Buy our AIBZIP 293T transfected lysate (positive control). ab94227 has been validated in western blot. Abcam now offers a 12-month guarantee.
Reviews, coupons, analysis, whois, global ranking and traffic for g-box.com.ua. Learn more about g-box OR g-box.com.ua. Is g-box.com.ua a scam or a fraud? Coupon for g-box.com.ua
NFIL3山羊多克隆抗体(ab1078)可与人样本反应并经WB实验严格验证,被1篇文献引用。中国75%以上现货,所有产品均提供质保服务,可通过电话、电邮或微信获得本地专属技术支持。
hypothetical protein, PAC1, Anapl_07643, AS27_06939, AS28_03976, bcd1, B-cell-derived protein 1, C86813, CB1_000294041, cba1, copeb, core promoter element binding protein, core promoter element-binding protein, cpbp, FM2, FM6, GBF, GC-rich binding factor, GC-rich sites-binding factor GBF, Ierepo1, Ierepo3, immediate early response, erythropoietin 1, klf6-a, klf6-b, Krueppel-like factor 6, Krueppel-like factor 6-like, Krueppel-like factor 7, Kruppel-like factor 6, Kruppel-like zinc finger protein Zf9, M91_01956, M959_03695, MDA_GLEAN10016415, N300_13616, N301_13483, N302_03995, N303_03824, N305_14493, N306_00708, N307_00582, N308_06795, N309_01017, N312_07173, N320_02403, N321_14125, N322_09693, N324_04458, N325_02508, N326_01608, N327_05534, N328_08868, N329_08139, N330_10147, N331_09768, N332_08191, N334_00881, N335_03384, N336_10967, N339_05665, N340_06919, N341_10990, PAL_GLEAN10001872, PANDA_010138, proto-oncogene BCD1, protooncogene B-cell derived 1, R75280, ST12, suppression of ...
Shop Leucine zipper protein ELISA Kit, Recombinant Protein and Leucine zipper protein Antibody at MyBioSource. Custom ELISA Kit, Recombinant Protein and Antibody are available.
The worlds first wiki where authorship really matters. Due credit and reputation for authors. Imagine a global collaborative knowledge base for original thoughts.
The goal of this protocol is to use the fluorescence activated cell sorting (FACS) technique to sort specific types of neural cells for ...
Read "Bipartite determinants of DNA-binding specificity of plant basic leucine zipper proteins, Plant Molecular Biology" on DeepDyve, the largest online rental service for scholarly research with thousands of academic publications available at your fingertips.
BZIP domain: The Basic Leucine Zipper Domain ( bZIP domain ) is found in many DNA binding eukaryotic proteins. One part of the domain contains a region that mediates sequence specific DNA binding properties and the leucine zipper that is required to hold together (dimerize) two DNA binding regions. The DNA binding region comprises a number of basic amino acids such as arginine and lysine. Proteins containing this domain are transcription factors. [Source: Wikipedia] ...
The basic leucine zipper transcription factor ATF5 is overexpressed in many tumor types and interference with its expression or function inhibits cancer cell survival. As a potential therapeutic approach to exploit these findings, we created dominant-negative (DN) ATF5 forms lacking DNA-binding ability that retain the ATF5 leucine zipper, and thus associate with and sequester ATF5s requisite leucine zipper-binding partners. Preclinical studies with DN-ATF5, including a cell-penetrating form, show in vitro and in vivo efficacy in compromising cancer cell survival. However, DN-ATF5s targets, and particularly those required for tumor cell survival, have been unknown. We report that cells lacking ATF5 succumb to DN-ATF5, indicating that ATF5 itself is not DN-ATF5s obligate target. Unbiased pull-down assays coupled with mass spectrometry and immunoblotting revealed that DN-ATF5 associates in cells with the basic leucine zipper proteins CEBPB and CEBPD and coiled-coil protein CCDC6. Consistent with ...
The basic leucine zipper (bZIP) family is one of the largest transcription factor (TF) families in plants, which play crucial roles in plant growth and development. bZIP proteins are involved in multiple biological processes, as well as responses to various biotic/abiotic stresses. Although genome-wide analysis of the bZIP gene family has been conducted in several plant species, only few comprehen ...
The basic leucine zipper (bZIP) family is one of the largest transcription factor (TF) families in plants, which play crucial roles in plant growth and development. bZIP proteins are involved in multiple biological processes, as well as responses to various biotic/abiotic stresses. Although genome-wide analysis of the bZIP gene family has been conducted in several plant species, only few comprehen ...
Purpose of the present study is to point-out a number of psychiatric-forensic remarks about the management of violent behavior against the person (VBP) amongst psychiatric patients. The study is the authors personal contribution based on clinical and forensic experience as experts in the management of psychiatric patients with VBP. Twelve psychiatric-forensic remarks have been highlighted in the present study: 1) VBP is a multifactorial event; 2) the risk of VBP against the person may change rapidly over time in quantity and quality; 3) there are no methods for reliable prediction of VBP in a single clinical-case; 4) there are no medications with an indication of "heal" the VBP; 5) there are no therapeutic measures that neutralize always, quickly and without recurrences VBP; 6) there exist clinical hypotheses to assess VBP; 7) there exist principles of victimology to assess VBP; 8) there are emotional reactions that can affect the evaluation and clinical and forensic management of VBP; 9) the ...
Jaclyn M. Schwarz is the author of this article in the Journal of Visualized Experiments: Using Fluorescence Activated Cell Sorting to Examine Cell-Type-Specific Gene Expression in Rat Brain Tissue
E4BP4 (NFIL3), PE, clone: S2M-E19, eBioscience™ 25μg; PE E4BP4 (NFIL3), PE, clone: S2M-E19, eBioscience™ Primary Antibodies E1 to Eh
(His)6-GBF1 is a BFA-resistant ARF-GEF. (A) Fractions enriched in (His)6-GBF1 display a GEF specific for ARFs. Identical volumes (5 μl) of the 50 mM imidazole
The sheer absurdity of the New world of medicine I have worked n medical for 30+ and been a CPer for close to 20 yrs and the past week has literally floored me. I have had the same PM for 6 yrs here and the one before that in my home state for 13..... ...
Soil salinity severely affects plant growth and agricultural productivity. AtbZIP24 encodes a bZIP transcription factor that is induced by salt stress in Ambidopsis thaliana but suppressed in the salt-tolerant relative Lobularia maritima. Transcriptional repression of AtbZIP24 using RNA interference improved salt tolerance in A. thaliana. Under non-stress growth conditions, transgenic A. thaliana lines with decreased AtbZIP24 expression activated the expression of stress-inducible genes involved in cytoplasmic ion homeostasis and osmotic adjustment: the Na+ transporter AtHKT1, the Na+/H+ antiporter AtSOS1, the aquaporin AtPIP2.1, and a glutamine synthetase. In addition, candidate target genes of AtbZIP24 with functions in plant growth and development were identified such as an argonaute (AGO1)-related protein and cyclophilin AtCYP19. The salt tolerance in transgenic plants correlated with reduced Na+ accumulation in leaves. In vivo interaction of AtbZIP24 as a homodimer was shown using ...
Mareks disease virus (MDV) is one of several oncogenic herpesviruses and causes fatal lymphomas in chickens. The current "gold standard" vaccine is the live-attenuated MDV strain CVI988/Rispens (CVI), which is widely used and efficiently prevents tumor formation. Intriguingly, CVI expresses two predominant isoforms of the major MDV oncogene meq: one variant with a regular size of meq (Smeq) and one long... ...
To unravel the biological function of Cap1p in C. albicans, we deleted the CAP1 gene in strain CAI4 and analyzed the consequence of this deletion on (i) the level of expression of Cap1p transcriptional targets and (ii) the susceptibility of the cells to a variety of toxic compounds. On the one hand, we found that deletion of CAP1 has no effect on the basal transcription of the genes analyzed, although these genes were found to be Cap1p transcriptional targets, as shown by their upregulation in theCAP1-TR transformants (Fig. 4). This observation is consistent with what has been found in S. cerevisiae for Yap1p targets such as YCF1, GSH1, andTRX2, whose expression is not reduced in a yap1deletion strain under noninducing conditions (50, 56). Rather, Yap1p has been shown to be required for stress-induced transcriptional activation of its targets (50), a situation mimicked by elevated gene dosage (56) or by expression of Yap1p derivatives carrying an altered CRD (see below). On the other hand, we ...
PubMed comprises more than 30 million citations for biomedical literature from MEDLINE, life science journals, and online books. Citations may include links to full-text content from PubMed Central and publisher web sites.
The KOMP Repository is located at the University of California Davis and Childrens Hospital Oakland Research Institute. Question? Comments? For Mice, Cells, and germplasm please contact us at [email protected], US 1-888-KOMP-MICE or International +1-530-752-KOMP, or for vectors [email protected] or +1-510-450-7917 ...
Nuclear factor (erythroid-derived 2)-like 2, also known as NFE2L2 or Nrf2, is a transcription factor that in humans is encoded by the NFE2L2 gene. Nrf2 is a basic leucine zipper (bZIP) protein that regulates the expression of antioxidant proteins that protect against oxidative damage triggered by injury and inflammation. Several drugs that stimulate the NFE2L2 pathway are being studied for treatment of diseases that are caused by oxidative stress. NFE2L2 and other genes, such as NFE2, NFE2L1 and NFE2L3, encode basic leucine zipper (bZIP) transcription factors. They share highly conserved regions that are distinct from other bZIP families, such as JUN and FOS, although remaining regions have diverged considerably from each other. Under normal or unstressed conditions, Nrf2 is kept in the cytoplasm by a cluster of proteins that degrade it quickly. Under oxidative stress, Nrf2 is not degraded, but instead travels to the nucleus where it binds to a DNA promoter and initiates transcription of ...
Order GBF1 ELISA Kits for many Reactivities. and more. Compare GBF1 ELISA Kits and find the right product on antibodies-online.com.
1GBF: ALPHA-LYTIC PROTEASE WITH MET 190 REPLACED BY ALA AND GLY 216 REPLACED BY LEU COMPLEX WITH METHOXYSUCCINYL-ALA-ALA-PRO-ALANINE BORONIC ACID
Stata courses from top universities and industry leaders. Learn Stata online with courses like Methods and Statistics in Social Sciences and IBM Data Science.
Cottier, F Raymond, M, Kurzai, O, Bolstad, M, Leewattanapasuk, W, Jim nez-L pez, C , Lorenz, MC, Sanglard, D, V chova, L, Pavelka, N, Palkova, Z, M hlschlegel, FA (2012). The bZIP transcription factor Rca1p is a central regulator of a novel CO2 sensing pathway in yeast. PLOS Pathogen 8: e1002485, DOI: 10.1371/journal.ppat. ...
Expression of GBF1 (ARF1GEF, KIAA0248) in cerebellum tissue. Antibody staining with HPA037759 and HPA037760 in immunohistochemistry.
Complete information for LUZP2 gene (Protein Coding), Leucine Zipper Protein 2, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene Compendium
Gene target information for BZW2 - basic leucine zipper and W2 domains 2 (human). Find diseases associated with this biological target and compounds tested against it in bioassay experiments.
... Udsalg Outlet Danmark Butikker - Køb Herrer Sko Klik Her Og Find Den Bedste Pris Nu. Autentiske Kvalitet, Hurtig Gratis Forsendelse! Stort Udvalg Af Komfortabel Produkt Til Billige Priser!
Previous fossil records suggested this group was part of an ancient lineage from North America but the DNA showed these unusual forms were part of the modern radiation of equid species," Dr Orlando says.. A new species of ass was also detected on the Russian Plains and appears to be related to European fossils dating back more than 1.5 million years. Carbon dates on the bones reveal that this species was alive as recently as 50,000 years ago.. "Overall, the new genetic results suggest that we have under-estimated how much a single species can vary over time and space, and mistakenly assumed more diversity among extinct species of megafauna," Professor Cooper says. "This has important implications for our understanding of human evolution, where a large number of species are currently recognised from a relatively fragmentary fossil record. "It also implies that the loss of species diversity that occurred during the megafaunal extinctions at the end of the last Ice Age may not have been as ...
hypothetical protein, A306_16176, Anapl_09380, AS27_04981, AS28_10071, BTB and CNC homolog 2, BTB and CNC homology 1, basic leucine zipper transcription facto, BTB and CNC homology 1, basic leucine zipper transcription factor 2, BTB and CNC homology 2, BTB and CNC homology, basic leucine zipper transcription factor 2, BTB and CNC-like protein 2, BTB and CNC-like proteiny 1, basic leucine zipper transcription factor 2, BTBD25, CB1_000371003, D623_10023882, EGK_15169, GW7_21221, H920_09183, M91_21520, N300_01162, N301_04236, N302_15591, N303_00283, N306_11786, N307_06313, N309_15054, N312_12567, N320_02542, N321_10716, N322_10547, N324_08521, N325_01813, N326_10621, N327_13435, N329_07672, N330_12030, N332_00603, N333_12747, N334_07268, N335_02849, N336_03526, N339_08762, N340_07775, N341_06653, PAL_GLEAN10025165, PANDA_014576, RGD1562865, Transcription regulator protein BACH2, Transcription regulator protein BACH2 (BTB and CNC homolog 2), transcription regulator protein BACH2-like protein, ...
Many people say they dont work out because they simply dont have the time. If youre one of them, your favorite excuse may have just fallen by the wayside - a new study shows just 30 minutes of daily activity is enough for weight loss ...
Un fiocco nero per Genova e per quelle vittime la cui unica colpa è stata di andare a scuola o al lavoro.. Copiate e condividete il nostro dolore per non aver anteposto la tutela dei bambini prima di qualunque altra cosa. Cé ancora tanto fango e dovremo ricomprare molte cose andate perdute ma i bambini, quelli, non ce li ridarà più nessuno.. ...
Un fiocco nero per Genova e per quelle vittime la cui unica colpa è stata di andare a scuola o al lavoro.. Copiate e condividete il nostro dolore per non aver anteposto la tutela dei bambini prima di qualunque altra cosa. Cé ancora tanto fango e dovremo ricomprare molte cose andate perdute ma i bambini, quelli, non ce li ridarà più nessuno.. ...
Full Sequence ttttgctcacatgtnngagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgtt agagagataattggaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagt aataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaac ttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccGCAAAAATGCCATCC TACAGgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcac cgagtcggtgcttttttgttttagagctagaaatagcaagttaaaataaggctagtccgtttttagcgcg tgcgccaattctgcagacaaatggctctagaggtacccgttacataacttacggtaaatggcccgcctgg ctgaccgcccaacgacccccgcccattgacgtcaatagtaacgccaatagggactttccattgacgtcaa tgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgcccc ctattgacgtcaatgacggtaaatggcccgcctggcattgtgcccagtacatgaccttatgggactttcc tacttggcagtacatctacgtattagtcatcgctattaccatggtcgaggtgagccccacgttctgcttc actctccccatctcccccccctccccacccccaattttgtatttatttattttttaattattttgtgcag cgatgggggcggggggggggggggggcgcgcgccaggcggggcggggcggggcgaggggcggggcggggc gaggcggagaggtgcggcggcagccaatcagagcggcgcgctccgaaagtttccttttatggcgaggcgg ...