Looking for Fusobacterium? Find out information about Fusobacterium. in physics. 1 The change of a substance from the solid to the liquid state, also known as melting. The heat given up by a unit mass of a substance during... Explanation of Fusobacterium
Colorectal cancers comprise a complex mixture of malignant cells, nontransformed cells, and microorganisms. |i|Fusobacterium nucleatum|/i| is among the most prevalent bacterial species in colorectal cancer tissues. Here we show that colonization of human colorectal cancers with |i|Fusobacterium|/i| …
WASHINGTON -- A combination of antibiotics aimed at Fusobacterium varium offers ulcerative colitis patients improved symptoms, a Japanese researcher said here.
2.A.118 The Basic Amino Acid Antiporter (ArcD) Family. The ArcD family is a constituent of the IT superfamily (Lolkema and Slotboom, 2003; Prakash et al., 2003; Rabus et al., 1999). It is the st313/AitC family of Lolkema and Slotboom (2003). It consists of proteins from Gram-negative and Gram-positive bacteria (e.g., Streptococcus, Escherichia, Salmonella, Fusobacterium and Borrelia species). The proteins are of about 480 aas with 10-12 putative TMSs. Functionally characterized homologues are in the DcuC (TC #2.A.61) and ArsB (TC #2.A.4) families. Some members of the family probably catalyze arginine/ornithine or citruline/ornithine antiport (Gupta et al., 2013; Rimaux et al., 2013). ...
Fusobacterium nucleatum subsp. nucleatum ATCC ® 25586D-5™ Designation: Genomic DNA from Fusobacterium nucleatum subsp. nucleatum strain VPI 4355 TypeStrain=True Application:
We report a case of infected iliac artery aneurysm concomitant with liver abscesses caused by Fusobacterium nucleatum. A 58-year-old man developed an aneurysm of the right common iliac artery and liver abscesses. The aneurysm was resected and a femoro-femoral crossover bypass with a knitted Dacron graft was performed for impending rupture. Anaerobic cultures obtained from blood and intramural thrombus were positive for Fusobacterium nucleatum. With antibiotics, the liver abscesses disappeared without drainage. Iliopsoas abscesses developed after surgery, but it was controlled with antibiotics. The patient was free of infection 1 year after the surgery. The causative bacterium was suspected to originate in the oral cavity, because the patient had a notable history of poor chronic periodontal conditions. Clinically, infected aortoiliac aneurysm complicated by Fusobacterium is extremely rare relative to the prevalence of the pathogenic bacterium. However, it is noteworthy that Fusobacterium can cause this
Genome Sequence of Fusobacterium nucleatum Subspecies Polymorphum - a Genetically Tractable Fusobacterium. . Biblioteca virtual para leer y descargar libros, documentos, trabajos y tesis universitarias en PDF. Material universiario, documentación y tareas realizadas por universitarios en nuestra biblioteca. Para descargar gratis y para leer online.
By Ramadhani Chambuso. The same oral commensal bacterium and gum disease pathogen called Fusobacterium nucleatum was found to be predominantly associated with primary human colorectal cancer cells and even in distant metastatic lesions, a study published in 2017 on the journal Science, reports. Furthermore, it was proven in mice with colon cancer that after treatment with antibiotics, Fusobacteruim load, cancer cell proliferation and overall tumour growth, all were reduced, which indicates that this organism may play a crucial role in colon cancer development.. Despite other studies suggesting the possible pro-tumorigenic role of Fusobacterium which may include modulation of host immune response to cancer cells and further enhancement of tumour cell invasion in colon cancer pathogenesis, this new study was scientifically able to show the correlation between decrease in Fusobacterium load and the decreased in rate of tumour growth and improved overall patient survival.. Although it is not clear ...
By Ramadhani Chambuso. The same oral commensal bacterium and gum disease pathogen called Fusobacterium nucleatum was found to be predominantly associated with primary human colorectal cancer cells and even in distant metastatic lesions, a study published in 2017 on the journal Science, reports. Furthermore, it was proven in mice with colon cancer that after treatment with antibiotics, Fusobacteruim load, cancer cell proliferation and overall tumour growth, all were reduced, which indicates that this organism may play a crucial role in colon cancer development.. Despite other studies suggesting the possible pro-tumorigenic role of Fusobacterium which may include modulation of host immune response to cancer cells and further enhancement of tumour cell invasion in colon cancer pathogenesis, this new study was scientifically able to show the correlation between decrease in Fusobacterium load and the decreased in rate of tumour growth and improved overall patient survival.. Although it is not clear ...
Tannases are tannin-degrading enzymes that have been described in fungi and bacteria as an adaptative mechanism to overcome the stress conditions associated with the presence of these phenolic compounds. We have identified and expressed in E. coli a tannase from the oral microbiota member Fusobacterium nucleatum subs. polymorphum (TanBFnp). TanBFnp is the first tannase identified in an oral pathogen. Sequence analyses revealed that it is closely related to other bacterial tannases. The enzyme exhibits biochemical properties that make it an interesting target for industrial use. TanBFnp has one of the highest specific activities of all bacterial tannases described to date and shows optimal biochemical properties such as a high thermal stability: the enzyme keeps 100% of its activity after prolonged incubations at different temperatures up to 45 °C. TanBFnp also shows a wide temperature range of activity, maintaining above 80% of its maximum activity between 22 and 55 °C. The use of a panel of 27 esters
BACKGROUND: There is a lack of prospective data on the potential association of Fusobacterium nucleatum (F. nucleatum) and colorectal cancer risk. In this study, we assessed whether antibody responses to F. nucleatum are associated with colorectal cancer risk in prediagnostic serum samples in the European Prospective Investigation into Nutrition and Cancer (EPIC) cohort. METHODS: We applied a multiplex serology assay to simultaneously measure antibody responses to 11 F. nucleatum antigens in prediagnostic serum samples from 485 colorectal cancer cases and 485 matched controls. Conditional logistic regression models were used to estimate odds ratios (ORs) and 95% confidence intervals (CI). RESULTS: We observed neither a statistically significant colorectal cancer risk association for antibodies to individual F. nucleatum proteins nor for combined positivity to any of the 11 proteins (OR, 0.81; 95% CI, 0.62-1.06). CONCLUSIONS: Antibody responses to F. nucleatum proteins in prediagnostic serum samples from
Fusobacterium nucleatum is a Gram-negative anaerobic organism that plays a central role in the development of periodontal diseases. The progression of periodontitis is associated with a rise in pH of the gingival sulcus which promotes the growth and expression of virulence factors by periodontopathic bacteria. We have previously reported that the expression of specific cytoplasmic proteins is altered by a shift in growth pH. In the present study we have compared cell envelope protein expression of F. nucleatum during chemostat growth at pH 7.2 and 7.8. From a total of 176 proteins resolved from the cell envelope, 15 were found to have altered expression in response to an increase in growth pH and were identified by MS. Upregulated proteins included an outer membrane porin which has been identified as playing a role in virulence, a periplasmic chaperone which assists in the folding of outer membrane proteins, and a transporter thought to be involved with iron uptake. Proteins downregulated at pH 7.8 were
Many Bacteroidetes, especially Bacteroides are opportunistic pathogens. The figure shows predominant sites colonized by Bacteroides and other anaerobic bacilli. Their levels are higher in celiac disease and more severe forms of IBS (Rome III criteria). Prevotella, and Fusobacterium are prevalent in the body and usually dont cause problems, but may become involved in infections throughout the body (see Fig.). Within the Bacteroides group, B fragilis is the most common pathogen, followed B thetaiotaomicron and other members of the B fragilis group. Among the bile-sensitive Prevotella species, the ones most commonly encountered clinically are P melaninogenica, P oris, and P buccae. Porphyromonas species seem to be much less pathogenic except in dental infections. Fusobacterium nucleatum is the Fusobacterium species most often found as a pathogen, but F necrophorum occasionally produces serious disease. Several species of Flavobacteria are known to cause disease in freshwater fish. Bacteria that ...
Terpenoids, also known as isoprenoids, are a large class of natural products consisting of isoprene (C5) units. There are two biosynthetic pathways, the mevalonate pathway [MD:M00095] and the non-mevalonate pathway or the MEP/DOXP pathway [MD:M00096], for the terpenoid building blocks: isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP). The action of prenyltransferases then generates higher-order building blocks: geranyl diphosphate (GPP), farsenyl diphosphate (FPP), and geranylgeranyl diphosphate (GGPP), which are the precursors of monoterpenoids (C10), sesquiterpenoids (C15), and diterpenoids (C20), respectively. Condensation of these building blocks gives rise to the precursors of sterols (C30) and carotenoids (C40). The MEP/DOXP pathway is absent in higher animals and fungi, but in green plants the MEP/DOXP and mevalonate pathways co-exist in separate cellular compartments. The MEP/DOXP pathway, operating in the plastids, is responsible for the formation of essential oil ...
Han, Y.W.; Shi, W.; Huang, G.T.J.; Haake, S.K.nder; Park, N.H.e; Kuramitsu, H.; Genco, R.J., 2000: Interactions between periodontal bacteria and human oral epithelial cells: Fusobacterium nucleatum adheres to and invades epithelial cells
Identification and Characterization of Fusolisin, the Fusobacterium nucleatum Autotransporter Serine Protease. . Biblioteca virtual para leer y descargar libros, documentos, trabajos y tesis universitarias en PDF. Material universiario, documentación y tareas realizadas por universitarios en nuestra biblioteca. Para descargar gratis y para leer online.
Tropical ulcer, more commonly known as jungle rot, is a chronic ulcerative skin lesion thought to be caused by polymicrobial infection with a variety of microorganisms, including mycobacteria. It is common in tropical climates. Ulcers occur on exposed parts of the body, primarily on anterolateral aspect of the lower limbs and may erode muscles and tendons, and sometimes, the bones. These lesions may frequently develop on preexisting abrasions or sores sometimes beginning from a mere scratch. The vast majority of the tropical ulcers occur below the knee, usually around the ankle. They may also occur on arms. They are often initiated by minor trauma, and subjects with poor nutrition are at higher risk. Once developed, the ulcer may become chronic and stable, but also it can run a destructive course with deep tissue invasion, osteitis, and risk of amputation. Unlike Buruli ulcer, tropical ulcers are very painful. Lesions begin with inflammatory papules that progress into vesicles and rupture with ...
Medical definition of calf diphtheria: an infectious disease of the mouth and pharynx of calves and young cattle associated with the presence of large numbers of a bacterium of the genus Fusobacterium (F. necrophorum) and commonly resulting in pneumonia or generalized septicemia if untreated.
PubMed comprises more than 30 million citations for biomedical literature from MEDLINE, life science journals, and online books. Citations may include links to full-text content from PubMed Central and publisher web sites.
Silver, Fusobacterium, Fusobacterium Nucleatum, Ability, Copper, Nanoparticles, Oxygen, Mothers, Oral Cavity, Porphyromonas, Porphyromonas Gingivalis, Pregnancy, Strains, Lead, Titanium, Tungsten, Concentrations, Electron, Electron Microscopy, Elements
Infections with anaerobic organisms belonging to the Bacteroides-Fusobacterium group are much more common than is generally appreciated. This paper is concerned with clinical and bacteriologic findings in 127 infections due to these organisms, occurring in 102 patients. These organisms were isolated from the blood stream in 11 cases; the portal of entry was the urinary tract in two; peritoneum, in three; meninges, in one; gastrointestinal tract, in two; and was unknown in three. One of these patients has had recurrent bacteremia for over one year and is thought to have subacute bacterial endocarditis. The organisms were isolated from the urine ...
A common oral bacteria, Fusobacterium nucleatum, acts like a key to open a door in human blood vessels and leads the way for it and other bacteria like Escherichia coli to invade the body through the blood and make people sick, according to dental researchers
Multi-disciplinary methods reveal a novel type of ion binding in the rotor ring of the F1Fo-ATP synthase from the opportunistic pathogen Fusobacterium nucleatum.
General Information: Environment: Gastrointestinal tract, Host, Respiratory; Isolation: Subgingival sulcus. Temp: Mesophile; Temp: 37C. Selenomonas sputigena is commonly isolated from the oral cavity of humans. ...
Rusakova E.V.; Kashlyaeva T.K.; Gusarova L.D.; Muradova G.D., 1987: Epidemiological and immunobiological evaluation of prophylactic immunization schedules
Feces from CRC cases had very strong microbe-metabolite correlations that were predominated by Enterobacteriaceae and Actinobacteria. Metabolites mediated a direct CRC association with Fusobacterium and Porphyromonas, but not an inverse association with Clostridia and Lachnospiraceae. This study ide …
Background: Fusobacterium necrophorum as a non-spore-forming Gram-negative anaerobic bacillus is an important human and animal pathogen. It may cause severe systemic infections (Lemierres syndrome) and some other infections. The aim of this study was to subtype Fusobacterium necrophorum by using PCR methods. Materials and Methods: Twenty five strains of Fusobacterium necrophorum ...
The lipid A component of lipopolysaccharides from Fusobacterium nucleatum Fev 1 consists of beta-1,6-linked D-glucosamine disaccharides, which carry two phosphate groups: one in glycosidic and one in ester linkage. The amino groups of the glucosamine disaccharides are substituted by D-3-hydroxyhexadecanoic acid. The hydroxyl groups of the disaccharide backbone are acylated by tetradecanoic, hexadecanoic, and D-3-hydroxytetradecanoic acids. Part of the ester-bound D-3-hydroxytetradecanoic acid is 3-O-substituted by tetradecanoic acid. Whereas a similar pattern of fatty acids was detected in lipopolysaccharides from two other F. nucleatum strains, the amide-bound fatty acid in F. varium and F. mortiferum was D-3-hydroxytetradecanoic acid. The chemical relationships of lipid A from Fusobacteria and other gram-negative bacteria are discussed. ...
Intra-abdominal sepsis was studied in Wistar rats by using four microbial species: Escherichia coli, enterococci, Bacteroides fragilis, and Fusobacterium varium. These organisms were implanted into the peritoneal cavity singly and in all possible dual combinations. Results were evaluated by mortality rates and the incidence of intra-abdominal abscesses on autopsy following sacrifice after 7 days. Mortality was restricted to recipients of E. coli, thus implicating coliforms in the acute lethality associated with this experimental model. Intra-abdominal abscesses were produced in 61 of 95 (94%) animals that received the combination of an anaerobe and a facultative organism. Abscesses failed to form with any single strain or with E. coli plus enterococci, and they were detected in one 1 of 19 animals receiving B. fragilis plus F. varium. These results suggest that intra-abdominal abscess formation is related to synergy between anaerobes and facultative bacteria. ...
Antimicrobial effect of calcium hydroxide as an intracanal medicament in root canal treatment.. Restorative Dentistry and Endodontics Rev 2014:
Fusobacterium nucleatum é um anaeróbio estrito e considerado membro da microbiota indígena da cavidade bucal humana. É comumente observado em diferentes infecções monomicrobianas e mistas em humanos e animais. O objetivo deste estudo foi avaliar o perfil plasmidial de F. nucleatum orais isolados de pacientes com doença periodontal, indivíduos sadios, e de macacos Cebus apella, e verificar a estabilidade plasmidial e a associação com genes de resistência à penicilina. Quarenta e cinco cepas de F. nucleatum orais isoladas de pacientes, 38 de indivíduos sadios e sete de macacos C. apella, foram examinadas. A extração plasmidial realizada detectou plasmídios em 26,7% das cepas humanas e em apenas uma cepa de C. apella. A maioria das cepas apresentou duas bandas plasmidiais variando de 4 a 16 Kb, e as digestões com endonucleases demonstraram serem essas bandas pertencentes a um único plasmídio, sendo classificados em três grupos segundo o tamanho. Cepas de indivíduos sadios não ...
Fusobacterium nucleatum is a gram-negative anaerobe ubiquitous to the oral cavity. It is associated with periodontal disease. It is also associated with preterm birth and has been isolated from the amniotic fluid, placenta, and chorioamnionic membran
Price, S.L., Hardy, S., Gale, P. and Basten, G. (2012) Prevalence of Fusobacterium necrophorum in persistent sore throat samples. British journal of biomedical science, 68 (4), pp. 209- ...
Results One hundred and ninety six patients were recruited: 158 CRC patients, 24 adenoma patients and 14 normal colon controls (median age 70; range 35-90). Tumours were staged as 6 T0, 4 T1, 23 T2, 97 T3, 27 T4; 99 N0, 40 N1, 27 N2; 6 M1. No significant differences were seen in diversity or taxonomy between the UK and Czech cohorts. Adenoma and healthy colon control samples were taxonomically indistinct. However, CRCs were characterised by reduced Shannon diversity (p,0.01), with enrichment of organisms including Bacteroides fragilis,Fusobacterium nucleatum and under-representation of Bacteroides vulgatus,Bacteroides uniformisandFaecalibacterium prausnitzii (all q,0.01). Furthermore, we found a significant progressive reduction in the expression of Bacteroides vulgatus with advancing T stage and a corresponding increase in Fusobacterium nucleatum expression (figure). Additionaly, samples from patients with T4 tumours and cancers expressing histological and molecular markers of poor prognosis ...
https://doi.org/10.18632/oncotarget.5166 Ya-Nan Yu, Ta-Chung Yu, Hui-Jun Zhao, Tian-Tian Sun, Hui-Min Chen, Hao-Yan Chen, Hui-Fang An, Yu-Rong Weng, Jun Yu, Min Li, Wen-Xin Qin, Xiong Ma, Nan Shen,...
Subacute hematogenous osteomyelitis is an insidious infection, which commonly has a delayed diagnosis. We describe the case of a 7-year-old boy with subacute osteomyelitis, which was initially considered to be a bone tumor. Infection should be considered in all cases of bone pain, especially in children, even in the absence of typical systemic features of inflammation.
In contrast to the well-established roles of microbes in the aetiology of acute sinusitis, the exact roles of the abovementioned microorganisms (namely Prevotella and Porphyromonas spp., Fusobacterium spp., GPAC, V. parvula, L. buccalis, E. corrodens, E. lenta, Bacteroides spp. and Clostridium spp.) in the aetiology of CRS are uncertain [1, 2]. Various researchers disagree on the microbial aetiology of CRS; some of the disagreement may be explained by the different methodological approaches to the processing of the obtained microbiological samples. Many bacterial organisms have been identified in the sinus tracts of patients with CRS and are reported in the literature, but there is no consensus as to their correct pathogenic role. Despite the exact cause of the inflammation associated with CRS is uncertain, the presence of bacteria within the sinuses has been well documented in different studies [9, 10]. Some of these studies have examined the bacterial pathogens associated with CRS, but most of ...
Fusobacterium necrophorum was quantified from ruminal contents and ruminal wall tissue collected at slaughter. Livers were examined and scored for abscesses. The mean concentration of F. necrophorum on the ruminal wall ...
Case Reports in Hematology is a peer-reviewed, Open Access journal that publishes case reports in all areas of hematology, including general hematology, pathology, and oncology, with a specific focus on lymphomas and leukemias.
We found this cancer is linked to an infection from [the bacterium], said Yiping Han, professor of periodontics at the dental school and the studys lead investigator. This discovery creates the potential for new diagnostic tools and therapies to treat and prevent the cancer.. The results of the research appear in the current issue of Cell Host & Microbe, in conjunction with a second study from a different research group that highlights how the bacteria can speed the accumulation of cancerous cells.. The researchers also learned how to prevent the microorganism, called Fusobacterium nucleatum (Fn), from attaching to colon cells and potentially triggering a cascade of changes that can lead to cancer.. The latest findings advance research from 2011, in which Han and her team identified an adhesive molecule on Fns surface-called FadA-that can attach to VE-cadherin, a cell receptor from the cadherin group on blood vessels.. As Han completed the work on FadA and VE-cadherin, researchers from ...
González, Octavio A. et al HIV-1 Reactivation Induced by the Periodontal Pathogens Fusobacterium nucleatum and Porphyromonas gingivalis Involves Toll-Like Receptor 4 and 9 Activation in Monocytes/Macrophages. Clinical and Vaccine Immunology 17.9 (2010): 1417-1427. Web. 03 June. 2020. ...
Multimorbidity of intestinal cancer (IC), type 2 diabetes (T2D) and obesity is a posh set of ailments, affected by environmental and genetic threat components. High-fat diet (HFD) and oral bacterial infection play essential roles in the etiology of these ailments by way of irritation and numerous organic mechanisms. To research the complexity of this multimorbidity, we used the collaborative cross (CC) mouse genetics reference inhabitants. We aimed to research the multimorbidity of IC, T2D, and obesity using CC lines, measuring their responses to HFD and oral bacterial infection.. The research used 63 mice of each sexes generated from two CC lines (IL557 and IL711). For 12 weeks, experimental mice have been maintained on particular dietary regimes mixed with co-infection with oral micro organism Porphyromonas gingivalis and Fusobacterium nucleatum, whereas management teams werent contaminated. Body weight (BW) and outcomes of a intraperitoneal glucose tolerance check (IPGTT) have been recorded ...
Multimorbidity of intestinal cancer (IC), type 2 diabetes (T2D) and obesity is a posh set of ailments, affected by environmental and genetic threat components. High-fat diet (HFD) and oral bacterial infection play essential roles in the etiology of these ailments by way of irritation and numerous organic mechanisms. To research the complexity of this multimorbidity, we used the collaborative cross (CC) mouse genetics reference inhabitants. We aimed to research the multimorbidity of IC, T2D, and obesity using CC lines, measuring their responses to HFD and oral bacterial infection.. The research used 63 mice of each sexes generated from two CC lines (IL557 and IL711). For 12 weeks, experimental mice have been maintained on particular dietary regimes mixed with co-infection with oral micro organism Porphyromonas gingivalis and Fusobacterium nucleatum, whereas management teams werent contaminated. Body weight (BW) and outcomes of a intraperitoneal glucose tolerance check (IPGTT) have been recorded ...
Melbourne: World Health Organization. Fusobacterium fusiforme. Ischemia to new screening. Tongue sumycin for sale in Canada. Always reconsider your healthcare provider to ensure the nausea displayed on this page exists to Sumycin uterine circumstances. Dispersion Details. These millions have been hit by both the oral and stated afternoon of tetracyclines but are less stress after parenteral use. Back Next. Into a white strip of oral curb. The Wall Column Journal. In pulse with high quality and acquisition manufacture, weight, and destination you will save money. It and relieve to your life schedule is higher when used medications, usually grants new, pandas to help in clinical regulation. Japanese women, protracted into Sumycin with jerks and associated neck. Stresses have a broad comprehensive of buddhist rose. Antibiotics Using Sumycin during pregnancy could harm the maximum baby or cause erectile tooth whitening later in the babys life. Immensely newsletter. Latin women, all Sumycin as is a ...
Propionibacterium species are nonsporulating, gram-positive anaerobic bacilli that are considered commensal bacteria on the skin. They are usually nonpathogenic and are common contaminants of blood and body fluid cultures.
Infections caused by anaerobic bacteria are common and may be serious and life-threatening. Anaerobes are the predominant components of the bacterial flora of
Your basket is currently empty. i ,p>When browsing through different UniProt proteins, you can use the basket to save them, so that you can back to find or analyse them later.,p>,a href=/help/basket target=_top>More...,/a>,/p> ...
If we know how fusobacteria localize and become enriched in colon tumors, hopefully we can utilize the same or similar mechanisms to guide and deliver cancer therapeutics to colon tumors, said co-senior author Wendy Garrett, MD, PhD, of the Harvard T.H. Chan School of Public Health in Boston, in a press release. ...
ATGAAAAAAATATTAGCATTTATTAGTTTATTATTTTTAATGGTAGCTTGTTCTTCAACAGAAGAAGTTA AAAGTACTGGTAATAGAAATATTAACAGAGGAAGTAATATTTCAAGAAGTCAAACAACAATAAGAAATAT TGGAAAATTCCAAGTTGACTCAAATTCTTATGTGGCAACAGGGAAAAATGAAAGAATTCAATTTATTATT GTTCACTATACAGCAACAGATAATGCAGGTGCTATTAAAGAATTGACTTCAAGTAGAGTAAGTTCACATT TCTTAGTTTTAGATGAAGATGATAATAAAATATACAGCCTAGTTCCACTTGAACAAAGAGCTTGGCATGC AGGAGCAAGTGCATTTAGAGGAAGAACAAATATAAATGATACTTCTGTTGGAATTGAAATAGTGAGTGAA GGTATAGCAAAAGAATTTGTACCTGACCCTAATCCATATCATCCTTATGATCACTATGTTGATTATAAGC CAATACAAATAGAAAAGACTGCACAAATCATAAAATATGTAGCAGAAAAATATAATATTCCTGCAAGAAA TATACTTGCACATTCTGATATTGCACCAAGTAGAAAGAAAGATCCGGGAGCAAAATTTCCTTGGAAAGAA TTATATGATAAATATAATATAGGTGCTTGGTATGATGAAGCAGATAAACAAGAATTTATGGATGAAGAAA AATTTAATGCTACTTCAATTAGAGAAATAAAAGATGAATTGAGAAAATATGGTTATGAAATAAATAGATT TGATGAATGGGATAAAGAAAGTAAAGATGTGGTTTATGCTTTTCAATTGCACTTTAATCCTAAAAATCCA ACAGGAGAAATGGATTTAGAAACTTTTGCAATTTTAAAAGCATTGAATAAAAAATATCCTGAATAA ...
Councils have cut their pest control units by 25% since 2012, leading to a dramatic decrease in the number of reports dealt with, research reveals.