements in high-throughout genotyping techniques, researchers are facing the very challenging task of analyzing large-scale genetic associations, especially at the whole-genome level, without an optimal solution. genotype data, it does not require any computationally rigorous phasing program to account for uncertain haplotype phase. Background Currently, with Artesunate the availability of large-scale genotyping technologies, the genotyping cost of genome-wide association (GWA) studies has been largely reduced and a boom of large-scale GWA studies is underway. Nevertheless, the success of most association studies is based on the linkage disequilibrium (LD) between the functional mutations and markers in a local region of the genome. Varieties of statistical methods that rely on LD pattern have been developed to map functional variants (Spielman et al. 1993; Olson et al. 1994; Rannala and Reeve 2001; Ardlie et al. 2002). The most straightforward approach of LD-based ...
Mean age of patients was 78±6.7 years with a baseline VA of 51±17 ETDRS letter scores. Mean change in VA was +6.8±12.3, +5.1±13.4 and 3.3±14.9 letters at 3, 6 and 12 months, respectively. Patients received 4.2±1.1 and 6.4±2.3 injections in the first 6 and over 12 months, respectively. The AA genotype at rs11200638 (HTRA1 promoter SNP) predicted a better outcome of +7 and +9 letters after 6 (p= 0.003) and 12 months (p,0.0001), respectively. Similarly, the CC genotype at rs3793917 (LOC387715/ARMS2) was associated with increased VA outcome of +7 letters after 6 (p=0.006) and 12 months (p=0.001), whereas the TT genotype at rs10490924 (LOC387715/ARMS2) predicted a poorer VA response of -7 and -8 letters at 6 (p=0.004) and 12 months (p=0.001).. ...
8. Subjects must have an eligible CFTR genotype as noted below. If the screening CFTR genotype result is not received before the Run-in Period (Part 2) or randomization (Parts 1 and 3), a previous CFTR genotype laboratory report may be used to establisheligibility. Subjects who have been enrolled and whose screening genotype does not confirm study eligibility must be discontinued from the study ...
A number of factors are associated with an increased risk of developing adult-onset multiple sclerosis (MS), including modulated immune function, vitamin D insufficiency, the human leukocyte antigen (HLA) genotype, and interaction with the Epstein-Barr virus. Interestingly, some of these risk factors are also associated with being obese.. Although the study is limited by using self-reported BMIs at the age of 20 years and non-standarized methods of genotyping, the findings still have impact. Five years ago (2009-2010), 16.9% of children and adolescents in the United States were obese. This may translate into a growing population of people with MS in the future. Although there is no control over genes, there is control over BMI: perhaps a reduction in the number of obese adolescents will contribute to a reduction of the incidence of MS. However, this should be interpreted cautiously: there is only a correlation between obesity and MS, which does not mean causation.. To read more about the study, ...
6.Lab 6 - If youve seen differences in the distribution of phenotypes in Tm4 over-expressing B35 cells versus control B35 cells, describe these differences. Formulate a hypothesis with regards to what changes on the molecular level may have occurred due to the over-expression of Tm4 that lead to morphological changes that you have observed Genotype A corresponded to the tm4 over-expressing B35, while Genotype B corresponded to the wildtype control B35 cells. Between these two genotypes differences in their distribution of phenotypes was observed through total cell counts. In the control B35 cells, the majority of cells were of stumped or prolonged phenotypes, with all other phenotypes,(besides fan phenotype with nearly no cells), receiving an equal distribution of remaining cells. However, changes were seen when observing the phenotypes of the Tm4 over-expressing B35 cells, with the majority of cells falling into prolonged and stringed phenotype groups, followed by the stumped phenotype. The ...
As most commonly used within SNPedia, genotype refers to the pair of SNPs inherited at a given chromosomal position, one inherited from Dad, one inherited from Mom. Example: rs1234(A;C) is how we indicate someone with a (A;C) genotype at snp rs1234. However, this definition of genotype varies a bit from the one intended when it first introduced over 100 years ago [10.1126/science.35.896.340], and even from the most common usage in genetics textbooks. Although genotype can refer to an individuals genetic constitution (as a whole), the most typical usage is to refer to the pair of alleles carried by an individual at a given locus (or gene). Alleles are classically defined by their protein products and mode of inheritance (e.g. dominant, recessive, etc.), but at a molecular level, alleles may also be defined by one or more co-inherited SNPs. See also Magnitude and Repute Notable genotypes ...
As most commonly used within SNPedia, genotype refers to the pair of SNPs inherited at a given chromosomal position, one inherited from Dad, one inherited from Mom. Example: rs1234(A;C) is how we indicate someone with a (A;C) genotype at snp rs1234. However, this definition of genotype varies a bit from the one intended when it first introduced over 100 years ago [10.1126/science.35.896.340], and even from the most common usage in genetics textbooks. Although genotype can refer to an individuals genetic constitution (as a whole), the most typical usage is to refer to the pair of alleles carried by an individual at a given locus (or gene). Alleles are classically defined by their protein products and mode of inheritance (e.g. dominant, recessive, etc.), but at a molecular level, alleles may also be defined by one or more co-inherited SNPs. See also Magnitude and Repute Notable genotypes ...
The impact of the common alleles at structural loci coding for apolipoprotein (apos) A-IV, E, and H on 12 quantitative risk factors for cardiovascular disease (apos A-I, A-II, B, C-II, C-III, and E; total cholesterol; triglycerides; high density lipoprotein cholesterol; systolic blood pressure; diastolic blood pressure; and red blood cell sodium-lithium countertransport) was estimated in 453 unrelated individuals (227 men and 226 women) aged 26-63 years from the Rochester Family Heart Study, who were not using medications affecting lipid levels or blood pressure. Each risk factor was adjusted for concomitants (assay date, age, age, squared, height, weight and smoking status) before the genotypic effects on mean levels and variances were estimated. Allele frequencies were the same in men and women and were similar to those observed in other studies of US Caucasians. There were very different gender-specific estimates of the relative contribution of concomitants, measured genetic effects, and ...
The Transgenic Genotyping Service (TGS) provides genotyping for JAX Mice and assay development. TGS also provides speed congenics & mapping projects as well as SNP genotyping services for JAX researchers.. TGSs mission is to produce accurate genotyping results with the shortest turnaround time as inexpensively as possible for our clients within the Jackson Laboratory. TGS strives to be the most efficient genotyping service available and to provide complete satisfaction for its clients.. ...
Exploring the structure of genomes and analysing their evolution is essential to understand the ecological adaptation of organisms. However, with the large amounts of data being produced by Next Generation Sequencing (NGS), computational challenges arise in terms of storage, search, sharing, analysis, and visualisation. This is particularly true regarding genomic variation studies that are currently lacking scalable and user-friendly data exploration solutions. Here we present Gigwa, a web-based tool which provides an easy and intuitive way to explore large amounts of genotyping data by filtering the latter based not only on variant features, including functional annotations, but also on genotype patterns. The data storage relies on MongoDB, which offers good scalability perspectives. Gigwa can handle multiple databases and may be deployed in either single or multi-user mode. Finally, it provides a wide range of popular export formats. The Gigwa application is suitable to manage large amounts of
ROX (6-carboxy-X-rhodamine) is used as a passive reference dye in ROX-dependent real-time PCR instruments to normalize for variations of fluorescence levels that can arise mainly due to optical path variations among wells. Normalisation of the fluorescence intensity (Rn) is done in real-time PCR software by dividing the emission intensity of the specific signal by the emission intensity of ROX.. ROX does not take part in the PCR reaction and its fluorescence levels are not proportional to the quantity of DNA in each well, so the addition of this fluorophore to a mix provides a constant fluorescent signal during amplification.. Different types of real-time PCR instruments requiring a passive reference standard have different optimal concentrations of ROX, mainly due to the different optical configurations of each system (i.e. the different type of excitation source and optics used).. The addition of either too little or too much ROX would result in a very noisy signal impacting on the results of ...
The problems of ascertainment bias and missing information due to genotyping errors are widely recognized as limiting factors in genetic studies. We have conducted the first formal analysis of the effect of novel variants on genotyping arrays, and we have shown that these variants account for a larg …
The notion that there is a one to one mapping from genotype to phenotype was overturned a long time ago. Along with genotype and environment, ‘non-genetic changes’ orchestrated by altered RNA and protein molecules also guide the development of phenotype. The idea that there is a route through which changes in phenotype can lead to changes in genotype impinges on several phenomena of molecular, developmental, evolutionary and applied interest. Phenotypic changes that do not alter the underlying DNA sequence have been studied across model systems (eg: DNA and histone modifications, RNA editing, prion formation) and are known to play an important role in short term adaptation. However, because of their transient nature and unstable inheritance, the role of such changes in long term evolution has remained controversial. I classify and review three ways in which non-genetic changes can influence genotype and impact cellular fitness across generations, with an emphasis on the enticing idea that
We redesigned Phytophthora-ID from the ground up in version 2.0 so it is now faster and more stable. We have also developed a new tool for multilocus genotyping of P. ramorum and P. infestans. We hope you enjoy the current implementation.. The sequence based identification module of Phytophthora-ID was created by the Grünwald lab in collaboration with Everett Hansen and Frank Martin, with funding from the Pacific Southwest Research Station, USDA-ARS and the US Forest Service.. The genotype identification module of Phytophthora-ID was created by the Grünwald lab in collaboration with Howard Judelson, Bill Fry, Chris Smart, and Jean Ristaino, with funding from USDA-NIFA and USDA-ARS.. If you use Phytophthora-ID for species identification please cite the following references:. ...
Various genetic markers such as for example IS-elements DR-elements adjustable number tandem repeats (VNTR) solitary nucleotide polymorphisms (SNPs) in housekeeping genes and additional sets of genes are being utilized for genotyping. of genes of the sort II TA systems from 173 sequenced genomes of was performed. Several genes of type II TA systems had been found to transport SNPs that correlate with particular genotypes. We propose a minimally adequate group of genes of TA systems for parting of strains at nine fundamental genotype as well as for additional department into subtypes. Applying this group of genes we genotyped a series comprising 62 medical isolates of [1] but also people that have revised virulence transmissibility and pathogenicity. Several researches discovered a relationship between genotypes and their virulence and inclination to acquire medication level of resistance [2 3 The genus and strain identification is of great importance for the proper treatment assignment and SMAD2 ...
genotype: the alleles at a particular locus - that is, the genetic makeup (see also Mendelian genetics) phenotype: the characteristics of a particular genotype that can be observed in an organism
In this study, significant differences could be demonstrated in CV mortality between the G/G and the A/G genotypes, with a higher risk in the G/G group. It is interesting to note that in the study population an elderly community-living group of persons were investigated, that is, all those aged 70 to 85 were invited, and almost seven years of follow-up were applied. Even if the median age at inclusion of the participants was high, 77 years, significant differences in mortality could be demonstrated in the G/G genotype.. Also, in the female group compared to the male group, a tendency for a higher point estimate of the cardiovascular risk by having the G/G genotype could be demonstrated. However, the sample size was limited, and the confidence interval was wide, so we interpret the result as indicating that both sexes having the G/G genotype are exposed to a greater cardiovascular risk, and the females might be exposed to the highest risk.. As patients with diagnosed diabetes are exposed to a ...
Eesti Teadusinfosüsteem koondab informatsiooni teadus- ja arendusasutuste, teadlaste, teadusprojektide ning erinevate teadustegevuste tulemuste kohta.
The combined risk genotypes distribution in gastric cancer familial relatives. A. The prevalences of the ITGA5-1160/ ITGB1-1949/ITGB1 + 31804 as T-carrier/A-
Definition of environment in regard to interaction with genotypes can be widen to include sexes and major genes. Interaction of sexes with genotypes has been found in meat-type chickens under extreme environmental conditions. In this case, sexes are regarded as environments. Interaction of sexes with environments has been also reported. It appears that overall efficiency of broiler production can be improved by placing males in more optimal environments, and females in less optimal ones. Interaction of major genes for disease resistance with genotypes, i.e., genetic background was found to affect their level of expression. This type of interaction is essential to the utilization of gene transfer technology; an appropriate method for its analysis is described ...
The -607CC genotype was less frequent for HAC group (p=0.0501; OR=0.4890; CI=0.2480 to 0.9643), and infected patients (p=0.0232; OR=0.5207; CI=0.3033 to 0.8937) compared to healthy controls. The -607AC genotype was more frequent for HAC group (p=0.0387; OR=1.991; CI=1.043 to 3.801), and infected patients (p=0.0376; OR=1.757; CI=1.047 to 2.948) compared to healthy controls. No significant difference was observed for allelic and genotypic frequencies of the -137C/G among deferments groups. No significant difference was observed for allelic and genotypic frequencies of the -137C/G and -607A/C polymorphisms when correlated with proviral load. ...
The present investigation was undertaken to study the genetic polymorphism of the DRB3 exon 2 in 75 crossbred cattle by the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique. Five genotypes i.e. HaeIII-a, HaeIII-b, HaeIII-e, HaeIII-ab and HaeIII-ae were observed when the 284 bp PCR products were digested with HaeIII restriction enzyme. The corresponding frequencies of these patterns were 0.53, 0.04, 0.01, 0.38 and 0.04, respectively. Digestion with RsaI restriction enzyme resolved 24 different restriction patterns. The frequencies of these patterns ranged from 0.013 (RsaI-f, RsaI-k and RsaI-c/n) to 0.120 (RsaI-n). The results revealed that the crossbred cows belonged to the RsaI patterns namely b, k, l, a/l, d/s, l/n, l/o and m/n, whose corresponding frequencies were 0.027, 0.013, 0.040, 0.027, 0.040, 0.067, 0.027 and 0.067, respectively. Digestion of the 284 bp PCR product of DRB3.2 gene with PstI in the crossbred cattle did not reveal any restriction site. ...
Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) Analysis of Three Lipooligosaccharide-Associated Genes of Campylobacter jejuni and Campylobacter coli Isolated From Animal Samples ...
OBJECTIVES--To investigate the possible association between vitamin D receptor genotype and bone mineral density in a large group of postmenopausal twins. DESIGN--Cross sectional twin study. SETTING--Twin population based in Britain. SUBJECTS--95 dizygotic (non-identical) pairs of twins and 87 monozygotic (identical) pairs of twins aged 50-69 years, postmenopausal, and free of diseases affecting bone, recruited from a national register of twins and with a media campaign. MAIN OUTCOME MEASURES--Bone mineral density measured at the hip, lumbar spine, forearm, and for the whole body by dual energy x ray absorptiometry in relation to differences in the vitamin D receptor genotype. RESULTS--At all sites the values of bone density among dizygotic twins were more similar in those of the same vitamin D receptor genotype than in those of differing genotype, and the values in the former were closer to the correlations seen in monozygotic twins. Women with the genotype that made them at risk of osteoporotic
Read Associations between three common single nucleotide polymorphisms (rs266729, rs2241766, and rs1501299) of ADIPOQ and cardiovascular disease: a meta-analysis, Lipids in Health and Disease on DeepDyve, the largest online rental service for scholarly research with thousands of academic publications available at your fingertips.
TY - JOUR. T1 - Angiotensin-converting enzyme genotype and outcome in pediatric IgA nephropathy. AU - Delos Santos, Noel M.. AU - Ault, Bettina H.. AU - Gharavi, Ali G.. AU - Kritchevsky, Stephen B.. AU - Quasney, Michael W.. AU - Jackson, Elizabeth C.. AU - Fisher, Kimberly A.. AU - Woodford, Susan Y.. AU - Mitchell, Bonnie L.. AU - Gaber, Lillian. AU - Arheart, Kristopher L.. AU - Wyatt, Robert J.. PY - 2002/12/1. Y1 - 2002/12/1. N2 - Angiotensin-converting enzyme (ACE) I/D polymorphism has been implicated as a genetic marker for progression of glomerular disease. Studies of ACE genotypes in adults with IgA nephropathy (IgAN) have yielded conflicting results. We performed ACE genotyping on 79 patients with IgAN diagnosed prior to age 18 years who had either progressed to end-stage renal disease (ESRD) or are now more than 5 years post biopsy. Mean follow-up was 14.8 years for those with normal renal function. Forty-three (54.4%) subjects had normal renal function and a normal urinalysis at ...
Genome‐wide association studies have successfullyidentified many novel genetic loci for various human complex diseases and quantitative traits
To assess percentages of hepatitis C virus (HCV) genotypes in infected Lebanese patients referred to St. George Hospital, Beirut, Lebanon, 77 infected cases were studied. Of those, 27 were hemodialysis patients. Genotyping was performed by nested PCR of the HCV core-region with specific primers, followed by DNA enzyme-immunoassay using HCV type and subtype-specific probes. Single genotype infections were detected in 52 patients (67.5%). In these cases, types 1, 2, 3 and 4 were detected in 19.5%, 32.5%, 5.1% and 10.4% of the cases respectively. Twenty-five (32.5%) samples showed mixed genotype infections. Single genotype distribution was significantly different among dialysis and non-dialysis patients. In the dialysis group, genotype 2 was predominant (80%, p , 0.001). In single HCV genotype-infected patients, subtype 1b was frequently detected in nondialysis cases (34.4%) whereas this genotype was found in only 5% of dialysis cases. Genotypes 5 and 6 were not detected in any of the cases ...
Genetic diversity assessment is necessary to help tackle the threats of environmental fluctuations and for the effective exploitation of genetic resources in breeding program. Recent advancement in the field of molecular markers has made the genetic characterization of genotypes rapid, reliable and reproducible. In the present investigation, we have characterized 49 wheat genotypes at molecular level using 52 SSR primers (including Yr specific primers). 27 polymorphic SSR markers were dispersed over the AABBDD wheat genome, a total of 102 alleles were detected with allele range of 1 to 6. Polymorphism information content (PIC) values calculated to assess the informativeness of each marker ranged from 0.11 to 0.95 and there is significant that 5 out of 27 SSR loci, namely Xpsp 3000, Xwgp249, Wmc198, csLV34, Xgwm301 revealed PIC values above 0.70, can be considered highly useful for differentiation of wheat genotypes. The UPGMA cluster tree analysis led to the grouping of 49 wheat genotypes in two major
Gillihan, S. J., Rao, H., Wang, J., Detre, J., Breland, J., … Farah, M. J. (2010). Serotonin transporter genotype modulates amygdala activity during mood recovery. Social Cognitive and Affective Neuroscience, 5, 1-10.. ...
A multilocational evaluation of 20 soybean genotypes was conducted in two distinct locations (Nsukka in Derived Savanna agro-ecology and Jalingo in northern Guinea Savanna) of Nigeria in 2015 and 2016 cropping seasons. The main objective of this study was to assess the genotype-by-environment interaction (G x E) for specific traits such as number of pods, pod weight, seed yield and yield stability. The results revealed highly significant differences among the genotypes and locations for all the traits except for seed yield. Genotype by environment interaction was not significant for all the traits except for days to 50% flowering indicating relative consistency in time of flowering among the genotypes across the locations and year. The genotype, Ashuku produced the highest yield in the two locations. However, the most stable genotypes across the locations were Dadinkowa and Vom while the ideal environments were Jalingo 2016 (ENV2) and Nsukka 2016 (ENV4) which produced 14.0 and 14.5 g, respectively.
Chickpea is the major pulse crop cultivated in Ethiopia. However, its production is constrained due to genotype instability and environmental variability.  This research was carried out to examine the magnitude of environmental effect on yield of chickpea genotypes and to investigate the stability and adaptability of genotypes under different agro-ecologies.  Twelve genotypes evaluated in randomized complete block design with three replications in three locations for two continuative years. Various stability indices used to assess stability and genotype by environment performances. Combined analysis of variance for yield and yield components revealed highly significant (P≤0.01) differences for genotypes, environments and their interaction. Growing years do not show difference. The significant interaction showed genotypes respond differently across environments.  At Guduru, Hareto and Gitilo, top performing genotype in grain yield were genotype 229961 (2.33ton/ha), genotype 225887 (3
Commerce Business Daily has the largest database of fedbizopps, fed biz ops, fed biz opps, and federal business opportunities for contractors.
Peripheral blood (2 ml) was taken from all subjects and genomic DNA was extracted from peripheral blood using the TIANamp Blood DNA kit (Tiangen Biotech, Beijing, China) according to manufacturers instructions. The quality and concentration of extracted DNA was measured in two OD wavelength 260 and 280 nm using NanoDrop (Thermo Scientific, U.S.A.). SNP genotyping was performed using polymerase chain reaction-restriction fragment length polymorphism method. The primers used for the nucleotide extension reaction were AACAAGTAAGAATGAAAAGAGGACATGGT (forward) and CCCCCAATGAGGTCATAGAAGAATC (reverse) for rs2275913 and ACCAAGGCTGCTCTGTTTCT (forward) and GGTAAGGAGTGGCATTTCTA (reverse) for rs763780 polymorphism. For PCR, 25 μl reaction mixture contained as follows: 2.5 μl of 10× reaction buffer (with 1.5 mM MgCl2), 2 μl of deoxynucleotide triphosphate (dNTP; 2.5 mM), 2 μl of each pair primer, 50 ng DNA template, 1 μl of 0.4U Taq polymerase (Applied Biosystems, Evry, France) and 14.5 μl ddH2O. The ...
Wheat is the most important host for cereal cyst nematode, Heterodera filipjevi. The wild relatives of wheat have important sources of resistance genes to cereal nematodes. Phenotypic and genotypic evaluations have important implications for breeding programs, hence in this study information on the reaction of wheat genotypes to H. filipjevi and their genetic relationships are provided. A total of 223 wheat genotypes originating mostly from West Asia and North Africa (WANA countries) were evaluated against the H. filipjevi. Genetic diversity of 188 genotypes were assessed by using a 152 K single nucleotide polymorphism (SNP) chip. Data were analysed using generalized linear model, showed that there are significant differences at P
Background: Interleukin (IL)-23 has an important role in tumor immune regulation. Objective: To investigate the possible association of interleukin-23 receptor (IL23R) gene variants rs1884444, rs10889677 and rs11209026 with development of acute lymphoblastic leukemia (ALL). Methods: The IL23R variants were studied in 164 ALL patients and compared to 175 healthy controls by polymerase chain reaction-restriction fragment length polymorphism. The relationship between these variants and clinical and laboratory features of the patients and response to therapy were evaluated. Results: No significant differences in genotype and allele frequencies existed between patients and controls. The rs1884444TG genotype was significantly lower in patients who relapsed (24.2%) compared to those without relapse (55.9%, p=0.006). Fewer patients who relapsed had evidence of the G allele (P=0.034). The TG genotype was associated with a longer complete remission at1804±116 days compared to other genotypes (|1217 days, p=0.028
The single nucleotide polymorphism (SNP) rs1053004 in Signal transducer and activator of transcription 3(STAT3) was recently reported to be associated with chronic hepatitis B (CHB)-related hepatocellular carcinoma(HCC) in a Chinese cohort. This study was aimed at investigating whether the SNP might also contribute toHCC susceptibility in the Thai population. Study subjects were enrolled and divided into 3 groups includingCHB-related HCC (n=211), CHB without HCC (n=233) and healthy controls (n=206). The SNP was genotypedusing allelic discrimination assays based on TaqMan real-time PCR. Data analysis revealed that the distributionof different genotypes was in Hardy-Weinberg equilibrium (P|0.05). The frequencies of allele T (major allele)in HCC patients, CHB patients and healthy controls were 51.4%, 58.6% and 61.4%, respectively, whereas thefrequencies of C allele (minor allele) were 48.6%, 41.4% and 38.6%. The C allele frequency was higher in HCCwhen compared with CHB patients (odds ratio (OR)=1.34, 95%
To increase tolerance to abiotic stresses in breeding programmes, typically families and collections of genotypes are evaluated in series of trials (environments) representing different levels of stress. The statistical analysis of the data from such trials concentrates on modelling the phenotypic behaviour of the genotypes across the set of environments. This phenotypic behaviour can be modelled in the form of genotype-specific linear and non-linear response curves in relation to environmental characterizations. Non-parallelism of the response curves indicates genotype × environment interaction. Identification of the genetic basis of the parameters determining the response curves will help in the development of breeding programmes for improving abiotic stress tolerance and understanding genotype × environment interaction. In this paper we present two strategies for locating quantitative trait loci for response-curve parameters and estimation of their allele effects. The procedures are ...
TY - JOUR. T1 - Comparison of Abbott RealTime genotype II, GeneMatrix restriction fragment mass polymorphism and Sysmex HISCL HCV Gr assays for hepatitis C virus genotyping. AU - Han, Mi Soon. AU - Park, Yongjung. AU - Kim, Hyonsuk. PY - 2017/7/1. Y1 - 2017/7/1. N2 - Hepatitis C virus (HCV) genotype is a predictive marker for treatment response. We sequentially evaluated the performances of two nucleic acid amplification tests (NAATs) and one serology assay for HCV genotype: Abbott RealTime genotype II (RealTime II), GeneMatrix restriction fragment mass polymorphism (RFMP), and Sysmex HISCL HCV Gr (HISCL Gr). We examined 281 clinical samples with three assays. The accuracy was assessed using the HCV Genotype Performance Panel PHW204 (SeraCare Life Sciences) for two NAATs. Discrepant cases were re-genotyped by the Versant HCV v.2.0 (line probe 2.0) assay. With the RealTime II assay, clinic samples were analyzed as follows: genotypes 1b (43.1%), 2 (40.2%), 1 subtypes other than 1a and 1b (12.5%), ...
1. Angiotensin-converting enzyme (ACE) genotypes in hypertensive patients were studied in order to delineate their cardiovascular risk due to the ACE gene. We hypothesized that the distribution of ACE genotypes may change with age because of the risk of myocardial infarction associated with the homozygous deletional (DD) genotype. 2. A total of 223 subjects were recruited from the Hypertension Outpatient Clinic of the Sai Ying Pun Hospital with consent. They consisted of 75 patients with newly diagnosed or documented hypertension, 46 patients with ischaemic heart disease and 102 normal controls. Genomic DNA was extracted from peripheral leucocytes and amplified by polymerase chain reaction. Insertion (I) or deletion (D) alleles were identified after electrophoresis. The frequencies of ACE genotypes and alleles were measured in three age groups: | 50 years, 50-59 years and | or = 60 years. 3. A significant correlation between ACE genotype and age was found (P = 0.03). The relative frequency of the D
Aim: The current study was conducted to investigate the effect of GSTP1 codon 105 polymorphism, alone and in combination with GSTM1-deletion polymorphism, on erythrocyte GST activity in 196 Han Chinese. Methods: GST activity was measured in healthy Chinese by a spectrophotometric method (n = 196; 101 males and 95 females; age range 21-81 years; median 43.5 years). GSTM1 polymorphisms were analyzed by a PCR-Multiplex procedure, whereas GSTP1 polymorphism was analyzed by PCR-RFLP. Results: The frequency of GSTM1 null genotype was 56.1% and the frequency of I/I, I/V, and V/V genotypes was 60.7%, 35.2% and 4.1%, respectively, in Han Chinese. The mean erythrocyte GST enzyme activity for I/V genotype group(3.53 ± 0.63 U · g-1 Hb) was significantly lower than that for I/I genotypes (4.25 ± 1.07 U · g-1 Hb, P = 0.000), while significantly higher than that for V/V genotypes (2.44 ± O. 67 U · g-1 Hb, P = 0.004). In GSTM1 (-) group, the GST activity of carriers of GSTM1 (-)/ GSTP1 - I/I is ...
Hepatitis C viral infection after injection drug use is very prevalent. The most important genotype causing HCV infection in PWID globally is genotype 1, as is the case in the general population, but also genotype 3 is highly prevalent in PWID. Genotype 4 is most prevalent in Africa, spreading into Europe, whereas genotype 2 and 6 are more located in Asia. The most important difference comparing to the general population are generally lower prevalence of genotype 1b, and higher prevalence of genotype 1a and 3 in PWID. As the genotype nowadays still determines the treatment, and as there is a different genotype distribution than in the general population, it is important to identify the genotype also in PWID ...
INTRODUCTION: Asthma is a common respiratory childhood disease that results from an interaction between genetic, environmental and immunologic factors. The implication of nucleotide-binding and oligomerization domain 1 and 2 (NOD1/CARD4, NOD2/CARD15) was highlighted in many inflammatory diseases.. METHODS: In this case-control study, we analyzed the association of three NOD2 polymorphisms and one NOD1 variant, in 338 Tunisian asthmatic children and 425 healthy Controls, using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. We also assessed NOD1 and NOD2 mRNA and protein levels by qRT-PCR and ELISA techniques.. RESULTS: The homozygous AA genotype of rs2075820 was a risk factor for asthma (OR 2.39). The influence of the E266K variant in the presence of the heterozygous AG genotype was higher in male than female groups. The homozygous AA genotype was a risk factor associated with asthma, for patients aged between 6 and 18 years OR 2.39, IC95% (1.04-5.49) p , ...
Of all the lesions, HPV 16 was the most frequent genotype. This finding is in accordance with many other studies carried out worldwide [20]. In our study, this genotype was present in 35.3% of total lesions. However, in a previous study carried in our hospital from 1993 to 2000, the HPV 16 presence in the total number of lesions was somewhat higher than at present (39%) [21]. Also, in a recent study carried in a southern region of Spain from 2006 to 2007, this presence was even lower than ours (21.2%) [17].. As expected, HPV16 presence increased in accordance with the grade of the lesion (15.8% in benign lesions, 26.1% in CIN1 cases, 56.3% in CIN2-3 cases and 71.4% in ICC).. HPV 31 was the second most frequent genotype in CIN1 lesions and in CIN2-3 lesions. In a study carried in an eastern region of Spain, HPV 31 was also the second most frequent genotype in HSIL lesions and the presence found in these (10.8%) was very similar to the presence obtained in our study (10.8%) [19]. Previous ...
Plant breeders consistently come up against the phenomenon of the genotype x environment interaction (GxE) in the activities of breeding programs, especially in the phases of evaluating genotypes for recommendation to producers. These genotypes are thoroughly evaluated through more replications, crop years, locations, and crop seasons. Always with the purpose of obtaining a genotype with high yields, wide adaptability and high stability of performance (Barili et al. 2015Barili LD, Vale NM, Prado AL, Carneiro JES, Silva FF and Nascimento M (2015) Genotype-environment interaction in common bean cultivars with carioca grain cultivated in Brazil in the last 40 years. Crop Breeding and Applied Biotechnology 15: 244-250. ). When genotypes are evaluated in multi-environment tests, the need arises for studies on the GxE interaction.. Babić et al. (2010Babić V, Babić M, Ivanović M, Kraljević-Balalić M and Dimitrijević M (2010) Understanding and utilization of genotype-by-environment interaction in ...
Background: Knowledge of HBV genotype is very important for clinical treatment. Studies have suggested possible pathogenic and therapeutic differences among HBV genotypes. The aim of this study was to determine HBV subtypes and genotypes in HBV-infected patients in our region (southeast Brazil) and to correlate results with clinical and histopathological data. Methods: One hundred and thirty-nine HBsAg-positive patients were included in the study. All patients were anti-HCV and anti-HIV negative (64% male; mean age 42 ± 14.5 years; range 7-80 years; 84% Caucasian) and were followed up at the University Hospital. A method for genotyping and subtyping HBV by partial HBsAg gene sequencing with primers common to all known genotypes was used. The viral load was measured by Amplicor Monitor assay (Roche). Results: HBV genotype A was the most prevalent (55%), while genotypes C, D and F were found in 3%, 38% and 4% of HBV-infected patients, respectively. Among the patients infected by genotype A, 18.3% ...
Specific genotypes of hepatitis B virus (HBV) are increasingly recognized for their clinical significance and association with particular viral mutations. Although many HBV genotyping methods exist, there has been no standardized or commercially available method for direct molecular typing of the HBV genome. A newly available line probe assay (INNO-LiPA HBV Genotyping assay; Innogenetics N.V., Ghent, Belgium) that allows the identification of HBV genotypes A to G was assessed by comparison with pre-S1/pre-S2 sequence analysis of the isolates in 188 serum specimens. All seven genotypes were detected by the line probe assay (LiPA), and complete concordance between LiPA and sequence analysis was observed for 152 specimens (81%). LiPA was able to detect 19 mixed genotype infections not detected by amplicon sequencing, which for the most part were confirmed by cloning and sequencing of the pre-S1/pre-S2 amplicon. Four specimens had discrepant results between the two methods, and five specimens had ...
Single nucleotide polymorphism at exon 7 splice acceptor site of OAS1 gene determines response of hepatitis C virus patients to interferon therapy.: Response to
Single nucleotide polymorphism (SNP) genotyping assays normally give rise to certain percents of no-calls; the problem becomes severe when the target organisms, such as cattle, do not have a high resolution genomic sequence. Missing SNP genotypes, when related to target traits, would confound downstream data analyses such as genome-wide association studies (GWAS). Existing methods for recovering the missing values are successful to some extent - either accurate but not fast enough or fast but not accurate enough. To a target missing genotype, we take only the SNP loci within a genetic distance vicinity and only the samples within a similarity vicinity into our local imputation process. For missing genotype imputation, the comparative performance evaluations through extensive simulation studies using real human and cattle genotype datasets demonstrated that our nearest neighbor based local imputation method was one of the most efficient methods, and outperformed existing methods except the time-consuming
Association of carriers of single nucleotide polymorphisms rs1143634 and rs16944 of the Il-1B gene and rs6265 of the BDNF gene with temporal lobe epilepsy
Meckes, C., Moyna, N., Tsongalis, G., Miles, M. (2001). Apolipoprotein E Genotype Does Not Affect the Changes in Serum Lipids with Exercise Training. Circulation, 104(17), 343-343 ...
Type: JAX GEMM Strain - Mutant Strain Ty … Type: JAX GEMM Strain - Mutant Strain Type: JAX GEMM Strain - Spontaneous Mutation TJL Mating System: Outcross-Intercross (Female x Male) TJL Breeding Summary: homozygote x B6CBACa-Aw-J/A F1 then obligate heterozygote x heterozygote Species: laboratory mouse Generation: N68F1 (07-NOV-05) Appearance white-bellied agouti, ataxic Related Genotype: Aw-J/? Kcnj6wv/Kncj6wv OR agouti, ataxic Related Genotype: A/A Kcnj6wv/Kncj6wv OR white-bellied agouti, unaffected Related Genotype: Aw-J/? +/? or Aw-J/A Kncj6wv/+ OR agouti, unaffected Related Genotype: A/A +/? or A/A Kncj6wv/+ Strain Description Mice homozygous for the weaver spontaneous mutation (Kcnj6wv) are recognizable in the second postnatal week by their small size, instability of gait, weakness, and hypotonia. Many homozygous mutant mice die at weaning age, but some survive to adulthood, and females may breed. The cerebellum in homozygous mutants is very small, simple, and almost devoid of granule ...
Based on favorable data for 12 weeks of treatment for noncirrhotic patients in the phase 2 SURVEYOR-2 study (100% SVR12 in 34 patients with genotype 4, 5, or 6) (Kwo, 2017b), ENDURANCE-4 enrolled 121 DAA-naive or -experienced (sofosbuvir plus ribavirin ± peginterferon) genotype 4, 5, or 6 patients without cirrhosis to receive 12 weeks of the daily fixed-dose combination of glecaprevir (300 mg)/pibrentasvir (120 mg) administered as three 100 mg/40 mg pills (Asselah, 2018b). Of those enrolled, 86% had fibrosis stage F0 to F1 and 68% were treatment naive. The genotype distribution was 63% genotype 4, 21% genotype 5, and 16% genotype 6. The overall SVR12 rate for the intention-to-treat population was 99% (120/121), including 99% (75/76) for genotype 4, 100% for genotype 5 (26/26), and 100% (19/19) for genotype 6. Genotype 4, 5, and 6 patients were not included in the randomized study to compare an 8-week vs 12-week course for DAA-naive, noncirrhotic patients. However, part 4 of the SURVEYOR-2 study ...
Errors in genotype determination can lead to bias in the estimation of genotype effects and gene-environment interactions and increases in the sample size required for molecular epidemiologic studies. We evaluated the effect of genotype misclassification on odds ratio estimates and sample size requirements for a study of NAT2 acetylation status, smoking, and bladder cancer risk. Errors in the assignment of NAT2 acetylation status by a commonly used 3-single nucleotide polymorphism (SNP) genotyping assay, compared with an 11-SNP assay, were relatively small (sensitivity of 94% and specificity of 100%) and resulted in only slight biases of the interaction parameters. However, use of the 11-SNP assay resulted in a substantial decrease in sample size needs to detect a previously reported NAT2-smoking interaction for bladder cancer: 1,121 cases instead of 1,444 cases, assuming a 1:1 case-control ratio. This example illustrates how reducing genotype misclassification can result in substantial ...
54 apoa5 TaqMan 5-nuclease assay chemistry provides a fast and simple way to get single nucleotide polymorphism (SNP) genotyping results.
683 serpina4 TaqMan 5-nuclease assay chemistry provides a fast and simple way to get single nucleotide polymorphism (SNP) genotyping results.