Biology Assignment Help, Heliozoans - protozoan, Heliozoans - Protozoan Heliozoans are spherical protozoan that occur in the sea or in still bodies of fresh water. They are mainly located in the bottom debris. Fine needle like pseudopodia radiate from the surface of the body. These are known a
Life Science: Protists -eukaryotic micro-organisms whose cells have a nucleus. Text book summary notes with links to a related rap song, free mp3 download, & lyrics.
Since protozoa are eukaryotic organisms, they contain vacuoles, a cell membrane and all the other cellular machinery found in the cells of plants, fungi, animals and other eukaryotes. For example, protozoa use their cell membrane and vacuoles for food absorption and digestion. Their cell membranes assist in the engulfing of food and their vacuoles can give off useable nitrogen during digestion. Generally, protozoa feed on other organic matter, bacteria, fungi and other protozoans in some cases.. Protozoa are not a huge concern when it comes to human illnesses because they are usually harmless. With this being said however, protozoa are the cause of malaria and dysentery. Malaria is a disease transmitted by mosquitoes, but these infected mosquitoes carry a microorganism from the genus Plasmodium, in which five specific species are infectious. Protozoa are truly remarkable microorganisms. They are capable of reproducing by the process of fission, they can move in a variety of ways despite having ...
Pterocystis heliozoan. Coloured scanning electron micrograph (SEM) of Pterocystis a freshwater protozoan. This single-celled organism has many projections, known as axopods, radiating from its cell body. The axopods are used to capture prey and for movement. In this species the axopods are funnel shaped. Magnification: x 3000 when printed at 10cm wide. Specimen collected from Vietnam courtesy of Mike Allen, Plymouth Marine Laboratory. - Stock Image C036/0565
Light microscopy of two heliozoa (white), with extended axopods radiating from their cell surface. Heliozoa are amoeba-like protozoa common in all aquatic environments. The axopods aid them in detecting and engulfing prey, which they do by phagocytosis. Filmed with Darkfield illumination. - Stock Video Clip K003/3275
3. The process of phagocytosis. The above motivated me to document the process of eating more thoroughly. Timelapse photography is a productive method of doing this and studying heliozoans in general. For this, I used the Lapseit app on my phone. Some of these timelapse movies were recorded overnight: I kept the foldscope right next to where I sleep to make adjustments if the organism went past the field of view. It is fascinating to see how prey pierced by the Actinosphaerium is taken up into the endoplasm. It is almost as though the spines melt away to bring the prey closer to the center. The key molecular component involved in this process are microtubules that assemble and disassemble based on the requirements. The process is fascinating to watch ...
Changes in the structure and composition of a protistan community were characterized through the analysis of small-subunit ribosomal RNA gene (18S) sequences for a 3-day bottle incubation using a single sample collected in the western North Atlantic. Cloning and sequencing was used to investigate changes in perceived species richness and diversity as a consequence of environmental perturbation. The treatments included a control (unamended seawater), inorganic nutrient enrichment, and enrichment with a complex organic mixture. Five clone libraries were constructed and analyzed at the time of collection (t-0 h) and after 24 (t-24 h) and 72 (t-72 h) h for the control, and at t-72 h for the inorganic and organic enrichments, resulting in an analysis of 1,626 partial 18S rDNA sequences that clustered into 238 operational taxonomic units (OTUs). Analysis of the clone libraries revealed that protistan assemblages were highly dynamic and changed substantially at both the OTU level and higher taxonomic ...
The origin of eukaryotes stands as a major conundrum in biology1. Current evidence indicates that the last eukaryotic common ancestor already possessed many eukaryotic hallmarks, including a complex subcellular organization1, 2, 3. In addition, the lack of evolutionary intermediates challenges the elucidation of the relative order of emergence of eukaryotic traits. Mitochondria are ubiquitous organelles derived from an alphaproteobacterial endosymbiont4. Different hypotheses disagree on whether mitochondria were acquired early or late during eukaryogenesis5. Similarly, the nature and complexity of the receiving host are debated, with models ranging from a simple prokaryotic host to an already complex proto-eukaryote1, 3, 6, 7. Most competing scenarios can be roughly grouped into either mito-early, which consider the driving force of eukaryogenesis to be mitochondrial endosymbiosis into a simple host, or mito-late, which postulate that a significant complexity predated mitochondrial ...
Genomics and Evolution of Eukaryotic Microbes synthesizes the rapidly emerging fields of eukaryotic diversity and genome evolution. Eukaryotes, cells with nuclei, evolved as microbes and have existed on Earth for approximately two billion years. The tremendous diversity of eukaryotic microbes (protists) is often overlooked by those who study the macroscopic eukaryotic lineages: plants, animals, and fungi.
Citation: Eukaryota (unknown) Deep-Sea Guide (DSG) at http://dsg/mbari.org/dsg/view/concept/Eukaryota. Monterey Bay Aquarium Research Institute (MBARI). Consulted on 2018-09-20. ...
Lineage: cellular organisms; Eukaryota; Opisthokonta; Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Saccharomycetes; Saccharomycetales; Saccharomycetaceae; Saccharomyces; Saccharomyces ...
Lineage: cellular organisms; Eukaryota; Opisthokonta; Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Saccharomycetes; Saccharomycetales; Saccharomycetaceae; Saccharomyces; Saccharomyces ...
Taxonomic hierarchy of Superkingdom Eukaryota Whittaker & Margulis, 1978. Display of synonyms, alternative taxonomic positions, references, number of subtaxa, and phylogenetic/bibliographic position can be switched on/off. Subtaxa can be ordered by name or phylogenetic/bibliographic position.
The opisthokonts (Greek: ὀπίσθιος (opísthios) = "rear, posterior" + κοντός (kontós) = "pole" i.e. "flagellum") or "Fungi/Metazoa group" are a broad group of eukaryotes, including both the animal and fungus kingdoms, together with the eukaryotic microorganisms that are sometimes grouped in the...
Diseases may be defined as illness of one or more of the body organs or tissues, caused by pathogens or germs. Germs (virus, bacteria) and protozoa are classified according to size. Parasites, though not germs, can cause ill health. The significance of a disease depends on the rate of infection or infestation and the number…. ...
void:inDataset: http://aims.fao.org/aos/agrovoc/void.ttl#Agrovoc. Created: 2014-02-26T08:58:39Z. Last modified: 2014-07-03T20:22:48Z. skos:notation: 330944 ...
By the end of this section, you will be able to: Describe the main characteristics of protists Describe important pathogenic species of protists Des
To Veljo Kisand , Does anybody have or know how I can get minicells which I like to stain , with some fluorescence marker and use for protozoa grazing experiments on , these bacterial mini cells? I have used E. Coli minicells for protozoa grazing expriments. At first,you had better get E. Coli x1488 strain. And, refer to the next paper when you separate minicells from E.coli cells. A.A.Christen, M.L.Pall, T.Manzara & P.Lurquin. Gene 23, 195-198 (1983). I tried to stain minicells with DTAF. About Staining method of DTAF,I refered to the next paper. B.F.Sherr, E.B.Sherr & R.D.Fallon. Appled and Environmental Microbiology 53, 958-965 (1987). Hope it will help. -- Tetsuji ISHIGAKI Address : ishigaki at ori.u-tokyo.ac.jp University of Tokyo , Ocean research Institute , Plankton Division TEL : 81-3-5351-6477 FAX : 81-3-5351-6480 ...
Earlier work by Inoué (1952) had shown that when cells are exposed to cold temperatures the mitotic spindle-later shown to be composed of microtubules-disappears. Working with the protozoan Actinosphaerium nucleofilum, which has needle-like extensions (axopodia) consisting of a well-defined system of microtubules, Tilney and Porter reasoned that "if the microtubules are instrumental in the maintenance of these slender protoplasmic extensions, then low temperature, which, as previously stated, should cause the breakdown of the microtubules, ought secondarily to cause retraction of the axopodia.". Their results supported this hypothesis. Cold treatment of A. nucleofilum cells caused the microtubules to disassemble and the axopodia to withdraw; after returning the cells to room temperature for a few minutes, the microtubules started to reassemble and the axopodia reformed (Tilney and Porter, 1967). The authors concluded that "microtubules are intimately involved not only with the maintenance of ...
Reason this person is a Gold Ribbon Hero: Danica Oney is a 26-year cancer survivor. At age 35 Danica was working full-time giving care, aid and comfort to memory care patients in a nursing home while living in Parker, Colorado, raising her 15-year-old son as a single mom.. At age nine, Danica was diagnosed with a Cerebellar Astrocytoma brain tumor. She underwent more than 20 surgeries, 18 months of chemotherapy and full radiation. At one point during her 2 1/2 years of treatment, her doctors gave her a 10% chance of survival. Her recovery was a miracle through a combination of modern medicine and much prayer. She has bravely adapted to a variety of health issues caused by the late term effects of childhood cancer treatment, always with a cheerful attitude, dignity and grace.. She recently ended up in the emergency room with symptoms of extreme vertigo, loud ringing in her ears, and some confusion which prompted an MRI. It was discovered that she has developed a Meningioma brain tumor that is in ...
Risks for Blue-green algae toxicity, Blue-green algae toxicity treatments, recommended products for Blue-green algae toxicity, ways to prevent Blue-green algae toxicity, causes of Blue-green algae toxicity
Genomic comparative studies on entirely sequenced genomes from the three domains of life, i.e. Bacteria, Archaea and Eukaryota [1], evidenced that proteins involved in the organization or processing of genetic information (structures of ribosome and chromatin, translation, transcription, replication and DNA repair) display a closer relationship between Archaea and Eukaryota than between Bacteria and Eukaryota [2-4]. To identify new proteins involved in such important cellular mechanisms, an exhaustive inventory of proteins of unknown function common to only Eukaryota and Archaea but not in Bacteria has been devised [5-7]. Among such proteins, the Cluster of Orthologous Group COG2042 comprises proteins ubiquitously present in Eukaryota and present in many, but not all, Archaea; a hallmark of their ancient origin. The corresponding ancestral protein should have been present in the common ancestor of these two domains of life. Some partial experimental data are known from the Saccharomyces ...
Chlorella Pyrenoidosa je sladkovodní řasa s vysokým obsahem bílkovin, vitaminu A, C, B2, vápníku, hořčíku, železa a chlorofylu, je rovněž zdrojem vitamínů B6 a B1.
Treatment can involve drugs known to kill or retard the reproduction of the responsible protozoa S. neurona. None of the drugs kill 100% of the protozoa. But the drugs reduce the protozoa population to a level where the horses immune system kills the rest. It is important to help the equine rebuild its immune system while treatment is ongoing. Relapses are frequent without strong immune system support. Reduction of stress and a healthy diet are also important. Significant help is also needed through supplementation in supporting the immune system in order to combat this disease.. Treatments can be expensive. Although complications are rare, treatments may affect stallion fertility and may pose certain health risks to unborn foals. While treatment success rates are high, not all equines respond positively to therapy and approximately 10-20% of horses may experience a relapse. Equines that have recovered may still suffer from some permanent damage. ...
Natura - nature Mundus - physical world;material world Naturalia Biota 3.2 Domain Eukaryota - eukaryotes H,N,P,R,B,L; Ref:P.M. Kirk et al., 2001:403; Count:[p]5k;74p;246c;1118o;8389f;72,585g;142,091s;12,825ss;1558v; 3o;15f;112g;439s;70ss; 5p;54c;370o;2079f;8365g;3728s;155ss 1 Kingdom Protozoa (Goldfuss, 1818) R. Owen, 1858 - protozoa H,N,P,R,B,L; Ref:P.M. Kirk et al., 2001:651; Count:[p]13p;67c;189o;734f;3662g;4751s;69ss;48v; 4o;5f;158g;204s;6ss 2.1.1 Kingdom Animalia C. Linnaeus, 1758 - animals H,N,P,R,B,L; Ref:P.M. Kirk et al., 2001:403; Count:[p]37p;88c;514o;5956f;53,045g;120,745s;12,303ss;96v; 3o;15f;110g;435s;70ss; 5p;48c;333o;1995f;7974g;3369s;129ss 2.1.2 Kingdom Fungi T.L. Jahn & F.F. Jahn, 1949 ex R.T. Moore, 1980 - fungi H,N,P,R,B,L; Ref:P.M. Kirk et al., 2001:403; Count:[!]7p;38c;133o;563f;4603g;1737s;8ss;22v; 1g;1s 2.2.1 Kingdom Plantae Haeckel, 1866 - plants H,N,P,R,B,L; Ref:P.M. Kirk et al., 2001:403; Count:[p]8p;31c;166o;866f;10,148g;11,338s;436ss;819v; 2g;4s; 6c;28o;64f;96g;94s ...
PEP is a large-scale interdisciplinary, and collaborative research project, involving six Canadian universities in five provinces. It is financed by Genome-Canada and managed by Genome-Atlantic and Génome Québec. PEP aims at the exploration of the diversity of eukaryotic genomes in a systematic, comprehensive and integrated way. The focus is on unicellular microbial eukaryotes, known as protists. Protistan eukaryotes comprise more than a dozen major lineages that, together, encompass more evolutionary, ecological and probably biochemical diversity than the multicellular kingdoms of animals, plants and fungi combined. PEP is a unique endeavor in that it is the first phylogenetically-broad genomic investigation of protists. More details about the objectives of PEP, the complete listing of taxa studied, the PEP database, the analysis workbench AnaBench, and PEP bioinformatics tools are available ...
OCKLEFORD, C D (1975) Redundancy of washing in the preparation of biological specimens for transmission electron microscopy. Journal of Microscopy, 105 (2). pp. 193-203. ISSN 0022-2720. OCKLEFORD, C D (1975) ULTRAVIOLET-LIGHT MICROBEAM IRRADIATION OF MICROTUBULES IN SINGLE HELIOZOAN AXOPODIA. Experimental Cell Research, 93 (1). pp. 127-135. ISSN 0014-4827. ...
WHAT CAUSES DISEASES? Certain bacteria, viruses, and protozoa are responsible for many diseases that affect humans. Below is a brief description of one disease-causing agent from each of the three groups and the name of a disease each agent causes. Using the characteristics given, draw the disease-causing agent in the space provided.. ...
An infectious disease is an illness caused by a microbe - an organism too small to be seen with the naked eye. Bacteria, virus, fungi and protozoa are all disease-causing microbes. A colleague coughs and doesnt cover his mouth; a student gets creative when there are no tissues to wipe her runny nose; friends share a water… Read more ». ...
Arikawa, M., Saito, A., Omura, G., Khan, S. M. M. K., Suetomo, Y., Kakuta, S., Suzaki, T. 2006 Ca2+-dependent in vivo contractility of a precipitate isolated from an extract of the heliozoan Actinophrys sol. Cell Motil. Cytoskeleton, 63, 57-65 ...
This applicable star in the month of December is a large multinucleate heliozoan, Actinosphaerium eichhornii. It resembles a piece of soap suds, is about 500 µm in diameter, but can reach a size of three mm. Inside the body you can see a captured rotifer and some algae ...
Protein translocation is the process by which peptides are transported across a membrane bilayer. Translocation of proteins across the membrane of the...
Metazoan animals are multicellular, mitochondrial eukaryotes. Today Metazoa encompasses all animals with differentiated tissues, including nerves and muscles. They evolved from the protists approximately 700 million years ago. There are two prominent theories dealing with how the metazoans came to be, although one, the syncytial theory, has been somewhat discredited. The other, the colonial theory proposed by Ernst Haeckel in 1874 states basically that multicellular organisms have a colonial ancestor. This is in keeping with the idea that the choanoflagellates, a group of colonial protists, created the colonies from which multicelled organisms first evolved. This evolution occured sometime during the Precambrian period; the oldest known animal fossils were discovered in Precambrian rocks in 1946. ...
Natura - nature Mundus - physical world;material world Naturalia Biota Domain Eukaryota - eukaryotes Kingdom Plantae - plants Subkingdom Viridaeplantae - green plants Phylum Bryophyta - mosses 0.1.0 [Class Anthocerotae] SF: Class Anthocerotopsida H,N,P,R,B,L; Ref:L. Margulis & K.V. Schwartz, 1982:252 ...
by Merry Youle | Many heterotrophic single-celled eukaryotes are content to let the algae handle photosynthesis and then eat them. Others have opted for the convenience of having the algae residing in-house, living as endosymbionts within their cytoplasm.
Nano-sized, single-celled algae are among Earths earliest life forms. They have been surviving in many of Earths harshest environments for 3.7 billion years. Algaes simplicity enables these plants to…. ...
Some Aspects of the Comparative Study of Semi-empirical Combustion Models on FLUENT and OpenFOAM Codes, High-Performance Computing Infrastructure for South East Europes Research Communities Results of the HP-SEE User Forum 2012, Editors: Mihnea Dulea, Aneta Karaivanova, Anastasis Oulas, Ioannis Liabotis, Danica Stojiljkovic, Ognjen ...
The characteristics of animal-like protists, or protozoans, include the need to obtain food from their environment since they cannot make it themselves, and an ability to move around in their...
Protists are a diverse group of organisms, and they reproduce in a number of different ways, including asexual binary fission, multiple fission, fragmentation and several forms of sexual...
Čeprav so glive tradicionalno vključene v botanične učne načrte in učbenike, danes mislijo, da so glive bolj tesno povezane z živalmi kot z rastlinami in so uvrščene skupaj z živalmi v monofiletsko skupina Opisthokonta.[3] Analize s pomočjo molekularne filogenetike podpirajo monofiletski izvor gliv.[2] Taksonomija gliv se neprestano razvija, zlasti zaradi nedavnih raziskav, ki temeljijo na DNK primerjavah. Te današnje filogenetske analize pogosto ovržejo klasifikacije, ki temeljijo na starejših in včasih manj diskriminativnih metodah, ki temeljijo na morfoloških značilnosti.[4]. Ne obstaja splošno sprejet sistem na višjih taksonomskih nivojih in pogosto prihaja do spreminjanja imen na vseh nivojih, od vrste navzgor. Prizadevanja med raziskovalci sedaj potekajo za vzpostavitev in spodbujanje enotne uporabe in bolj dosledno nomenklaturo.[2][5] Posamezne vrste gliv imajo lahko tudi več znanstvenih imen, odvisno od njihovega življenjskega cikla in načina (spolnega ali ...
Define Silicoflagellata: a group of marine flagellates formerly classified among the radiolarians but now usually constituting a family of the order …
Thomas Cavalier-Smith, Protist phylogeny and the high-level classification of Protozoa, Europ. J. Protistol. 39, 338-348 (2003 ...
Chlorella Pyrenoidosa is distinguished from Chlorella Vulgaris by its thicker cell wall. The components of this cell wall may facilitate a slightly more powerful detoxification effect, and promote slightly higher nutritional value than Chlorella Vulgaris. However, the thickness of this cell wall also makes Pyrenoidosa slightly more difficult to digest.. High in vitamins, minerals, amino acids and protein. Natural detoxifier for immune support.* Natural digestive enzymes aiding to support fresh breath and relief from occasional constipation. Contains magnesium to support a healthy cardiovascular system.*. ...
BackgroundThe Nuclear Pore Complex (NPC) facilitates molecular trafficking between nucleus and cytoplasm and is an integral feature of the eukaryote cell. It exhibits eight-fold rotational symmetry and is comprised of approximately 30 nucleoporins (Nups) in different stoichiometries. Nups are broadly conserved between yeast, vertebrates and plants, but few have been identified among other major eukaryotic groups.. Methodology/Principal FindingsWe screened for Nups across 60 eukaryote genomes and report that 19 Nups (spanning all major protein subcomplexes) are found in all eukaryote supergroups represented in our study (Opisthokonts, Amoebozoa, Viridiplantae, Chromalveolates and Excavates). Based on parsimony, between 23 and 26 of 31 Nups can be placed in LECA. Notably, they include central components of the anchoring system (Ndc1 and Gp210) indicating that the anchoring system did not evolve by convergence, as has previously been suggested. These results significantly extend earlier results ...
The protozoan oyster parasite Perkinsus marinus causes extensive mortality in eastern oyster (Crassostrea virginica) populations during summer and fall across much of the oysters distribution. Despite more than 40 yr of ...
In the drinking water samples taken at 5 tap locations in the same drinking water distribution network (Fig. S1,† TP1-TP5), different eukaryotic communities were identified within each of the tap water samples. These differences may reflect the existence of a variety of microhabitats defined by complex environmental conditions existing in the distribution network (reservoir, pipes and premise plumbing) that affect the eukaryotic community composition and structure. Both the number of shared eukaryotic groups and their relative abundance varied between the PW (drinking water feeding the network) and each of the tap water samples in the network (except Gastrotrich detected only in TP4). In addition, the taxonomic diversity of the fungal community in the network was higher than observed in the PW (Fig. S4†). Results showed that the core community shared between the PW and the all combined tap water samples was composed of 84 OTUs (28.1%). The core community between the PW and each of the tap ...
Save 39% Solaray - Red Marine Algae 375 mg 100 Capsules Red Marine Algae 375 mg Rhodymenia palmata 375 mg Per Capsule Green Screened From the Wild Red Marine Algae, or Dulse, has been used by people as a food staple for thousands of years. Often referred to as a sea vegetable, research has suggested that the sulfated polysaccharides in Red Marine Algae may provide nutritional support for immune health. Vegetarian Capsules.
Save 39% Solaray - Red Marine Algae 375 mg 100 Capsules Red Marine Algae 375 mg Rhodymenia palmata 375 mg Per Capsule Green Screened From the Wild Red Marine Algae, or Dulse, has been used by people as a food staple for thousands of years. Often referred to as a sea vegetable, research has suggested that the sulfated polysaccharides in Red Marine Algae may provide nutritional support for immune health. Vegetarian Capsules.
Do Trimastix pyriformis and other amitochondriates gain any advantages by replacing the canonical eukaryotic versions of the glycolytic enzymes or is it just a random process [53]? The use of pyrophosphate-linked instead of ATP-dependent enzymes can increase the overall efficiency of glycolysis, which is especially important if ATP production is solely carried out by glycolysis [54-56]. Pyrophosphate (PPi) is created during biosynthetic polymerization reactions and, in most organisms is hydrolyzed by inorganic pyrophosphatase in order to thermodynamically favor the anabolic reactions. Organisms like Giardia lamblia, which presumably lack inorganic pyrophosphatase, can use pyrophosphate instead of ATP as the phosphor-donor in some reactions [54, 55]. In Trimastix we found in addition to an ATP-dependent PK, the pyrophosphate-linked PPDK as a second enzyme that catalyzes the conversion of phosphoenolpyruvate (PEP) to pyruvate (PPDK can also work in the other direction towards gluconeogenesis). For ...
Whirling disease is an infectious disease, caused by the myxosporean parasite Myxobolus cerebralis. It is primarily a salmonid (salmon and trout) disease and is characterized by erratic circular swimming movements (hence the common name for this disease). The parasite primarily infects the cartilaginous- and boney tissues of the head, vertebral column, and fins. The characteristic whirling swimming pattern is due to constriction of the spinal cord, brain, and brainstem. Vertebral malformation is also associated with constriction of the spinal nerves that normally regulate skin pigmentation and infected fish also often exhibit skin darkening of the tail and tail fin. To complete its lifecycle it requires a freshwater oligochaete worm (Tubifex tubifex) as intermediate host. This worm is widely distributed within fresh water bodies throughout the world.. Host response to M. cerebralis infection varies greatly among the different genera and species with some considered extremely sensitive (e.g. ...
Meiosis is necessary for sexual reproduction in eukaryotes. Genetic recombination between non-sister homologous chromosomes is needed in most organisms for successful completion of the first meiotic division. Proteins that function during meiotic recombination have been studied extensively in model organisms. However, less is known about the evolution of these proteins, especially among protists. We searched the genomes of diverse eukaryotes, representing all currently recognized supergroups, for 26 genes encoding proteins important for different stages of interhomolog recombination. We also performed phylogenetic analyses to determine the evolutionary relationships of gene homologs. At least 23 of the genes tested (nine that are known to function only during meiosis in model organisms) are likely to have been present in the Last Eukaryotic Common Ancestor (LECA). These genes encode products that function during: (i) synaptonemal complex formation; (ii) interhomolog DNA strand exchange; (iii) ...
Chlorella is an amazing food with lots of vitamins, minerals, nucleic acids (RNA and DNA), and amino acids, including all of the essential ones. It is a
Recent molecular and cellular evidence indicates that eukaryotes comprise three major lineages: the probably ancestrally uniciliate protozoan phylum Amoebozoa; the ancestrally posteriorly uniciliate opisthokont clade (animals, Choanozoa, and fungi); and a very diverse ancestrally biciliate clade, the bikonts-plants, chromalveolates, and excavate and rhizarian Protozoa. As Heliozoa are the only eukaryote phylum not yet placed on molecular sequence trees, we have sequenced the 18S rRNA genes of three centrohelid heliozoa, Raphidiophrys ambigua, Heterophrys marina, and Chlamydaster sterni, to investigate their phylogenetic position. Phylogenetic analysis by distance and maximum likelihood methods allowing for intersite rate variation and invariable sites confirms that centrohelid heliozoa are a robust clade that does not fall within any other phyla. In particular, they are decisively very distant from the heterokont pedinellid chromists, at one time thought to be related to heliozoa, and lack the ...
Choanoflagellates, one-celled planktonic marine organisms, are aquatic microbes distinguished by a flagellum (green) used for swimming and feeding and surrounded by a collar of tentacles (red) against which bacterial prey are trapped. The nucleus of the one-celled organism is highlighted in blue. The newly sequenced genome of |em|Monosiga brevicollis|/em|, a type of choanoflagellates, is already telling scientists about the evolutionary changes that accompanied the jump from one-celled life forms to multicellular animals like us.
Cilia (flagella) are important eukaryotic organelles, present in the Last Eukaryotic Common Ancestor, and are involved in cell motility and integration of extracellular signals. Ciliary dysfunction causes a class of genetic diseases, known as ciliopathies, however current knowledge of the underlying mechanisms is still limited and a better characterization of genes is needed. As cilia have been lost independently several times during evolution and they are subject to important functional variation between species, ciliary genes can be investigated through comparative genomics. We performed phylogenetic profiling by predicting orthologs of human protein-coding genes in 100 eukaryotic species. The analysis integrated three independent methods to predict a consensus set of 274 ciliary genes, including 87 new promising candidates. A fine-grained analysis of the phylogenetic profiles allowed a partitioning of ciliary genes into modules with distinct evolutionary histories and ciliary functions ...
The aim of the present study is to determine presence of Plasmid-R in isolated bacteria of C. virginica, during its process of collection, distribution, commercialization, and consumption in Alvarado, Veracruz lagoon.
Buy Source Naturals Red Marine Algae - 90 Tablets at the lowest price from eVitamins. Find Red Marine Algae reviews, side effects, coupons and more from eVitamins.
... Microbial Eukaryotes June 2nd, Smithfield Rhode Island To elucidate principles of eukaryotic genome evolution, we must increase studies of microbial eukaryotes. The bulk of eukaryotic diversity is microbial yet our current knowledge of eukaryotic genome evolution comes largely from studies of plants, animals and fungi. Our intention in this one-day symposium is to highlight recent achievements in understanding the diversity of eukaryotic genomes, and to expose relevant researchers to advances in techniques for both data acquisition and data analysis. Speakers and titles appear below. Travel funds are available for undergraduates, graduate students and postdocs. These funds will offset costs of those currently working on molecular evolution/genomics of microbial eukaryotes, and those switching into the field. Students and postdocs are encouraged to bring a poster of their work. For more information, visit: ...
Prototheca richardsi is a protist of uncertain taxonomy which mediates growth inhibition in anuran larvae. Cells of P. richardsi were isolated from tadpole faeces and DNA was purified by Qiagen chromatography. Nuclear small-subunit (18S) rDNA (ssu-rDNA) was amplified by PCR using universal primers, cloned, and six clones (two from each of three separate isolates) were sequenced. All clones yielded an essentially identical sequence of 1802 nucleotides. In situ hybridization of fluorescent Prototheca-specific oligonucleotide probes, designed using the derived 18S rDNA sequence, confirmed that the sequence was indeed from P. richardsi cells and not from other components of tadpole faeces. The P. richardsi sequence was aligned with ssu-rDNA from a range of other eukaryotes, and phylogenetic analyses were carried out using several inference methods. P. richardsi consistently and stably grouped within a novel clade that contains rDNAs from an apparently heterodisperse group of parasitic micro-organisms
A choanoflagellate is a single-celled organism that is generally believed to be the most closely related to multi-celled animals, and many would classif...
Bernard, C., Simpson, A. G. B. & Patterson, D. J. (2000) Some free-living flagellates (Protista) from anoxic habitats. Ophelia 52: 113-142.. Cavalier-Smith, T. (2003) The excavate protozoan phyla Metamonada Grasse emend. (Anaeromonadea, Parabasalia, Carpediemonas, Eopharyngia) and Loukozoa emend. (Jakobea, Malawimonas): their evolutionary affinities and new higher taxa. Int. J. Syst. Evol. Microbiol. 53: 1741-1758.. Edgcomb, V. P., Roger, A. J., Simpson, A. G. B., Kysela, D. & Sogin, M. L. (2001) Evolutionary relationships among jakobid flagellates as indicated by alpha- and beta-tubulin phylogenies. Mol. Biol. Evol. 18: 514-522.. Flavin, M. & Nerad, T. A. (1993) Reclinomonas americana n. g., n. sp., a new freshwater heterotrophic flagellate. J. Eukaryot. Microbiol. 40: 172-179.. Gray, M. W., Lang, B. F. & Burger, G. (2004) Mitochondria of protists. Annu. Rev. Genet. 38: 477-525.. Lang, B. F., Burger, G., O Kelly, C. J., Cedergren, R., Golding, G. B., Lemieux, C., Sankoff, D., Turmel, M. & Gray, ...
Bernard, C., Simpson, A. G. B. & Patterson, D. J. (2000) Some free-living flagellates (Protista) from anoxic habitats. Ophelia 52: 113-142.. Cavalier-Smith, T. (2003) The excavate protozoan phyla Metamonada Grasse emend. (Anaeromonadea, Parabasalia, Carpediemonas, Eopharyngia) and Loukozoa emend. (Jakobea, Malawimonas): their evolutionary affinities and new higher taxa. Int. J. Syst. Evol. Microbiol. 53: 1741-1758.. Edgcomb, V. P., Roger, A. J., Simpson, A. G. B., Kysela, D. & Sogin, M. L. (2001) Evolutionary relationships among jakobid flagellates as indicated by alpha- and beta-tubulin phylogenies. Mol. Biol. Evol. 18: 514-522.. Flavin, M. & Nerad, T. A. (1993) Reclinomonas americana n. g., n. sp., a new freshwater heterotrophic flagellate. J. Eukaryot. Microbiol. 40: 172-179.. Gray, M. W., Lang, B. F. & Burger, G. (2004) Mitochondria of protists. Annu. Rev. Genet. 38: 477-525.. Lang, B. F., Burger, G., O Kelly, C. J., Cedergren, R., Golding, G. B., Lemieux, C., Sankoff, D., Turmel, M. & Gray, ...
Derma E Purifying Gel Cleanser with Marine Algae and Activated Charcoal Details Lather away sweat, oil and toxin buildup for a clean, refreshed, glowing complexion with this refreshing detox cleanser.
Other articles where Opisthokonta is discussed: protozoan: Annotated classification: Opisthokonta Possess a posterior flagellum at some stage in the life cycle; otherwise the posterior flagellum has been secondarily lost. Usually have flattened mitochondrial cristae. The monophyletic fungi and metazoa are classified in this group. Mesomycetozoa At least 1 life stage consisting of round cells,…
Roy Bartal, Bingyan Shi, William P. Cochlan & Edward J. Carpenter, A model system elucidating calcification functions in the prymnesiophyte Emiliania huxleyi reveals dependence of nitrate acquisition on coccoliths, Limnol. Oceanogr. 60, 2015, 149-158 doi: 10.1002/lno.10015 link p.153 table 4 ...
The establishment of forward genetics in S. rosetta reveals the first gene known to be required for choanoflagellate multicellular development.
Most sexually transmitted diseases are caused by viruses or bacteria. STDs caused by viruses include herpes and genital warts, and the viruses that cause them arent even technically living organisms - they are pieces of genetic information that are able to infect a host cell. STDs caused by bacteria include gonorrhea and syphilis; bacteria are microscopic, single-celled organisms with relatively simple cell structures.. But some STDs are caused by other types of living organisms. Protozoan organisms are microscopic and unicellular, like bacteria; unlike bacteria, their cell structures more closely resemble that of the so-called "higher" life forms such as animals and plants. While protozoa are considered to be "animal-like," they are not animals at all - they are single-celled organisms that reproduce asexually. When certain types of protozoans get into your body, they can cause infections - such as trichomoniasis, the most common curable STD among young females (as well as more females over 40 ...
Tony Stewart called Danica Patrick fearless on Wednesday, his first comments about her upcoming departure from his race team in a financial move that could end her full-time driving career in NASCAR.
Danica Hunter brings her quirky blend of pop, soul, jazz, and hip-hop with her unique vocals and keep it real lyrics for the colourful Typical video.
Hayward, B.W.; Le Coze, F.; Gross, O. (2018). World Foraminifera Database. Virgulina recta var. howei Cushman, 1936 †. Accessed at: http://marinespecies.org/foraminifera/aphia.php?p=taxdetails&id=930648 on 2019-10-20 ...
Kingdom Animalia includes all animals and humans. Kingdom Plantae includes all plants, veggies and fruits. Kingdom Monera includes, well, monera! Monera are one cell creatures that have no nucleus. Kingdom Protista includes a large and diverse group of eukaryotic microorganisms including algae, amoeba, paramecium, and euglena. (Whew!) Kingdom Fungi includes varieties of fungi and mold. (Fun guys not included ...
Motile forms of Stentors swim about searching for a good place where they can attach and feed; under darkfield illumination at a magnification of 600x.
● Protists are usually single celled organisms. ● Live in moist environments. ● Vary in the ways they move and obtain energy. Protists obtain their energy in several ways. ● Animal-like protists ingest or absorb food after capturing or trapping it. ● Plant-like protists produce food through photosynthesis. ● Fungus-like protists obtain their food by external digestion either as decomposers or as parasites. ● Some protists have both autotrophic and heterotrophic characteristics.
Protozoa are microscopic, one-celled organisms that can be free-living or parasitic in nature. They are able to multiply in humans, which contributes to their survival and also permits serious infections to develop from just a single organism. Transmission of protozoa that live in a humans intestine to another human typically occurs through a fecal-oral route (for example, contaminated food or water or person-to-person contact). Protozoa that live in the blood or tissue of humans are transmitted to other humans by an arthropod vector (for example, through the bite of a mosquito or sand fly ...
To overcome some of the statistical uncertainties inherent in analyzing all four primer sets vs. the pooled data, we also aggregated the four separate datasets and compared this aggregate to the pooled data. (Essentially this amounts to averaging the four individual primer sets results and comparing this average to the pooled results). The results are shown in Figure 4. Again the nonparametric version gives higher results, but the confidence intervals overlap considerably. The most optimistic interpretation of Figure 4 is that, on average, the four primer sets can be expected to recover at most 60% of the total microbial diversity recoverable using the pooled approach.. The above statistical analyses showed that estimates of the protistan richness of the sample based on single PCR primer data sets do not significantly differ, and varied between 43 (SE 17) and 107 (SE 34) species (defined as OTUs grouping sequences that share at least 99% identity) (Figure 2). These analyses also showed that ...
Get FREE Shipping when you buy Source Naturals Blue-Green Algae - 2 oz Powder at the lowest price from eVitamins. Find Blue-Green Algae reviews, side effects, coupons and more from eVitamins.
Our lab is interested in the molecular events that enable apicomplexan parasites to remain widespread and deadly infectious agents. We study many important human pathogens, including Toxoplasma gondii, to model features conserved throughout the phylum. We seek to expand our understanding of eukaryotic diversity and identify specific features that can be targeted to treat parasite infections ...
Super Kingdom prokaryota and Eukaryota All cellular organisms so far studied fall naturally into one of two major groups, the prokaryota and eukaryota The prokaryotes appeared about 3500 million years ago and comprise a variety of organisms collectively known as bacteria. All the cells of prokaryotes (pro=before+karyon=nucleus)lake true nuclie. In other words their genetic material (DNA) is not enclosed by .... Read More » ...
Does anybody have experience with using UltraLife blue-green algae remover (http://www.ultralifedirect.com/HTML/blue-green_remover.htm)? If it really is a more gentle approach, I would prefer using it, before I reach for antibiotics (erythromycin). Id like to hear about how effective it is, and if O2 levels and pH get affected drastically. Thanks!
AC seq_length taxid rank species species_name ## 1 NC_013146 16960 100858 species 100858 Threskiornis aethiopicus ## 2 NC_016427 16379 82464 species 82464 Myodes regulus ## genus genus_name family family_name superkingdom ## 1 100857 Threskiornis 33574 Threskiornithidae 2759 ## 2 447134 Myodes 337677 Cricetidae 2759 ## superkingdom_name strand forward_match forward_mismatch forward_tm ## 1 Eukaryota D ATACCGCCCGTCACCCTC 2 45.64 ## 2 Eukaryota D ACACCGCCCGTCACCCTC 1 53.84 ## reverse_match reverse_mismatch reverse_tm amplicon_length ## 1 CTAAGTGCACATTCCGGT 2 45.55 74 ## 2 CCAAGCACACTTTCCAGT 4 16.28 79 ## sequence ## 1 CTCATAAGCTACTGACTCCCATAACTAATACCCTAATTAGCCGAAGATGAGGTAAGTCGTAACAAGGTAAGTGT ## 2 CTCAAACTAAATAAATGAGATCTATACATAATTACATCAAACTTTTACGAGAGGAGATAAGTCGTAACAAGGTAAGCAT ## definition ## 1 Threskiornis aethiopicus mitochondrion, complete genome ## 2 Myodes regulus mitochondrion, complete ...
Patrick mentioned she hadnt had a chance to meet up with Ed and the team yet. Ed Carpenter is the only IndyCar owner named Ed.
This is a list of changes made recently to pages linked from a specified page (or to members of a specified category). Pages on your watchlist are bold. ...
This is a list of changes made recently to pages linked from a specified page (or to members of a specified category). Pages on your watchlist are bold. ...
It is proposed in the SGM journal (Society for General Microbiology-journal not available on line) that the term prokaryote should be scrapped altogether. As well as being an incorrect label for a large group of organisms it also produces an incorrect evolutionary perspective. The use of the eukaryote/prokaryote terms suggests a very human based linear "One upon a time there were blobs with no nuclei and then they got nuclei and then they were better" sort of story. A more correct view is that of all three superkingdoms; bacteria, archaea and eukaryotes splitting away from each other. Eukaryotes safely packaging their DNA away, allowing a more complex system to build up, yet forfeiting the ability to share bits of DNA. The archaea and bacteria on the other hand, continued to share their genetic material, just became more selective about it as they diverged (hense the mostly seperate history ...
Anyway, about the number of kingdoms. You can put all into one kingdom and than have lets say three subkingdoms (eukarya, eubacteria, archea) and than divide them into many more clades or you can divide them immediately into 6 kingdoms (as are presented here) a and some of them group into some superkingdoms etc. or you can have even 50 or 100 kingdoms, which will supplement todays phyla. This system will always be just made by humans and the nature does not care ...
Animal-like Protists Unicellular Consumers Usually produce asexually, but may also produce sexually. Live in or on other living or dead organisms that are found in soil or water. Many have specialized vacuoles for digesting food and getting rid of excess water.
More than 25 strains of red marine algae (RMA) are known to contain natural antiviral and immunomodulatory agents. Difficulty lies in finding the species of RMA that are potent enough to be effective, for antiviral strength varies widely among the various algae based on their varying content of ...
More than 25 strains of red marine algae (RMA) are known to contain natural antiviral and immunomodulatory agents. Difficulty lies in finding the species of RMA that are potent enough to be effective, for antiviral strength varies widely among the various algae based on their varying content of ...
Nano-sized, single-celled algae are among Earths earliest life forms. They have been surviving in many of Earths harshest environments for 3.7 billion years. Algaes simplicity enables these plants to…. ...
by Christoph | Microbiologists face three problems today when talking to fellow biologists or any curious audience: the numbers of pro-kar-yo-tes and unicellular eukaryotes, their diversity, and their tininess. Sure, one can do the maths and juggle with numbers. Thats entertaining, and everybody is amazed when they learn that microbiologists easily count up to 108 individual cells in an E. coli colony...
ID CAOWC1_1_1006 STANDARD; PRT; 243 AA. AC CAOWC1_1_1006; DT 00-JAN-0000 (Rel. 1, Created) DT 00-JAN-0000 (Rel. 2, Last sequence update) DT 00-JAN-0000 (Rel. 3, Last annotation update) DE Flags: Fragments; DE (CAOWC1_1_1006). OS CAPSASPORA OWCZARZAKI ATCC 30864. OC Eukaryota; Ichthyosporea; Capsaspora. OX NCBI_TaxID=595528; RN [0] RP -.; RG -.; RL -.; CC -!- SEQ. DATA ORIGIN: Translated from the HOGENOM CDS CAOWC1_1_1006. CC , Capsaspora owczarzaki ATCC 30864 hypothetical protein (729 nt) Note(s CC At least one base has a quality score < 10. Missing 3 prime End; CC -!- GENE_FAMILY: HOG000206402 [ FAMILY / ALN / TREE ] DR HOGENOMDNA; CAOWC1_1_1006; -. SQ SEQUENCE 243 AA; UNKNOWN MW; UNKNOWN CRC64; MAQAQQPDIP SLLLSDDEME QVRTVLGARA QAVVTAVAQV HLAQNPRSWS KIATGALAFV RDKAARSYFI RLIDIEQGTV RFQQELYTEC VYKCPRPLFH SFAGDKCMVG LAFADQTEAT NFKNAVQGQL DKVNKRKTVA PRNPAPRPAS SPSPQPGLGS ASVSISGPMA GSGQVTLNSL SGKGSTTSLS SQGSVRDKKK GKFSKADIGA PSDFRHVGHI GWSPEKGFDV TTFRRVADAL PEG ...
319101 people for biomedexperts: Dragan, Micic, Mirjana, Aleksandra, Kendereski, Sunao, Sumarac-Dumanovic, Danica, Romania, Koichi Kaikita, München, Svetlana
Felsővégtag és kéz contracturáinak etiologiája, pathologiája és terápiája (Posttraumás-, ischaemiás-. Dupuytren-, perinatalis, cerebralis spasticus-, és congenitális)
Your basket is currently empty. i ,p>When browsing through different UniProt proteins, you can use the basket to save them, so that you can back to find or analyse them later.,p>,a href=/help/basket target=_top>More...,/a>,/p> ...
You may have heard of the many benefits of spirulina, a superfood blue-green algae. However, did you know that it makes a great addition to a latte?
My Rates - I am Claire Black, London based pervert. I want to play with your body, give it sensations it craves and desires, manipulate, flagellate, twist, tie and tease it. Ill be your guide through exquisite,My Rates -
Marques, M.A. (UFRJ), Oliveira, P.A.G. (UFRJ-IBqM), Pereira, E.G. (UFRJ), Dias, C.V. (UESC), Souza, T.L.F. (UFRJ-FF), Ferretti G (UFRJ), Cordeiro, Y. (UFRJ-FF), Cascardo, J.C.M. (UESC), Almeida, F.C.L. (UFRJ-IBqM), Valente, A.P. (UFRJ-IBqM), Silva, J.L. (UFRJ-IBqM ...
First introduced to the USA in 1958, Myxobolus cerebralis, the parasite responsible for whirling disease in salmonids, has since spread across the country causing severe declines in wild trout populations in the intermountain west. Recent development of risk assessment models used to assess the likelihood and consequences of exotic parasite introduction, have strengthened the process of science-based decision-making in aquatic animal health. In the case of M. cerebralis, it is necessary to use a risk assessment model with two unique segments that clearly address the distinct life stages and respective hosts of the parasite separately. The studies described examine the probability of M. cerebralis introduction and establishment for two regions: the state of Alaska, and the Willamette River basin, Oregon. The Alaska risk assessment was based on the assumption that the parasite did not already occur in the state. However, in the process of validating this assumption, we documented the first ...
Kudoa thyrsites is a myxosporean parasite of marine fishes. It has a worldwide distribution, and infects a wide range of host species. This parasite is responsible for causing economic losses to the fisheries sector, by causing post-mortem "myoliquefaction", a softening of the flesh to such an extent that the fish becomes unmarketable. It is not infective to humans. The spores of K. thyrsites are stellate in shape, with 4 valves and 4 polar capsules. Upon infection by the actinosporean stage the sporoplasm migrates to a muscle fibre where it forms a pseudocyst. Within these pseudocysts are the developing spore stages. Comparison of 18S rDNA sequences of Kudoa species and other myxozoan species to determine their relationships. They show that Kudoa species are distinct from other myxozoans analyzed (Myxidium sp., Myxobolus sp., and Henneguya zschokkei)[1]. Kudoa thyrsites is an interesting member of this group in that apparently has very broad host specificity, infecting many fish species around ...
The occurrence and morphology of actinosporean stages of myxosporeans were studied at a fish farm and in the River Tisza in Hungary. The 43 samples sequenced belonged to 10 genotypes, from which six
International Atomic Energy Agency, Marine Environment Laboratories, Principality of Monaco. In the framework of a program focusing on marine resource protection and management in the Caribbean, the objective of this work was to characterize As bioaccumulation in the common edible oyster Crassostrea virginica. Dissolved As (stable As + 73As as a tracer) was taken up according to saturation kinetics for all tested exposure concentrations (2-10 mg l-1), and steady-state was reached rapidly within ~1 week. A slight decrease in uptake efficiency was observed for the higher concentration tested. Whole-body depuration kinetics showed that 73As was lost according to double exponential depuration kinetics that were characterized by short-lived biological half-lives (Tb1/2s) of 0.5-0.9 d and by long-lived Tb1/2l of 8-16 d. No significant difference in 73As retention was found among different initial exposure concentrations of As. Overall, our results indicate that C. virginica bioaccumulates As ...
The effects of 24-h exposure to spectinomycin (100 microgram/ml) and ethidium bromide (1 microgram/ml) on the accumulation of chloroplast and mitochondrial rRNAs and on organelle ultrastructure were studied in greening cells of Ochromonas danica. Cells treated with ethidium bromide for 24 h divide at the same rate as controls but contain less than one third the normal amount of mitochondrial rRNA. Ultrastructural observations showed that these cells contain only 10% the number of mitochondrial ribosomes found in controls as well as fewer mitochondrial cristae. Ethidium bromide has no effect on chloroplast ultrastructure in Ochromonas. Greening cells treated with spectinomycin grow at close to control rates but contain 30-40% less chloroplast rRNA than do controls. Electron microscopy showed that spectinomycin disrupts the organization of chloroplast membranes and reduces the number of chloroplast ribosomes by 30%. Under these conditions, spectinomycin has no effect on mitochondrial rRNA or ...
Monoclonal antibody B4 (mAb B4) was previously developed to the myxozoan parasite Tetracapsuloides bryosalmonae Canning, Curry, Feist, Longshaw et Okamura, 1999, the causative agent of proliferative kidney disease of salmonids. Here we describ...
Looking for online definition of Proliferative Kidney Disease in the Medical Dictionary? Proliferative Kidney Disease explanation free. What is Proliferative Kidney Disease? Meaning of Proliferative Kidney Disease medical term. What does Proliferative Kidney Disease mean?
Tan, T.C.; Ong, S.C.; Suresh, K.G. (2009) Genetic variability of Blastocystis sp isolates obtained from cancer and HIV/AIDS patients. Parasitology Research, 105 (5). pp. 1283-1286. ISSN 0932-0113. Tan, T.C.; Suresh, K.G. (2006) Amoeboid form of Blastocystis hominis - a detailed ultrastructural insight. Parasitology Research, 99 (6). pp. 737-742. ISSN 0932-0113. Tan, T.C.; Suresh, K.G. (2007) Evidence of plasmotomy in Blastocystis hominis. Parasitology Research, 101 (6). pp. 1521-1525. ISSN 0932-0113. Tan, T.C.; Suresh, K.G. (2006) Predominance of amoeboid forms of Blastocystis hominis in isolates from symptomatic patients. Parasitology Research, 98 (3). pp. 189-193. ISSN 0932-0113. Tan, T.C.; Suresh, K.G.; Smith, H.V. (2008) Phenotypic and genotypic characterisation of Blastocystis hominis isolates implicates subtype 3 as a subtype with pathogenic potential. Parasitology Research, 104 (1). pp. 85-93. ISSN 0932-0113. Tan, T.C.; Suresh, K.G.; Thong, K.L.; Smith, H.V. (2006) PCR fingerprinting of ...
The fine structure of Cyanidium caldarium, as seen in thin sections of KMnO4-fixed cells examined with the electron microscope, is described. This organism, whose taxonomic position among algae is undetermined, contains a single well defined chloroplast, a nucleus, and mitochondria. Studies, with the electron microscope, of Chlorella pyrenoidosa and Nostoc are also reported. Structural differences within cells of Cyanidium, chlorella, and Nostoc are discussed. It is concluded that if Nostoc can be taken as a typical Cyanophyte and Chlorella as a representative Chlorophyte and if the items of fine structure examined are diagnostic, then Cyanidium is certainly not a Cyanophyte and, while it has numerous features in common with Chlorella, is not a green alga similar to Chlorella. Comparisons are also made between Cyanidium and other algae whose fine structure has been described by others.. ...