article{e9ac4e46-7f3f-4f79-aec3-ce5508715b29, abstract = {Comparative analysis of expressed sequence tags is becoming an important tool in molecular ecology for comparing gene expression in organisms grown in certain environments. Additionally, expressed sequence tag database information can be used for the construction of DNA microarrays and for the detection of single nucleotide polymorphisms. For such applications, we present PHOREST, a web-based tool for managing, analysing and comparing various collections of expressed sequence tags. It is written in PHP (PHP: Hypertext Preprocessor) and runs on UNIX, Microsoft Windows and Macintosh (Mac OS X) platforms.}, author = {Ahrén, Dag and Troein, Carl and Johansson, Tomas and Tunlid, Anders}, issn = {1471-8278}, language = {eng}, number = {2}, pages = {311--314}, publisher = {Wiley-Blackwell}, series = {Molecular Ecology Notes}, title = {PHOREST: a web-based tool for comparative analyses of expressed sequence tag data}, url = ...
EST sequences are valuable data for gene discovery, especially for plant species with large genomes that have not been fully sequenced, and they provide a convenient means of accessing the transcriptome of a given species. However, ESTs generally correspond to only partial cDNA sequences, and EST samples are typically highly redundant (especially if EST sets are not derived from normalized EST libraries). Therefore, the assembly of overlapping ESTs into putative unique transcript contigs on a frequent and regular basis constitutes the first step for all EST analyses performed at PlantGDB (for more details, see http://www.plantgdb.org/prj/ESTCluster/progress.php). A similar analysis is provided by the TIGR gene indices for selected species with sufficiently large numbers of ESTs (http://www.tigr.org/tdb/tgi/plant.shtml; Lee et al., 2005).. EST assembly remains a computational challenge given the large number of EST sequences currently available. For example, with more than 400,000 maize ESTs, ...
Read Large-scale EST sequencing in rice, Plant Molecular Biology on DeepDyve, the largest online rental service for scholarly research with thousands of academic publications available at your fingertips.
A normalised cDNA library was constructed from Bermudagrass to attain notion into the transcriptome of Cynodondactylon L. An entire of 15 588 high-top quality expressed sequence tags (ESTs) from the cDNA library have been subjected to The Institute for Genomic Evaluation Gene Indices clustering devices to offer a unigene set.. An entire of 9414 unigenes have been obtained from the high-quality ESTs and solely 39.6% of the high-quality ESTs have been redundant, indicating that the normalisation course of was environment friendly. A giant-scale comparative genomic analysis of the unigenes was carried out using publicly obtainable devices, harking back to BLAST, InterProScan and Gene Ontology. The unigenes have been moreover subjected to a search for EST-derived straightforward sequence repeats (EST-SSRs) and conserved-intron scanning primers (CISPs), which might be useful as DNA markers.. Although the candidate EST-SSRs and CISPs found throughout the present study needs to be empirically examined, ...
Theoretical considerations predict that amplification of expressed gene transcripts by reverse transcription-PCR using arbitrarily chosen primers will result in the preferential amplification of the central portion of the transcript. Systematic, high-throughput sequencing of such products would result in an expressed sequence tag (EST) database consisting of central, generally coding regions of expressed genes. Such a database would add significant value to existing public EST databases, which consist mostly of sequences derived from the extremities of cDNAs, and facilitate the construction of contigs of transcript sequences. We tested our predictions, creating a database of 10,000 sequences from human breast tumors. The data confirmed the central distribution of the sequences, the significant normalization of the sequence population, the frequent extension of contigs composed of existing human ESTs, and the identification of a series of potentially important homologues of known genes. This approach
Sequencing of expressed sequence tags (ESTs) has been one of the primary techniques used for transcriptome analysis in a wide spectrum of species including those utilized for aquaculture. However, many researchers are still unfamiliar with the many genome applications and byprod- ucts of EST analysis, and they often regard ESTs as only short random sequences. Additionally, lack of cDNA library normalization, project planning, and quality control have often restricted the value of EST resources created in many laboratories. This review aims to address these issues by providing information on the construction of normalized cDNA libraries for efficient generation and analysis of ESTs and by highlighting the significance of EST analysis for the genome research of species lacking a sequenced genome. A successful EST project can provide the sequence tools needed for not only gene discovery, but also for physical, linkage and compara- tive mapping, analysis of alternative splicing and gene duplication, ...
Several methods have been developed for the comprehensive analysis of gene expression in complex biological systems. Generally these procedures assess either a portion of the cellular transcriptome or a portion of the cellular proteome. Each approach has distinct conceptual and methodological advantages and disadvantages. We have investigated the application of both methods to characterize the gene expression pathway mediated by androgens and the androgen receptor in prostate cancer cells. This pathway is of critical importance for the development and progression of prostate cancer. Of clinical importance, modulation of androgens remains the mainstay of treatment for patients with advanced disease. To facilitate global gene expression studies we have first sought to define the prostate transcriptome by assembling and annotating prostate-derived expressed sequence tags (ESTs). A total of 55000 prostate ESTs were assembled into a set of 15953 clusters putatively representing 15953 distinct transcripts.
Abstract Expressed sequence tags (ESTs) are complementary deoxyribonucleic acid (cDNA) fragments, which are reverse transcribed from mature ribonucleic acid (mRNA), a direct gene transcript. ESTs are a readily rich information source of complete expressed gene sequences. They reveal the type and number of genes being expressed in an organism. Joining ESTs into complete gene sequences is computationally expensive because they are numerous, erroneous, redundant and mixed up. ESTs that originate from the same gene are grouped together. This enables efficient consensus sequences generation, which reveals underlying gene sequences and their possible alternative splicings. EST clustering enables efficient discovery of expressed genes based on which several fields rely such as: disease diagnostics, drug discovery, genetic engineering, alternative splicing and many others. Most clustering algorithms developed so far are quadratic and their running time is prohibitively high. A tree-structured index ...
Isolation and sequence analysis of ZNRF2. The full-length cDNA sequence of human and mouse ZNRF2 was determined by analyzing expressed sequence tag (EST) clones (wh57e11, wi35c02, and xs53e14 for human; ux04e08, my52g11, and mu26f10 for mouse) obtained from the Washington University-Merck EST project. These clones were sequenced completely, and the sequence information was combined with those present in GenBank (Unigene clusters Hs.127294, Hs.209125, Hs.288088, Hs.300734, and Hs.351657 for human and Mm.423 and Mm.158534 for mouse) to create contiguous full-length sequences. Sequence editing, mapping, alignment, and contig production was performed using the DNASTAR (Madison, WI) and Vector NTI Suite 6 (InforMax, Frederick, MD) software packages. Human genome sequences for ZNRF1 and ZNRF2 were obtained from the database ( accession number AC099508 for ZNRF1; accession number AC006978 for ZNRF2) and compared with cDNA sequences of ZNRF1 and ZNRF2 using BLAST2 (basic local alignment search ...
BACKGROUND: Publicly accessible EST libraries contain valuable information that can be utilized for studies of tissue-specific gene expression and processing of individual genes. This information is, however, confounded by multiple systematic effects arising from the procedures used to generate these libraries. RESULTS: We used alignment of ESTs against a reference set of transcripts to estimate the size distributions of the cDNA inserts and sampled mRNA transcripts in individual EST libraries and show how these measurements can be used to inform quantitative comparisons of libraries. While significant attention has been paid to the effects of normalization and substraction, we also find significant biases in transcript sampling introduced by the combined procedures of reverse transcription and selection of cDNA clones for sequencing. Using examples drawn from studies of mRNA 3-processing (cleavage and polyadenylation), we demonstrate effects of the transcript sampling bias, and provide a
The zebrafish is a powerful system for understanding the vertebrate genome, allowing the combination of genetic, molecular, and embryological analysis. Expressed sequence tags (ESTs) provide a rapid means of identifying an organisms genes for further analysis, but any EST project is limited by the availability of suitable libraries. Such cDNA libraries must be of high quality and provide a high rate of gene discovery. However, commonly used normalization and subtraction procedures tend to select for shorter, truncated, and internally primed inserts, seriously affecting library quality. An alternative procedure is to use oligonucleotide fingerprinting (OFP) to precluster clones before EST sequencing, thereby reducing the re-sequencing of common transcripts. Here, we describe the use of OFP to normalize and subtract 75,000 clones from two cDNA libraries, to a minimal set of 25,102 clones. We generated 25,788 ESTs (11,380 3 and 14,408 5) from over 16,000 of these clones. Clustering of 10,654 ...
TY - JOUR. T1 - Long-range heterogeneity at the 3′ ends of human mRNAs. AU - Iseli, Christian. AU - Stevenson, Brian J.. AU - De Souza, Sandro J.. AU - Samaia, Helena B.. AU - Camargo, Anamaria A.. AU - Buetow, Kenneth H.. AU - Strausberg, Robert L.. AU - Simpson, Andrew J.G.. AU - Bucher, Philipp. AU - Victor Jongeneel, C.. PY - 2002/7/30. Y1 - 2002/7/30. N2 - The publication of a draft of the human genome and of large collections of transcribed sequences has made it possible to study the complex relationship between the transcriptome and the genome. In the work presented here, we have focused on mapping mRNA 3′ ends onto the genome by use of the raw data generated by the expressed sequence tag (EST) sequencing projects. We find that at least half of the human genes encode multiple transcripts whose polyadenylation is driven by multiple signals. The corresponding transcript 3′ ends are spread over distances in the kilobase range. This finding has profound implications for our ...
Author: Hilson, P. et al.; Genre: Journal Article; Published in Print: 2004; Keywords: repeat-containing gene|br/|secondary cell-wall|br/|vacuolar h+-atpase|br/|microarray analysis|br/|escherichia-coli|br/|wide expression|br/|restorer gene|br/|plant-growth|br/|design|br/|thaliana; Title: Versatile gene-specific sequence tags for Arabidopsis functional genomics: Trancript profiling and reverse genetics applications
Purification of CASKIN. Rat brain proteins were affinity-purified on immobilized glutathioneS-transferase (GST)-CASK1-337 fusion protein essentially as described previously (Butz et al., 1998). Three proteins were detectable on Coomassie-stained gels: Mint 1, a 180 kDa protein called Caskin 1 in this study, and a 225 kDa protein. The 180 kDa and 225 kDa bands were eluted from the gel and digested by trypsin, and tryptic peptides were purified by HPLC and sequenced by Edman degradation essentially as described previously (Hata et al., 1993). The 180 kDa peptide sequences did not match any protein in the database except for KIAA and expressed sequence tag (EST) sequences (see Results), whereas the 225 kDa protein was identified as the rat homolog of NEDD4-like ubiquitin ligase 1 (GenBank accession #BAB13352).. cDNA cloning and sequencing. GenBank searches identified a random human brain cDNA (KIAA1306) and human EST clones that contained the sequences of the peptide fragments. To determine the ...
ul,,li,Preparation of EST data: Sequences were extracted from dbEST and were subjected to quality control screening (vector, E. coli, polyA, T, or CT removal, minimum length = 100 bp, < 3% N).,/li,,li,Preparation of transcript (ET) database: All sequences from the appropriate divisions of GenBank (including RefSeq) were extracted. Non-coding sequences were discarded and cDNAs and coding sequences from genomic entries were saved. Sequences and related information (e.g. PubMed links) are stored in the qcGene database (qcGene).,/li,,li,Assembly: Cleaned EST sequences and non-redundant transcript (ET) sequences were combined. Using the Paracel Transcript Assembler Program, sequences were assembled into contigs. TCs are consensus sequences based on two or more ESTs (and possibly an ET) that overlap for at least 40 bases with at least 94% sequence identity. These strict criteria help minimize the creation of chimeric contigs. These contigs are assigned a TC (Tentative Consensus) number. TCs may ...
The DNATools sequencing software package version 5.1.375 is available for downloading at: http://www.crc.dk/phys/Dnatools/A01B04C04_Downloading.htm New in this revision: + Searching with protein strings on nucleotide sequences refined + File list based on Text Header content improved + Auto-build Text Headers after mail blast search improved + SAGE functions improved and thoroughly tested + Reporting facilities after SAGE tag file comparisons improved + Back-translation based on codon usage data now correct + Contig builder/editor improved (simple merge function) + Close redundant files improved (mostly for EST projects) + PSG (project subgroup) file handling improved DNATools is continuously being improved (as you may have noticed as a reader of this news group). This does not imply that upgrading is necessary each time a new revision is released. Im most cases the new revision only corrects minor bugs that you may not have noticed. My ambition, however, is to make bug fixes and improvements ...
Nygaard, V; Liu, Fang; Holden, Marit; Kuo, Winston P.; Trimarchi, Jeff; Ohno-Machado, Lucila; Cepko, Connie L.; Frigessi, Arnoldo; Glad, Ingrid K.; Wiel, Mark A. van de; Hovig, Eivind & Lyng, H (2008). Validation of oligoarrays for quantitative exploration of the transcriptome. BMC Genomics. ISSN 1471-2164. 9 . doi: 10.1186/1471-2164-9-258 Vis sammendrag Background Oligoarrays have become an accessible technique for exploring the transcriptome, but it is presently unclear how absolute transcript data from this technique compare to the data achieved with tag-based quantitative techniques, such as massively parallel signature sequencing (MPSS) and serial analysis of gene expression (SAGE). By use of the TransCount method we calculated absolute transcript concentrations from spotted oligoarray intensities, enabling direct comparisons with tag counts obtained with MPSS and SAGE. The tag counts were converted to number of transcripts per cell by assuming that the sum of all transcripts in a single ...
ESTviewer is a web application for interactively visualizing human gene structures, with emphasis on mammalian and avian expressed sequence tags (ESTs) that are conserved in the human genome and alternatively spliced (AS) variants. AS variants from the UCSC, Vega and PSEP annotations are presented in this application for comparison. EST data from six species, human, mouse, rat, cattle, pig and chicken, are mapped to the human genome to show cross-species EST conservation in annotated exonic and intronic regions. Cross-species EST conservation is evolutionarily and functionally important because it represents the effects of selection pressure on genic regions and transcriptome over evolutionary time. Emphatically, ESTviewer provides a convenient tool to compare highly conserved non-human ESTs and human AS variants. The application takes human gene accession Ids or coordinates of genomic sequences as inputs and presents annotated gene structures and their AS variants. In addition, the lengths and
In this study, we employed in silico analysis to identify a panel of marker genes for NSCLC prognosis and assessment of therapy efficacy. Based on our experimental results, the National Cancer Institute-Cancer Genome Anatomy Project database and the Digital Gene Expression Displayer program are useful tools for identifying differentially expressed genes between two pools of samples provided that a sufficient number of expressed sequence tags libraries for the tissue of interest are archived in the database. The differentially expressed genes can be further developed into marker genes for diagnostic or prognostic purposes by experimental verification procedures such as real-time qPCR.. NSCLC is heterogeneous with respect to histology and biological characteristics (15). Individual NSCLC cells within a tumor and in different patients tumors express different amounts of marker gene transcripts. The heterogeneity of marker gene expression levels in NSCLC cells limits the reliability of an assay ...
Usage: fossil tag SUBCOMMAND ... Run various subcommands to control tags and properties. fossil tag add ?OPTIONS? TAGNAME CHECK-IN ?VALUE? Add a new tag or property to CHECK-IN. The tag will be usable instead of a CHECK-IN in commands such as update and merge. If the --propagate flag is present, the tag value propagates to all descendants of CHECK-IN Options: --raw Raw tag name. --propagate Propagating tag. --date-override DATETIME Set date and time added. --user-override USER Name USER when adding the tag. --dryrun,-n Display the tag text, but do not actually insert it into the database. The --date-override and --user-override options support importing history from other SCM systems. DATETIME has the form YYYY-MMM-DD HH:MM:SS. fossil tag cancel ?--raw? TAGNAME CHECK-IN Remove the tag TAGNAME from CHECK-IN, and also remove the propagation of the tag to any descendants. Use the the --dryrun or -n options to see what would have happened. fossil tag find ?OPTIONS? TAGNAME List all objects that ...
AceView provides a curated, comprehensive and non-redundant sequence representation of all public mRNA sequences (mRNAs from GenBank or RefSeq, and single pass cDNA sequences from dbEST and Trace). These experimental cDNA sequences are first co-aligned on the genome then clustered into a minimal number of alternative transcript variants and grouped into genes. Using exhaustively and with high quality standards the available cDNA sequences evidences the beauty and complexity of mammals transcriptome, and the relative simplicity of the nematode and plant transcriptomes. Genes are classified according to their inferred coding potential; many presumably non-coding genes are discovered. Genes are named by Entrez Gene names when available, else by AceView gene names, stable from release to release. Alternative features (promoters, introns and exons, polyadenylation signals) and coding potential, including motifs, domains, and homologies are annotated in depth; tissues where expression has been ...
The Pig Analysis Database presents accurate pig gene annotations in all sequenced genomic regions. It integrates various available pig sequence data, including 3.84 million whole-genome-shortgun (WGS) reads and 0.7 million Expressed Sequence Tags (ESTs) generated by Sino-Danish Pig Genome Project, and 1 million miscellaneous GenBank records. The Pig Analysis Database has covered nearly 50% of the whole pig genome and over 70% of the coding sequences (CDS), and aims to provide the most complete pig gene set to date.. In addition to gene annotations, the Pig Analysis Database also presents expressional information from 98 EST libraries, SNPs detected from both WGS reads and ESTs, oligos that can be used in microarray design and relevant evolutionary data.. Various views can be found here.. ...
To make an EST, RNA is isolated from cells and reverse transcribed into cDNA. Typically, the cDNA is cloned into a plasmid vector and a read is taken from the 5 and/or 3 primer. For most - but not all - ESTs, the reverse transcription is primed by an oligo-dT, which hybridizes with the poly-A tail of mature mRNA. The reverse transcriptase may or may not make it to the 5 end of the mRNA, which may or may not be degraded. In general, the 3 ESTs mark the end of transcription reasonably well, but the 5 ESTs may end at any point within the transcript. Some of the newer cap-selected libraries cover transcription start reasonably well. Before the cap-selection techniques emerged, some projects used random rather than poly-A priming in an attempt to retrieve sequence distant from the 3 end. These projects were successful at this, but as a side effect also deposited sequences from unprocessed mRNA and perhaps even genomic sequences into the EST databases. Even outside of the random-primed projects, ...
Hubbard T, Barker D, Birney E, Cameron G, Chen Y, Clark L, Cox T, Cuff J, Curwen V, Down T et al. The Ensembl genome database project. Nucleic Acids Res. 2002 Jan 1;30(1):38-41. PMID: 11752248; PMC: PMC99161 Pruitt KD, Harrow J, Harte RA, Wallin C, Diekhans M, Maglott DR, Searle S, Farrell CM, Loveland JE, Ruef BJ et al. The consensus coding sequence (CCDS) project: Identifying a common protein-coding gene set for the human and mouse genomes. Genome Res. 2009 Jul;19(7):1316-23. PMID: 19498102; PMC: PMC2704439 Pruitt KD, Tatusova T, Maglott DR. NCBI Reference Sequence (RefSeq): a curated non-redundant sequence database of genomes, transcripts and proteins. Nucleic Acids Res. 2005 Jan 1;33(Database issue):D501-4. PMID: 15608248; PMC: PMC539979 ...
STACK_PACK EST CLUSTERING MANAGEMENT AND ANALYSIS TOOL-SUITE now available SANBI announces the free academic availability of the STACK_PACK EST clustering management and analysis tool-suite. STACK_PACK 1.0 has been developed by SANBI in collaboration with Electric Genetics, Cape Town (PTY) LTD, to support analysis of the increasing EST load for Gene Discovery. The tool-suite interchangeably supports modules such as PHRAP and other assemblers, and includes D2-cluster and CRAW together with other codes specifically developed for the system. STACK_PACK manages flow and stringent analysis of data between these applications. The system creates two outputs: a standard data set as well as a more highly-qualified data subset based upon consensus quality. Alternate splicing and low quality EST consensi are also detected and processed. This system has been used to manufacture STACK, the sequence tag alignment and consensus knowledgebase which is also distributed by SANBI. ...
Nor does this list include all approved institution tags. Our practice on tags for institutions, organizations, named projects, and so on, is in flux. We have tags for some but not all publishers; some but not all universities; some but not all societies; some but not all named projects, and so on. The reason we have some is that some are major players who come up a lot. The reason we dont have all, or dont aspire to have all, is that there are thousands of them. We dont even have a principle or firm border line to help distinguish those that do and dont have tags, or those that should and shouldnt. Bottom line: Feel free to create a tag for any institution, organization, project, and so on. On the other hand, if the institution, organization, or project is mentioned in your description, then users can still find those tag records with keyword searches, even if they cant find them with tag searches; hence feel free to avoid creating or using tags for them ...
Shop for Estée Lauder Personal Care and read product reviews. Find cheap prices on Estée Lauder Personal Care from a selection of brands and stores .
brain, neuroblastoma, non-normalized, cell line, EST, unknown developmental stage, MGC, Rubin non-normalized, size fractionated, plasmid vector, directionally cloned, oligo-dT ...
There is no tag wiki for this tag … yet! Tag wikis help introduce newcomers to the tag. They contain an overview of the topic defined by the tag, along with guidelines on its usage. All registered users may propose new tag wikis. (Note that if you have less than 20000 reputation, your tag wiki will be peer reviewed before it is published.) ...
There is no tag wiki for this tag … yet! Tag wikis help introduce newcomers to the tag. They contain an overview of the topic defined by the tag, along with guidelines on its usage. All registered users may propose new tag wikis. (Note that if you have less than 20000 reputation, your tag wiki will be peer reviewed before it is published.) ...
There is no tag wiki for this tag … yet! Tag wikis help introduce newcomers to the tag. They contain an overview of the topic defined by the tag, along with guidelines on its usage. All registered users may propose new tag wikis. (Note that if you have less than 20000 reputation, your tag wiki will be peer reviewed before it is published.) ...
There is no tag wiki for this tag … yet! Tag wikis help introduce newcomers to the tag. They contain an overview of the topic defined by the tag, along with guidelines on its usage. All registered users may propose new tag wikis. (Note that if you have less than 4000 reputation, your tag wiki will be peer reviewed before it is published.) ...
There is no tag wiki for this tag … yet! Tag wikis help introduce newcomers to the tag. They contain an overview of the topic defined by the tag, along with guidelines on its usage. All registered users may propose new tag wikis. (Note that if you have less than 4000 reputation, your tag wiki will be peer reviewed before it is published.) ...
Lib=934[Homo_sapiens,prostate,prostatic_intraepithelial_neoplasia_- _high_grade,,,adult] Length=234 Length = 234 Plus Strand HSPs: Score = 156 (23.4 bits), Expect = 1.4, P = 0.76 Identities = 82/128 (64%), Positives = 82/128 (64%), Strand = Plus / Plus Query: 225 TGGGAATAAAATT-CTA-AGTGAATACATAAAGAAATTAAAAGAAACTACAGNATCATTA 282 TGG AA AA ATT CT A TG TACATAAAGAAATT A GAAA T AT TT Sbjct: 76 TGGTAACAACATTTCTTCAATGT-TACATAAAGAAATTGAGGGAAATTTTGCAATACTTG 134 Query: 283 AGATTACCAAAATTTA-CATGGACAACTA--CACTTG-ATCTTGTGCAAACATCGACATC 338 G TTACC TTTA C TGGACA A CACT G AT T GC AC T G CA C Sbjct: 135 GGGTTACCTT--TTTATCTTGGACAGTGATCCACTAGTATATCAGGCTGACCTAGTCAAC 192 Query: 339 TA-TGGGTATT 348 T TGG TATT Sbjct: 193 TGGTGGCTATT 203 cbil,dbest,162347>>cbil,dbest,162347 T92226 ye17e11.r1 5 Lib=249[Homo_sapiens,lung,,,,72_years] Length=245 Length = 245 Plus Strand HSPs: Score = 146 (21.9 bits), Expect = 4.6, P = 0.99 Identities = 54/80 (67%), Positives = 54/80 (67%), Strand = Plus / Plus Query: 212 ...
Both examples act differently because the data inside the tags are parsed differently according to the tag type. Now, imagine the parser goes from left to right. In the first case, after entering the div tag, the parser stays as html and opens an a tag with the title attribute (because the closing div tag is text in an attribute, it will not close the tag).. In the second case, when the parser enters the style tag, it changes to CSS parser, which means no a tag is created, and the style tag will be closed where the attribute was supposed to be.. So, how can this information help us in finding vulnerabilities? Imagine a tag that parses differently in different cases, for example, the noscript tag. The trick here is that the noscript tag in HTML is treated differently, whether JavaScript (JS) is enabled or disabled. When JS is enabled, the data inside the tag is parsed as JS. But, when its disabled, the data is parsed as html. In nearly all cases, JS is enabled in browsers.. Lets take a look ...
Lib=9[Plasmodium_falciparum,,,,,] Length=346 Length = 346 Plus Strand HSPs: Score = 184 (27.6 bits), Expect = 0.028, P = 0.028 Identities = 130/206 (63%), Positives = 130/206 (63%), Strand = Plus / Plus Query: 22 TTACA-ATATTTTGTGAATAAACTTTTTGGTGATTTGCCATCAAGTTTTAATTATATGAT 80 TTA A AT TTTTGTGA T A TT TG T TG A AAG AATT T GA Sbjct: 4 TTATACATCTTTTGTGATTTAGGTTAAAA-TG-TATGTTA--AAGAAGAAATTGTG-GAG 58 Query: 81 -AGGCAAAACGATA-GAG-T-ATGA-TATAAAGATTAGTTATTATGAAATATATGAAGGG 135 A G AAAAC AT GA T AT A TA AAAGA AG A AT AAATATATGAA GG Sbjct: 59 GAAGAAAAACTATCTGATATTATCAATAAAAAGAA-AGAAAACATAAAATATATGAAAGG 117 Query: 136 CATGNTAAAAATGGTGAAGAGGTTTGTGT-ATTT-ATATATGAGAAGAA--TAATAAAGA 191 ATG AAAA T TGAA A TT G ATTT A A TGA A GAA TA T A GA Sbjct: 118 AATG--AAAATTCCTGAAAATATTCTAGCCATTTCAAACTTGA-AGGAAGTTATTGATGA 174 Query: 192 AACGAGTTTTGTAAAANGATATATAAA-ACNCCATT 226 C AG TTTGT AA T TAT A AC CCA T Sbjct: 175 TGC-AGATTTGTTAATATTTGTATTACCACACCAAT 209 cbil,dbest,1133595>>cbil,dbest,1133595 AA488925 aa55b10.r1 5 ...
Hi i have created several div tags and the corresponding css ids and am having a problem with creating a final tag that will house 3 individual div tags. the problem tag is the #selection tag. i...
In gene expression when exposed to CO2 elevated to 560 mmolmol21. The expression of 4600 expressed sequence tags in poplar have been investigated by Gupta et
The most important resource in your organization is your People. Labor Efficiency Ratio tool discovers if have the right people, doing the right things right?
标签蛋白的表达是研究目标蛋白的一种重要办法。而这个可能会影响到蛋白结构和功能研究的蛋白标签往往需要被去除。该视频介绍了几种用于标签蛋白柱上酶切的试剂,以及在使用过程中的一些小技巧。. The expression of tagged proteins is the major source of proteins for research purposes. It is often recommended to remove the tag, which might otherwise interfere with protein function or interactions. This video will give you some examples of automated on-column tag removal with different cleavage agents ...
HRP偶联6X His tag®抗体(ab1269)经WB, ELISA, ICC实验严格验证,被3篇文献引用并得到3个独立的用户反馈,实验条件参看说明书。中国75%以上现货。
Get your new Doctor luggage tags from Zazzle. Choose any of our great designs for your bag tag and help your luggage stand out. Start shopping today!
HA tag兔多克隆抗体(ab75640)经WB, IP实验严格验证,被1篇文献引用。中国75%以上现货,所有产品均提供质保服务,可通过电话、电邮或微信获得本地专属技术支持。
The public EST (expressed sequence tag) databases represent an enormous but heterogeneous repository of sequences, including many from a broad selection of
Transcriptome analysis can provide useful data for refining genome sequence annotation. Application of massively parallel signature sequencing (MPSS) revealed reproducible transcription, in multiple MPSS cycles, from 73% of computationally predicted genes in the Theileria parva schizont lifecycle stage. Signatures spanning consecutive exons confirmed 142 predicted introns. MPSS identified 83 putative genes, , 100 codons overlooked by annotation software, and 139 potentially incorrect gene models (with either truncated ORFs or overlooked exons) by interfacing signature locations with stop codon maps. Twenty representative models were confirmed as likely to be incorrect using reverse transcription PCR amplification from independent schizont cDNA preparations. More than 50% of the 60 putative single copy genes in T. parva that were absent from the genome of the closely related T. annulata had MPSS signatures. This study illustrates the utility of MPSS for improving annotation of small, gene-rich ...
TY - JOUR. T1 - Annotation and analysis of 10,000 expressed sequence tags from developing mouse eye and adult retina.. AU - Yu, Jindan. AU - Farjo, Rafal. AU - MacNee, Sean P.. AU - Baehr, Wolfgang. AU - Stambolian, Dwight E.. AU - Swaroop, Anand. N1 - Copyright: This record is sourced from MEDLINE®/PubMed®, a database of the U.S. National Library of Medicine. PY - 2003. Y1 - 2003. N2 - BACKGROUND: As a biomarker of cellular activities, the transcriptome of a specific tissue or cell type during development and disease is of great biomedical interest. We have generated and analyzed 10,000 expressed sequence tags (ESTs) from three mouse eye tissue cDNA libraries: embryonic day 15.5 (M15E) eye, postnatal day 2 (M2PN) eye and adult retina (MRA). RESULTS: Annotation of 8,633 non-mitochondrial and non-ribosomal high-quality ESTs revealed that 57% of the sequences represent known genes and 43% are unknown or novel ESTs, with M15E having the highest percentage of novel ESTs. Of these, 2,361 ESTs ...
Little information is available on gene expression profiling of halophyte A. canescens. To elucidate the molecular mechanism for stress tolerance in A. canescens, a full-length complementary DNA library was generated from A. canescens exposed to 400 mM NaCl, and provided 343 high-quality ESTs. In an evaluation of 343 valid EST sequences in the cDNA library, 197 unigenes were assembled, among which 190 unigenes (83.1% ESTs) were identified according to their significant similarities with proteins of known functions. All the 343 EST sequences have been deposited in the dbEST GenBank under accession numbers JZ535802 to JZ536144. According to Arabidopsis MIPS functional category and GO classifications, we identified 193 unigenes of the 311 annotations EST, representing 72 non-redundant unigenes sharing similarities with genes related to the defense response. The sets of ESTs obtained provide a rich genetic resource and 17 up-regulated genes related to salt stress resistance were identified by qRT-PCR.
dbEST is a division of GenBank that contains sequence data and other information on single-pass cDNA sequences, or Expressed Sequence Tags, from a number of organisms. Expressed Sequence Tags (ESTs) are short (usually about 300-500 bp), single-pass sequence reads from mRNA (cDNA). Typically they are produced in large batches. They represent a snapshot of genes expressed in a given tissue and/or at a given developmental stage. They are tags (some coding, others not) of expression for a given cDNA library. Most EST projects develop large numbers of sequences. These are commonly submitted to GenBank and dbEST as batches of dozens to thousands of entries, with a great deal of redundancy in the citation, submitter and library information. To improve the efficiency of the submission process for this type of data, we have designed a special streamlined submission process and data format. dbEST also includes sequences that are longer than the traditional ESTs, or are produced as single sequences or ...
Citation: Vogel, J.P., Gu, Y.Q., Twigg, P., Lazo, G.R., Chingcuanco, D.L., Hayden, D.M., Donze, T., Vivia-Lindsay, A., Stamova, B., Coleman-Derr, D. 2006. EST sequencing and phylogenetic analysis of the model grass brachypodium distachyon. Theoretical and Applied Genetics. 113: 186-195. Interpretive Summary: Brachypodium distachyon is a small grass that serves as a model system for the temperate grasses (i.e. forage grasses and cereals). Expressed sequence tags (ESTs) are short DNA sequences from random cDNAs (genes). ESTs are useful tools for many functional and physical genomic experiments including the construction of microarrays and the development of molecular markers. This paper describes the sequencing of a large collection of ESTs from five different cDNA libraries. Analysis of the ESTs included the identification of putative lignin biosynthetic genes and the construction of phylogentic trees that demonstrated the close relationship of Brachypodium to wheat and barley. Technical ...
Expressed sequence tags (EST) are potential source for the development of genic microsatellite markers, gene discovery, comparative genomics, and other genomic studies. In the present study, 7630 ESTs were examined from NCBI for SSR identification and characterization. A total of 263 SSRs were identified with an average density of one SSR/4.2 kb (3.4% frequency). Analysis revealed that trinucleotide repeats (47.52%) were most abundant followed by tetranucleotide (19.77%), dinucleotide (19.01%), pentanucleotide (9.12%), and hexanucleotide repeats (4.56%). Functional annotation was done through homology search and gene ontology, and 35 EST-SSRs were selected. Primer pairs were designed for evaluation of cross transferability and polymorphism among 11 plants belonging to five different families. Total 402 alleles were generated at 155 loci with an average of 2.6 alleles/locus and the polymorphic information content (PIC) ranged from 0.15 to 0.92 with an average of 0.75.
Despite advances in sequencing technology, we are still a long way from having well-annotated genome sequences for all organisms of interest. Instead, EST (Expressed Sequence Tag) data is available for less popular organisms in many cases, prior to a genome project. EST data presents a particular challenge for the identification of proteins using mass spectrometry (MS): it is often redundant (multiple copies of the same gene), consists primarily of short fragments of coding sequence, contains many sequencing errors and is generally poorly annotated. Nevertheless, generating EST libraries represents a much cheaper alternative to full genome sequence and has the advantage of focusing on the parts of the genome of interest to proteomics, i.e. the expressed genes, many of which will be protein-coding. The School of Biological Sciences, Centre for Proteomic Research and the National Oceanography Centre, Southampton have been collaborating to develop bioinformatics analysis tools to help clean up the ...
In genetics, an expressed sequence tag (EST) is a short sub-sequence of a cDNA sequence. ESTs may be used to identify gene transcripts, and are instrumental in gene discovery and in gene-sequence determination. The identification of ESTs has proceeded rapidly, with approximately 74.2 million ESTs now available in public databases (e.g. GenBank 1 January 2013, all species). An EST results from one-shot sequencing of a cloned cDNA. The cDNAs used for EST generation are typically individual clones from a cDNA library. The resulting sequence is a relatively low-quality fragment whose length is limited by current technology to approximately 500 to 800 nucleotides. Because these clones consist of DNA that is complementary to mRNA, the ESTs represent portions of expressed genes. They may be represented in databases as either cDNA/mRNA sequence or as the reverse complement of the mRNA, the template strand. One can map ESTs to specific chromosome locations using physical mapping techniques, such as ...
Siamese mud carp (Henichorynchus siamensis) is a freshwater teleost of high economic importance in the Mekong River Basin. However, genetic data relevant for delineating wild stocks for management purposes currently are limited for this species. Here, we used 454 pyrosequencing to generate a partial genome survey sequence (GSS) dataset to develop simple sequence repeat (SSR) markers from H. siamensis genomic DNA. Data generated included a total of 65,954 sequence reads with average length of 264 nucleotides, of which 2.79% contain SSR motifs. Based on GSS-BLASTx results, 10.5% of contigs and 8.1% singletons possessed significant similarity (E value | 10-5) with the majority matching well to reported fish sequences. KEGG analysis identified several metabolic pathways that provide insights into specific potential roles and functions of sequences involved in molecular processes in H. siamensis. Top protein domains detected included reverse transcriptase and the top putative functional transcript identified
At PlantGDB, efforts are undertaken to identify and remove all contaminant DNA so that a clean dataset is made available to researchers. Here, we use the Vmatch program (with options -l 50 -identity 90) to screen EST sequences against UniVec for vector contaminations as well as against E. coli genomes for bacterial sequences contaminations. The table lists the individual contaminated sequence. (Return to Vector Contamination menu). ...
1 #include ,graphics.h, 2 3 #include ,iostream.h, 4 #include ,math.h, 5 #include ,dos.h, 6 #include ,conio.h, 7 8 void main( ) 9 { 10 float x, y, x1, y1, x2, y2, dx, dy, step; 11 int i, gd = DETECT, gm; 12 initgraph(&gd, &gm, C:\\TURBOC3\\BGI); 13 14 cout ,, Enter the value of x1 and y1 : ; 15 cin ,, x1 ,, y1; 16 cout ,, Enter the value of x2 and y2: ; 17 cin ,, x2 ,, y2; 18 19 dx = (x2 - x1); 20 dy = (y2 - y1); 21 if(abs(dx) ,= abs(dy)) 22 step = abs(dx); 23 else 24 step = abs(dy); 25 dx = dx / step; 26 dy = dy / step; 27 x = x1; 28 y = y1; 29 i = 1; 30 while(i ,= step) { 31 putpixel(x, y, 5); 32 x = x + dx; 33 y = y + dy; 34 i = i + 1; 35 delay(100); 36 } 37 getch(); 38 closegraph(); 39 } ...
Major recent improvements in biotechnology have led to an accelerated production of DNA sequences. The completion of the human genome sequence, along with the genomes of more than two hundred other species, has marked the arrival of the genome era. The ultimate goal is to understand the structure and function of genomes and their genes. This thesis has focused on the computational analysis of complementary DNA (cDNA) sequences. These are copies of mRNA transcripts that correspond to the coding regions of genomes.. Studying the expression patterns of genes is essential for understanding gene function. Many gene expression profiling techniques generate short sequence tags that derive from transcripts. A pilot study was performed to assess the feasibility of using the pyrosequencing platform for gene expression analysis. The sequences generated by pyrosequencing in most cases (≈ 85%) were long enough (, 18 nucleotides) to uniquely identify the corresponding transcripts through database searches. ...
Animals and Treatments. All animal experiments and treatments were reviewed and approved by the Research Animal Resource Center at the University of Wisconsin or by the appropriate oversight department of submitting institutions. Institutions, strains, sex, ages, treatment vehicle, circadian time, and route of administration are recorded for all experiments and can be found for each experiment at the EDGE Web site.. Expressed Sequence Tag Libraries. Poly-A mRNA was isolated from total RNA via the Oligotex kit (QIAGEN, Valencia, CA). Construction of expressed sequence tag (EST) libraries was typically performed by using the cDNA Timesaver kit (Amersham Biosciences Inc., Sunnyvale, CA). In brief, 5 μg of poly-A was used to generate first strand cDNA with an anchored poly-T oligonucleotide [dT(18)-N] that also contained a NotI-specific restriction site. First strand cDNA was then purified via a phenol/chloroform extraction. After second strand synthesis, cDNA was again purified using ...
abstract = {A novel mosquito antimicrobial peptide, gambicin, and the corresponding gene were isolated in parallel through differential display-PCR, an expressed sequence tag (EST) project, and characterization of an antimicrobial activity in a mosquito cell line by reverse-phase chromatography. The 616-bp gambicin ORF encodes an 81-residue protein that is processed and secreted as a 61-aa mature peptide containing eight cysteines engaged in four disulfide bridges. Gambicin lacks sequence homology with other known proteins. Like other Anopheles gambiae antimicrobial peptide genes, gambicin is induced by natural or experimental infection in the midgut, fatbody, and hemocyte-like cell lines. Within the midgut, gambicin is predominantly expressed in the anterior part. Both local and systemic gambicin expression is induced during early and late stages of natural malaria infection. In vitro experiments showed that the 6.8-kDa mature peptide can kill both Gram-positive and Gram-negative bacteria, has ...
Multimeric protein complexes have a role in many cellular pathways and are highly interconnected with various other proteins. The characterization of their domain composition and organization provides useful information on the specific role of each region of their sequence. We identified a new module, the PAM domain (P CI/PINT a ssociated m odule), present in single subunits of well characterized multiprotein complexes, like the regulatory lid of the 26S proteasome, the COP-9 signalosome and the Sac3-Thp1 complex. This module is an around 200 residue long domain with a predicted TPR-like all-alpha-helical fold. The occurrence of the PAM domain in specific subunits of multimeric protein complexes, together with the role of other all-alpha-helical folds in protein-protein interactions, suggest a function for this domain in mediating transient binding to diverse target proteins.
EST). A short partial sequence, typically 200-400 bp long, of a complementary DNA (cDNA) clone. Because cDNAs are prepared by reverse transcription of messenger RNA molecules, ESTs act as markers for genes that are expressed in particular tissues or organs. EST sequence data are held on databases, and researchers use computer programs to search for sequences that correspond to, say, a partial amino-acid sequence for a protein under investigation. The EST sequence can then be used to construct a DNA probe to locate the respective clone from a DNA library. ...
Hsiang, T. and P.H. Goodwin. 2003. Distinguishing plant and fungal sequences in ESTs from infected plant tissues. Journal of Microbiological Methods 54:339-351. Expressed sequence tags (ESTs) from fungal-infected plant tissues are composed of a mixture of plant and fungal sequences. Using freely available software and tools, a novel procedure is described for distinguishing plant and fungal DNA sequences. Although the GenBank non-redundant database is larger and therefore one would presume that BLASTX analysis of it would be more accurate, superior resolution of 700 randomly selected fungal ESTs was found with Standalone TBLASTX analyses with a local matching database composed of a plant and a fungal genome. Standalone TBLASTX analyses of 3983 ESTs from nine different fungal-infected plant EST libraries also proved to be superior in identifying the origin of sequences as either plant or fungal compared to GenBank BLASTX analysis. Standalone TBLASTX with a matching database comprised of a single ...
Mon choix dun puerh cru ancien en vrac a pour but de me faire voyager dans le temps et de retourner en enfance, quand les Noëls étaient magiques et dune joie innocente sans faille. Ce nest pas tant que cétait mieux autrefois, mais que cétait plus simple de croire au père Noël, aux anges qui annoncent Jésus aux bergers... quand on est enfant que quand on est adulte. La dégustation dun puerh vieux et si pur et si délicieux est un petit miracle qui ouvre la porte à limagination. En plus, jai la parfaite théière pour loccasion: une Yixing antique (fin de la dynastie Qing) en forme de buche! Elle est décorée de fleurs de prunus (symbole de résistance à lhiver) et sa décoration avec des émaux de couleur (falangcai) vert, jaune, bleu et rose convient assez à le décoration bariolée de Noël. Mais surtout, cette théière a une glaise zisha fine, assez poreuse, légèrement sous cuite qui arrondit et intensifie bien le goût du puerh cru ancien ...
De Novo Characterization of Flower Bud Transcriptomes and the Development of EST-SSR Markers for the Endangered Tree Tapiscia sinensis. . Biblioteca virtual para leer y descargar libros, documentos, trabajos y tesis universitarias en PDF. Material universiario, documentación y tareas realizadas por universitarios en nuestra biblioteca. Para descargar gratis y para leer online.
p,Transcript Support Level 1, when transcripts are supported by at least one non-suspect mRNA.,/p,,p,The ,a href=https://genome.ucsc.edu/cgi-bin/hgc?hgsid=423831555_sqRhAapgi8atmzzBPBAz8Me5797J&c=chr14&o=94517268&t=94547548&g=wgEncodeGencodeCompV19&i=ENST00000544005.1#tsl target=_self,Transcript Support Level,/a, (TSL) is a method to highlight the well-supported and poorly-supported transcript models for users. The method relies on the primary data that can support full-length transcript structure: mRNA and EST alignments supplied by UCSC and Ensembl.,/p,TSL:1The GENCODE set is the gene set for human and mouse. ,a href=/Help/Glossary?id=500 class=popup,GENCODE Basic,/a, is a subset of representative transcripts (splice variants).GENCODE basic,p,PRINCIPAL1 - APPRIS candidate principal isoform.,/p,,p,,a class=popup href=/Homo_sapiens/Help/Glossary?id=521,APPRIS,/a, is a system to annotate alternatively spliced transcripts based on a range of computational methods.,/p,APPRIS P1 ...
ARTICLE. Ayoubi P, Jin X, Leite S, Liu X, Martajaja J, Abduraham A, Wan Q, Yan W, Misawa E and Prade R 2002 PipeOnline 2.0: Automated EST Processing and Functional Data Sorting Nucleic Acid Research 30: 4761-4769. Expressed sequence tags (ESTs) are generated and deposited in the public domain, as redundant, un-annotated, single-pass reactions, with virtually no biological content. PipeOnline automatically analyses and transforms large collections of raw DNA-sequence data from chromatograms or FASTA files by calling the quality of bases, screening and removing vector sequences, assembling and rewriting consensus sequences of redundant input files into a unigene EST data set and finally through translation, amino acid sequence similarity searches, annotation of public databases and functional data. PipeOnline generates an annotated database, retaining the processed unigene sequence, clone/file history, alignments with similar sequences, and proposed functional classification, if available. ...
p,Transcript Support Level 1, when transcripts are supported by at least one non-suspect mRNA.,/p,,p,The ,a href=https://genome.ucsc.edu/cgi-bin/hgc?hgsid=423831555_sqRhAapgi8atmzzBPBAz8Me5797J&c=chr14&o=94517268&t=94547548&g=wgEncodeGencodeCompV19&i=ENST00000544005.1#tsl target=_self,Transcript Support Level,/a, (TSL) is a method to highlight the well-supported and poorly-supported transcript models for users. The method relies on the primary data that can support full-length transcript structure: mRNA and EST alignments supplied by UCSC and Ensembl.,/p,TSL:1The GENCODE set is the gene set for human and mouse. ,a href=/Help/Glossary?id=500 class=popup,GENCODE Basic,/a, is a subset of representative transcripts (splice variants).GENCODE basic,p,PRINCIPAL1 - APPRIS candidate principal isoform.,/p,,p,,a class=popup href=/Homo_sapiens/Help/Glossary?id=521,APPRIS,/a, is a system to annotate alternatively spliced transcripts based on a range of computational ...
All ESTs in GenBank on the date of the track data freeze for the given organism are used - none are discarded. When two ESTs have identical sequences, both are retained because this can be significant corroboration of a splice site.. ESTs are aligned against the genome using the Blat program. When a single EST aligns in multiple places, the alignment having the highest base identity is found. Only alignments that have a base identity level within a selected percentage of the best are kept. Alignments must also have a minimum base identity to be kept. For more information on the selection criteria specific to each organism, consult the description page accompanying the EST track for that organism.. The maximum intron length allowed by Blat is 500,000 bases, which may eliminate some ESTs with very long introns that might otherwise align. If an EST aligns non-contiguously (i.e. an intron has been spliced out), it is also a candidate for the Spliced EST track, provided it meets various quality ...
All ESTs in GenBank on the date of the track data freeze for the given organism are used - none are discarded. When two ESTs have identical sequences, both are retained because this can be significant corroboration of a splice site.. ESTs are aligned against the genome using the Blat program. When a single EST aligns in multiple places, the alignment having the highest base identity is found. Only alignments that have a base identity level within a selected percentage of the best are kept. Alignments must also have a minimum base identity to be kept. For more information on the selection criteria specific to each organism, consult the description page accompanying the EST track for that organism.. The maximum intron length allowed by Blat is 500,000 bases, which may eliminate some ESTs with very long introns that might otherwise align. If an EST aligns non-contiguously (i.e. an intron has been spliced out), it is also a candidate for the Spliced EST track, provided it meets various quality ...
The high frequency of alternative splicing among plant Serine/Arginine-rich (SR) family of proteins has been linked to important roles in gene regulation during development and in response to environmental stress. In this report, the genomes of maize and sorghum have been searched and the manual annotation of all the SR proteins have been performed. The experimental validation of gene structure by RT-PCR analysis revealed, with few exceptions, that SR genes produced multiple isoforms of transcripts by alternative splicing. Despite sharing high structural similarity and conserved positions of the introns, alternative splicing profiles of vast majority of SR genes are not conserved between maize and sorghum. These include many transcript isoforms discovered by RT-PCR and not represented in extant EST collection. The occurrence of several isoforms of maize and sorghum SR mRNAs have been determined and that these isoforms display evolutionary conservation of splicing events with their homologous SR ...
Global Animal Tag Supplier Directory, Animal Tag, Animal Tag Manufacturers, Animal Tag Factories, Animal Tag Manufacturing, Animal Tag Manufacturer, Factory,Animal Tag Export Company, Animal Tag Suppliers, Exporters, Animal Tag Producers, Wholesalers, Distributors, International Animal Tag, OEM Animal Tag, Agriculture.
Global Animal Tag Supplier Directory, Animal Tag, Animal Tag Manufacturers, Animal Tag Factories, Animal Tag Manufacturing, Animal Tag Manufacturer, Factory,Animal Tag Export Company, Animal Tag Suppliers, Exporters, Animal Tag Producers, Wholesalers, Distributors, International Animal Tag, OEM Animal Tag, Agriculture.
Transcriptome profiling and digital gene expression are tewo examples that illustrate the power of NGS. For a few thousand dollars, a single run of a SOLiD or Illumina sequencer can produce more ESTs (Expressed Sequence Tags) than exist in all of dbEST. Even more striking is that the data in dbEST were collected over many years and 100s million dollars were invested in getting the sequences. Also, it is important to understand that the data in dbEST represent only a relatively small number of molecules from a broad range of organisms and tissues. While dbEST has been useful for providing a glimpse into the complex nature of gene expression and, in the case of human, mouse and a few other organisms, mapping a reasonable number of genes, the resource is unable to provide the deeper details and insights into alternative splicing, antisense transcription, small RNA expression, and allelic variation that can only be achieved when a cells complement of RNA is sampled deeply. As recent literature ...
We use cookies to ensure that we give you the best experience on our website. If you click Continue we will assume that you are happy to receive all cookies and you will not see this message again. Click Find out more for information on how to change your cookie settings ...
You can often find vector information at NCBI, either directly or in their list of vectors screened for contamination of new sequence at Vecscreen. VectorDB contains information about many common vectors, including yeast vectors. The EMBL Hamburg outstation maintains a large database of vectors. I.M.A.G.E. Consortium Vectors contains information about plasmids commonly used in EST collections such as those sold by OpenBioSystems and Invitrogen. For eukaryotic vectors (Fish, Xenopus) see Minnesota. The Forsburg Lab maintains a list of Fisson Yeast vectors. Promega maintains a list of their vectors. NEB maintains a list of common vectors. Epicentre also maintains its own list. Lucigen provides transcription-free vectors for cloning AT-rich and other difficult DNAs. Addgenes Vector DB contains most of the information from Stanfords VectorDB, plus more vector information they have curated from commercial websites and added through our plasmid curation efforts. (However, it seems to be rather ...
So its still a shotgun-style technique, and the problem has been getting long enough read lengths to assemble the pieces into a whole sequence. Think of it like a jigsaw puzzle. The smaller the pieces are, the more you have that look identical, and the harder it is to figure out where to put them. Given 3 x 109 bases in the human genome, youd need a read length of about 17 base pairs to be certain of ending up with all different pieces. They report average read lengths of 23 bp, with each individual sequence chunk represented about 150 times, and every part of the genome represented. This allows them to keep the error rate low enough that they could sequence different strains of the virus, and reliably pick up the genomic differences between the two. The paper doesnt say how long this takes, but their marketing material says the process takes only one day.. The technique as practiced by Helicos has one major drawback, however, that will limit how low it can take the cost/base. It requires ...
After switching from Preview to Show All Tags view composer has what appears to be a second body tag (actually a graphic relic) showing in the show all tags view. Build: 2001091003 Reproducibility: Everytime Steps to Reproduce: 1.Open Composer 2.Switch to Preview view 3.Switch to Show All Tags view Actual Results: A second body tag will appear to show up behind the real one. This is not a real body tag but something that appears there. Expected Results: I would expect that only one body tag would appear no matter what view I switch from ...
Please be a careful not to add a redundant tag.. You can label this presentation with either an existing tag or a new tag. To add an existing tag, simply chose the appropriate one from the drop down menu below on the left. Or, to add a new tag, enter it in the box on the right. Then click Add Tag. Before creating a new tag, please check the menu on the left to see if that tag already exists! ...