Two-component signal transduction systems enable bacteria to sense, respond, and adapt to changes in their environment or in their intracellular state. Each two-component system consists of a sensor protein-histidine kinase (HK) and a response regulator (RR). In the prototypical two-component pathway, the sensor HK phosphorylates its own conserved His residue in response to a signal(s) in the environment. Subsequently, the phosphoryl group of HK is transferred onto a specific Asp residue on the RR. The activated RR can then effect changes in cellular physiology, often by regulating gene expression. Two-component pathways thus often enable cells to sense and respond to stimuli by inducing changes in transcription ...
Two-component signal transduction systems enable bacteria to sense, respond, and adapt to changes in their environment or in their intracellular state. Each two-component system consists of a sensor protein-histidine kinase (HK) and a response regulator (RR). In the prototypical two-component pathway, the sensor HK phosphorylates its own conserved His residue in response to a signal(s) in the environment. Subsequently, the phosphoryl group of HK is transferred onto a specific Asp residue on the RR. The activated RR can then effect changes in cellular physiology, often by regulating gene expression. Two-component pathways thus often enable cells to sense and respond to stimuli by inducing changes in transcription ...
Zhu J, Miller MB, Vance RE, Dziejman M, Bassler BL, Mekalanos JJ. Quorum-sensing regulators control virulence gene expression in Vibrio cholerae. Proc Natl Acad Sci U S A. 2002 ;99(5):3129-34. ...
E coli rssB protein: negative regulator of sigma(S) factor, Rpos; isolated from E. coli; this two-component response regulator affects sigma S-dependent proteins; it is implicated in the control of protein stability; has been sequenced; homologous proteins, namely, Mvia and Hnr found in other bacteria
We use cookies to enhance your experience on our website. By continuing to use our website, you are agreeing to our use of cookies. You can change your cookie settings at any time.Find out more ...
Signal transductionRegulatory functionsDNA interactionsphosphonate utilization transcriptional regulator PhnR (TIGR03337; HMM-score: 32.5) ...
H-NS family proteins are nucleoid-associated proteins that form oligomers on DNA and function as global regulators. They are found in both bacterial chromosomes and plasmids, and were suggested to be candidate effectors of the interaction between them. TurA and TurB are the predominantly expressed H-NS family proteins encoded on the chromosome of Pseudomonas putida KT2440, while Pmr is encoded on the carbazole-degradative incompatibility group P-7 plasmid pCAR1. Previous transcriptome analyses suggested that they function cooperatively, but play different roles in the global transcriptional network. In addition to differences in protein interaction and DNA-binding functions, cell expression levels are important in clarifying the detailed underlying mechanisms. Here, we determined the precise protein amounts of TurA, TurB, and Pmr in KT2440 in the presence and absence of pCAR1. The intracellular amounts of TurA and TurB in KT2440 and KT2440(pCAR1) were determined by quantitative western blot analysis
Two-component signal transduction systems (TCSs) play fundamental roles in bacterial survival and pathogenesis and have been proposed as targets for the development of novel classes of antibiotics. A new coupled assay was developed and applied to analyse the kinetic mechanisms of three new kinds of inhibitors of TCS function. The assay exploits the biochemical properties of the cognate HpkA-DrrA histidine kinase-response regulator pair from Thermotoga maritima and allows multiple turnovers of HpkA, linear formation of phosphorylated DrrA, and Michaelis-Menten analysis of inhibitors. The assay was validated in several ways, including confirmation of competitive inhibition by adenosine 5′-β,γ-imidotriphosphate (AMP-PNP). The coupled assay, autophosphorylation and chemical cross-linking were used to determine the mechanisms by which several compounds inhibit TCS function. A cyanoacetoacetamide showed non-competitive inhibition with respect to ATP concentration in the coupled assay. The
Shop Leucine-responsive regulatory protein ELISA Kit, Recombinant Protein and Leucine-responsive regulatory protein Antibody at MyBioSource. Custom ELISA Kit, Recombinant Protein and Antibody are available.
CategoryTree ,Parents= * 3. [[Information processing]] ** 3.4. [[Regulation of gene expression]] ,Neighbours= * 3.4.1. [[Sigma factors and their control]] * 3.4.2. [[Transcription factors and their control]] * 3.4.3. [[Trigger enzymes]] * 3.4.4. [[RNA binding regulators]] * 3.4.5. [[Regulators of core metabolism]] * 3.4.6. [[Transition state regulators]] * 3.4.7. [[Phosphorelay]] * 3.4.8. [[Quorum sensing]] * 3.4.9. [[Other regulators]] ,Related= none ,}} == Genes in this functional category == * [[abh]] * [[abrB]] * [[salA]] * [[scoC]] * [[sinI]] * [[sinR]] * [[slrA]] * [[slrR]] =Back to [[categories ...
This unit provides a chronological in‐depth description of all protocols needed for quantitative reverse transcription-PCR (Q‐RT‐PCR) analysis of Borrelia burgdorferi gene expression within infected mouse tissues
PubMed comprises more than 30 million citations for biomedical literature from MEDLINE, life science journals, and online books. Citations may include links to full-text content from PubMed Central and publisher web sites.
The two-component signal transduction system (TCS) BarA/UvrY activates transcription of CsrB and CsrC noncoding RNAs, which act by sequestering the RNA-binding global regulatory protein CsrA. Here, we show that the metabolic end products formate and acetate provide a physiological stimulus for this TCS and thus link posttranscriptional regulation by the Csr system to the metabolic state of the cell. ...
GT:ID BAD55842.1 GT:GENE BAD55842.1 GT:PRODUCT putative two-component system response regulator GT:DATABASE GIB00210CH01 GT:ORG nfar0 GB:ACCESSION GIB00210CH01 GB:LOCATION 1103586..1104263 GB:FROM 1103586 GB:TO 1104263 GB:DIRECTION + GB:PRODUCT putative two-component system response regulator GB:PROTEIN_ID BAD55842.1 LENGTH 225 SQ:AASEQ MTAVLLAEDDEAIAAPLSRALGREGYTVTVESFGPAVLRRALEGNHDLLILDLGLPGMDGLEVCRQVRARGADLAVLMLTARTDEVDFVVGLDAGADDYVGKPFRLAELLARVRALLRRSGIGDEAVEVGGIRLEPAARRVLVNGVEVGLANKEYELLKVLIDRAGQVVPRETILREVWGDAELRGSKTLDMHMSWLRRKIGDEGPMAERRIVTVRGVGFRLNTD GT:EXON 1,1-225:0, BL:SWS:NREP 1 BL:SWS:REP 1-,222,REGX3_MYCTU,4e-41,41.4,220/227, SEG 105-,119,rlaellarvrallrr, BL:PDB:NREP 1 BL:PDB:REP 2-,222,2oqrA,5e-41,41.1,219/226, RP:PDB:NREP 1 RP:PDB:REP 1-,219,3c3wB,1e-22,25.4,205/210, RP:PFM:NREP 2 RP:PFM:REP 4-,104,PF00072,4e-15,43.6,101/111,Response_reg, RP:PFM:REP 145-,222,PF00486,2e-11,53.2,77/77,Trans_reg_C, HM:PFM:NREP 2 HM:PFM:REP 4-,114,PF00072,8.6e-28,36.9,111/112,Response_reg, HM:PFM:REP ...
GT:ID BAD55509.1 GT:GENE BAD55509.1 GT:PRODUCT putative two-component system response regulator GT:DATABASE GIB00210CH01 GT:ORG nfar0 GB:ACCESSION GIB00210CH01 GB:LOCATION complement(685615..686331) GB:FROM 685615 GB:TO 686331 GB:DIRECTION - GB:PRODUCT putative two-component system response regulator GB:PROTEIN_ID BAD55509.1 LENGTH 238 SQ:AASEQ MGGVSTSPTPTVLVVDDDEDVLASVERGLRLSGFHVLVARDGAAALRSVNADCPDAVVLDMNMPVLDGAGVVTALRALGNDVPICVLSARASVDDRISGLESGADDYLVKPFVLAELVARIKALLRRRTDAPAAAATPGAITVGPLEVDEAGYRALLHGREIELTKREFELLSTLARNAGVVLSRERLLELVWGYDFAADTNVVDVFVGYLRRKLEADGTPRLLHTIRGVGFVLRAPK GT:EXON 1,1-238:0, BL:SWS:NREP 1 BL:SWS:REP 27-,235,PRRA_MYCTU,5e-65,65.2,207/233, SEG 4-,26,vstsptptvlvvdddedvlasve, SEG 123-,140,allrrrtdapaaaatpga, SEG 181-,192,vvlsrerllelv, BL:PDB:NREP 1 BL:PDB:REP 27-,235,1ys6B,2e-65,65.2,207/227, RP:PDB:NREP 1 RP:PDB:REP 27-,231,3c3wB,2e-24,20.9,187/210, RP:PFM:NREP 2 RP:PFM:REP 33-,122,PF00072,6e-17,45.6,90/111,Response_reg, RP:PFM:REP ...
Escherichia coli is transformed from a commensal organism into a pathogen by acquisition of genetic elements called pathogenicity islands (PAIs). Katsowich et al. investigated how the PAI virulence genes of enteropathogenic E. coli (EPEC) respond when the bacterium attaches to a host gut cell. EPEC first sticks to the host by means of pili and then uses a PAI-encoded type 3 secretion system (T3SS) to inject multiple effectors into the host cell. But not all virulence mediators are injected. For example, CesT, a bacterial chaperone, delivers virulence effectors into the T3SS apparatus. Then, within the bacterial cytoplasm, it interacts with a gene repressor called CsrA, which reprograms bacterial gene expression to help the bacteria to adapt to epithelial cell-associated life.. Science, this issue p. 735 ...
Reliable identification of targets of bacterial regulators is necessary to understand bacterial gene expression regulation. These targets are commonly predicted by searching for high-scoring binding sites in the upstream genomic regions, which typically leads to a large number of false positives. In contrast to the common approach, here we propose a novel concept, where overrepresentation of the scoring distribution that corresponds to the entire searched region is assessed, as opposed to predicting individual binding sites. We explore two implementations of this concept, based on Kolmogorov-Smirnov (KS) and Anderson-Darling (AD) tests, which both provide straightforward P value estimates for predicted targets. This approach is implemented for pleiotropic bacterial regulators, including σ70 (bacterial housekeeping σ factor) target predictions, which is a classical bioinformatics problem characterized by low specificity. We show that KS based approach is both faster and more accurate, departing from
There could be an interesting connection here with another resent paper where in yeast it was shown that the cost of GFP is dramatically different for stable and denaturation-prone variants (for brilliant discussion of this paper see this post in It Takes 30). Is GFP equally stable in E. coli during the early and late exponential phase? Could it be that the effects observed here are reflecting mere change in GFP stability? Intracellular conditions do change in E. coli under different conditions, so it is possible that GFP is not always equally stable, and this may affect its physiological cost. Surprisingly, another report claims that in E. coli aggregated and soluble LacZ have very similar cost, which to some extent dispels my worries about GFP stability and cost ...
Wilson, Philip, Welsh Assembly Government (Wales), corp creator. (2011) A rapid evidence assessment : investigating the drop in attainment during the transition phase with a particular focus on child poverty. ...
Getting a woman to spread her legs for you depends on your ability to smoothly navigate her through the 4 transition phases of seduction. Lets hammer out the first 2.
Transcription initiation is a critical step in bacterial gene regulation and is often controlled by transcription regulators. The alternate sigma factor (sigma54) is one such regulator that facilitates activator-dependent ...
Barrett, J. F., Goldschmidt, R. M., Lawrence, L. E., Foleno, B., Chen, R., Demers, J. P., Johnson, S., Kanojia, R., Fernandez, J., Bernstein, J., Licata, L., Donetz, A., et al. Antibacterial agents that inhibit two-component signal transduction systems Proceedings of the National Academy of Sciences of the United States of America 1998 95:5317-5322 DOI:10.1073/pnas.95.9.5317 PMID:9560273 ...
During infection, senses and responds to stress; such responses may be modulated by MisRS (NGO0177 and NGO0176), a two-component system that is a homolog of CpxRA. In , CpxRA senses and responds to envelope stress; CpxA is a sensor kinase/phosphatase for CpxR, a response regulator. When a mutant is grown in medium containing glucose, CpxR is phosphorylated by acetyl phosphate but cannot be dephosphorylated, resulting in constitutive activation. Kandler and coworkers (J. L. Kandler, C. L. Holley, J. L. Reimche, V. Dhulipala, J. T. Balthazar, A. Muszynski, R. W. Carlson, and W. M. Shafer, Antimicrob Agents Chemother 60:4690-4700, 2016, https://doi.org/10.1128/AAC.00823-16) showed that MisR (CpxR) is required for the maintenance of membrane integrity and resistance to antimicrobial peptides, suggesting a role in gonococcal survival Here, we evaluated the contributions of MisR and MisS (CpxA) to gonococcal infection in a murine model of cervicovaginal colonization and identified MisR-regulated genes ...
4IHT: The DNA-binding domain of BenM reveals the structural basis for the recognition of a T-N11-A sequence motif by LysR-type transcriptional regulators.
Degree of conservation of fungal oxidative stress regulators. (A) Orthologues of S. cerevisiae oxidative stress regulators in the fungi analysed. As before, the
Event SWPAs Pumping Systems & Controls Training. The pinnacle of SWPA’s Training and Educational programs is our Semi -Annual Pumping Systems Training ...
A magnetic carrier and a two-component developer are provided which have remedied blank areas, fog after leaving, carrier sticking during running, and image density variations before and after runnin
A 4-man rap group from Finland. Enjoying a a fairly big cult following despite being officially formed as late as fall 2000. Members: Davo MC, producer,...
Låt de första träffarna vara på neutral mark. Om du känner dig osäker ta det säkra före det osäkra. För mer råd och tips ring 031-7740067
Linda Sara 1994 Dvdrip. Linda Sara 1994 Dvdrip Related Tags: Linda Sara 1994 Dvdrip 80453122e1 21 HOT! foto memek anak smp umur 15 tahun ms office 2003 free...
MetabolismFatty acid and phospholipid metabolismBiosynthesisfatty acid metabolism transcriptional regulator FadR (TIGR02812; HMM-score: 17.4) ...
Motivated by recent experimental advances, we study two-component spin-orbit coupled ultracold bosonic atoms in two dimensions on a square optical lattice. Using a Bose-Hubbard model with spin-conserving and non-spin-conserving ...
transcriptional regulator [Snora] GTGTGCCGTCCGCGTGACCACCGGGCGTCGGTGCAGGTGGTCACGCCTGGCGCAAGTTCG AAGGAAAAACGGGAGGAAGACTTGGAATTTCGACTGCTGGGTCCGGTTGAAATACTCTGG CAGGGGCGCAACATCATGCCGACGGCTCCCAAGCCGCGGCAGGTCATATCCCTTCTGATG CTCCGTCACAACACAGTCGTGCAGGCTGCGGAGCTGATCGACGAATTATGGCCGGAGCTG CCGCCGCCGAGCGCGATCACCACCCTCCAGACCTACATCTACAAATTCCGGAAGATTCTC ATGAAGCAGGGGGCCGATGATCTTCTGCGTACCCAGCCGGGCGGATACATCCTGACGATC CCGCCCTCCACCGTCGACGTCAACCGGTTCGAACGGGACGCCGACGACGGGCAGGAACTG CTGCAGCGCGGTGACGCCGCCGGCGGGACGAAGCTCGGCCACGCCCTGGCCCTGTGGCGG GGCCCAGCACTGGCCGATGTCGTCGCCAGCGGACGCCTGTTCTCGTACGTCACGCGGCTG GAGGAGCTGCGGTTTCGCATCCTCGAACTGCGCATCGAGGCGGACCTCGCGACCGGGCGG CACCGGGAACTCGTGAGCGAGCTGAAATCGCTGGTACTGGCACACCCCCTCCACGAGCAC CTGCACGGGCTGCTGATGCTGGCCCTGCACCGGTCGGGGCGGCCCCACGAGGCGTTGGAG GTCTACCGGAGCGTACGCCACAAGATGATCGAGGACCTCGCCCTGGAACCCGCCCAGGAC TTCGCCACTTTGCACCACACCCTGCTGTCCGACTCCCCGCCCGAGGCACCCGAACCCCTC TGGCCGGCACAGCACCTGACGACCAAGCAGCCGGAACGCGTCACCATCGCCCGCGAACCA GCCCCGGACACCGCCCCCAGCCCGCTGGCCAGACCGGCCCAATTGCCCGCCGACATCGTG ...
The cell envelope of bacteria is of pivotal importance for growth and survival, and hence it is often the target of antimicrobial compounds. One of the main components involved in CESRs are extracytoplasmic function (ECF) [sigma] factors. The genome of B. subtilis encodes for seven ECF [sigma] factors, [sigma]M, [sigma]W, [sigma]X, [sigma]Y, [sigma]V, [sigma]Z and [sigma]YlaC. Several studies have been conducted to understand the role that these ECF [sigma] factors play in CESR in B. subtilis, one of the challenges found is that they display significant redundancy within their regulons. In this study, we have performed an in depth analysis of one of the ECF [sigma] factors of B. subtilis, [sigma]V, which had been previously uncharacterized. We have described the regulon of [sigma]V, the role that it plays in lysozyme resistance, and provided evidence for a novel promoter element important for [sigma]V recognition. Additionally, we have studied the role that [sigma]M plays in moenomycin ...
The bacterial cell envelope is the first and major line of defence against threats from the environment. It is an essential and vulnerable structure that gives the cell its shape and counteracts the high internal osmotic pressure. It also provides an important sensory interface and molecular sieve, mediating both information flow and controlled transport of solutes. The cell envelope is also the target for numerous antibiotics. Therefore, the monitoring and maintaining of cell envelope integrity in the presence of envelope perturbating agents and conditions is crucial for survival. In Bacillus subtilis a complex regulatory network, consisting of 7 signal transducing systems, orchestrates the cell envelope stress response. Two forms of regulatory systems can be found: ECF-sigma factors and two component systems (TCS). One of these TCS is the LiaRS system that responds to cell wall antibiotics that interfere with the undecaprenol cycle and to perturbation of the cytoplasmic me! mbrane. It is ...
Streptococcus pneumoniae is an important human pathogen in all age groups worldwide that causes a variety of diseases, ranging from life threatening septicaemia and meningitis to less severe sinusitis and otitis media. The factors that determine the virulence of S. pneumoniae are very complex but a key aspect of the organisms disease causing potential is the ability of the bacteria to regulate virulence factor expression and activity. In this study two main approaches were taken to investigate virulence gene expression in S. pneumoniae. Firstly, the feasibility of Recombinase based In vivo Expression Technology, RIVET, for use in S. pneumoniae to study gene expression in vitro, and then in vivo was assessed. However, the system was found to be unsuitable for use in this study. Secondly, the requirement for and the role of virulence gene regulators identified by Signature Tagged Mutagenesis were investigated. The requirement for different virulence gene regulators varied according to the murine ...
Background The expression of genes in Corynebacterium glutamicum, a Gram-positive non-pathogenic bacterium used mainly for the industrial production of amino acids, is regulated by seven different sigma factors of RNA polymerase, including the stress-responsive ECF-sigma factor SigH. The sigH gene is located in a gene cluster together with the rshA gene, putatively encoding an anti-sigma factor. The aim of this study was to analyze the transcriptional regulation of the sigH and rshA gene cluster and the effects of RshA on the SigH regulon, in order to refine the model describing the role of SigH and RshA during stress response. Results Transcription analyses revealed that the sigH gene and rshA gene are cotranscribed from four sigH housekeeping promoters in C. glutamicum. In addition, a SigH-controlled rshA promoter was found to only drive the transcription of the rshA gene. To test the role of the putative anti-sigma factor gene rshA under normal growth conditions, a C. glutamicum rshA deletion ...
The molecular determinants necessary and sufficient for recognition of its specific DNA target are contained in the C-domain (H-NSctd) of nucleoid-associated protein H-NS. H-NSctd protects from DNaseI cleavage a few short DNA segments of the H-NS-sensitive hns promoter whose sequences closely match the recently identified H-NS consensus motif (tCGt/aTa/tAATT) and, ... read more alone or fused to the protein oligomerization domain of phage λ CI repressor, inhibits transcription from the hns promoter in vitro and in vivo. The importance of H-NS oligomerization is indicated by the fact that with an extended hns promoter construct (400 bp), which allows protein oligomerization, DNA binding and transcriptional repression are highly and almost equally efficient with native H-NS and H-NSctd::λCI and much less effective with the monomeric H-NSctd. With a shorter (110 bp) construct, which does not sustain extensive protein oligomerization, transcriptional repression is less effective, but native H-NS, ...
In this study, we demonstrated that a mutant strain lacking a functional slyA gene in D. dadantii 3937 had pleiotropic effects: (i) diminished virulence in potato tubers; (ii) decreased survival ability in its host, potato; (iii) increased sensitivity to the CAMP polymyxin B, sodium hypochlorite, and oxidative stress; (iv) reduced exopolysaccharide production; (v) inability to form pellicles; and (vi) failure of hyperinduction of pectate lyase production while normal levels of polygalacturonases, cellulases, and proteases were observed. Changes in these phenotypes in the ΔslyA mutant were restored by introducing the slyA homologue of D. dadantii 3937 on a multicopy vector, pGEM-T Easy [ΔslyA(pSlyA)]. Thus, SlyA is a global transcriptional regulator involved in the regulation of the synthesis of a large group of virulence-associated factors in D. dadantii 3937.. SlyA was originally identified as an S. enterica serovar Typhimurium gene product by screening for cytolysin on blood agar plates and ...
HilA activates the expression of Salmonella enterica serovar Typhimurium invasion genes. To learn more about regulation of hilA, we isolated Tn5 mutants exhibiting reduced hilA and/or invasion gene expression. In addition to expected mutations, we identified Tn5 insertions in pstS, fadD, flhD, flhC, and fliA. Analysis of the pstS mutant indicates that hilA and invasion genes are repressed by the response regulator PhoB in the absence of the Pst high-affinity inorganic phosphate uptake system. This system is required for negative control of the PhoR-PhoB two-component regulatory system, suggesting that hilA expression may be repressed by PhoRPhoB under low extracellular inorganic phosphate conditions. FadD is required for uptake and degradation of long-chain fatty acids, and our analysis of the fadD mutant indicates that hilA is regulated by a FadDdependent, FadR-independent mechanism. Thus, fatty acid derivatives may act as intracellular signals to regulate hilA expression. flhDC and fliA encode
Sensor kinases play a key role in sensing and responding to environmental and physiological signals in bacteria. In this study we characterized a previously unknown orphan hybrid sensor kinase from Pseudomonas putida, which is conserved in several Pseudomonads. Inactivation of the gene coding for this sensor kinase, which we have named HskA, modified the expression of at least 85 genes in cells growing in a complete medium. HskA showed a strong influence on the composition of the electron transport chain. In cells growing exponentially in a complete medium, the absence of HskA led to a significant reduction in the expression of the genes coding for the bc1 complex and for the CIO and Cbb3-1 terminal oxidases. In stationary phase cells, however, lack of HskA caused a higher expression of the Cyo terminal oxidase and a lower expression of the Aa3 terminal oxidase. The HskA polypeptide shows two PAS (signal-sensing) domains, a transmitter domain containing the invariant phosphorylatable histidine ...
The LysR-family regulator MexT modulates the expression of the MexEF-OprN efflux system in the human pathogen Pseudomonas aeruginosa. Recently, we demonstrated that MexT regulates certain virulence phenotypes, including the type-three secretion system and early attachment independent of its role in regulating MexEF-OprN. In this study, transcriptome profiling was utilized to investigate the global nature of MexT regulation in P. aeruginosa PAO1 and an isogenic mexEF mutant. Twelve genes of unknown function were highly induced by overexpressing MexT independent of MexEF-OprN. A well-conserved DNA motif was identified in the upstream regulatory region of nine of these genes and upstream of mexE. Reporter fusion analysis demonstrated that the expression of the genes was significantly induced by MexT in P. aeruginosa and a heterogenous Escherichia coli strain and that the conserved sequence was required for this induction. The conserved DNA motif was further characterized as the MexT binding site by ...
SlyA is a member of the MarR family of bacterial transcriptional regulators. Previously, SlyA has been shown to directly regulate only two operons in Escherichia coli K-12 MG1655, fimB and hlyE (clyA). In both cases, SlyA activates gene expression by antagonizing repression by the nucleoid-associated protein H-NS. Here, the transcript profiles of aerobic glucose-limited steady-state chemostat cultures of E. coli K-12 MG1655, slyA mutant and slyA over-expression strains are reported. The transcript profile of the slyA mutant was not significantly different from that of the parent; however, that of the slyA expression strain was significantly different from that of the vector control. Transcripts representing 27 operons were increased in abundance, whereas 3 were decreased. Of the 30 differentially regulated operons, 24 have previously been associated with sites of H-NS binding, suggesting that antagonism of H-NS repression is a common feature of SlyA-mediated transcription regulation. Direct binding of
An anti-sigma factor for extracytoplasmic function (ECF) sigma factor SigK. ECF sigma factors are held in an inactive form by an anti-sigma factor until released by regulated intramembrane proteolysis (RIP). RIP occurs when an extracytoplasmic signal triggers a concerted proteolytic cascade to transmit information and elicit cellular responses. The membrane-spanning regulatory substrate protein is first cut extracytoplasmically (site-1 protease, S1P), then within the membrane itself (site-2 protease, S2P, Rip1), while cytoplasmic proteases finish degrading the regulatory protein, liberating the sigma factor.
Soil-dwelling Streptomyces bacteria such as S.coelicolor have to constantly adapt to the nitrogen (N) availability in their habitat. Thus, strict transcriptional and post-translational control of the N-assimilation is fundamental for survival of this species. GlnR is a global response regulator that controls transcription of the genes related to the N-assimilation in S. coelicolor and other members of the Actinomycetales. GlnR represents an atypical orphan response regulator that is not activated by the phosphorylation of the conserved aspartate residue (Asp 50). We have applied transcriptional analysis, LC-MS/MS analysis and electrophoretic mobility shift assays (EMSAs) to understand the regulation of GlnR in S. coelicolor M145. The expression of glnR and GlnR-target genes was revisited under four different N-defined conditions and a complex N-rich condition. Although, the expression of selected GlnR-target genes was strongly responsive to changing N-concentrations, the glnR expression itself ...
PubMed comprises more than 30 million citations for biomedical literature from MEDLINE, life science journals, and online books. Citations may include links to full-text content from PubMed Central and publisher web sites.
Although proteins fulfil most of the requirements that biology has for structural and functional components such as enzymes and receptors, RNA can also serve in these capacities. For example, RNA has sufficient structural plasticity to form ribozyme1,2 and receptor3,4 elements that exhibit considerable enzymatic power and binding specificity. Moreover, these activities can be combined to create allosteric ribozymes5,6 that are modulated by effector molecules. It has also been proposed7,8,9,10,11,12 that certain messenger RNAs might use allosteric mechanisms to mediate regulatory responses depending on specific metabolites. We report here that mRNAs encoding enzymes involved in thiamine (vitamin B1) biosynthesis in Escherichia coli can bind thiamine or its pyrophosphate derivative without the need for protein cofactors. The mRNA-effector complex adopts a distinct structure that sequesters the ribosome-binding site and leads to a reduction in gene expression. This metabolite-sensing regulatory system
CsgD, the master regulator of biofilm formation, activates the synthesis of curli fimbriae and extracellular polysaccharides in Escherichia coli. To obtain insights into its regulatory role, we have identified a total of 20 novel regulation target genes on the E. coli genome by using chromatin immunoprecipitation (ChIP)-on-chip analysis with a high-density DNA microarray. By DNase I footprinting, the consensus CsgD-binding sequence predicted from a total of 18 target sites was found to include AAAAGNG(N(2))AAAWW. After a promoter-lacZ fusion assay, the CsgD targets were classified into two groups: group I genes, such as fliE and yhbT, are repressed by CsgD, while group II genes, including yccT and adrA, are activated by CsgD. The fliE and fliEFGH operons for flagellum formation are directly repressed by CsgD, while CsgD activates the adrA gene, which encodes an enzyme for synthesis of cyclic di-GMP, a bacterial second messenger, which in turn inhibits flagellum production and rotation. Taking these
This chapter summarizes studies that led to identification and characterization of the Cpx envelope stress response and highlights recent work that hints at a diverse range of Cpx-influenced cellular phenotypes. Silverman and colleagues provided the kernels for our current understanding of the Cpx envelope stress response. The Cpx envelope stress response is regulated by a typical two-component regulatory system. In addition to functioning as an activator and a repressor, a new role for CpxR~P in transcription has recently been put forth, that of potentiator. Researchers have shown by microarray analysis of biofilm and planktonic populations of cells that the Cpx-regulated genes cpxP and spy were highly up-regulated in biofilms and that cpxP and cpxR mutants formed biofilms with reduced mass and substrate coverage. It has been shown that CpxR homologues in Legionella pneumophila and Yersinia enterocolitica are likely involved in transcription of the icm-dot genes encoding the type IV secretion system
Bacillus subtilis is the best-characterized member of the Gram-positive bacteria. Its genome of 4,214,810 base pairs comprises 4,100 protein-coding genes. Of these protein-coding genes, 53% are represented once, while a quarter of the genome corresponds to several gene families that have been greatl …
Creation and analysis of a lisK deletion mutant.A mutant, with a nonpolar 498-bp deletion in lisK from nucleotide 1872 to 2369, was created to confirm that the Tn917 insertion event was responsible for the enhanced survival at low pHH displayed by LO28-M9. The SOE (splicing by overlap extension) PCR procedure (13) was used to splice two 348-bp PCR products from either side of the sequence to be deleted. This hybrid was subsequently cloned into the temperature-sensitive shuttle vector pKSV7 (25) and transformed into LO28. An allelic exchange between the SOE product on pKSV7 and the intact gene resulted in the removal of a 498-bp sequence encoding one of the hydrophobic regions and the conserved histidine of the histidine kinase (Fig. 1A). The mutation was confirmed by PCR analysis, and the mutant was subsequently designated LO28ΔlisK.. Carbohydrate utilization (as assayed by API-CH50), listeriolysin O production on blood agar plates, and phospholipase production on egg yolk emulsion plates (all ...
Isopropyl-beta-D-thiogalactopyranoside, Isopropyl-beta-D-thiogalactopyranoside supplier, Isopropyl-beta-D-thiogalactopyranoside distributor, CAS 367-93-1, Isopropyl-beta-D-thiogalactopyranoside manufacturer, Isopropyl-beta-D-thiogalactopyranoside wholesale
Plans for a Transition Phase, which would help ensure a seamless transition from UN Environments environmental assessment to the clean-up of oil contamination, were presented to a meeting of the Presidential Implementation Committee in Abuja in February 2011. The United Nations prepared a Transition Phase proposal at the request of the Presidential Implementation Committee. The Transition Phase would include steps such as preparing clean-up plans and detailed designs; the preparation of bidding documents; seeking agreement between key partners on legal and financial matters; and consultations with key stakeholders. The proposal also recommended to identify the sites for potential treatment centres in Ogoniland, design monitoring programmes and regimes, and develop laboratory procedures and protocols. In 2018, building on its 2011 environmental assessment of Ogoniland, UN Environment began a new project that aims to strengthen the Hydrocarbon Pollution Remediation Project (HYPREP) and its
Bacillus subtilis uses two-component signal transduction systems to sense intra- and extracellular stimuli to adapt to fluctuating environmental situations. Regulator aspartate phosphatases (Raps) have important roles in these processes, as they can dephosphorylate certain response-regulators, and are themselves subject to cell-density-controlled inhibition by secreted Phr (phosphate regulator) peptides. Eleven chromosomal genes encode this family of phosphatases, but in addition, certain strains contain endogenous plasmids with genes for homologous Rap-Phr systems. Plasmid pTA1060 encodes Rap60 and its antagonistic signalling molecule Phr60. Strikingly, expression of Rap60 in B. subtilis 168 strongly repressed the production of proteolytic enzymes. In fact, the transcription of the aprE gene, encoding a major extracellular protease, was shown to be decreased upon Rap60 expression, whereas this effect could be antagonized by the extracellular addition of synthetic Phr60 pentapeptide. Finally,
ID A0A0H2ZLT6_PSEAB Unreviewed; 210 AA. AC A0A0H2ZLT6; DT 16-SEP-2015, integrated into UniProtKB/TrEMBL. DT 16-SEP-2015, sequence version 1. DT 30-AUG-2017, entry version 17. DE SubName: Full=Putative two-component response regulator {ECO:0000313,EMBL:ABJ15565.1}; GN Name=uhpA {ECO:0000313,EMBL:ABJ15565.1}; GN OrderedLocusNames=PA14_07840 {ECO:0000313,EMBL:ABJ15565.1}; OS Pseudomonas aeruginosa (strain UCBPP-PA14). OC Bacteria; Proteobacteria; Gammaproteobacteria; Pseudomonadales; OC Pseudomonadaceae; Pseudomonas. OX NCBI_TaxID=208963 {ECO:0000313,EMBL:ABJ15565.1, ECO:0000313,Proteomes:UP000000653}; RN [1] {ECO:0000313,EMBL:ABJ15565.1, ECO:0000313,Proteomes:UP000000653} RP NUCLEOTIDE SEQUENCE [LARGE SCALE GENOMIC DNA]. RC STRAIN=UCBPP-PA14 {ECO:0000313,EMBL:ABJ15565.1, RC ECO:0000313,Proteomes:UP000000653}; RX PubMed=17038190; DOI=10.1186/gb-2006-7-10-r90; RA Lee D.G., Urbach J.M., Wu G., Liberati N.T., Feinbaum R.L., Miyata S., RA Diggins L.T., He J., Saucier M., Deziel E., Friedman L., Li L., ...
Shop Flagella synthesis protein ELISA Kit, Recombinant Protein and Flagella synthesis protein Antibody at MyBioSource. Custom ELISA Kit, Recombinant Protein and Antibody are available.
A number of bacteria and some plants produce large quantities of indole, which is widespread in animal intestinal tracts and in the rhizosphere. Although it ha...
The Pm promoter of the TOL plasmid of Pseudomonas putida is expressed at high level along the growth curve. This transcription is dependent on the positive regulator XylS activated by 3-methylbenzoate. The sigma factor sigma 38 is required for expression in early stationary phase and thereafter. To …
p>The checksum is a form of redundancy check that is calculated from the sequence. It is useful for tracking sequence updates.,/p> ,p>It should be noted that while, in theory, two different sequences could have the same checksum value, the likelihood that this would happen is extremely low.,/p> ,p>However UniProtKB may contain entries with identical sequences in case of multiple genes (paralogs).,/p> ,p>The checksum is computed as the sequence 64-bit Cyclic Redundancy Check value (CRC64) using the generator polynomial: x,sup>64,/sup> + x,sup>4,/sup> + x,sup>3,/sup> + x + 1. The algorithm is described in the ISO 3309 standard. ,/p> ,p class="publication">Press W.H., Flannery B.P., Teukolsky S.A. and Vetterling W.T.,br /> ,strong>Cyclic redundancy and other checksums,/strong>,br /> ,a href="http://www.nrbook.com/b/bookcpdf.php">Numerical recipes in C 2nd ed., pp896-902, Cambridge University Press (1993),/a>),/p> Checksum:i ...
Vern Schramm, Ph.D.Most antibiotics initially work extremely well, killing more than 99.9% of microbes they target. But through mutation and the selection pressure exerted by the antibiotic, a few bacterial cells inevitably manage to survive, repopulate the bacterial community, and flourish as antibiotic-resistant strains.. Vern L. Schramm, Ph.D., professor and Ruth Merns Chair of Biochemistry at Einstein and senior author of the paper, hypothesized that antibiotics that could reduce the infective functions of bacteria, but not kill them, would minimize the risk that resistance would later develop. Dr. Schramms collaborators at Industrial Research Ltd. earlier reported transition state analogues of an enzyme that interferes with "quorum sensing" - the process by which bacteria communicate with each other by producing and detecting signaling molecules known as autoinducers. These autoinducers coordinate bacterial gene expression and regulate processes - including virulence - that benefit the ...
1) Kunst F, et al. (1997) The complete genome sequence of the gram-positive bacterium Bacillus subtilis.. Nature 390(6657):249-56 PubMed: 9384377 ...
Exposure to environmental insults generally occurs at low levels, making it challenging to measure bacterial responses to such interactions. Additionally, microbial behaviour and phenotype varies in differing bacterial types or growth phases, likely giving rise to growth- or species-specific responses to environmen
Type-III secretion systems (T3SSs) are responsible for the biosynthesis of flagella, and the interaction of many animal and plant pathogens with eukaryotic cells. T3SSs consist of multiple proteins which assemble to form an apparatus capable of exporting proteins through both membranes of Gram-negative bacteria in one step. Proteins conserved amongst T3SSS can be used for analysis of these systems using computational homology searching. By using tools including BLAST and HMMER in conjunction phylogenetic analysis this thesis examines the range of T3SSs, both in terms of the proteins they contain, and also the bacteria which contain them. In silico analysis of several of the conserved components of T3SSs shows similarities between them and other secretion systems, as well as components of ATPases. Use of conserved components allows for identification of T3SS loci in diverse bacteria, in order to assess in the different proteins used by different T3SSs, and to see where, in evolutionary space, ...
Impact of mutations in individual protease genes/operons on biofilm formation in vitro. The relative capacity to form a biofilm was assessed using a microtiter
Many bacteria, including V. fischeri, recognize and respond to their environments using two-component regulatory systems (Fig. 2A, reviewed in Stock et al.
LB broth is used for maintaining and cultivating recombinant strains of Escherichia coli. The ingredients of LB broth are tryptone, yeast extract and Sodium Chloride. We show you how to prepare the LB medium. - LB Medium Preparation - AbVideo™ - Support - Abnova
Fullscreen (supported by IE11, latest versions of Firefox, Chrome, Safari (not including iOS Safari), Edge, Chrome for Android, Samsung Internet) ...
Mai S, et al. Global regulation of alternative RNA splicing by the SR-rich protein RBM39. Biochim Biophys Acta. 2016 Aug;1859(8):1014-24. (IF=5.373). ...
Each population is trying to expand, and selective pressure is constantly being applied on both sides," Deem said. "You can see how this plays out in the CRISPR over time. Theres a diverse assortment of genes in the first spacer, but the second spacer has been in there longer, so theres been more selective pressure applied to that spacer. Because bacteria that contain the dominant viral strain in their CRISPR are more likely to survive than those that dont, they tend to squeeze out their neighbors that are more vulnerable. At position N, the farthest way from position one, selection has been at work the longest, so the genes we find there were the most common and the ones that tended to afford the most overall protection to the organism ...
Our bodies are hosts to some hundreds of thousands of bacteria that live in harmony with each other, helping the body be healthy, in return for the food
Diaphragm pump role in the process control is to accept the regulator control signal, or computer change modulated medium flow, make the modulated maintain within the scope of the required parameters, so as to achieve the automation of produ
Study shows bacterial response to drugs varies in different environments, providing scientists with a new way to test antibiotics for better drugs.
நோய்க்கடத்தலை தடுப்பதற்கு, ஒவ்வொரு நோயையும் உருவாக்கும் உயிரினம் பற்றி, நோயின் இயல்புபற்றி, நோய் கடத்தப்படும் முறைபற்றி அறிந்திருத்தல் அவசியமாகும். அறிந்துகொள்ள வேண்டிய முக்கியமான இயல்புகளாவன, நோய்க்காரணியின் நோய்த்தொற்று வீரியம் (virulence), நோய்ப் பாதிப்புக்கு உட்பட்டிருப்பவர் செல்லும் தூரம், நோய்த் தொற்றின் நிலை என்பனவாகும். உதாரணமாக எய்ட்சு எனப்படும் மனித ...
Združenje DrogArt je zasebna neprofitno volonterska organizacija ustanovljena leta 1999 z glavnim namenom zmanjševanja škodljivih posledic drog med mladimi
Združenje DrogArt je zasebna neprofitno volonterska organizacija ustanovljena leta 1999 z glavnim namenom zmanjševanja škodljivih posledic drog med mladimi
The activation of additional promoter sites by production of an alternative sigma subunit for RNA polymerase is a common strategy for the coordinate regulation of gene expression. Many alternative sigma factors control genes for specialized, and often narrowly distributed, functions. For example, most of the alternative sigma factors in Bacillus subtilis control genes necessary for endospore formation. In contrast, the B. subtilis sigma D protein controls the expression of genes important for flagellar-based motility and chemotaxis, a form of locomotion very broadly distributed in the eubacteria. A homologous sigma factor, sigma F, controls a similar group of motility genes in the enteric bacteria. The conservation of both promoter specificity and genetic function in these two regulons allowed us to test the ability of a B. subtilis sigma factor to function within an Escherichia coli host. We demonstrate that expression of the B. subtilis sigD gene restores motility to an E. coli strain mutant ...
Anabaena sp. strain PCC 7120 is a filamentous cyanobacterium that fixes N2 in specialized cells called heterocysts, which differentiate from vegetative cells in a process that requires the nitrogen control transcription factor NtcA. 2-Oxoglutarate-stimulated binding of purified NtcA to wild-type and modified versions of the ntcA gene promoter from Anabaena sp. was analyzed by mobility shift and DNase I footprinting assays, and the role of NtcA-binding sites in the expression of the ntcA gene during heterocyst differentiation was studied in vivo by using an ntcA-gfp translational fusion and primer extension analysis. Mutation of neither of the two identified NtcA-binding sites eliminated localized expression of ntcA in proheterocysts, but mutation of both sites led to very low, nonlocalized expression. Copyright © 2008, American Society for Microbiology. All Rights Reserved ...
Bacteria thrive in many different habitats, and therefore will encounter a multitude of environmental stresses. Survival requires the development of sophisticated response mechanisms that can identify potential threats and initiate regulatory cascades orchestrating the expression of defensive components. The cell envelope is the first layer of the cell to come in contact with any environmental agent. In Gram-positive bacteria this envelope is comprised of a cytoplasmic membrane surrounded by a thick multilayered cell wall. The cytoplasmic membrane forms an essential permeability barrier and is made of different types of complex lipids which vary not only in the length and modifications of the acylated fatty acid groups but also in the composition of their headgroups. The cell wall is a complex matrix consisting predominantly of equal amounts of peptidoglycan and teichoic acids with the addition of surface attached proteins. Cell wall synthesis and maturation requires both incorporation of new ...
The catabolism of glutarate in P. aeruginosa PAO1 depends on GcdH, whose expression is under the control of the GcdR transcriptional activator (38). The catabolism of glutarate in E. coli depends on CsiD and LhgO (20). The expression of csiD in E. coli is significantly upregulated during carbon starvation (39). However, the two pathways cooperate in glutarate catabolism in P. putida KT2440 and both GcdH and CsiD are induced during carbon starvation (19). In this study, it was found that two regulators, CsiR and GcdR, control the two pathways described above in P. putida KT2440, respectively. CsiR cannot interact with the gcdH promoter region (Fig. 4C) and has no effect on the transcription of gcdH (Fig. 4A). Similarly, GcdR cannot interact with the csiD promoter region (Fig. 4D) and has no effect on the transcription of csiD (Fig. 4A). In contrast to GcdH, which is present universally in Pseudomonas species, CsiD and LhgO may be acquired via horizontal gene transfer and are sporadically ...
A characteristic feature of biofilm formation is the production of a protective extracellular polymeric matrix. In the gram-positive bacterium Bacillus subtilis, the biofilm matrix is synthesized by the products of the epsABCDEFGHIJKLMNO operon (hereafter called the eps operon) and yqxM-sipW-tasA loci. Transcription from these operons is repressed by two key regulators, AbrB and SinR. Relief of inhibition is necessary to allow biofilm formation to proceed. Here we present data indicating that Abh, a sequence and structural homologue of AbrB, regulates biofilm architecture by B. subtilis when colony morphology and pellicle formation are assessed. Data indicating that abh expression is dependent on the environmental signals that stimulate the activity of the extracytoplasmic function sigma-factor sigma(X) are shown. We demonstrate that expression of slrR, the proposed activator of yqxM transcription, is positively controlled by Abh. Furthermore, Abh is shown to activate transcription from the ...
The general stress response (GSR) represents an important trait to survive in the environment by leading to multiple stress resistance. In alphaproteobacteria, the GSR is under the transcriptional control of the alternative sigma factor EcfG. Here we performed transcriptome analyses to investigate the genes controlled by EcfG of Sphingomonas melonis Fr1 and the plasticity of this regulation under stress conditions. We found that EcfG regulates genes for proteins that are typically associated with stress responses. Moreover, EcfG controls regulatory proteins, which likely fine-tune the GSR. Among these, we identified a novel negative GSR feedback regulator, termed NepR2, on the basis of gene reporter assays, phenotypic analyses, and biochemical assays. Transcriptional profiling of signaling components upstream of EcfG under complex stress conditions showed an overall congruence with EcfG-regulated genes. Interestingly however, we found that the GSR is transcriptionally linked to the regulation of
Cyanobacteria are solar-powered cell factories that can be engineered to supply us with renewable fuels and chemicals. To do so robust and well-working biological parts and tools are necessary. Parts for controlling gene expression are of special importance in living systems, and specifically promoters are needed for enabling and simplifying rational design. Synthetic biology is an engineering science that incorporates principles such as decoupling, standardization and modularity to enable the design and construction of more advanced systems from simpler parts and the re-use of parts in new contexts. For these principles to work, cross-talk must be avoided and therefore orthogonal parts and systems are important as they are decoupled by definition. This work concerns the design and development of biological parts and tools that can enable synthetic biology in cyanobacteria. This encompasses parts necessary for the development of other systems, such as vectors and translational elements, but with ...
Pseudomonas aeruginosa is a highly versatile opportunistic pathogen capable of colonizing multiple ecological niches. This bacterium is responsible for a wide range of both acute and chronic infections in a variety of hosts. The success of this microorganism relies on its ability to adapt to environmental changes and re-program its regulatory and metabolic networks. The study of P. aeruginosa adaptation to temperature is crucial to understanding the pathogenesis upon infection of its mammalian host. We examined the effects of growth temperature on the transcriptome of the P. aeruginosa PAO1. Microarray analysis of PAO1 grown in Lysogeny broth at mid-exponential phase at 22°C and 37°C revealed that temperature changes are responsible for the differential transcriptional regulation of 6.4% of the genome. Major alterations were observed in bacterial metabolism, replication, and nutrient acquisition. Quorum-sensing and exoproteins secreted by type I, II, and III secretion systems, involved in the ...
Nowadays, the emergence and spread of antibiotic resistance have become an utmost medical and economical problem. It has also become evident that subinhibitory concentrations of antibiotics, which pollute all kind of terrestrial and aquatic environments, have a non-negligible effect on the evolution of antibiotic resistance in bacterial populations. Subinhibitory concentrations of antibiotics have a strong effect on mutation rates, horizontal gene transfer and biofilm formation, which may all contribute to the emergence and spread of antibiotic resistance. Therefore, the molecular mechanisms and the evolutionary pressures shaping the bacterial responses to subinhibitory concentrations of antibiotics merit to be extensively studied. Such knowledge is valuable for the development of strategies to increase the efficacy of antibiotic treatments and to extend the lifetime of antibiotics used in therapy by slowing down the emergence of antibiotic resistance.
Two-component systems (TCSs) are highly conserved across bacteria and are used to rapidly sense and respond to changing environmental conditions. The human pathogen Staphylococcus aureus uses the S. aureus exoprotein expression (sae) TCS to sense host signals and activate transcription of virulence factors essential to pathogenesis. Despite its importance, the mechanism by which the sae sensor kinase SaeS recognizes specific host stimuli is unknown. This thesis describes topology and mutagenesis studies of the sensing domain of SaeS, including basal expression and inducer-dependent phenotypes. Meanwhile, investigation of the sae auxiliary protein SaeP has identified a novel DNA binding function for this surface expressed lipoprotein that may be involved in fine-tuning the activity of the sae system. Overall, these structure-function studies provide insight into the sae signal transduction mechanism and raise some new questions regarding the role the sae system plays in the larger regulatory network S.
Front Microbiol. 2016 Aug 25;7:1326. doi: 10.3389/fmicb.2016.01326. eCollection 2016.. The Response Regulator YycF Inhibits Expression of the Fatty Acid Biosynthesis Repressor FabT inStreptococcus pneumoniae.. Mohedano ML1, Amblar M2, de la Fuente A1, Wells JM3, López P1.. Author information. Abstract. The YycFG (also known as WalRK, VicRK, MicAB, or TCS02) two-component system (TCS) is highly conserved among Gram-positive bacteria with a low G+C content. In Streptococcus pneumoniae the YycF response regulator has been reported to be essential due to its control of pcsB gene expression. Previously we showed that overexpression of yycF in S. pneumoniae TIGR4 altered the transcription of genes involved in cell wall metabolism and fatty acid biosynthesis, giving rise to anomalous cell division and increased chain length of membrane fatty acids. Here, we have overexpressed the yycFG system in TIGR4 wild-type strain and yycF in a TIGR4 mutant depleted of YycG, and analyzed their effects on ...
LeuO is a dual transcriptional regulator that regulates genes involved in leucine biosynthesis [1, 15], genes involved in the utilization of certain β-glucosides [5, 7] and genes encoding LuxR-type transcription factors [14] It is also involved in the bacterial stringent response [16]. LeuO is one of the transcription factors that counteracts H-NS-mediated repression of specific loci [1, 5, 7, 17, 18] Overproduction of LeuO causes the phenotype Bgl+, since LeuO can unsilence the bglGFB operon, which is silenced (phenotypically Bgl ) under laboratory conditions [7] LeuO is part of the RpoS/H-NS/Hfq/LeuO/DsrA RNA regulatory cascade that controls the bglGFH operon [5]and translation of rpoS, particularly at low temperatures [19, 20]. LeuO belongs to the LysR transcriptional regulator family and contains a helix-turn-helix DNA-binding domain [4, 7] No LeuO consensus binding sequence is known [14]. LeuO activates transcription of the divergent leuLABCD operon [2]. An in vivo genetic selection ...
Carbon storage regulator A (CsrA) is an RNA binding protein. The CsrA homologs are found in most bacterial species, in the pseudomonads they are called repressor of secondary metabolites (RsmA and RsmE). The CsrA proteins generally bind to the Shine-Dalgarno sequence of messenger RNAs and either inhibit translation or facilitate mRNA decay. CsrA has a regulatory effect on glycogen biosynthesis and catabolism, glycolysis, biofilm formation and quorum sensing. The CsrA protein binds to a Stem-loop RNA motif. The ability of the protein to inhibit translation of bound mRNAs can be countered by the expression of sRNAs such as CsrB, CsrC, RsmZ, RsmY and RsmX that contain multiple copies of the RNA motif. These RNAs sequester CsrA, which allows the translation of the previously inhibited bound mRNAs. A study investigating specific binding of CsrA in the Salmonella transcriptome has identified 467 binding sites. Gutiérrez, P; Li, Y; Osborne, MJ; Pomerantseva, E; Liu, Q; Gehring, K (May 2005). "Solution ...
View Notes - DNA REPAIR from BIO 326R at University of Texas. approximate positions of some of the genes of the SOS regulon are shown. SOS RESPONSE 20 Trans-lesion synthesis by DNA POL V (A) Helicase
Matt Hutchings Key Research Interests We are interested in how bacteria interact with the environment and how they sense and respond to environmental signals. All bacteria contain a cell envelope which consists of at least one cell membrane and (in most cases) a cell wall. Bacteria interact with their environment using cell surface proteins which are anchored either in the cell wall or the cell membrane. We are characterising two classes of these proteins in the filamentous bacteria Streptomyces. The first class are called sensor kinases and they span the membrane and transmit signals from the outside to the inside of the cell. They pass these signals to cognate response regulator proteins inside the cell and these bring about a response to the original signal, usually by altering gene expression. The second class are called lipoproteins and are attached by a lipid modification to the outside of the cell membrane. They have diverse roles including the scavenging of nutrients, surface attachment, ...
Read press releases about Government: Environmental Regulation news and subscribe to RSS feeds about Government: Environmental Regulation - Page 98
Wells, Hannah (2015) Further characterisation of the envelope stress responses of Salmonella Typhimurium. Doctoral thesis, University of East Anglia. ...
Brune, I., Götker, S., Schneider, J., Rodionov, D. A., & Tauch, A. (2011). Negative transcriptional control of biotin metabolism genes by the TetR-type regulator BioQ in biotin-auxotrophic Corynebacterium glutamicum ATCC 13032. Journal of Biotechnology, 159(3), 225-234. doi:10.1016/j.jbiotec.2011.12. ...
In vivo expression technology (IVET) is a promoter-trap strategy deigned to identify genes whose expression in induced in a specific environment, typically that encountered in a host. Signature-tagged mutagenesis (STM) uses comparative hybridisation to isolate mutants unable to survive specified environmental conditions and has been used to identify genes critical for survival in the host. Both methods have been used to identify virulence genes in S. aureus. The main aim of this project was to find any probable new genes of S. aureus that are essential for biofilm formation and infection mouse model by STM. A library of tagged insertion mutants of S. aureus and a series of selected tags in plasmids of S. aureus strain RN6390 were used. Most of the experiments with both the library and selected tags had problems with cross-hybridisation. All the selected tags were therefore sequenced and 33 tags with less than 50% identity were chosen for future experiments. A library of 825 mutants was made with ...
During the last decade Bacillus megaterium was systemically developed for the gram per liter production of recombinant proteins. In contrast to the usual bacterial gene expression scenario, recombinant protein production systems often rely on multicopy plasmid encoded promoters, repressors and target genes. During production of the green fluorescent model protein (GFP) as a model culture heterogeneity was observed at the single cell level using time-lapse microscopy. The two subpopulations (producing versus low-producing) were separated by cell sorting and initially analyzed for limiting components of the expression system via quantitative RT-PCR. Further cultivation of both subpopulations revealed a systematic reajustment of their subpopulation distributions, indicationg bistability. An initial model was deduced as working hypothesis to identify the molecular basis for the observed phenotype and to improve our mathematical model ...
Numerous hits in gapped BLAST to probable two-component sensor sequences,e.g.residues 289-699 are 26% similar to probable two-component sensor from Pseudomonas aeruginosa strain PAO1 (11352392,).Residues 477-702 are 33% similar to sensor kinase for HydG, hydrogenase 3 activity from Escherichia coli K12 (,gb,AAC76977.1,).Residues 289-699 are 22% similar to sensor protein AtoS from Escherichia coli strain K-12 (7466912 ...
Description: Our laboratory studies two bacterial pathogens, Vibrio cholerae, the causative agent of cholera and Yersinia pestis, the causative agent of plague. Regarding V. cholerae our laboratory studies two transcription factors, ToxR and TcpP, that regulate virulence gene transcription and environmental conditions that affect virulence gene expression levels. Our goal is to determine the nature of environmental sensing by V. cholerae as it induces virulence gene expression in hopes of interfering with that pathway with customized therapeutics. Our studies with Y. pestis focus on the ability of this organism to introduce toxic "Yop" proteins into targeted host cells. In addition to contributing to cell adhesion and Yop delivery, the Y. pestis surface protein Ail confers resistance to human serum, an activity required for virulence. Current work is focused on the mechanism of Ail - mediated serum - resistance with the goal of designing therapeutics interfering with this activity ...
The Are two-component system, comprising the ArcB sensor kinase and the ArcA response regulator, modulates the expression of numerous genes in response to the respiratory growth conditions. Under anoxic growth conditions ArcB autophosphorylates and transphosphorylates ArcA, which in turn represses or activates its target operons. The anaerobic metabolite D-lactate has been shown to stimulate the in vitro auto-phosphorylating activity of ArcB. In this study, the in vivo effect Of D-lactate on the kinase activity of ArcB was assessed. The results demonstrate that D-lactate does not act as a direct signal for activation of ArcB, as previously proposed, but acts as a physiologically significant effector that amplifies ArcB kinase activity. ...
Here, I will present the recently discovered regulation of nos genes through the two-component system NasST. NasS is a nitrate sensor and NasT is a transcription antiterminator. Mutation of nasS induced both N2O reductase activity and transcription of nos genes (nosRZD), in cells of B. diazoefficiens incubated in the absence of nitrate. The NasS_NasT protein complex was dissociated in vitro by the addition of nitrate, suggesting the release of NasT, which is known to bind the leader RNA of the target gene, thereby preventing hairpin formation and allowing complete transcription. Disruption of nasT led to a marked decrease in nos transcription in B. diazoefficiens cells incubated with nitrate, indicating that NasST system regulates nos transcription in response to nitrate. Although analysis of the region upstream nosR and nosZ genes revealed no regulatory hairpin structures similar to those present in the leader RNA of other genes regulated by NasT, we could confirm binding of purified NasT with ...
We study mechanisms of transcription regulation by the histone-like nucleoid-structuring protein HNS in commensal and pathogenic Escherichia coli. Specifically, we focus on mechanisms of de-repression by the LysR-type and FixJ/NarL-type transcription regulators such as LeuO, BglJ-RcsB and others, and their role in regulatory networks controlling pathogenicity. In addition, we analyze the interdependence of repression by H-NS and the rate of transcription. H-NS is an pleiotropic regulator and an architectural protein of the enterobacterial chromosome (the nucleoid), and it is important for silencing of loci acquired by horizontal gene transfer and for bacterial fitness. H-NS binds as dimer to specific nucleation sites located within an AT-rich sequence context, and then forms extended complexes by polymerization along the DNA (stiffening) and by building DNA-HNS-DNA bridges (bridging). Formation of HNS-DNA complexes next to promoters represses transcription by occluding RNA polymerase or, as ...