The proto- oncogene c- erbB- 1 codes for the epidermal growth factor receptor. Its name originates from the viral homolog v- erbB which was isolated from an avian erythroblastosis virus ( AEV) where it was contained as a fragment of the chicken c- ErbB- 1 gene lacking the amino- terminal ligand- binding domain. Overexpression of erbB- 1 genes occurs in a wide range of tumors, commonly squamous carcinomas of various sites and less commonly adenocarcinomas. The human c- erbB- 1 gene is located in the chromosomal region 7p14 and 7p12 ...
The HER-2/Neu/ErbB-2 receptor tyrosine kinase is a major human oncogene and a validated therapeutic target in breast cancer. We are investigating the normal and carcinogenic functions of HER2 and other EGF receptor family kinases to understand how they cause cancers and how they can best be treated. An important practical problem with new, targeted cancer therapies is linking patients to therapies that match the specific alterations in their cancers. We are pursuing high throughput genetic and proteomic approaches to this problem.. Specialized Terms: Cancer Biology; Signal transduction by HER2/ErbB2 and other EGF family receptor tyrosine kinases; EGF family receptors in breast cancer and mammary development; DNA damage checkpoint signaling; Functional and genetic analysis of cancer; Melanoma ...
EphA2, a member of Eph family receptor tyrosine kinases, is frequently overexpressed in a variety of human cancers, including breast cancers (Merlos-Suárez and Batlle, 2008; Pasquale, 2008). Overexpression of EphA2 is associated with an aggressive and metastatic cellular phenotype in breast cancers, and recent studies have revealed that EphA2 acts as a downstream effector of EGF receptors to promote cancer cell motility and invasion, independently of the ligand ephrin stimulation (Zelinski et al., 2001; Macrae et al., 2005; Larsen et al., 2007; Brantley-Sieders et al., 2008; Miao et al., 2009). Conversely, stimulation of EphA2 with its ligand ephrinA1 in cancer cells inhibits cell proliferation and migration (Miao et al., 2009). However, the mechanisms underlying the oncogenic effects of EphA2 remain poorly understood.. Rho family small GTPases play pivotal roles in the regulation of the actin cytoskeleton and cell migration and also contribute to many steps in cancer initiation and progression ...
Chan, P. Y., Carrera Silva, E. A., De Kouchkovsky, D., Joannas, L. D., Hao, L., Hu, D., Huntsman, S., Eng, C., Licona-Limón, P., Weinstein, J. S., Herbert, D. R., Craft, J. E., Flavell, R. A., Repetto, S., Correale, J., Burchard, E. G., Torgerson, D. G., Ghosh, S., Rothlin, C. V.: The TAM family receptor tyrosine kinase TYRO3 is a negative regulator of type 2 immunity. Science 352(6281): 99-103, 2016 ...
881 Introduction: The human homeobox (HOX) genes encode a family of highly conserved transcription factors that act as master control genes and regulate diverse aspects of development. HOX genes are associated with multiple pathways including pathways deregulated in ovarian cancer. The V-erb-a erythroblastic leukemia viral oncogene (ERBB/HER) gene family is well known to be associated with ovarian cancer and is located proximate to the HOX genes on the same chromosomes (chromosomes 2, 7, 12 and 17). No obvious molecular interactions have been characterized between ERBB and HOX family genes. This study focuses on measuring the relationship between these two gene families and their potential relationship with ovarian cancer. Methods: 65 ovarian tissue samples diagnosed according to the World Health Organization Classification of Ovarian Tumors, were analyzed using oligonucleotide microarray technology. Analysis focused on significant HOX and ERBB genes between non-malignant and malignant tumor ...
|p|Description:|br /|IC50: AZD8931 showed equipotent, reversible inhibition of EGFR (IC50, 4 nmol/L), erbB2 (IC50, 3 nmol/L), and erbB3 (IC50, 4 nmol/L) phosphorylation in cells|br /|The erbB receptor family is composed of four related receptor tyrosine k
Complete information for ERBB2 gene (Protein Coding), Erb-B2 Receptor Tyrosine Kinase 2, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene Compendium
The ErbB family of receptor tyrosine kinases includes EGFR, ErbB2/HER2, ErbB3/HER3 and ErbB4/HER4. Abundant evidence supports the causal role of HER2 overexpres...
In vivo interaction of Ebp1 with ErbB3 (A) Ebp1 associates with ErbB3 in LNCaP cells. LNCaP cell lysates were immunoprecipitated with mouse isotype control IgG
High-quality ErbB3 proteins from ACROBiosystems. Various species and tags of ErbB3 proteins. Minimal Batch-to-Batch Variation. Bulks in stock.
Plasmid MSCV-human Erbb2-IRES-GFP from Dr. Martine Roussels lab contains the insert Erbb2 and is published in Cell Rep. 2017 Mar 21;18(12):2907-2917. doi: 10.1016/j.celrep.2017.02.073. This plasmid is available through Addgene.
The selective erbB2 antagonist AG825 dampens the NRG1α-induced MRVA.Administration of AG825 in DMSO vehicle (n = 5) caused a robust, dose-dependent decreas
人ErbB2 ELISA试剂盒ELISA试剂盒datasheet (ab100510).Abcam抗体、ELISA、激动剂拮抗剂、表观遗传试剂、蛋白多肽,使用效果保证,中国70%以上现货。
Dr. Braunsteins research focuses on inherited predisposition to hematologic diseases. His laboratory studies the inherited genetic changes in DNA that increase susceptibility to disease. Blood cancers such as myeloproliferative neoplasms and myelodysplastic syndromes are traditionally thought to be acquired disorders, however there is increasing evidence that inherited genetic changes play a role. In addition, Dr. Braunstein studies non-malignant blood diseases including atypical hemolytic uremic syndrome (aHUS) and related thrombotic disorders such as APLS, TTP and HELLP syndrome which are caused in part by genetic mutations. His work has identified a germline variants in the ERBB genes that predispose to hematologic malignancies. In addition, his research group found that patients with catastrophic APLS and HELLP syndrome frequently harbor germline mutations in complement regulatory genes. This has led directly to clinical trials designed to test the efficacy of complement inhibitio...n in ...
Applications Treatment of cancers that possess the ErbB receptors (e.g. colorectal, liver, bladder, and head and neck tumors)Advantages
Catalytic domain of the Protein Tyrosine Kinase, Epidermal Growth Factor Receptor. Protein Tyrosine Kinase (PTK) family; Epidermal Growth Factor Receptor (EGFR); catalytic (c) domain. The PTKc family is part of a larger superfamily that includes the catalytic domains of other kinases such as protein serine/threonine kinases, RIO kinases, and phosphoinositide 3-kinase (PI3K). PTKs catalyze the transfer of the gamma-phosphoryl group from ATP to tyrosine (tyr) residues in protein substrates. EGFR (HER1, ErbB1) is a member of the EGFR (HER, ErbB) subfamily of proteins, which are receptor tyr kinases (RTKs) containing an extracellular EGF-related ligand-binding region, a transmembrane helix, and a cytoplasmic region with a tyr kinase domain and a regulatory C-terminal tail. Unlike other tyr kinases, phosphorylation of the activation loop of EGFR proteins is not critical to their activation. Instead, they are activated by ligand-induced dimerization, leading to the phosphorylation of tyr residues in ...
Dysregulation of the epidermal growth factor receptor family (EGFR, HER2, HER3, HER4) by mutation and/or overexpression plays an important role in tumorigenesis, and targeted agents directed against two members of the HER/ErbB family, epidermal growth factor receptor (EGFR/HER1), and HER2/ErbB2, are used in the treatment of cancer. Extensive crosstalk seen among these receptors implies that blocking signaling of more than one receptor may be more effective in inhibiting tumor growth and circumventing resistance mechanisms than targeting individual receptors. In particular, HER3 is considered a key mediator of resistance to many targeted agents. We generated a "two-in-one" antibody, MEHD7945A, that binds to EGFR and HER3 with high affinity, inhibits receptor function and is more broadly efficacious in various tumor types when compared to monospecific anti-EGFR or anti-HER3 antibodies. Given the ability of HER3 to potently activate the PI3K survival pathway, we investigated if antagonizing ...
Glioblastoma (GBM) is often resistant to conventional and targeted therapeutics. ERBB4 is expressed throughout normal brain and is an oncogene in several pediatric brain cancers; therefore, we investigated ERBB4 as a prognostic marker and therapeutic target in GBM. Using RT-qPCR, we quantified mRNA encoding total ERBB4 and known ERBB4 variants in GBM and non-neoplastic normal brain (NNB) samples. Using immunohistochemistry, we characterized the localization of total and phosphorylated ERBB4 (p-ERBB4) and EGFR protein in archived GBM samples and assessed their association with patient survival. Furthermore, we evaluated the effect of ERBB4 phosphorylation on angiogenesis and tumorigenicity in GBM xenograft models. Total ERBB4 mRNA was significantly lower in GBM than NNB samples, with the JM-a and CYT-2 variants predominating. ERBB4 protein was ubiquitously expressed in GBM but was not associated with patient survival. However, high p-ERBB4 in 11% of archived GBM samples, independent of p-EGFR, was
RESULTS: 775 genes were differentially expressed and clustered in terms of their growth factor responsiveness. As well as identifying uncharacterized genes as novel targets of ErbB2-dependent signalling, ErbB2 overexpression augmented the induction of multiple genes involved in proliferation (e.g. MYC, MAP2K1, MAP2K3), autocrine growth factor signalling (VEGF, PDGF) and adhesion/cytoskeletal regulation (ZYX, THBS1, VCL, CNN3, ITGA2, ITGA3, NEDD9, TAGLN), linking them to the hyper-poliferative and altered adhesive phenotype of the ErbB2-overexpressing cells. We also report ErbB2-dependent down-regulation of multiple interferon-stimulated genes that may permit ErbB2-overexpressing cells to resist the anti-proliferative action of interferons. Finally, IGFBP3 was unique in its pattern of regulation and we further investigated a possible role for IGFBP3 down-regulation in ErbB2-dependent transformation through suppressed IGF1 signalling. We show that IGF1-dependent signalling and proliferation were ...
The ErbB inhibitors, gefitinib, erbstatin, and tryphostin AG825, inhibit a cell signaling process controlling the death-rate of neutrophils, immune cells, which cause damage to the lungs. 
Oncogene ERBB4 (HER4) is a member of the type I receptor protein tyrosine subfamily that includes EGFR, ERBB2, and ERBB3. ERBB4 binds and is activated by neuregulins and other factors and induces a variety of cellular responses including mitogenesis and differentiation.
Her2 / ErbB2 antibody [RM228] (erb-b2 receptor tyrosine kinase 2) for IHC, WB. Anti-Her2 / ErbB2 mAb (GTX33616) is tested in Human samples. 100% Ab-Assurance.
Recombinant Human Her2/ERBB2 Protein (Pro489-Cys630) ECD, domain IV 10004-H08H4 with a fusion His Tag, is expressed in HEK293 Cells. With high purity, high biological activity, high stability, and other superior features, you can use this Human Her2/ERBB2 protein for relevant bioassay and related research.
ERBB3 Antibody 10369-1-AP has been identified with IHC, ELISA. 10369-1-AP detected band in {{ptg:PositiveWB}} with {{ptg:WesternTiter}} dilution...
Recombinant human ErbB 4 protein Protein fragment datasheet (ab85602). Abcam offers quality products including antibodies, assays and other reagents.
With enhanced promotor, HER3 / ERBB3 cDNA ORF Clone, Rat in pCMV3-SP-N-Myc is expression-ready, and confirmed by full-length sequence & expression validation
Plasmid mEmerald-ERBB2-N-18 from Dr. Michael Davidsons lab contains the insert ERBB2. This plasmid is available through Addgene.
ErbB (epidermal growth factor receptor) family is a drug target for treating several types of cancers, including lung and breast cancers. ErbB family of receptor tyrosine kinases consists of EGFR, HER2, ErbB3, and ErbB4. Overexpression of EGFR is observed in 62% of NSCLC tumors(nonsmall cell lung cancer) and overexpression of EGFR and HER2 are important prognostic markers for breast cancer. Members of the ErbB family share a similar overall structural architecture comprising: (i) extracellular ligand binding domain, (ii) transmembrane domain, (iii) intracellular juxtamembrane domain, (iv) intracellular tyrosine kinase domain, and (v) C-terminal regulatory region where phosphorylation occurs. We are interested in targeting the tyrosine kinase domain(TKD). Approved small molecules of the TKD domain include erlotinib Tarceva, OSI Pharmaceuticals), gefitinib (Iressa, AstraZeneca), and lapatinib (Tykerb, Glaxo-SmithKline). A fourth compound called AEE788 (Novartis) is in development. Among them, ...
The neuregulins are a subset of the ligands for the epidermal growth factor receptor family of receptors. They can bind to these receptors and evoke a range of cellular responses. Some of the neuregulins have however been found in the cell nucleus associated with nucleoli and intrachromatin granules. This brief review summarises the data for nuclear expression obtained from observations on normal and malignant tissues and the various laboratory experiments conducted to explore the system. Finally, we discuss the possible functions that could result from intra-nuclear expression of these molecules.. ...
The importance of ErbB receptors in development is proven from the analysis of genetically modified mice. Indeed, null mutations in individual ErbB loci are lethal. More specifically, depending upon the genetic background of the host, loss of ErbB1 leads to embryonic or perinatal lethality with mice showing abnormalities in multiple organs including the brain, skin, lung and gastrointestinal tract (Miettinen et al., 1995; Sibilia and Wagner, 1995; Threadgill et al., 1995; Sibilia et al., 1998). ErbB2 null mice die at midgestation (E10.5) due to trabeculae malformation in the heart (Lee et al., 1995), a phenotype that is shared by ErbB4 knockout mice (Gassmann et al., 1995). In addition, through genetic rescue of heart development via myocardial expression of an ErbB2 transgene, a further role for ErbB2 in peripheral nervous system development has been demonstrated (Morris et al., 1999). In the case of ErbB3, most knockout mice die by E13.5, displaying normal heart trabeculation but defective ...
The ErbB protein family or epidermal growth factor receptor (EGFR) family is a family of four structurally related receptor tyrosine kinases. Insufficient ErbB signaling in humans is associated with the development of neurodegenerative diseases, such as multiple sclerosis and Alzheimers Disease. In mice loss of signaling by any member of the ErbB family results in embryonic lethality with defects in organs including the lungs, skin, heart and brain. Excessive ErbB signaling is associated with the development of a wide variety of types of solid tumor. ErbB-1 and ErbB-2 are found in many human cancers and their excessive signaling may be critical factors in the development and malignancy of these tumors. The ErbB protein family consists of 4 members ...
The soluble ErbB4 ICD has been linked to a number of functions associated with transcriptional regulation and with DNA damage responses. We have identified several proteins associated with ErbB4, some of which have now been confirmed in other laboratories. Here, we describe the functional implications of ErbB4 association with the pleiotropic transcriptional corepressor Kap1. Both CYT-1 and CYT-2 ErbB4 isoforms bind Kap1, and binding does not require ErbB4 kinase activity nor a significant portion of the kinase domain. ErbB4 alters Kap1-related processes, but ErbB4 does not seem to phosphorylate Kap1.. Our data linking ErbB4 to Kap1 add to a growing list of ErbB4 interactions with transcriptional coregulators. ErbB4 binds to the corepressor Eto2, which restrains erythropoietic differentiation and has unknown functions in mammary tissue (30). ErbB4 reduces Eto2 corepression in reporter assays. In another context, ErbB4 ICD is linked to the corepressor NCoR through an interaction with the adapter ...
The four members of the ERBB (HER) family of transmembrane receptor tyrosine kinases are frequently activated in cancer by several mechanisms, such as mutation, amplification, or autocrine ligand-receptor stimulation. We recently identified gene fusions involving the ERBB ligand gene, NRG1, which represent a novel mechanism for ERBB pathway deregulation. These fusions lead to expression and presentation of the EGF-like domain of NRG1 on the cell surface, which binds to ERBB3 in an autocrine and juxtacrine manner, thus inducing the formation of ERBB2-ERBB3 heterodimers, and subsequent activation of the PI3K-AKT and MAPK signaling pathways. These fusion genes were exclusively detected in lung adenocarcinomas of never smokers of the invasive mucinous subtype, which usually presents as a multifocal and unresectable disease, for which no effective treatment exists. Considering the large amount of drugs that target ERBB2 (HER2) and ERBB3 (HER3), and which are currently in different stages of clinical ...
Semantic Scholar extracted view of A neu acquaintance for erbB3 and erbB4: a role for receptor heterodimerization in growth signaling. by Kermit L. Carraway et al.
Analysis of ERBB4 mutations and expression in japanese patients with lung cancer.: Only the kinase domain of ERBB4 has been analyzed in East Asian populations,
HER2/ErbB2 Antibody 51105-1-AP has been identified with ELISA, IF, IHC, WB. 51105-1-AP detected 185 kDa band in HeLa cells with 1:500-1:2000 dilution...
Buy our Recombinant Human ErbB 4 protein. Ab61640 is a protein fragment produced in Insect cells and has been validated in FuncS, SDS-PAGE. Abcam provides free…
Top performende anti-Wheat (Triticum) ERBB3 Antikörper für Immunohistochemistry (Frozen Sections) (IHC (fro)) vergleichen & kaufen.
Clone REA508 recognizes the human ErbB-3 antigen, a single-pass type I membrane protein, which is also known as tyrosine kinase-type cell surface receptor HER3. ErbB-3 is a receptor tyrosine kinase and a member of the epidermal growth factor receptor family (EGFR). It is unique among the ErbB family members in that it is has been shown to have weak or no tyrosine kinase activity. After dimerization with other members of the EGFR family several signal transduction cascades can be activated, including phosphoinosite 3-kinase (PI3-K)/Akt and extracellular signal-regulated kinase (ERK1/2). ErbB-3 is widely expressed in normal tissues including cells of the gastrointestinal, reproductive, respiratory and urinary tracts, as well as the skin, endocrine, and nervous system. It is expressed at elevated levels in a range of human malignancies. Additional information: Clone REA508 displays negligible binding to Fc receptors. - Principat dAndorra
The epidermal growth factor receptor (EGFR or ERBB) family member ERBB4 is essential for normal cardiac, neuronal, and mammary development and is activated by mutation in several cancers (1-4). As for other receptor kinases, ligand-induced phosphorylation of Tyr sites in ERBB4 recruits downstream signaling proteins. In addition, ERBB4 is unique in the ERBB family of receptor tyrosine kinases (RTKs) in that juxtamembrane-a (JM-a) spliced isoforms undergo ligand-induced ecto-domain and intramembrane proteolysis to release a soluble intracellular fragment that enters the nucleus and modifies transcription (5-7). In this context, ERBB4 can act as both a nuclear chaperone [such as for the transcription factor STAT5 (signal transducer and activator of transcription 5)] and a transcriptional modulator [such as for interactions with estrogen receptor, yes-associated protein (YAP), the transcription factor AP-2, the transcriptional coregulator TRIM28/KAP1, and TAB2 in complex with the transcriptional ...
In this study, systematic inhibitor response to ErbB missense mutations in gastric cancer (GC) is investigated by combining computational analysis and experimental assay. The response profile is created for 6 ATP-competitive, reversible inhibitors against 9, 17, 5 and 17 GC-associated missense mutations of ErbB1, ErbB2, ErbB3 and ErbB4 kinase domains, respectively. From the profile a number of p...
USE OF ERBB4 AS A PROGNOSTIC AND THERAPEUTIC MARKER FOR MELANOMA - It is disclosed herein that members of the protein tyrosine kinase (PTK) family are highly mutated in patients with melanoma. Described herein are novel somatic mutations in the ERBB4 gene that result in increased kinase activity, transformation ability and anchorage-independent growth. These ERBB4 mutations contribute to the tumorogenicity of melanoma. Thus, provided herein is a method of predicting the prognosis of a patient with melanoma by detecting the presence or absence of a mutation in the ERBB4 gene. In some examples, the ERBB4 mutation is selected from G949A, G1354A, G1624A, C1630T, G1687A, G2506A and G2614A (numbering based on SEQ ID NO: 1). Also provided are methods of selecting a patient as a candidate for treatment with an ERBB4 and/or PI3K/AKT pathway inhibitor, and a method of identifying a therapeutic agent for the treatment of a subject diagnosed with melanoma. Oligonucleotides that specifically hybridize with ...
` afatinib` の検索結果です。- ATGC論文チェッカー|Pubmed(パブメド)の論文検索をスムーズにするWEBツール
Expression of ERBB3 (HER3, LCCS2) in cancer tissue. The cancer tissue page shows antibody staining of the protein in 20 different cancers.
购买ErbB 4兔单克隆抗体[EP2272AY](ab76132),ErbB 4抗体经WB验证,可与人,小鼠,大鼠样本反应。产品出库一年都在质保范围内。中国现货速达。
EGFRd27 EGFRd27 S4935/EGFRd2.p2 AGCCGTGATCTGTCACCACATAATTACC 28 216 EIF4E NM_001968 S0106/EIF4E.f1 GATCTAAGATGGCGACTGTCGAA 23 217 EIF4E NM_001968 S0108/EIF4E.r1 TTAGATTCCGTTTTCTCCTCTTCTG 25 218 EIF4E NM_001968 S5000/EIF4E.p1 ACCACCCCTACTCCTAATCCCCCGACT 27 219 ErbB3 NM_001982 S0112/ErbB3.f1 CGGTTATGTCATGCCAGATACAC 23 220 Erb B3 NM_001982 S0114/ErbB3.r1 GAACTGAGACCCACTGAAGAAAGG 24 221 Erb B3 NM_001982 S5002/ErbB3.p1 CCTCAAAGGTACTCCCTCCTCCCGG 25 222 ERBB4 NM_005235 S1231/ERBB4.f3 TGGCTCTTAATCAGTTTCGTTACCT 25 223 ERBB4 NM_005235 S1232/ERBB4.r3 CAAGGCATATCGATCCTCATAAAGT 25 224 ERBB4 NM_005235 S4891/ERBB4.p3 TGTCCCACGAATAATGCGTAAATTCTCCAG 30 225 EREG NM_001432 S0670/EREG.f1 ATAACAAAGTGTAGCTCTGACATGAATG 28 226 EREG NM_001432 S0671/EREG.r1 CACACCTGCAGTAGTTTTGACTCA 24 227 EREG NM001432 S4772/EREG.p1 TTGTTTGCATGGACAGTGCATCTATCTGGT 30 228 ERK1 Z11696 S1560/ERK1.f3 ACGGATCACAGTGGAGGAAG 20 229 ERK1 Z11696 S1561/ERK1.r3 CTCATCCGTCGGGTCATAGT 20 230 ERK1 Z11696 S4882/ERK1.p3 CGCTGGCTCACCCCTACCTG 20 231 fas ...
AST-1306 is a selective, irreversible inhibitor of ErbB2 and EGFR with IC50 values of 0.5nM and 3nM, respectively [1].AST-1306 is designed and synthesized based on the chemical structure of lapatinib. The molecular docking method shows AST-1306 binds to t
TY - JOUR. T1 - Requirement of ErbB2 for signalling by interleukin-6 in prostate carcinoma cells. AU - Qiu, Yun. AU - Ravi, Lakshmeswari. AU - Kung, Hsing-Jien. PY - 1998/5/7. Y1 - 1998/5/7. N2 - Interleukin-6 (IL-6) is a cytokine that was initially recognized as a regulator of immune and inflammatory responses, but it also regulates the growth of many tumour cells, including prostrate carcinoma. Overexpression of the growth-factor receptors ErbB2/neu and ErbB3 has been implicated in the neoplastic transformation of prostate carcinoma. Here we show that treatment of the prostate cancer cell line LNCaP with IL-6 induces tyrosine phosphorylation of ErbB2 and ErbB3, but not ErbB1/EGFR. We also show that ErbB2 forms a complex with the gp130 subunit of the IL-6 receptor in an IL- 6-dependent manner. This association is important because the inhibition of ErbB2 activity results in abrogation of IL-6-induced MAPK activation. Thus ErbB2 is a critical component of IL-6 signalling through the MAP kinase ...
The family of Neuregulins (NRG), growth factors like epidermal growth factor, is known to induce growth and differentiation of epithelial, glial, neuronal, and skeletal muscle cells. This family comprises four members, being NRG1 the most largely studied, particularly at the cardiovascular level. The biological effects of NRG1 in the adult heart are mediated by the tyrosine kinase receptors ErbB. In the adult heart, NRG1 is expressed by cells of the endocardial endothelium and the cardiac microvascular endothelium, and the receptors ErbB2/ErbB4 are expressed by ventricular cardiomyocytes and are located in T-tubule system and intercalated disks in close proximity to the system components of excitation-contraction coupling. The importance of the NRG/ErbB signaling axis at the cardiovascular level became evident after discovering that patients treated with trastuzumab (inhibitory antibody against ErbB2, used in the treatment of breast cancer) can develop ventricular dysfunction and have higher ...
WWOX, WW domain-containing oxidoreductase, is a tumor suppressor that is altered in many human cancers, including breast cancer. Wwox interacts with the ErbB4 receptor, reduces nuclear translocation of the cleaved intracellular domain of ErbB4, and inhibits its transactivation function mediated thro …