BioMed Research International is a peer-reviewed, Open Access journal that publishes original research articles, review articles, and clinical studies covering a wide range of subjects in life sciences and medicine. The journal is divided into 55 subject-specific sections.
In a landmark study, University of Otago researchers have achieved the feat of sequencing complete mitochondrial genomes for members of what was likely to be one of the first groups of Polynesians to settle New Zealand and have revealed a surprising degree of genetic variation among these pioneering voyagers.
antibody-antibodies.com is the marketplace for research antibodies. Find the right antibody for your research needs. Sequencing strategy for the whole mitochondrial genome resulting in high quality sequences.
Animal mitochondrial genomes have provided large and diverse datasets for evolutionary studies. Here, the first two representative mitochondrial genomes from the family Pompilidae (Hymenoptera: Vespoidea) were determined using next-generation sequencing. The sequenced region of these two mitochondrial genomes from the species Auplopus sp. and Agenioideus sp. was 16,746 bp long with an A + T content of 83.12% and 16,596 bp long with an A + T content of 78.64%, respectively. In both species, all of the 37 typical mitochondrial genes were determined. The secondary structure of tRNA genes and rRNA genes were predicted and compared with those of other insects. Atypical trnS1 using abnormal anticodons TCT and lacking D-stem pairings was identified. There were 49 helices belonging to six domains in rrnL and 30 helices belonging to three domains in rrns present. Compared with the ancestral organization, four and two tRNA genes were rearranged in mitochondrial genomes of Auplopus and Agenioideus, respectively.
Comparing complete animal mitochondrial genome sequences is becoming increasingly common for phylogenetic reconstruction and as a model for genome evolution. Not only are they much more informative than shorter sequences of individual genes for inferring evolutionary relatedness, but these data also provide sets of genome-level characters, such as the relative arrangements of genes, which can be especially powerful. We describe here the protocols commonly used for physically isolating mitochondrial DNA (mtDNA), for amplifying these by polymerase chain reaction (PCR) or rolling circle amplification (RCA), for cloning, sequencing, assembly, validation, and gene annotation, and for comparing both sequences and gene arrangements. On several topics, we offer general observations based on our experiences with determining and comparing complete mitochondrial DNA sequences.. View Publication. ...
Next generation sequencing technologies have revolutionized molecular biology by making whole genome sequencing projects possible for any species. Low coverage whole genome shotgun sequencing has proven a valuable approach for rapid and easy acquisition of a large amount of sequence data at relatively low cost. Low coverage data is useful for marker acquisition as well as the assembly of plastid genomes [20, 21, 31-33]. Despite its power, few examples of the application of NGS on de novo assembly of plant mitochondrial genomes have been reported. Recently Straub and colleagues [22] attempted to assemble the milkweed mitochondrial genome using Illumina data from unenriched whole genome DNA. The assembly resulted in a partial mitochondrial genome assembly of 115 contigs. Here we demonstrate how 454 data from whole genome DNA library can be used for a complete de novo assembly of the mitochondrial genome of Daucus carota. Adequate coverage, sufficient read length, and application of a ...
PhD Project - Mitochondrial Genomics: Computational analysis of RNA sequencing data to unravel post-transcriptional processes influencing mitochondrial function at Kings College London, listed on FindAPhD.com
The phylogenetic hypotheses (Figures 2, 3) generated by our whole mitochondrial genome sequences using different models are generally concordant. The relationships among the Neoaves (the ingroup) differ little whether or not the outgroup (Galloanserae) is included (Figures 2, 3). Where the two phylogenies differ is in small changes in the position of the loon, penguins, albatross/petrel, stork/heron, and pelican/frigatebird. In all other respects the inclusion of the Galloanserae does not affect the relationships resolved and thus the basic stability of the tree is observed.. The seven birds in our mitochondrial sequence dataset that represent elements of the Metaves group do not form a monophyletic clade. Ericson and co-workers [7] also failed to obtain the Metaves clade using four nuclear genes, although they could with the inclusion of FGB-int7. No other dataset, molecular nor morphological, has found direct evidence for the division of the Neoaves into Metaves and Coronaves [8, 9, 17]. Nor ...
The purpose of this project is to compare the complexities of different species mitochondrial genome sequences. Using an implementation of Deflate compression algorithm from Java standard library, we were able to compress mitochondrial genomes of nine different species. The complexity of each sequence is estimated as a ratio of the original sequence length to the length of the compressed sequence. In addition, we show how a notion of topological entropy from symbolic dynamics can be used as another complexity measure of nucleotide sequences.
Academic Journals Database is a universal index of periodical literature covering basic research from all fields of knowledge, and is particularly strong in medical research, humanities and social sciences. Full-text from most of the articles is available. Academic Journals Database contains complete bibliographic citations, precise indexing, and informative abstracts for papers from a wide range of periodicals.
The Complete Mitochondrial Genome of Delia antiqua and Its Implications in Dipteran Phylogenetics. . Biblioteca virtual para leer y descargar libros, documentos, trabajos y tesis universitarias en PDF. Material universiario, documentación y tareas realizadas por universitarios en nuestra biblioteca. Para descargar gratis y para leer online.
The control region in the turtle mitochondrial genome is 1194 bp long, and it is localized between the tRNAPro and tRNAPhe genes (Table 1; ref. 33). Analysis of this control-region sequence permitted the identification of one conserved-sequence block, a putative conserved-sequence block, and three termination-associated sequences (34). Moreover, the presence of six direct repeats localized in tandem at the 3′ end of the control region was also detected (34). Each repeat was composed of a 45-bp sequence followed by a (TA)n microsatellite with a variable number of repeat units (n = 10-11) (34).. The origin of light-strand replication, which in vertebrates is located normally in a cluster of five tRNA genes (WANCY region), was not found in the turtle mitochondrial genome. The same condition has been reported in other reptiles and in the chicken (35-37). It has been suggested that the tRNAs in the WANCY region, which have the potential to fold into a stem-loop secondary structure, might replace ...
A new type of maize mitochondrial genome has been identified in the male fertile (normal) inbred line A188. It has been named NA (N in the A188 nuclear background). In comparison to previously described maize mitochondrial genomes, it is classified as a new type since the genome contains unique DNA sequences and unique sets of repeated sequences, and has a unique organization. This brings the number of the maize mitochondrial genome types to five of which three are the cytoplasmic male steriles cmsT, cmsC and cmsS and of which two are the male fertile types NA (in this report) and NB (the previously characterized normal genome in the B37 nuclear background). ...
The complete sequence mitochondrial genome of Papilio polytes was determined using long PCR and conserved primers walking approaches. The genome was 15,260 bp in length and contained 13 protein-coding genes, 2 rRNA genes, 22 tRNA genes and 1 control region (CR). The gene composition and order of P. polytes were similar to other lepidopteran species. All protein-coding genes begin with ATG and ATT as initiation codon except COI using CGA. 8 genes (ATP8, ATP6, ND3, ND5, ND4L, ND6, Cytb and ND1) ended with TAA and TAG stop codon, the remaining five genes had incomplete stop codon T. The overall base composition of the genome in descending order was 39.51% A, 11.86% C, 40.75% T and 7.88% G, with a A + T bias of 80.26%. CR is located between the 12S rRNA and tRNA-Met genes and is 439 bp in length, with an AT content of 83.37%.
Read Research Alzheimers More http://fuckalzheimers.com/2018/01/04/assembly-of-809-whole-mitochondrial-genomes-with-clinical-imaging-and-fluid-biomarker-phenotyping/ title=Share this by email. class=social email> ...
Nuclear recessive mutations at the chloroplast mutator (CHM) locus of Arabidopsis produce a variegated phenotype that is inherited in a non-Mendelian fashion. Molecular analysis of the cytoplasmic genomes of variegated plants from two independent chm mutant lines, using specific chloroplast and mitochondrial probes, showed that the chm mutations reproducibly induce the appearance of specific new restriction fragments in the mitochondrial genome. The presence of these restriction fragments cosegregated with the variegated phenotype in the progeny of crosses between mutant and wild-type plants. Sequence analysis of one of the new restriction fragments found in the variegated plants suggested that it was the product of a rearrangement event involving regions of the mitochondrial genome. Thus, it appears that the CHM locus may encode a protein involved in the control of specific mitochondrial DNA reorganization events.. ...
The widespread occurrence of linear mitochondrial genomes evokes intriguing questions concerning the evolutionary origin and mechanisms leading to the emergence and stabilization of linear DNA genophores. The study of their replication strategies opens a unique possibility of discovering alternative solutions to the end-replication problem and of elucidating how these mechanisms have appeared in evolution. The analysis of linear mitochondrial genomes in organisms belonging to different phylogenetic lines indicates that their evolutionary emergence was accompanied by the generation of various types of terminal structures, the adaptation of existing replication machinery and by the application of different strategies of the telomere replication. This scenario is illustrated by the molecular anatomy and replication of the linear mitochondrial genome in the opportunist yeast pathogen Candida parapsilosis. Recent studies have revealed the existence of extragenomic minicircular molecules derived from ...
Adaptive evolution may preferentially occur at the molecular level and may be expressed as an increased ratio of nonsynonymous substitutions to synonymous substitutions [71]. Our study adds to the growing body of evidence for adaptive evolution in the mitochondrial genome of high-elevation species. Similar to previous studies of major adaptations to high-elevation habitats of different endothermic animals based on genomic data [8, 9, 11], the Glyptosternoid fish lineage exhibits accelerated evolution in the mitochondrial genome relative to other non-Glyptosternoid fish lineages. A consequence of the fact that species living in similar ecological environments can be shaped by convergent evolution to form physiological or morphological similarities [72]. In particular, the specialized Glyptosternoid fishes have higher nonsynonymous to synonymous substitutions than the basal species, suggesting the specialized species developed accelerated evolutionary rates in order to adapt to the high-elevation ...
Mitochondria are the fuel power plants of animal cells. The number of mitochondria in a cell varies from tissue to tissue. Some cells have only few mitochondria while the cells that need lots of energy to function may have thousands of mitochondria.
A study reported in the August 8th issue of the journal Cell, a Cell Press publication, reveals the complete mitochondrial genome of a 38,000-year-old Neandertal. The findings open a window into the Neandertals past and helps answer lingering questions about our relationship to them.
One of the defining features of eukaryotic cells is the presence of membrane-enclosed organelles. Two of these organelles, the mitochondria and chloroplast, are unique in that they contain their own genetic material necessary for proper functioning. These organelle genomes are evolutionary relics of free-living bacteria that entered into a symbiotic relationship with a host cell. Through the process of cellular respiration, mitochondria produce about 90 percent of the chemical energy that a cell needs to survive. The discovery that mutations in the mitochondrial genome can cause a variety of human diseases has increased our interest in this other human genome.. ...
Our team is interested in the mechanisms controlling the maintenance, segregation and repair of the mitochondrial genome (mtDNA) of plants, as well as in the processes of anterograde (nucleus to organelles) and retrograde (organelles to nucleus) regulation of mitochondrial gene expression.. Mitochondria of higher plants have large size genomes with a dynamic structure resulting from recombination events. These recombination mechanisms are necessary for the replication and stoichiometric segregation of the mitochondrial genetic information, but their activities are also responsible for the rapid structural evolution of the plant mtDNA. In addition, the oxidative environment generated by the respiratory chain constantly challenges the maintenance of the mtDNA, requiring efficient DNA repair pathways. We are especially interested in recombination-dependent repair, but also in base excision repair (BER) or nucleotide excision repair (NER). We investigate these processes, and the factors involved, ...
The mitochondrial genome of yeast ( S. cerevisiae or S. carlsbergensis) appears to be formed by 60-70 genetic units, each one of which is formed by (1) a GC-rich sequence, possibly having a...
Researchers have analyzed the mitochondrial genome of a Neanderthal bone to help resolve timing of gene flow between Neanderthals and modern humans.
Question is ⇒ What is the approximate size (in kb) of the melon mitochondrial genome?, Options are ⇒ (A) 600 kilobase, (B) 1200 kilobase, (C) 2400 kilobase, (D) 3000 kilobase, (E) , Leave your comments or Download question paper.
Brett Kaufmann, PhD Associate Professor, University of Pittsburgh Department of Medicine, Division of Cardiology Mitochondrial genome regulation and disease resilience
The GiiB-JST mtSNP (mitochondrial single nucleotide polymorphism) database provides information related to the functional differences among mitochondrial SNPs. This web site is useful for identification of mtSNPs associated with age-related conditions such as longevity, Parkinsons disease, and Alzheimers disease, as well as those related to energy metabolism such as obesity, thinness, and type-2 diabetes, or to atherosclerosis. The main part of this mtSNP database includes the entire mitochondrial genome sequences of individuals belonging to 7 different groups, with 96 individuals in each group, namely, centenarians, patients with Parkinsons disease, patients with Alzheimers disease, young obese males, young non-obese males, and type-2 diabetes patients with or without severe vascular involvement ...
An exponential growth of science throughout modern history has been frequently boasted by numerous narcissistic accounts of modern humanity. Nonetheless, modern science seems to have overwhelmingly compromised on its original promises by fitting into an industrial scheme. With this concern, molecular phylogeographics with conservational ambitions would look an intact ground for research efforts in a school of biotechnology. The dog (Canis familiaris) as an earliest domestic animal has a history of conflicts over its origins and dispersal. Having those disputes addressed, valuable knowledge could be acquired on the nature and dynamics of domestication, and of human societies particularly of pre-agricultural ages. We employed two most widely-used genealogical markers, the mitochondrial DNA (mtDNA) and the non-recombining portion of the Y-chromosome (NRY), to address dog demography. Through 582 bps of mtDNA Control Region, complemented with whole mitochondrial genomes, it was ...
An exponential growth of science throughout modern history has been frequently boasted by numerous narcissistic accounts of modern humanity. Nonetheless, modern science seems to have overwhelmingly compromised on its original promises by fitting into an industrial scheme. With this concern, molecular phylogeographics with conservational ambitions would look an intact ground for research efforts in a school of biotechnology. The dog (Canis familiaris) as an earliest domestic animal has a history of conflicts over its origins and dispersal. Having those disputes addressed, valuable knowledge could be acquired on the nature and dynamics of domestication, and of human societies particularly of pre-agricultural ages. We employed two most widely-used genealogical markers, the mitochondrial DNA (mtDNA) and the non-recombining portion of the Y-chromosome (NRY), to address dog demography. Through 582 bps of mtDNA Control Region, complemented with whole mitochondrial genomes, it was ...
Sequence data suggest that all extant mitochondria are derived from an ancestor of R. prowazekii as the result of a single endosymbiotic event. The evidence that modern mitochondria result from a single event comes from examination of the most bacteria-like mitochondrial genome, that of the protozoan Reclinomonas americana. Its genome contains 97 genes, of which 62 specify proteins that include all of the protein-coding genes found in all of the sequenced mitochondrial genomes (Figure 18.5). Yet, this genome encodes less than 2% of the protein-coding genes in the bacterium E. coli. It seems unlikely that mitochondrial genomes resulting from several endosymbiotic events could have been independently reduced to the same set of genes found in R. americana ...
Sequence data suggest that all extant mitochondria are derived from an ancestor of R. prowazekii as the result of a single endosymbiotic event. The evidence that modern mitochondria result from a single event comes from examination of the most bacteria-like mitochondrial genome, that of the protozoan Reclinomonas americana. Its genome contains 97 genes, of which 62 specify proteins that include all of the protein-coding genes found in all of the sequenced mitochondrial genomes (Figure 18.5). Yet, this genome encodes less than 2% of the protein-coding genes in the bacterium E. coli. It seems unlikely that mitochondrial genomes resulting from several endosymbiotic events could have been independently reduced to the same set of genes found in R. americana ...
1. Lancioni H, Di Lorenzo P, Cardinali I, Ceccobelli S, Capodiferro MR, Fichera A, Grugni V, Semino O, Ferretti L, Gruppetta A, Attard G, Achilli A, Lasagna E (2016) Survey of uniparental genetic markers in the Maltese Cattle breed reveals a significant founder effect, but does not indicate local domestication. Animal Genetics doi: 10.1111/age.12408. [Epub ahead of print] [IF: 2.210].. 3.Colli L*, Lancioni H*, Cardinali I, Olivier A, Capodiferro MR, Pellecchia M, Rzepus M, Zamani W, Naderi S, Gandini S, Farhad Vahidi SM, Agha S, Randi E, Sardina MT, Portolano B, Rezaei HR, Lymberakis P, Boyer F, Coissac E, Pompanon F, Taberlet P, Ajmone Marsan P and Achilli A (2015) Whole Mitochondrial Genomes Unveil the Impact of Domestication on Goat Matrilineal Variability. BMC Genomics 16(1):1115. doi: 10.1186/s12864-015-2342-2 *These authors contributed equally to this work [IF: 4.041].. 4.Grugni V, Battaglia V, Perego UA, Raveane A, Lancioni H, Olivieri A, Ferretti L, Woodward SR, Pascale JM, Cooke R, ...
Phy-Mer :: DESCRIPTION Phy-Mer is a novel alignment-free and reference-independent mitochondrial haplogroup classifier. ::DEVELOPER MEEI Bioinformatics Center (MBC) :: SCREENSHOTS N/A :: REQUIREMENTS L
Supplementary table Species, systematic position and accession number of mitochondrial genome sequences used in the phylogenetic analysis and for gene order comparisons
1958-D 25C MS64 PCGS. PCGS Population (256/1648). NGC Census: (101/1790). Mintage: 78,124,896. Numismedia Wsl. - Available at Internet Coin Auction #131252.
Their discovery is described in an article published online Aug. 2 in the journal eLife.. The mothers curse is one of the more bizarre consequences of natural selection. According to evolutionary theory, mitochondrial DNA (mtDNA) and nuclear DNA are locked in an unending competition. As one accumulates beneficial mutations, then the other is forced to adapt. This is known as the Red Queen hypothesis, taken from Through the Looking Glass written by Lewis Carroll and spoken by the Red Queen: ...it takes all the running you can do, to keep in the same place.. Plants have much larger mitochondrial genomes containing larger numbers of genes. In plants, striking instances of male-harming mitochondria already have been discovered. As the mitochondrial genome in animals is much smaller, it makes it much harder to detect similar male-harming mutations.. The experiment that ultimately discovered male-harming mtDNA mutations took more than four years to complete. Scientists set up 18 independent ...
Difficult Choice VF 1870-CC Quarter 1870-CC 25C VF35 PCGS. CAC. While the mintage figure of 8,340 pieces already - Available at 2009 March Baltimore, MD...
We sequenced and characterized the complete mitogenome (KX964606) of the Amur hedgehog Erinaceus amurensis to provide more data for comparative mitogenomics of the genus Erinaceus (Erinaceidae). The mitogenome of E. amurensis is a circular molecule 16,941 bp long, consisting of a control region and a conserved set of 37 genes containing 13 protein-coding genes, 22 tRNA genes, and two rRNA genes (12S rRNA and 16S rRNA). The mitogenome of E. amurensis is AT-biased, with a nucleotide composition of 33.9% A, 21.1% C, 32.6% T, and 12.4% G. The mitogenomes of E. amurensis and the closely related hedgehog species E. europaeus, excluding the control region (66.7%), share over 90% sequence similarity. According to the inter-generic relationship based on six mitogenomes described from five genera of Erinaceidae, the subfamilies Erinaceinae and Galericinae are strongly supported as monophyletic groups, with each genus well placed within its own subfamily. Within the subfamily Erinaceinae, E. amurensis is a sister
PubMed Central Canada (PMC Canada) provides free access to a stable and permanent online digital archive of full-text, peer-reviewed health and life sciences research publications. It builds on PubMed Central (PMC), the U.S. National Institutes of Health (NIH) free digital archive of biomedical and life sciences journal literature and is a member of the broader PMC International (PMCI) network of e-repositories.
Using 1007 full mitochondrial genome sequences we have identified sequence variation in mtDNA that affects mtDNA copy number. Two different clades were significantly associated with higher mtDNA copy number. Each of these clades represents statistically separate effects. The first was defined by branch 124 and consisted of individuals with haplogroup U5A1, and is defined by m.9667A,G (p.Asn154Ser). This variant has also been reported in D2A1, D4M1, and J1B2A haplogroups [69]; however, no individuals in our dataset belong to these haplogroups. We analyzed this substitution to determine if it likely causes COXIII malfunction, and then to determine whether or not it could cause the observed increase in mtDNA copy number. Our analyses suggest this substitution does not impact COXIII function. This conclusion is based on several lines of evidence; first, this is a high frequency, known substitution [70], second the substitution occurs in an unconserved site (Figure 3), third asparagine and glycine, ...
Gutiérrez V, Rego N, Naya H, García G. First complete mitochondrial genome of the South American annual fish Austrolebias charrua (Cyprinodontiformes: Rivulidae): peculiar features among cyprinodontiforms mitogenomes. BMC Genomics. 2015 Oct 28;16(1):879 - Gianola D, de los Campos G, Toro MA, Naya H, Schön CC, Sorensen D. Do Molecular Markers Inform About Pleiotropy? Genetics. 2015 Sep;201(1):23-9.- Fernandez-Calero T, Garcia-Silva R, Pena A, Robello C, Persson H, Rovira C, Naya H, Cayota A. Profiling of small RNA cargo of extracellular vesicles shed by Trypanosoma cruzi reveals a specific extracellular signature. Mol Biochem Parasitol. 2015;199(1-2):19-28.- Berná L, Iraola G, Greif G, Coitinho C, Rivas CM, Naya H, Robello C. Whole-Genome Sequencing of an Isoniazid-Resistant Clinical Isolate of Mycobacterium tuberculosis Strain MtURU-002 from Uruguay. Genome Announc. 2014;2(4)- Chiribao ML, Libisch, G, Parodi‐Talice, A, Robello, C. Early Trypanosoma cruzi infection reprograms human ...
Background Assessment of the biodiversity of communities of small organisms is most readily done using PCR-based analysis of environmental samples consisting of mixtures of individuals. Known as metagenetics, this approach has transformed understanding of microbial communities and is beginning to be applied to metazoans as well. Unlike microbial studies, where analysis of the 16S ribosomal DNA sequence is standard, the best gene for metazoan metagenetics is less clear. In this study we designed a set of PCR primers for the mitochondrial 12S ribosomal DNA sequence based on 64 complete mitochondrial genomes and then tested their efficacy. Methodology/Principal Findings A total of the 64 complete mitochondrial genome sequences representing all metazoan classes available in GenBank were downloaded using the NCBI Taxonomy Browser. Alignment of sequences was performed for the excised mitochondrial 12S ribosomal DNA sequences, and conserved regions were identified for all 64 mitochondrial genomes. These
Retrieving a large amount of genetic information from extinct species was demonstrated feasible, but complete mitochondrial genome sequences have only been deciphered for the moa, a bird that became extinct a few hundred years ago, and for Pleistocene species, such as the woolly mammoth and the mastodon, both of which could be studied from animals embedded in permafrost. To enlarge the diversity of mitochondrial genomes available for Pleistocene species, we turned to the cave bear (Ursus spelaeus), whose only remains consist of skeletal elements. We collected bone samples from the Paleolithic painted cave of Chauvet-Pont dArc (France), which displays the earliest known human drawings, and contains thousands of bear remains. We selected a cave bear sternebra, radiocarbon dated to 32,000 years before present, from which we generated overlapping DNA fragments assembling into a 16,810-base pair mitochondrial genome. Together with the first mitochondrial genome for the brown bear western lineage, ...
Retrieving a large amount of genetic information from extinct species was demonstrated feasible, but complete mitochondrial genome sequences have only been deciphered for the moa, a bird that became extinct a few hundred years ago, and for Pleistocene species, such as the woolly mammoth and the mastodon, both of which could be studied from animals embedded in permafrost. To enlarge the diversity of mitochondrial genomes available for Pleistocene species, we turned to the cave bear (Ursus spelaeus), whose only remains consist of skeletal elements. We collected bone samples from the Paleolithic painted cave of Chauvet-Pont dArc (France), which displays the earliest known human drawings, and contains thousands of bear remains. We selected a cave bear sternebra, radiocarbon dated to 32,000 years before present, from which we generated overlapping DNA fragments assembling into a 16,810-base pair mitochondrial genome. Together with the first mitochondrial genome for the brown bear western lineage, ...
The whole mitochondrial genome sequencing analysis for these three families was performed independently at two different CLIA-accredited laboratories, respectively, at CCHMC (Method 1) and Baylor College of Medicine (Method 2). Genomic DNA was isolated from the blood samples of the patients and their family members using the Gentra DNA extraction kit (Qiagen) according to the manufacturers instructions. Entire mtDNA was amplified by a single long range PCR as previously described (23, 33⇓-35). One hundred nanograms of total genomic DNA isolated from blood were used as the template in a 50 μL PCR system.. For Method 1, the primers specifically recognize genuine mtDNA: F-2120 (GGACACTAGGAAAAAACCTTGTAGAGAGAG) and R-2119 (AAAGAGCTGTTCCTCTTTGGACTAACA). PCR amplifications were performed using TaKaRa LA Taq Hot Start polymerase (TaKaRa Biotechnology). PCR conditions were: 94 °C for 1 min; 98 °C for 10 s; and 68 °C for 16 min, 30 cycles; 72 °C for 10 min and held at 4 °C. The amplified mtDNA ...
TrendTerms displays relevant terms of the abstract of this publication and related documents on a map. The terms and their relations were extracted from ZORA using word statistics. Their timelines are taken from ZORA as well. The bubble size of a term is proportional to the number of documents where the term occurs. Red, orange, yellow and green colors are used for terms that occur in the current document; red indicates high interlinkedness of a term with other terms, orange, yellow and green decreasing interlinkedness. Blue is used for terms that have a relation with the terms in this document, but occur in other documents ...
The Coleoptera (beetles) exhibits tremendous morphological, ecological, and behavioral diversity. To better understand the phylogenetics and evolution of beetles, we sequenced three complete mitogenomes from two families (Cleridae and Meloidae), which share conserved mitogenomic features with other completely sequenced beetles. We assessed the influence of six datasets and three inference methods on topology and nodal support within the Coleoptera. We found that both Bayesian inference and maximum likelihood with homogeneous-site models were greatly affected by nucleotide compositional heterogeneity, while the heterogeneous-site mixture model in PhyloBayes could provide better phylogenetic signals for the Coleoptera. The amino acid dataset generated more reliable tree topology at the higher taxonomic levels (i.e. suborders and series), where the inclusion of rRNA genes and the third positions of protein-coding genes improved phylogenetic inference at the superfamily level, especially under a
Two cytoplasmic organelles responsible for the production of energy are the mitochondria (present in nearly all eukaryotic cells) and chloroplasts (present only in photosynthetic organisms). Both contain small, circular DNA molecules that constitute the nonnuclear portion of a eukaryotic genome. These organelles are descended from formerly free-living bacteria that took up residence in the first eukaryotes.. The human mitochondrial genome contains 16,569 base pairs specifying 13 protein products and 24 RNA products. In both lower eukaryotes and especially plants, larger mitochondrial genomes are present. In extreme cases, mitochondrial genomes may be several hundred thousand or millions of base pairs. Chloroplast genomes contain between 100 and 200 kilobases. It is thought that each was once larger, but over time their genes have been moved to the nucleus.. ...
A mitochondrial genome phylogeny of Diptera: whole genome sequence data accurately resolve relationships over broad timescales with high precision Stephen L. C
The mitochondrial genome is maternally inherited and harbors 37 genes in a circular molecule of approximately 16.6 kb that is present in hundreds to thousands of copies per cell [1] and has accumulated mutations at a rate at least an order of magnitude higher than its nuclear counterpart [2, 3]. Frequently, more than one mtDNA variant is present in the same individual, a phenomenon called heteroplasmy [4]. The mitochondrial genome is implicated in hundreds of diseases (over 200 catalogued at [5] as of mid-2010) with the majority of them caused by point mutations [6]. Multiple mtDNA mutations might also predispose one to common metabolic and neurological diseases of advanced age, such as diabetes as well as Parkinsons and Alzheimers diseases [7]. Additionally, mtDNA mutations appear to have a role in cancer etiology [8]. Many disease-causing mtDNA variants are heteroplasmic and their clinical manifestation depends on the relative proportion of mutant versus normal mitochondrial genomes [7, 9, ...