Spletni strežnik Apache, velikokrat samo Apache, je spletni strežnik, ki igra ključno vlogo pri širjenju spleta. Bil je prva alternativa Netscapeovemu spletnemu strežniku, trenutno znanemu kot spletni strežnik Sun Java System. Od aprila 1996 je Apache najbolj popularen HTTP strežnik na celem spletu. Od oktobra 2007 pa je bilo na Apachijevem strežniku postavljenih približno 48 % vseh spletnih strani. Uporablja ga 73,09%[1] vseh registriranih slovenskih domen. Ime »Apache« je bilo izbrano iz dveh razlogov: ...
On Sunday, August 24th at 3:20 am, a very large (6.0) earthquake struck the Napa Valley of California with most of the damage occurring in the old, historic part of town. I am heartbroken to see the images of some of my favorite buildings red tagged and literally shaken off their foundations with roofs collapsed, walls crumbled and windows blown out. My facebook feed is filled with photos of my friends homes and businesses and wineries in shambles. Picture the interior of your house. Now imagine someone picking it up, shaking it like mad, and then setting it back down. Everything fallen off the walls, dropped out of cupboards, broken glass and plates and heirlooms everywhere. No power...gas off because of the potential for leaks, no running water. That was downtown Napa this weekend. But Napans are strong and resilient. My heart was full hearing all the stories of neighbors helping neighbors. I am so happy to report that Napa Farmhouse 1885 is doing just fine...so, if you want to help, visit ...
TY - JOUR. T1 - High-resolution timing of cell cycle-regulated gene expression. AU - Rowicka-Kudlicka, Malgorzata. AU - Kudlicki, Andrzej. AU - Tu, Benjamin P.. AU - Otwinowski, Zbyszek. PY - 2007/10/23. Y1 - 2007/10/23. N2 - The eukaryotic cell division cycle depends on an intricate sequence of transcriptional events. Using an algorithm based on maximum-entropy deconvolution, and expression data from a highly synchronized yeast culture, we have timed the peaks of expression of transcriptionally regulated cell cycle genes to an accuracy of 2 min (≈1% of the cell cycle time). The set of 1,129 cell cycle-regulated genes was identified by a comprehensive analysis encompassing all available cell cycle yeast data sets. Our results reveal distinct subphases of the cell cycle undetectable by morphological observation, as well as the precise timeline of macromolecular complex assembly during key cell cycle events.. AB - The eukaryotic cell division cycle depends on an intricate sequence of ...
During the cell division cycle of the yeast Saccharomyces cerevisiae, the G1-to-S transition depends upon the activation of two transcription factors (SBF and MBF), which are responsible for the cell cycle-regulated expression of more than 200 genes. Bck2 becomes essential in the absence of Cln3, the most upstream activator of this transcriptional program. Here we have used a genome-wide approach to elucidate the targets of Bck2. Our data indicate that Bck2 activates a selection of cell cycle-regulated genes from all cell cycle stages. In contrast, Cln3 activates only G1/S phase genes. Furthermore, Bck2 activates many genes independently of Swi6, the common component of SBF and MBF. Comparison of Bck2 targets with those of other transcription factors suggests that, in addition to SBF and MBF, Bck2 may elicit gene expression via Ste12 and Mcm1. We propose that Bck2 activates its targets by a mechanism fundamentally different from that of Cln3, and that it may be a necessary cofactor for the full ...
Antibody-mediated defense against pathogens typically requires complex interactions between antibodies and other constituents of the humoral and cellular immune systems. However, recent evidence indicates that some antibodies alone can inhibit pathogen function in the absence of complement, phagocytes, or NK cells. In this issue of the JCI, McClelland et al. have begun to elucidate the molecular bases by which antibodies alone can impact pathogen growth and metabolism. They show that mAbs specific for the polysaccharide capsule of the human pathogenic fungus Cryptococcus neoformans elicit diverse effects on fungal gene expression, lipid biosynthesis, susceptibility to amphotericin B, cellular metabolism, and protein phosphorylation. These data suggest that pathogens have the capacity to generate broad metabolic responses as a result of surface binding by pathogen-specific antibodies, effects that may hold therapeutic promise. ...
Antibody-mediated defense against pathogens typically requires complex interactions between antibodies and other constituents of the humoral and cellular immune systems. However, recent evidence indicates that some antibodies alone can inhibit pathogen function in the absence of complement, phagocytes, or NK cells. In this issue of the JCI, McClelland et al. have begun to elucidate the molecular bases by which antibodies alone can impact pathogen growth and metabolism. They show that mAbs specific for the polysaccharide capsule of the human pathogenic fungus Cryptococcus neoformans elicit diverse effects on fungal gene expression, lipid biosynthesis, susceptibility to amphotericin B, cellular metabolism, and protein phosphorylation. These data suggest that pathogens have the capacity to generate broad metabolic responses as a result of surface binding by pathogen-specific antibodies, effects that may hold therapeutic promise. ...
At intermediate intensities, stress induces oscillations in the nucleocytoplasmic shuttling of the transcription factor Msn2 in budding yeast. Activation by stress results in a reversible translocation of Msn2 from the cytoplasm to the nucleus. This translocation is negatively controlled by the cAMP …
As a public service, the genomic sequence data and preliminary annotations for various fungal species are being made available before scientific publication by the Genozymes for Bioproducts and Bioprocesses Development Project which is funded primarily by Genome Canada. This website is being hosted and the data maintained at the Centre for Structural and Functional Genomics at Concordia University (Montreal, Quebec, Canada).. While early data release should aid scientific research and development, these pre-publication data are preliminary and may contain errors. The Genozymes for Bioproducts and Bioprocesses Development Project reserves the exclusive right to publish the genome annotation data, initial analyses on fungal gene expression under different growth conditions by means of transcriptomic and proteomic data analyses, comparative genomics analysis of these data with other fungal sequence data, and analyses of these data for distribution of protein domains and metabolic pathways.. By ...
Thank you for sharing this Eukaryotic Cell article.. NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.. ...
Cell fate can be determined by asymmetric segregation of gene expression regulators. In the budding yeast Saccharomyces cerevisiae, the transcription factor Ace2 accumulates specifically in the daughter cell nucleus, where it drives transcription of genes that are not expressed in the mother cell. T …
BioAssay record AID 460553 submitted by ChEMBL: Antiaging effect in Saccharomyces cerevisiae K6001 expressing uth1 mutant assessed as extension of replicative life span after 2 days.
A.4 Naider, F., Son, C. A., Sargsyan, H., and Becker, J. M., Biochemical and mutagenic analysis of a G protein-coupled receptor: Photocrosslinking of the tridecapeptide alpha-Factor into Ste2p of Saccharomyces cerevisiae reveals contact points between the peptide and its receptor binding site. 3rd International Peptide Symposium/28th European Peptide Symposium, (2004), p.93-95 ...
HapX positively regulates the levels of the CIR1 and RIM101 transcripts.Quantification of HAPX, CIR1 and RIM101 transcripts by quantitative RT-PCR in WT, hapXΔ
Preva*lence (?), n. [L. praevalentia: cf. F. prevalence. See Prevail.] The quality or condition of being prevalent; superior stre...
One of the most crucial tasks for a cell to ensure its long term survival is preserving the integrity of its genetic heritage via maintenance of DNA structure and sequence. While the DNA damage response in the yeast Saccharomyces cerevisiae, a model eukaryotic organism, has been extensively studied, much remains to be elucidated about how the organism senses and responds to different types and doses of DNA damage. We have measured the global transcriptional response of S. cerevisiae to multiple doses of two representative DNA damaging agents, methyl methanesulfonate (MMS) and gamma radiation. Hierarchical clustering of genes with a statistically significant change in transcription illustrated the differences in the cellular responses to MMS and gamma radiation. Overall, MMS produced a larger transcriptional response than gamma radiation, and many of the genes modulated in response to MMS are involved in protein and translational regulation. Several clusters of coregulated genes whose responses varied
AbstractProtein-metabolite interactions are of crucial importance for all cellular processes but remain understudied. Here, we applied a biochemical approach named PROMIS, to address the complexity of the protein-small molecule interactome in the model yeast Saccharomyces cerevisiae. By doing so, we provide a unique dataset, which can be queried for interactions between 74 small molecules and 3982 proteins using a user-friendly interface available at https://promis.mpimp-golm.mpg.de/yeastpmi/. By interpolating PROMIS with the list of predicted protein-metabolite interactions, we provided experimental validation for 225 binding events. Remarkably, of the 74 small molecules co-eluting with proteins, 36 were proteogenic dipeptides. Targeted analysis of a representative dipeptide, Ser-Leu, revealed numerous protein interactors comprising chaperones, proteasomal subunits, and metabolic enzymes. We could further demonstrate that Ser-Leu binding increases activity of a glycolytic enzyme ...
A central theme in biology is to understand how different signaling outputs can be accomplished by changes to signal transduction pathways. Here, we examined epigenetic differences between two cell states in the human fungal pathogen Candida albicans. We show that cells in the white state are sterile due to multiple bottlenecks in MAPK signaling relative to mating-competent opaque cells. Alleviation of these bottlenecks by reverse engineering effectively converts sterile white cells into sexually competent cells. These results have broad implications for understanding how epigenetic changes can impact MAPK expression and signaling output, including events associated with tumorigenesis. We also propose a model for how the white-opaque switch gained control of sexual reproduction in Candida during evolution.. ...
The last several years have been witness to significant developments in understanding transcriptional regulation of the yeast phospholipid structural genes. The response of most phospholipid structural genes to inositol is now understood on a mechanistic level. The roles of specific activators and repressors are also well established. The knowledge of specific regulatory factors that bind the promoters of phospholipid structural genes serves as a foundation for understanding the role of chromatin modification complexes. Collectively, these findings present a complex picture for transcriptional regulation of the phospholipid biosynthetic genes. The INO1 gene is an ideal example of the complexity of transcriptional control and continues to serve as a model for studying transcription in general. Furthermore, transcription of the regulatory genes is also subject to complex and essential regulation. In addition, databases resulting from a plethora of genome-wide studies have identified regulatory ...
Characterization of a glucose-repressed pyruvate kinase (Pyk2p) in Saccharomyces cerevisiae that is catalytically insensitive to fructose-1,6-bisphosphate ...
Saccharomyces cerevisiae sudah sejak lama digunakan sebagai starter fermentasi pembuatan roti dan minuman beralkohol. Dalam buku ini, Saccharomyces crervisiae dimanfaatkan sebagai agensia modifikasi dalam pengolahan pangan, kemampuan S. cerevisiae dalam merombak komponen pangan, produk metabolit yang dihasilkan oleh S. cerevisiae, modifikasi terhadap perubahan sifat beberapa produk pangan oleh S. cerevisiae seperti tapioka, tempe, dan modifikasi fermentasi kakao. Pengertian dasar mengenai khamir perlu dipahami oleh mahasiswa yang khususnya mempelajari mikrobiologi pangan, mikrobiologi industri dan teknologi pangan. S.cerevisiae adalah khamir ...
P. T. Spellman and G. Sherlock and M. Q. Zhang and V. R. Iyer and K. Anders and M. B. Eisen and P. O. Brown and D. Botstein and B. Futcher. Comprehensive identification of cell cycle-regulated genes of the yeast Saccharomyces cerevisiae by microarray hybridization. Mol Biol Cell. 9(12):3273-97, 1998 ...
TY - JOUR. T1 - The transcriptional response to alkaline pH in Saccharomyces cerevisiae: Evidence for calcium-mediated signalling. AU - Serrano, Raquel. AU - Ruiz, Amparo. AU - Bernal, Dolores. AU - Chambers, James R.. AU - Ariño, Joaquín. PY - 2002/12/1. Y1 - 2002/12/1. N2 - The short-time transcriptional response of yeast cells to a mild increase in external pH (7.6) has been investigated using DNA microarrays. A total of 150 genes increased their mRNA level at least twofold within 45 min. Alkalinization resulted in the repression of 232 genes. The response of four upregulated genes, ENA1 (encoding a Na+-ATPase also induced by saline stress) and PHO84, PHO89 and PHO12 (encoding genes upregulated by phosphate starvation), was characterized further. The alkaline response of ENA1 was not affected by mutation of relevant genes involved in osmotic or oxidative signalling, but was decreased in calcineurin and rim101 mutants. Mapping of the ENA1 promoter revealed two pH-responsive regions. The ...
TY - JOUR. T1 - Heterogeneity of stress gene expression and stress resistance among individual cells of Saccharomyces cerevisiae. AU - Attfield, Paul V. AU - Choi, Hung-Yoon. AU - Veal, Duncan A. AU - Bell, Phillip. PY - 2001. Y1 - 2001. U2 - 10.1046/j.1365-2958.2001.02444.x. DO - 10.1046/j.1365-2958.2001.02444.x. M3 - Article. VL - 40. SP - 1000. EP - 1008. JO - Molecular Microbiology. JF - Molecular Microbiology. SN - 0950-382X. IS - 4. ER - ...
A free platform for explaining your research in plain language, and managing how you communicate around it - so you can understand how best to increase its impact.
The Genetics Society of America (GSA), founded in 1931, is the professional membership organization for scientific researchers and educators in the field of genetics. Our members work to advance knowledge in the basic mechanisms of inheritance, from the molecular to the population level.. Online ISSN: 1943-2631. ...
ISW1-N小鼠多克隆抗体(ab43434)可与酿酒酵母样本反应并经WB, IP, ICC/IF实验严格验证。中国75%以上现货,所有产品提供质保服务,可通过电话、电邮或微信获得本地专属技术支持。
China Wholesale Animal Additive Yeast Saccharomyces Cerevisiae with High-Quality, Leading Wholesale Animal Additive Yeast Saccharomyces Cerevisiae Manufacturers & Suppliers, find Wholesale Animal Additive Yeast Saccharomyces Cerevisiae Factory & Exporters.
Author summary Genetically identical cells, even when they are exposed to the same environmental conditions, display incredible diversity. Gene expression noise is attributed to be a key source of this phenotypic diversity. Transcriptional dynamics is a dominant source of expression noise. Although scores of theoretical and experimental studies have explored how noise is regulated at the level of transcription, most of them focus on the gene specific, cis regulatory elements, such as the number of transcription factor (TF) binding sites, their binding strength, etc. However, how the global properties of transcription, such as the limited availability of TFs impact noise in gene expression remains rather elusive. Here we build a theoretical model that incorporates the effect of limiting TF pool on gene expression noise. We find that competition between genes for TFs leads to enhanced variability in mRNA copy number across an isogenic population. Moreover, for gene copies sharing TFs with other competitor
TY - BOOK. T1 - Environmental Stress Responses and Biological Interactions Investigated in the Drosophila Model System. AU - Ørsted, Michael. N1 - PhD supervisor: Professor Torsten Nygaard Kristensen, Department of Chemistry and Bioscience Aalborg University, Denmark. PY - 2017. Y1 - 2017. N2 - When organisms are faced with changes in their environment, they are forced to respond, if they are to maintain optimal function. Especially ectotherms must deal with environmental changes in e.g. temperature on a regular basis, and thus their survival and reproductive success depend on their ability to respond on a behavioral, physiological, morphological and/or evolutionary level according to the environmental cues.At the same time, if populations are small and fragmented, and have limited gene flow, environmental change and environmental stress might interact with intrinsic genetic stress such as inbreeding and genetic drift, which can exacerbate the effects of one or more environmental stresses. ...
Evolution of multigene families are considered in the review on the example of the PHO gene family encoding the structure of acid phosphatases in the yeast Saccharomyces cerevisiae. Analysis of the...
TY - JOUR. T1 - Dynamic Effects Related to Steady-State Multiplicity in Continous Saccharomyces Cerevisiae Cultivations. AU - Lei, Frede. AU - Olsson, Lisbeth. AU - Jørgensen, Sten Bay. PY - 2004. Y1 - 2004. N2 - The behavioral differences between chemostat and productostat cultivation of aerobic glucose-limited Saccharomyces cerevisiae were investigated. Three types of experiments were conducted: a chemostat, where the dilution rate was shifted up or down in stepwise manner; and a productostat, with either stepwise changed or a rampwise increased ethanol setpoint, i.e., an accelero-productostat. The transient responses from chemostat and productostat experiments were interpreted using a simple metabolic flux model. In a productostat it was possible to obtain oxido-reductive steady states at dilution rates far below D-crit due to a strong repression of the respiratory system. However, these steady states could not be obtained in a chemostat, since a dilution rate shift-down from an ...
Saccharomyces cerevisiae ATCC ® 201390D-5™ Designation: Genomic DNA from Saccharomyces cerevisiae Strain BY4743 (ATCC ® 201390™) Application:
Saccharomyces cerevisiae ATCC ® 201389D-5™ Designation: Genomic DNA from Saccharomyces cerevisiae Strain BY4742 (ATCC ® 201389™) Application:
TY - THES. T1 - Lipid transport to the plasma membrane of the yeast Saccharomyces cerevisiae. AU - Pichler, Harald. PY - 2000. Y1 - 2000. M3 - Doctoral Thesis. ER - ...
MOTIZUKI, M., MITSUI, K., ENDO, Y. and TSURUGI, K. (1986), Detection and partial characterization of the chromatin-associated proteases of yeast Saccharomyces cerevisiae. European Journal of Biochemistry, 158: 345-350. doi: 10.1111/j.1432-1033.1986.tb09757.x ...
Yeast Saccharomyces cerevisiae in vivo Prp8 splicing assay(A) Schematic representation of the two-step splicing pathway (SS, splice site; BS, branch site). Brie
TY - CHAP. T1 - Lipids and membranes in Saccharomyces cerevisiae.. AU - Schweizer, Michael. PY - 1999. Y1 - 1999. M3 - Chapter. SP - 79. EP - 155. BT - In The Metabolism & Molecular Physiology of Saccharomyces cerevisiae. Eds. J R Dickinson & M Schweizer. Taylor & Francis, London. ER - ...
Saccharomyces cerevisiae ATCC ® 9763D-5™ Designation: Genomic DNA from Saccharomyces cerevisiae NRRL Y-567 (ATCC ® 9763™) Application: Food testing
RAJVI ENTERPRISE- We are leading manufacturer,Supplier and exporter of Saccharomyces Cerevisiae from Gujarat, India. Buy highest quality of products from us at affordable price.
1P-022 Saccharomyces cerevisiaeの糖代謝における転写制御ネットワークの予測(遺伝子工学,一般講演)1P-022 Saccharomyces cerevisiaeの糖代謝における転写制御ネットワークの予測(遺伝子工学,一般講演)AN10549378 ...
For more than five decades S. cerevisiae has been studied as a model organism to better understand aging and has contributed to the identification of more mammalian genes affecting aging than any other model organism.[34] Some of the topics studied using yeast are calorie restriction, as well as in genes and cellular pathways involved in senescence. The two most common methods of measuring aging in yeast are Replicative Life Span (RLS), which measures the number of times a cell divides, and Chronological Life Span (CLS), which measures how long a cell can survive in a non-dividing stasis state.[34] Limiting the amount of glucose or amino acids in the growth medium has been shown to increase RLS and CLS in yeast as well as other organisms.[35] At first, this was thought to increase RLS by up-regulating the sir2 enzyme, however it was later discovered that this effect is independent of sir2. Over-expression of the genes sir2 and fob1 has been shown to increase RLS by preventing the accumulation of ...
The Saccharomyces Cerevisiae Morphological Database(SCMD) is a collection of micrographs of budding yeast mutants. Micorgraphs of mutants with altered cell morphology were taken at Ohya Group, University of Tokyo, from a set of the haploid MATa deleted strains obtained from EUROSCARF. From the micrographs, disruptant cells are automatically extracted by our novel cell-image processing software developed at Morishita Group, University of Tokyo. Heterozygous essential gene deletion set, DAmP collection set, natural yeast strain set and others were analyzed by this software. ...
Domain architecture and assignment details (superfamily, family, region, evalue) for YLR216C from Saccharomyces cerevisiae CLIB215. Plus protein sequence and external database links.
Domain architecture and assignment details (superfamily, family, region, evalue) for YLR216C from Saccharomyces cerevisiae JAY291. Plus protein sequence and external database links.
Domain architecture and assignment details (superfamily, family, region, evalue) for YLR222C from Saccharomyces cerevisiae SGD. Plus protein sequence and external database links.
Tetes tebu merupakan limbah pengolahan gula yang mengandung gula cukup tinggi sehingga sangat potensial dimanfaatkan sebagai media fermentasi. Fermentasi tetes tebu untuk menghasilkan bioetanol menjadi salah satu upaya megurangi jumlah limbah dan memenuhi kebutuhan Bahan Bakar Minyak (BBM) yang semakin meningkat. Tujuan dari penelitian ini adalah untuk mengetahui pengaruh pH dan lama fermentasi terhadap produksi bioetanol dari tetes tebu (molase) dengan cara fermentasi menggunakan Saccharomyces cerevisiae. Penelitian ini meliputi proses fermentasi dan pemisahan bioetanol dari media fermentasi. Proses fermentasi dilakukan dengan variasi pH 4, 4,5, dan 5, sedangkan variasi lama fermentasi dilakukan selama 3, 4, 5, dan 6 hari. Bioetanol hasil fermentasi dipisahkan dari media fermentasi dengan metode destilasi fraksinasi dan untuk mengukur kadar bioetanol digunakan metode kromatografi gas. Data yang diperoleh pada setiap perlakuan dianalisis menggunakan analisis varians (ANOVA) dan dilanjutkan ...
Saccharomyces cerevisiae Y12 - Organisms are classified by taxonomy into specified groups such as the multicellular animals, plants, and fungi; or unicellular microorganisms such as a protists, bacteria, and archaea.
Gene target information for PRB1 - proteinase B (Saccharomyces cerevisiae S288C). Find diseases associated with this biological target and compounds tested against it in bioassay experiments.
The following pages link to Saccharomyces cerevisiae: Displayed 2 items. View (previous 250 , next 250) (20 , 50 , 100 , 250 , 500) ...
EC number: 283-294-5 , CAS number: 84604-16-0 Extractives and their physically modified derivatives such as tinctures, concretes, absolutes, essential oils, oleoresins, terpenes, terpene-free fractions, distillates, residues, etc., obtained from Saccharomyces cerevisiae, Saccharomycelaceae. ...
EC number: 283-294-5 , CAS number: 84604-16-0 Extractives and their physically modified derivatives such as tinctures, concretes, absolutes, essential oils, oleoresins, terpenes, terpene-free fractions, distillates, residues, etc., obtained from Saccharomyces cerevisiae, Saccharomycelaceae. ...
EC number: 283-294-5 , CAS number: 84604-16-0 Extractives and their physically modified derivatives such as tinctures, concretes, absolutes, essential oils, oleoresins, terpenes, terpene-free fractions, distillates, residues, etc., obtained from Saccharomyces cerevisiae, Saccharomycelaceae. ...
Pl ss baba mikr b form ban, alkalmas mint sz rakoztat aj nd k, vagy mint tan t eszk z sz l knek s tan roknak. Az leszt gomba vagy s r leszt (Saccharomyces cerevisiae) a sarjadz - vagy leszt gomb k egy fajt ja. A korai id k ta ez a legfontosabb leszt faj - a keny rs t sn l s s rf z sn l haszn lj k. Els k nt a sz l h j n izol lt k (a s t t sz n gy m lcs k mint a...
Author: Stagge, F.; Genre: Thesis; Published in Print: 2010; Title: Etablierung neuartiger Fluoreszenzmarkierungen in der Bäckerhefe Saccharomyces cerevisiae für die hochauflösende Mikroskopie mitochondrialer Proteine.
Please enjoy this information on EpiCor made available through the generosity of Embrias adoption. Information on EpiCor, yeast fermentate, Saccharomyces cerevisiae.
Shop Transcriptional regulator of filamentous growth ELISA Kit, Recombinant Protein and Transcriptional regulator of filamentous growth Antibody at MyBioSource. Custom ELISA Kit, Recombinant Protein and Antibody are available.
Conidiation in the filamentous ascomycete Aspergillus nidulans requires activation of brlA, a well-characterized transcriptional regulator of genes that are induced specifically during asexual develop
A BioProject is a collection of biological data related to a single initiative, originating from a single organization or from a consortium. A BioProject record provides users a single place to find links to the diverse data types generated for that project
tgctgcttgtgccgcaagggacgcagacgttgaaaaagctgctctaaaaatgtttactga ttattgcagcggtaataaggaagccatcccagcattgattaaaccaattgtatttaacac tgtggcaagagttggtggtgcagaaaactatgaaaaagtttacaaaatctacttagatcc aatctctaacgatgaaaaattagccgcattaagatctttaggcagatttaaagaacctaa attattagaaagaaccttaggatatttgtttgatggcactgtcttaaaccaagacattta tattccaatgcaaggaatgagagctcatcaagaaggtgtagaggctttgtggaattgggt taaaaagaactgggacgaactcgtaaagagactacctcctggtctttcaatgctaggctc cgtcgtcacattaggtacctctggctttacatcaatgcaaaaaatagatgagattaagaa attctttgccactaaatccacgaaaggtttcgatcaaagtttggctcaatcactggacac tattacttcgaaagcgcagtggggttaacagagaccgtgatgtcgtcaacaagtatttga aggaaaatggttactattaagaaaaaatctcttttctagccattttgcctttttatatag tcaagtatctatatgtgacaaatacttcttctaagcttggccttctgataggcttagctt gcagtggttgcaaacatacataaatcaacaaaaaagtacggcttaaaattttggtattca tttatttcaacccgtgcacactggaaataaatctgtacataacagcatattttgtttttg aaaaaatttctgtgttcctccgatgtgggaagaattttaggatcggctaaatttcgtaaa gtatcagtaacttggtatctctgtataagcggagtctaatttcgataacaagcaacttca ...
Powered by Pure, Scopus & Elsevier Fingerprint Engine™ © 2020 Elsevier B.V. We use cookies to help provide and enhance our service and tailor content. By continuing you agree to the use of cookies. Log in to Pure. ...
Riles, L., Dutchik, J.E., Baktha, A., McCauley, B.K., Thayer, E.C., Leckie, M.P., Braden, V.V., Depke, J.E., Olson, M.V. (1993) Physical maps of the six smallest chromosomes of Saccharomyces cerevisiae at a resolution of 2.6 kilobase pairs. Genetics 134(1):81-150. PMID:8514151 ...