1. Cimetidine pretreatment of male Sprague-Dawley rats caused a significant increase in the specific content of total hepatic cytochrome P-450, supporting the hypothesis that this H2-receptor antagonist has monooxygenase induction effects. 2. Quantitative ultrastructural studies of liver of cimetidine-pretreated animals also supported this hypothesis in showing a significant proliferation of smooth endoplasmic reticulum. These ultrastructural changes were qualitatively similar to those produced by treatment of rats with phenobarbital, a well-characterized monooxygenase-inducing agent whose effects were studied for comparative purposes. 3. Competitive inhibition of metoprolol αhydroxylation by cimetidine in liver microsomes prepared from untreated animals (Ki = 18.8 μM) was also demonstrated. 4. These results allowed testing of the hypothesis (Burnet el al. 1986) that inhibition of a defined monooxygenase should lead to induction of the synthesis of the relevant cytochrome P-450 isozyme. 5. The ...
Author: Garda, H. A. et al.; Genre: Journal Article; Published in Print: 1994-12-07; Keywords: CYTOCHROME P450 LM2; SUBSTRATE BINDING; MICROHETEROGENEITY; MULTIPLICITY|br/|; Title: Heterogeneity in rabbit liver cytochrome P-450 LM2 observed by cation exchange HPLC: Partial biochemical characterization of the two major LM2 subfractions
The isolation and purification of two major phenobarbitone-induced hepatic cytochromes P-450 from male Wistar rats is described. These forms (designated cytochromes P-450 B1 and P-450 B2) were extensively characterised and structurally and functionally compared to two other homogeneous isoenzymic forms, cytochromes P-452 (clofibrate-induced) and cytochrome P-447 (BNF-induced). These characterisation studies (including catalytic, immunological, physical and spectral analysis) indicated that all four isoenzymes were distinct, unique hemoproteins. The above characterisation was extended towards the induction profiles of these hemoproteins in hepatic and renal microsomes, following single dose xenobiotic pretreatment. Of primary interest was the immunoquantitation data which revealed the presence of cytochrome P-452 as a major constitutive isoenzyme. This data in conjunction with the metabolic data also indicated that xenobiotic induction of cytochromes P-450 was both a specific and precise event. ...
(S,S)-3-[3-(Methylsulfonyl)phenyl]-1-propylpiperidine hydrochloride [(-)-OSU6162] is a weak dopamine D2 receptor modulator that possesses potential for the treatment of levodopa (L-DOPA)-induced dyskinesias in patients with Parkinsons disease. In this report, incubations with human liver microsomes revealed that (-)-OSU6162 is selectively metabolized via N-dealkylation to yield N-depropyl (-)-OSU6162. Kinetics evidence is presented that the N-depropylation of (-)-OSU6162 in human hepatic microsomes is mediated by multiple cytochrome p450 (p450) enzymes, in particular CYP2D6. This hypothesis is borne out by several lines of in vitro evidence; 1). incubations of (-)-OSU6162 (5 micro M) with hepatic microsomes from a panel of human donors showed that (-)-OSU6162 N-depropylase activity correlated well with CYP2D6-catalyzed dextromethorphan O-demethylase activity but not with other p450 enzyme-specific activities; 2). quinidine, a CYP2D6-specific inhibitor, inhibited (-)-OSU6162 N-depropylation, whereas
hepatic microsomal mixed function oxidase system의 중추인 cytochrome p-450은 주위환경, 약물, 식이 및 영양 상태에따라 활성이 변화하는것으로 알려져있다. 또한 이 효소계를 통하여 대사되는 2-acetylaminofluorene은 guinea pig를 제외한 모든 동물에서 간암을 일으키는 물질이라는것이 밝혀져서 연구의 대상이 되고있다. 최근 cholesterol은 성인병에 있어 그 원인 인자로서 중요성이 알려지고 있으며 cytochrome p-450과 b_(5)와의 연관성이 보고된바있다. 한편 인삼은 항암작용, 대사촉진, 간조직에서의 해독작용등 여러가지 기능이 보고되어 있다. 이에 저자는 cholesterol을 투여한 흰쥐에서 hepatic microsomal cytochrome p-450 및 b_(5)의 활성에대한 영향과 2-AAF의 ring-hydroxylation과 N-hydroxylation의 변화를 관찰하고, cholesterol과 인삼을 통시에 투여한 군과 비교관찰하여 다음과 같은 결론을 얻었다. 1) 정상 ...
1. We have constructed a full-length human liver cytochrome P450IIA cDNA from a partial-length clone by oligonucleotide-directed mutagenesis, and subcloned it into the monkey kidney (COS-7) cell expression vector, pSVL. 2. The cDNA encodes a 49 kDa protein with coumarin 7-hydroxylase (COH) activity which cross-reacts with antisera to the mouse cytochrome P-450 isoenzyme responsible for COH activity and comigrates with a human liver microsomal protein. 3. Western blot analysis of a panel of human livers indicates that the level of the 49 kDa protein, detected using antisera to either the mouse COH P-450 or rat P450IIA1 protein, correlates very highly with COH activity. 4. Antisera to the rat P450IIA1 protein can inhibit COH activity in human liver microsomes. Taken together, these data indicate that a member of the P450IIA subfamily is responsible for most, if not all, of the COH activity in human liver. ...
Interindividual variations in the level and activity of cytochrome P-450 enzymes were investigated in the liver microsomes of 30 Japanese and 30 Caucasian patients. The P-450 enzymes used in this study included P-450 1A2, 2A6, 2B6, 2C, 2D6, 2E1 and 3A, and the monooxygenase activities determined were 13 typical P-450 substrates and 9 procarcinogens. Although the total P-450 content was higher in Caucasian (mean, 0.43 nmol/mg of protein) than in Japanese populations (mean, 0.26 nmol/mg of protein), the relative levels (percent of total P-450) of individual forms of P-450 determined immunochemically were not very different except that P-450 2A6 and 2B6 levels were higher in the Caucasians. About 70% of liver P-450 could be accounted for by P-450 1A2, 2A6, 2B6, 2C, 2D6, 2E1 and 3A proteins, and P-450 3A (about 30% of total P-450) and 2C (about 20%) enzymes were found to be the major forms. Considerable levels of P-450 1A2 (about 13%) and 2E1 (about 7%) could be determined, whereas the P-450 2A6 ...
Chronic treatment of rats with the naturally occurring androgen, testosterone, leads to hypertension and cardiovascular disease. This effect is believed to be mediated through the adrenal gland and in particular by action on the steroid 11 beta-hydroxylase enzyme system. To study the possible mechanism of this effect, the enzyme system was examined at several time periods up to the time that hypertension develops. Rats were treated with testosterone (10 mg/day) for 3, 7, 21, and 42 days. Levels of cytochrome P-450(11) beta enzyme and messenger RNA (mRNA) were determined as well as 11 beta-hydroxylase enzyme activity. A significant decrease in enzyme activity was observed after 3 days of treatment. This correlates with a profound decrease in the level of cytochrome P-450(11) beta enzyme as determined by Western blot analysis. A large decrease in cytochrome P-450(11) beta mRNA was also observed after 3 days of treatment. All three parameters remained low throughout the treatment period. The ...
Cytochrome P-450 CYP1A1: A liver microsomal cytochrome P-450 monooxygenase capable of biotransforming xenobiotics such as polycyclic hydrocarbons and halogenated aromatic hydrocarbons into carcinogenic or mutagenic compounds. They have been found in mammals and fish. This enzyme, encoded by CYP1A1 gene, can be measured by using ethoxyresorufin as a substrate for the ethoxyresorufin O-deethylase activity.
Aggregates were formed when clear supernatants from hepatic microsomes that had been treated with steapsin were desalted and concentrated. These aggregates contain large numbers of uniform tubular elements. These structures resemble microtubules seen in many cells but differ in their substructure. The aggregates were rich in cytochrome P-420. Unlike soluble cytochrome P-420, the cytochrome P-420 contained in the aggregates combines with drugs to give the characteristic difference spectra normally seen only with cytochrome P-450 contained in intact microsomes. ...
Rabbit anti-human cytochrome P450 enzyme CYP2D6 (polyclonal antibody). O-demethylation of xenobiotics, CYP2D6 is involved in the metabolism and elimination of approximately 25% of clinically used drugs in humans1. Primarily expressed in the liver and areas of the CNS. CYP2D1 and CYP2D4 have a similar function in rats2.. CODE NUMBER: RT01.. QUANTITY: 0.1 mL.. SPECIFICITY: Reacts with human cytochrome P450 enzyme CYP2D6 in hepatic microsomal fraction. No cross-reactivity with other cytochrome P450 enzymes.. IMMUNOGEN: Synthetic peptide.. SUGGESTED APPLICATIONS: Western blot, immunohistochemistry on frozen and formaldehyde treated sections. Optimal working dilutions must be determined by end user.. SPECIES REACTIVITY: Human.. FORMAT: Rabbit antiserum.. PRESENTATION: Liquid. No preservatives.. STORAGE/HANDLING: Maintain at -20°C in undiluted aliquots for up to 12 months. Avoid repeated freeze/thaw cycles.. For research use only; not for use in diagnostic procedures. Not for human or animal ...
Rabbit anti-rat cytochrome P450 enzymes CYP1A1 and CYP1A2 (polyclonal antibody). Involved in metabolism of xenobiotics, drugs and polyunsaturated fatty acids. Implicated in metabolism of some polycyclic hydrocarbons to carcinogenic intermediates. CODE NUMBER: R1V.. QUANTITY: 0.1 mL.. SPECIFICITY: Reacts with rat cytochrome P450 enzymes CYP1A1 and CYP1A2 in hepatic microsomal fraction. No cross-reactivity with other cytochrome P450 enzymes.. IMMUNOGEN: Synthetic peptide.. SUGGESTED APPLICATIONS: Western blot: useful for the simultaneous detection of rat CYP1A1 (57 kDa) and CYP1A2 (54 kDa), which can be separated by SDS-polyacrylamide electrophoresis. Immunohistochemistry on frozen and formaldehyde treated sections. Optimal working dilutions must be determined by end user.. SPECIES REACTIVITY: Rat.. FORMAT: Rabbit antiserum.. PRESENTATION: Liquid. No preservatives.. STORAGE/HANDLING: Maintain at -20°C in undiluted aliquots for up to 12 months. Avoid repeated freeze/thaw cycles.. For research use ...
Sigma-Aldrich offers abstracts and full-text articles by [Alena Vanduchova, Veronika Tomankova, Pavel Anzenbacher, Eva Anzenbacherova].
Buy our Recombinant Human Cytochrome P450 2A6 protein. Ab114776 is a protein fragment produced in Wheat germ and has been validated in WB, ELISA, SDS-PAGE…
Buy our Recombinant Human Cytochrome P450 4A11/22 protein. Ab114572 is a full length protein produced in Wheat germ and has been validated in WB, ELISA…
In this study we present evidence that brain cells consume NO by a membrane-localized process that involves NADPH oxidation by CYPOR, a microsomal protein that transfers electrons from NADPH to an acceptor, classically a haem-containing cytochrome P450 [27]. Cytochrome P450 inhibitors decreased NO consumption by brain membranes, suggesting that reduction of these proteins by CYPOR underlies NO consumption.. Cytochrome P450s perform hydroxylation reactions which, in the brain, are involved in diverse functions including steroid hormone synthesis, cholesterol homoeostasis and vitamin, eicosanoid and xenobiotic metabolism [28,29]. Both CYPOR and several members of the cytochrome P450 family are expressed in brain, though at much lower levels than in the liver (1-10%; [30]). Interestingly, NO has been shown to bind and inhibit several cytochrome P450s [31,32], making them intriguing candidates for NO consumption by brain membranes. Indeed, the reductase domain of NOS is very similar to that of CYPOR ...
AIMS: To characterize potential mechanism-based inactivation (MBI) of major human drug-metabolizing cytochromes P450 (CYP) by monoamine oxidase (MAO) inhibitors, including the antitubercular drug isoniazid. METHODS: Human liver microsomal CYP1A2, CYP2C9, CYP2C19, CYP2D6 and CYP3A activities were investigated following co- and preincubation with MAO inhibitors. Inactivation kinetic constants (KI and kinact) were determined where a significant preincubation effect was observed. Spectral studies were conducted to elucidate the mechanisms of inactivation. RESULTS: Hydrazine MAO inhibitors generally exhibited greater inhibition of CYP following preincubation, whereas this was less frequent for the propargylamines, and tranylcypromine and moclobemide. Phenelzine and isoniazid inactivated all CYP but were most potent toward CYP3A and CYP2C19. Respective inactivation kinetic constants (KI and kinact) for isoniazid were 48.6 µm and 0.042 min1 and 79.3 µm and 0.039 min1. Clorgyline was a selective ...
Graham, Kirsty, Sparagano, Olivier, Pérez de Léon, Adalberto, Bell-Sakyi, Lesley, Guerrero, F. and Finn, Robert (2012) Identification of Novel Cytochrome P450s in the Acari. In: 19th International Symposium on Microsomes and Drug Oxidations and 12th European ISSX Meeting, 17-21 June, 2012, Noordwijk aan Zee, the Netherlands. Full text not available from this repository. (Request a copy ...
The cytokine-mediated suppression of hepatic drug-metabolizing enzymes by inflammatory disease and the relief of this suppression by successful disease treatment have recently become an issue in the development of drug interaction labels for new biological products. This study examined the effects of the inflammatory cytokine interleukin-6 (IL-6) on drug-metabolizing enzymes in human hepatocyte culture and the abrogation of these effects by a monoclonal antibody directed against IL-6. Treatment of human hepatocytes with IL-6 (n = 9 donors) revealed pan-suppression of mRNA of 10 major cytochrome P450 isoenzymes, but with EC50 values that differed by isoenzyme. Some EC50 values were above the range of clinically relevant serum concentrations of IL-6. Marker activities for CYP1A2 and CYP3A4 enzyme were similarly suppressed by IL-6 in both freshly isolated and cryopreserved hepatocytes. IL-6 suppressed induction of CYP1A2 enzyme activity by omeprazole and CYP3A4 enzyme activity by rifampicin but ...
Current problems in the safety evaluation of chemicals, including species differences in chemical toxicity, the difficulty in predicting whether metabolism will result in detoxication or activation, the different metabolic roles of tissue cytochromes P-450, and the significance of oxygen radical formation, are reviewed. A number of specific chemical problems are discussed, including the safety evaluation of benzene, methylene dichloride, DDT, dieldrin, TCDD, the PCBs, and the hepatotoxic drugs: benoxaprofen and tienilic acid. Two novel methods for the prospective evaluation of chemical toxicity are described, namely (i) computer optimized parametric analysis for chemical toxicity (COMPACT) based on the computer graphic determination of chemical structure and its relationship to specific cytochromes P-450 and hence toxicity, and (ii) enzyme activation in chemical toxicity (ENACT) based on the induction of specific cytochromes P-450 by the chemical, from which toxicity can be predicted.. ...
In the present study, the ability of modafinil to inhibit or to induce cytochrome P450 enzyme activities was studied in human liver preparations. Such information is important for the design of effective treatment programs that will include administration of modafinil, because such enzymatic interactions can either enhance or diminish the effectiveness and/or safety of concomitant medications.. Cytochrome P450 inhibition by modafinil appears to be limited to CYP2C19, whose substrates and inhibitors have been extensively reviewed (e.g., Flockhart, 1995; Parkinson, 1996; Rendic and Di Carlo, 1997). Modafinil does not itself appear to be a substrate for CYP2C19, and there are a relatively small number of marketed pharmaceutical products that are predominantly or even largely metabolized by the enzyme. Examples are S-mephenytoin (Goldstein et al., 1994), omeprazole (Ko et al., 1997), lansoprazole (Pearce et al., 1996b), proguanil (Wright et al., 1995), diazepam (Jung et al., 1997), and propranolol ...
www.MOLUNA.de Cytochrome P-450 [4208648] - Major advances have been made in recent years in clarifying the molecular properties of the cytochrome P-450 system. These advances stem, in practical terms, from the generally recognized importance of cytochrome P-450 in the metabolism of drugs and in the bioactivation of xenobiotics to toxic products. The fascinating multiplicity and
The pharmaceutical industry is committed to market safer drugs with fewer side effects, predictable pharmacokinetic properties and quantifiable drug-drug interactions. There is an increasing need to develop robust, enhanced-throughput in vitro assays, which accurately extrapolate to humans. The major drug metabolizing human hepatic cytochrome P450s (CYPs; CYP1A2, 2C9, 2C19, 2D6 and 3A4) have been co-expressed functionally in Escherichia coli with human NADPH-cytochrome P450 reductase and validated as surrogates to their counterparts in human liver microsomes (HLM) with respect to their kinetic and inhibition properties. Using these recombinant enzymes, fully automated in vitro assays to assess CYP inhibition and determine the enzymology of drug oxidation have been developed and validated. IC50 values determined for a series of test compounds in HLM and recombinant CYPs were similar (r2 = 0.9, P , 0.001). There was a good correlation between the sum of individual CYP intrinsic clearance (Clint) ...
Domain combinations containing the Serine metabolism enzymes domain superfamily . Domain architectures illustrate each occurrence of the Serine metabolism enzymes domain superfamily.
hypothetical protein, flavoprotein-linked monooxygenase, microsomal monooxygenase, xenobiotic monooxygenase, 4-nitrophenol 2-hydroxylase, CPE1, Cyp2e, CYPIIE1, cytochrome P-450, cytochrome P450 2E1, cytochrome P450, 2e1, ethanol inducible, cytochrome P450-ALC, cytochrome P450 CYP2E1, cytochrome P450, family 2, subfamily e, polypeptide 1, cytochrome P-450-J, cytochrome P450-J, cytochrome P450RLM6, cytochrome P450 subfamily 2e1 (ethanol-inducible), cytochrome P450, subfamily 2E, polypeptide 1, cytochrome P450, subfamily IIE (ethanol-inducible), polypeptide 1, P450C2E, P450-J, P450RLM6, cyp2e1 ...
Polycyclic aromatic hydrocarbons (PAHs) are products of incomplete combustion that are commonly inhaled by workers in the dusty trades. Many PAHs are metabolized by cytochrome P-4501A1 (CYP1A1), which may facilitate excretion but may activate pulmonary carcinogens. PAHs also stimulate their own metabolism by inducing CYP1A1. Recent studies suggest that respirable coal dust exposure inhibits induct
Protein domain dynamics and electron transfer chemistry are often associated, but real-time analysis of domain motion in enzyme-catalysed reactions and the elucidation of mechanistic schemes that relate these motions to the reaction chemistry are major challenges for biological catalysis research. Previously we suggested that reduction of human cytochrome P450 reductase with the reducing coenzyme NADPH is accompanied by major structural re-orientation of the FMN- and FAD-binding domains through an inferred dynamic cycle of open and closed conformations of the enzyme (PLoS Biol, 2011, e1001222). However, these studies were restricted to stopped-flow/FRET analysis of the reductive half-reaction, and were compromised by fluorescence quenching of the acceptor by the flavin cofactors. Here we have improved the design of the FRET system, by using dye pairs with near-IR fluorescence, and extended studies on human cytochrome P450 reductase to the oxidative half-reaction using a double-mixing ...
Almost one half of prospective drugs, including new chemical entities are not suitable for clinical use because of their metabolic unstability and for danger of drug interactions. This type of toxicity has been underlying several drug withdrawals in recent years and hence it is needed now to bring with any new compound proposed an information on its metabolism and on its interactions with major drug metabolizing enzyme systems namely with liver microsomal cytochromes P450 (CYP). Then, possibility of drug interactions with other drugs taken by the patient on the basis of drug metabolism may be evaluated to prevent significant losses in time, effort and money in drug development. The analysis of drug metabolism by individual CYPs, the possibility of drug interactions and of induction of individual CYP forms are performed with CYP in vitro systems with the respective substrates, inhibitors and inductors based on the recommendation of the U.S. Food and Drug Administration: ...
Central nervous system (CNS) infection and inflammation severely reduce the capacity of cytochrome P-450 metabolism in the liver. We developed a mouse model to examine the effects of CNS inflammation on hepatic cytochrome P-450 metabolism. FVB, C57BL/6, and C3H/HeouJ mice were given Escherichia coli LPS (2.5 μg) by intracerebroventricular (ICV) injection. The CNS inflammatory response was confirmed by the elevation of TNF-α and/or IL-1β proteins in the brain. In all mouse strains, LPS produced a 60-70% loss in hepatic Cyp3a11 expression and activity compared with saline-injected controls. Adrenalectomy did not prevent the loss in Cyp3a11 expression or activity, thereby precluding the involvement of the hypothalamic-adrenal-pituitary axis. Endotoxin was detectable (1-10 ng/ml) in serum between 15 and 120 min after ICV dosing of 2.5 μg LPS. Peripheral administration of 2.5 μg LPS by intraperitoneal injection produced similar serum endotoxin levels and a similar loss (60%) in Cyp3a11 expression and
PubMed journal article Construction and applications of a B vitamin genetic resource for investigation of vitamin dependent metabolism in maiz were found in PRIME PubMed. Download Prime PubMed App to iPhone or iPad.
Increasing use of zebrafish in drug discovery and mechanistic toxicology demands knowledge of cytochrome P450 (CYP) gene regulation and function. CYP enzymes catalyze oxidative transformation leading to activation or inactivation of many endogenous and exogenous chemicals, with consequences for normal physiology and disease processes. Many CYPs potentially have roles in developmental specification, and many chemicals that cause developmental abnormalities are substrates for CYPs. Here we identify and annotate the full suite of CYP genes in zebrafish, compare these to the human CYP gene complement, and determine the expression of CYP genes during normal development. Zebrafish have a total of 94 CYP genes, distributed among 18 gene families found also in mammals. There are 32 genes in CYP families 5 to 51, most of which are direct orthologs of human CYPs that are involved in endogenous functions including synthesis or inactivation of regulatory molecules. The high degree of sequence similarity ...
The cytochrome P450 (CYP) enzyme superfamily is involved in phase I metabolism which chemically modifies a variety of substrates via oxidative reactions to make them more water-soluble and easier to eliminate. Inhibition of these enzymes leads to undesirable effects, including toxic drug accumulations and adverse drug-drug interactions. Hence, it is necessary to develop in silico models that can predict the inhibition potential of compounds for different CYP isoforms. This study focused on five major CYP isoforms, including CYP1A2, 2C9, 2C19, 2D6 and 3A4, that are responsible for more than 90% of the metabolism of clinical drugs. The main aim of this study is to develop a multiple-category classification model (MCM) for the major CYP isoforms using a Laplacian-modified naive Bayesian method. The dataset composed of more than 4500 compounds was collected from the PubChem Bioassay database. VolSurf+ descriptors and FCFP_8 fingerprint were used as input features to build classification models. The ...
PubMed comprises more than 30 million citations for biomedical literature from MEDLINE, life science journals, and online books. Citations may include links to full-text content from PubMed Central and publisher web sites.
The results suggest that CYP3A4 is primarily responsible for catalyzing the N-demethylation of CIT in human liver microsomes. This conclusion was inferred from the following observations. First, the CIT N-demethylation activities showed a significant correlation with both α- and 4-hydroxylation activities for triazolam, a substrate of CYP3A4 (Kronbach et al., 1989), in microsomes prepared from 10 human livers (fig. 2). Second, ketoconazole and 17α-ethinylestradiol, known as selective inhibitors or substrates of CYP3A (Back and Tjia, 1991; Guengerich, 1988; Wrighton and Ring, 1994), strongly inhibited theN-demethylation of CIT in microsomes obtained from both the putative EM and PM livers for (S)-mephenytoin 4′-hydroxylation (fig. 3). Third, CIT N-demethylation was almost completely inhibited by the addition of anti-CYP3A antibodies (fig. 4). Fourth, the recombinant human CYP3A4 catalyzed CITN-demethylation (table 2).. However, the N-demethylation of CIT was catalyzed not only by recombinant ...
PubMed comprises more than 30 million citations for biomedical literature from MEDLINE, life science journals, and online books. Citations may include links to full-text content from PubMed Central and publisher web sites.
cytochrome P-450 CYP1B1: an enzyme that oxidizes a variety of structurally unrelated compounds, including steroids, fatty acids, and xenobiotics; inducable by polycyclic aromatic hydrocarbons; amino acid sequence given in first source; GenBank U09540
Human microsomal cytochrome P-450 2E1 (CYP2E1) monooxygenates , 70 low molecular weight xenobiotic compounds, as well as much larger endogenous fatty acid signaling molecules such as arachidonic acid. In the process, CYP2E1 can generate toxic or carcinogenic compounds, as occurs with acetaminophen overdose, nitrosamines in cigarette smoke, and reactive oxygen species from uncoupled catalysis. Thus, the diverse roles that CYP2E1 has in normal physiology, toxicity, and drug metabolism are related to its ability to metabolize diverse classes of ligands, but the structural basis for this was previously unknown. Structures of human CYP2E1 have been solved to 2.2 angstroms for an indazole complex and 2.6 angstroms for a 4-methylpyrazole complex. Both inhibitors bind to the heme iron and hydrogen bond to Thr303 within the active site. Complementing its small molecular weight substrates, the hydrophobic CYP2E1 active site is the smallest yet observed for a human cytochrome P-450. The CYP2E1 active site ...
19. Hanna, I. , and Guengerich, F. P. (2001) Heterologous expression of cytochrome P450 2D6 mutants, electron transfer, and catalysis of bufuralol hydroxylation: the role of aspartate 301 in structural integrity. Arch. Biochem. Biophys. 393, 255-261. 20. , and Guengerich, F. P. (2001) A new selective and potent inhibitor of human cytochrome P450 1B1 and its application to antimutagenesis. Cancer Res. 61, 8164-8170. 21. Omura, T. and Sato, R. (1964) The carbon monoxide-binding pigment of liver microsomes. 2. 99 mL of cytochrome-c assay buffer. 3. , 1-10 µL of a 1 mg/ mL solution). Mix (see Note 29). 4. Ensure that the absorbance remains at zero for approx 1 min. 5. Add 10 µL of 5 mM NADPH only to the sample cuvet. Mix. 6. Record the change in absorbance over at least 3 min. The activity should be linear. 4 mM-1 cm-1 at 550 nm. Cytochrome P450 Systems in E. 5. Results Achieved for the Expression of P450s The results achieved for the bacterial expression of P450s in E. coli are exemplified in ...
Principal Investigator:HIROBE Masaaki, Project Period (FY):1990 - 1992, Research Category:Grant-in-Aid for General Scientific Research (B), Research Field:Chemical pharmacy
Recombinant Cytochrome P450, Family 1, Subfamily A, Polypeptide 2 (CYP1A2) Protein. Species: Human. Source: Escherichia coli (E. coli). Order product ABIN6303723.
Our unprecedented systemic study of the effects of HCC on CYPs has provided strong evidence to argue strongly for the development of individualized therapy for each HCC patient. This is because all the major drug-metabolizing CYPs are severely dysregulated by liver cancer carcinogenesis such that the different drugs will be affected differently in different patients (i.e., there is no general pattern to follow for all HCC patients). Because liver biopsies are available, our results also support the use of highly sensitive LC/MS-MS method that requires small sample volume as a means to quantify the protein and activity levels of CYPs in both HCC and pericarcinomatous tissues. We believe that these levels are indicative of relevant CYP activities and can be used to guide clinical selection of drugs for developing an individualized treatment plan for the HCC patients.. Our systemic studies of the impact of HCC on liver CYPs are unprecedented. First, we derived our results using human HCC tumors ...
Stable expression of human cytochrome P4502E1 in HepG2 cells: characterization of catalytic activities and production of reactive oxygen intermediates.: Experim
Founded in 1983, the Gentest brand initially focused on the use of cultured human cells in GLP genotoxicity assays. In 1985, the company expanded research activities into the area of xenobiotic metabolism by developing cytochrome P450 cDNA-expression approaches. This led to the first commercial offering of cDNA-expressed human cytochrome P450 enzymes in 1990. Since that time, the range of Gentest offerings has increased dramatically, from recombinant systems to in vivo-like systems like primary hepatocytes. Now, as part of Corning Life Sciences, the Gentest offerings continue to grow, helping you stay on the leading edge of drug discovery and development.. Our scientists are internationally recognized as leaders and innovators in cytochrome P450 cDNA-expression, in vitro xenobiotic metabolism, and drug transporter techniques. Our demonstrated commitment to research has been rewarded by the receipt of several competitive NIH grants. The results and applications of our research are reported in ...
Experimental results, as well as theoretical approaches, indicate one route for substrate access, pw2a, that is common to P450s. Pw2a may also serve as a product egress route in some P450s (Gerber, 1994; Lüdemann et al, 2000a, 2000b; Prasad et al, 2000; Mueller et al, 2003), such as soluble bacterial proteins. However, for membrane‐bound P450s, the pws for product egress and substrate access are likely to differ. A hydrophobic substrate is likely to enter the active site of the enzyme from the membrane, along pw2a; a hydroxylated water‐soluble product is likely to be released into the cytoplasm and requires a different pathway (Fig 2).. The number of crystal structures of mammalian P450s available is limited and the enzymatic mechanism of membrane‐bound P450s is poorly understood. Recently, the first crystal structure of a mammalian membrane‐associated P450 (CYP2C5) in complex with a substrate, 4‐methyl‐N‐methyl‐N‐(2‐phenyl‐2H‐pyrazol‐3‐yl) benzenesulphonamide (DMZ), ...
Cytochrome P450 2C9 antibody, Internal (cytochrome P450, family 2, subfamily C, polypeptide 9) for IHC-P, WB. Anti-Cytochrome P450 2C9 pAb (GTX81252) is tested in Human samples. 100% Ab-Assurance.
As the functional relevance of vascular CYP enzymes has only been really appreciated in the last 10 to 15 years, the pathophysiological role played by CYP-derived metabolites in the regulation of vascular homeostasis has not yet been fully elucidated. Although some data are available from animal models of hypertension and heart failure, most investigations into the importance of EETs in human cardiovascular regulation have been little more than simple pharmacological characterizations of the NO/PGI2-independent changes in vascular diameter and blood flow. Despite the limitations associated with studying human tissue, convincing evidence has recently been presented to suggest that a CYP-dependent EDHF plays a significant role in the regulation of coronary arteriolar tone by affecting K+Ca channel activation and smooth muscle hyperpolarization.23,31 Moreover, in coronary arterioles from healthy subjects, a CYP-dependent mechanism seems to account for flow-induced dilatation, with NO playing only a ...
Shimada T, Yamazaki H, Mimura M, Inui Y and Guengerich FP (1994) 0 Interindividual variations in human liver cytochrome P-450 enzymes involved in the oxidation of drugs, carcinogens and toxic chemicals: Studies with liver microsomes of 30 Japanese and 30 Caucasians. J Pharmacol Exp Ther 270: 414- ...
Authors: Goldstone, J.V., A.G. McArthur, A. Kubota, J. Zanette, T. Parente, M. Jönsson, D.R. Nelson, & J.J. Stegeman. BMC Genomics 2010, 11: 643.. Increasing use of zebrafish in drug discovery and mechanistic toxicology demands knowledge of cytochrome P450 (CYP) gene regulation and function. CYP enzymes catalyze oxidative transformation leading to activation or inactivation of many endogenous and exogenous chemicals, with consequences for normal physiology and disease processes. Many CYPs potentially have roles in developmental specification, and many chemicals that cause developmental abnormalities are substrates for CYPs. Here we identify and annotate the full suite of CYP genes in zebrafish, compare these to the human CYP gene complement, and determine the expression of CYP genes during normal development. Zebrafish have a total of 94 CYP genes, distributed among 18 gene families found also in mammals. There are 32 genes in CYP families 5 to 51, most of which are direct orthologs of human ...
The loss of cytochrome P450 (CYP)-dependent activity continues to be a problem in the use of cultured hepatocytes in xenobiotic toxicity studies. It has been reported that the inclusion of pyruvate and various hormones in the culture medium improves the maintenance of various hepatic functions, including that of CYP2C11 mRNA expression. We have studied this further, by investigating the effects of the addition of pyruvate and hormones on various CYP-dependent enzyme activities and on the CYP-dependent toxicity of precocene II in rat hepatocyte cultures. No beneficial effects of this medium supplementation could be demonstrated ...
Cytochrome P450 3A5兔单克隆抗体[EPR4396](ab108624)可与人样本反应并经WB, IP, IHC实验严格验证。所有产品均提供质保服务,中国75%以上现货。
Cytochrome P450 26B兔多克隆抗体(ab113236)可与人样本反应并经WB, IHC实验严格验证。中国75%以上现货,所有产品均提供质保服务,可通过电话、电邮或微信获得本地专属技术支持。
This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum. In rodents, the homologous protein has been shown to metabolize certain carcinogens; however, the specific function of the human protein has not been determined. Multiple transcript variants have been found for this gene. [provided by RefSeq, Jan 2016 ...
Autori: Cojocaru V., Balali-Mood K., Sansom M.S.P., Wade R.C.. Editorial: PLoS Computational Biology, 7(8):e1002152, 2011.. Rezumat:. The microsomal, membrane-bound, human cytochrome P450 (CYP) 2C9 is a liver-specific monooxygenase essential for drug metabolism. CYPs require electron transfer from the membrane-bound CYP reductase (CPR) for catalysis. The structural details and functional relevance of the CYP-membrane interaction are not understood. From multiple coarse grained molecular simulations started with arbitrary configurations of protein-membrane complexes, we found two predominant orientations of CYP2C9 in the membrane, both consistent with experiments and conserved in atomic-resolution simulations. The dynamics of membrane-bound and soluble CYP2C9 revealed correlations between opening and closing of different tunnels from the enzymes buried active site. The membrane facilitated the opening of a tunnel leading into it by stabilizing the open state of an internal aromatic gate. Other ...
Gentaur molecular products has all kinds of products like :search , Detroit R & D \ Monoclonal Anti-Cytochrome P450 2B1 \ P2B1PT for more molecular products just contact us
Gentaur molecular products has all kinds of products like :search , Detroit R & D \ Monoclonal Anti-Cytochrome P450 1A1 \ P1A1PT for more molecular products just contact us
Most drugs are metabolized by hepatic cytochrome P450 3A4 (CYP3A4), resulting in their reduced bioavailability. In this study, we present the design and
in this discovery process is to identify drug-drug supernatant were dissolved with four (4) volume of interactions. The most widespread procedure for this acetonitrile and 2µL were transferred to a 96-well is to perform cytochrome P450 (CYP) inhibition assays LazWell plate. The solvent was evaporated to dryness using human liver microsomes (HLM). The most at room temperature. This dilution step was necessary commonly used method for analyzing CYP inhibition to reduce the unvolatile content into the final dry assay samples is LC-MS/MS. However, this method is samples. The resulting dry samples were analyzed in time-consuming and represents the bottleneck in this LDTD-MS/MS. Labelled internal standard were used type of assay. To increase the throughput, we propose for OH-midazolam and OH-diclofenac only. Table 1 Incubation conditions of the CYP assay ...
human CYP2D6/Cytochrome P450 2D6 gene cDNA, cloning vector & expression plasmid, mutiple tags. Optimized for high expression in mammalian cells. Save up to 60%.
The cytochrome P450 2E1 ( CYP2E1 ) gene in Homo sapiens is located on chromosome 10 and is responsible for encoding a membrane-bound CYP2E1 protein,
EMA and FDA regulatory testing service for Cytochrome P450 Induction using human hepatocytes - assay protocol, data and your questions answered
Cytochrome P450 tests - Overview covers definition and results of tests that analyze the effectiveness of certain antidepressants.
Cytochrome P450 tests - Overview covers definition and results of tests that analyze the effectiveness of certain antidepressants.
Mouse Monoclonal Anti-POR/Cytochrome P450 Reductase Antibody (4G2). Validated: WB, Flow, IHC, IHC-P. Tested Reactivity: Human. 100% Guaranteed.
Your doctor may use cytochrome P450 tests (CYP450 tests) to help determine how your body processes (metabolizes) a drug. Our bodies contain numerous P450 enzymes to process medications. Because of inherited (genetic) traits which cause variations in these enzymes, medications affect each person differently.
Learn more about Cytochrome P450 Test medical procedure, risk, preparation, definitions, what to expect after and results at FindaTopDoc.
The constant does not belong to the scientific literature, but is a measure adopted in this database.. The lack of standardization of the studies makes for a very coarse interpretation of the induction-related variables. We recommend to directly investigate the sources.. The variables related to the "role" of substrate are important to understand how the same a.p. is metabolized by different enzymes. For example, if an a.i. is metabolized by several cytochromes, but, particularly, by a CYP3A4 inhibited by another a.p. the consequences on the blood concentration of the first a.p. will be higher than other inhibitions.. They are:. ...
Mouse Monoclonal Anti-Cytochrome P450 2E1 Antibody (5F11). Validated: WB, ICC/IF, IHC, IHC-P. Tested Reactivity: Human. 100% Guaranteed.
1EHF: Crystal structures of cytochrome P450nor and its mutants (Ser286Val, Thr) in the ferric resting state at cryogenic temperature: a comparative analysis with monooxygenase cytochrome P450s.
1EHG: Crystal structures of cytochrome P450nor and its mutants (Ser286Val, Thr) in the ferric resting state at cryogenic temperature: a comparative analysis with monooxygenase cytochrome P450s.
CYP2E1 antibody [9E6] (cytochrome P450, family 2, subfamily E, polypeptide 1) for ICC/IF, IHC-P, WB. Anti-CYP2E1 mAb (GTX84635) is tested in Human samples. 100% Ab-Assurance.
The body must have the minerals zinc and potassium in order to carry out a myriad of functions. Zinc makes up part of multiple metabolism enzymes, helps to...
View mouse Cyp4f14 Chr17:32905071-32917342 with: phenotypes, sequences, polymorphisms, proteins, references, function, expression
View mouse Cyp2r1 Chr7:114549682-114562972 with: phenotypes, sequences, polymorphisms, proteins, references, function, expression
Recombinant protein of human cytochrome P450, family 51, subfamily A, polypeptide 1 (CYP51A1), 20 ug available for purchase from OriGene - Your Gene Company.
Itoh S; Yanagimoto T; Tagawa S; et al. (1992). „Genomic organization of human fetal specific P-450IIIA7 (cytochrome P-450HFLa)-related gene(s) and interaction of transcriptional regulatory factor with its DNA element in the 5 flanking region". Biochim. Biophys. Acta. 1130 (2): 133-8. PMID 1562592 ...
Principal nameCYP2C11 antibodyAlternative names for CYP2C11 antibodyCytochrome P450 2C11, CYPIIC11, Cytochrome P450H, Cytochrome P450-UT-ASwissProt…
Melet, A., Marques-Soares, C., Schoch, G. A., Macherey, A. C., Jaouen, M., Dansette, P. M., Sari, M. A., Johnson, E. F., Mansuy, D. Analysis of human cytochrome P4502C8 substrate specificity using a substrate pharmacophore and site-directed mutants Biochemistry 2004 43:15379-15392 DOI:10.1021/bi0489309 PMID:15581350 ...
cytochrome P450 [cytochrome P450 hydroxylase PiKC] GTGCGCCGTACCCAGCAGGGAACGACCGCTTCTCCCCCGGTACTCGACCTCGGGGCCCTG GGGCAGGATTTCGCGGCCGATCCGTATCCGACGTACGCGAGACTGCGTGCCGAGGGTCCG GCCCACCGGGTGCGCACCCCCGAGGGGGACGAGGTGTGGCTGGTCGTCGGCTACGACCGG GCGCGGGCGGTCCTCGCCGATCCCCGGTTCAGCAAGGACTGGCGCAACTCCACGACTCCC CTGACCGAGGCCGAGGCCGCGCTCAACCACAACATGCTGGAGTCCGACCCGCCGCGGCAC ACCCGGCTGCGCAAGCTGGTGGCCCGTGAGTTCACCATGCGCCGGGTCGAGTTGCTGCGG CCCCGGGTCCAGGAGATCGTCGACGGGCTCGTGGACGCCATGCTGGCGGCGCCCGACGGC CGCGCCGATCTGATGGAGTCCCTGGCCTGGCCGCTGCCGATCACCGTGATCTCCGAACTC CTCGGCGTGCCCGAGCCGGACCGCGCCGCCTTCCGCGTCTGGACCGACGCCTTCGTCTTC CCGGACGATCCCGCCCAGGCCCAGACCGCCATGGCCGAGATGAGCGGCTATCTCTCCCGG CTCATCGACTCCAAGCGCGGGCAGGACGGCGAGGACCTGCTCAGCGCGCTCGTGCGGACC AGCGACGAGGACGGCTCCCGGCTGACCTCCGAGGAGCTGCTCGGTATGGCCCACATCCTG CTCGTCGCGGGGCACGAGACCACGGTCAATCTGATCGCCAACGGCATGTACGCGCTGCTC TCGCACCCCGACCAGCTGGCCGCCCTGCGGGCCGACATGACGCTCTTGGACGGCGCGGTG GAGGAGATGTTGCGCTACGAGGGCCCGGTGGAATCCGCGACCTACCGCTTCCCGGTCGAG ...
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.. ...
CYP2B2, 10 Blots. The Cytochrome P450 superfamily of enzymes is one of three enzyme systems which metabolize the fatty acid arachadonic acid (AA) to regulators of vascular tone.
As pointed out already, PGHS is primarily Trere to catalyse xenobiotic metabo- lism in extrahepatic tissues and cells with low cytochrome P450 activity. Bias adjustment analyzing longitudinal data with informative missingness.
ウサギ・ポリクローナル抗体 ab95047 交差種: Ms,Hu 適用: WB,IHC-P,Flow Cyt…CYP27B1抗体一覧…画像、プロトコール、文献などWeb上の情報が満載のアブカムの Antibody 製品。国内在庫と品質保証制度も充実。
These cases are from the Liver section of Gastrointestinal Imaging Cases. The specific content of each case and its diagnosis are necessarily concealed in this abstract. Each case contains case history, followed immediately by the diagnosis, which is supported with findings, differential diagnosis, teaching points, management, and further reading suggestions.
This is a case from the Mediastinal Vascular Cases section of Chest Imaging Cases. The specific content of each case and its diagnosis are necessarily hidden from this abstract. Each case contains case history, followed immediately by the diagnosis, which is supported with findings, differential diagnosis, teaching points, management, and further reading suggestions.
P-19 間質性腫瘍と浸潤癌が近接して存在した乳腺腫瘍 : 2症例についての吟味(乳腺1-(6),一般演題・示説,第45回 日本臨床細胞学会秋期大会) (2006 ...
P-6-4 傍乳頭憩室を合併した胆管結石症例の胆道機能評価及び胆道付加手術の適応に関する検討 (,パネルディスカッション6, 胆管結石に対する下部胆道付加手術の再評価) (1998 ...
Meier U.T., Meyer U.A.. The metabolism of the anticonvulsant mephenytoin is subject to a genetic polymorphism. In 2-5% of Caucasians and 18-23% of Japanese subjects a specific cytochrome P-450 isozyme, P-450 meph, is functionally deficient or missing. We have accumulated evidence that autoimmune antibodies observed in sera of patients with tienilic acid induced hepatitis (anti-liver kidney microsome 2 or anti-LKM2 antibodies) specifically recognize the cytochrome P-450 involved in the mephenytoin hydroxylation polymorphism. This is demonstrated by immunoinhibition and immunoprecipitation of microsomal (S)-mephenytoin 4-hydroxylation activity and by the recognition by anti-LKM2 antibodies of a single protein band on immunoblots of human liver microsomes after sodium dodecyl sulfate-polyacrylamide gel electrophoresis or isoelectric focusing. The cytochrome P-450 recognized by anti-LKM2 antibodies was immunopurified from microsomes derived from livers of extensive (EM) or poor metabolizers (PM) of ...
en] Cytochrome P-450-dependent monooxygenases are able to oxidize a large variety of endogenous and exogenous substrates. This paper describes the in vitro interaction between benzopyrene and steroids at the level of two rat liver monooxygenases: steroid-16 alpha-hydroxylase and aryl hydrocarbon hydroxylase (AHH). The results obtained suggest the following conclusions: (1) Steroid-16 alpha-hydroxylase is partially supported by a specific cytochrome P-450 form which is not inhibited in vitro by exogenous substrates. Steroid-16 alpha-hydroxylase is completely independent from cytochrome P1-450 (or P-448), as it is insensitive, in vitro, to alpha-naphthoflavone; (2) AHH is supported by two cytochrome P-450 forms: a specific form which is inducible by methylcholanthrene and inhibited in vitro by alpha-naphthoflavone, but is insensitive to metyrapone and steroids; and another less specific form which is inhibited by metyrapone and steroids in vitro ...
A form of human hepatic microsomal cytochrome P-450 (P450hA7) with subunit Mr 50,400 has been purified from an epileptic who had been receiving long-term treatment with anticonvulsant drugs. P450hA7 metabolized the immunosuppressant drug cyclosporin A and the dihydropyridine calcium channel antagonist nifedipine, but did not metabolize a similar dihydropyridine drug, nicardipine, nor a series of alkoxyresorufin model substrates. The hepatic microsomal concentration of P450hA7 was higher in five individuals who had been receiving long-term anticonvulsant treatment than in any of 21 individuals who had not been similarly treated. The mean P450hA7 concentration in the treated individuals was 5-fold higher than the mean concentration in the untreated individuals. It is concluded that P450hA7 is a member of the cytochrome P450III family which is induced by anticonvulsant drugs in man. ...
The relationships between the level of skatole in backfat, the rate of skatole metabolism in isolated liver microsomes, hepatic cytochrome P450IIE1 content and mRNA levels were investigated in Large White ✕ Landrace (LW) and the Meishan ✕ Landrace (M) breeds. A method based on thin layer chromatography was developed and used for measurement of microsomal skatole metabolism. Skatole metabolism by liver microsomes was inhibited by diallyl sulphide, a specific inhibitor of cytochrome P450IIE1 but not by inhibitors of other P450 isoforms. We have shown that the rate of skatole metabolism by liver microsomes was proportional to the microsomal P450IIE1 content. In LW pigs there was considerable variation in cytochrome P450IIE1 expression and P450IIE1 protein level and there was a significant negative correlation between backfat skatole level and hepatic microsomal cytochrome P450IIE1 content. Pigs exhibiting low P450IIE1 content in general also showed low levels of P450IIE1 mRNA. These results ...
Cytochrome P450s (CYPs) are a large, ubiquitous family of heme-containing monooxygenases that are responsible for the oxidative metabolism of a wide variety of drugs, environmental chemicals and endogenous compounds, such as steroids, prostaglandins and fatty acids[1].. Most cytochrome P450 systems are composed of a monooxygenase and one or two additional proteins, constituting an electron transfer chain. Genes encoding these components are either expressed individually or linked resulting in self sufficient CYPs. To some extent, the natural electron transport chain from NAD(P)H to the heme containing cytochrome P450 can be replaced by either homologues or different proteins with similar function e.g. flavodoxin and flavodoxin reductase to support catalytic activity[2]. Therefore, the activity of CYPs is not only determined by its abundance, but also by the abundance of the electron transport partners[3] and possibly by their molar ratio.. Eukaryotic CYPs are membrane associated and many of ...
TY - JOUR. T1 - Regulation of the cerebral circulation by cytochrome P450 epoxygenase activity. AU - Peng, Xinqi. AU - Carhuapoma, Juan R.. AU - Bhardwaj, Anish. AU - Alkayed, Nabil J.. AU - Harder, David R.. AU - Traystman, Richard J.. AU - Koehler, Raymond C.. PY - 2002/7/1. Y1 - 2002/7/1. N2 - Cytochrome P450 epoxygenases metabolize arachidonic acid into epoxyeicosatrienoic acids (EETs), which can dilate cerebral vessels. In glial cell cultures, glutamate stimulates the release of EETs. Thus, an astrocyte-based epoxygenase pathway could form a link in the coupling of blood flow to neuronal activity. To test this hypothesis, neuronal activation was produced by mechanical displacement of the whiskers of anesthetized rats while monitoring red cell flux by laser-Doppler flowmetry over whisker barrel sensory cortex. N-methylsulfonyl-6-(2-propargyloxyphenol) hexanamide (MS-PPOH) or miconazole, two different types of P450 epoxygenase inhibitors, were superfused over the cortical surface in different ...
Cytokines are thought to cause the depression of cytochrome P-450 (CYP)-associated drug metabolism in humans during inflammation and infection. We have examined the role of five cytokines, i.e., interleukin-1 beta, interleukin-4, interleukin-6, tumor necrosis factor-alpha, and interferon-gamma, on the expression of CYP1A2, CYP2C, CYP2E1, CYP3A, and epoxide hydrolase in primary human hepatocyte cultures. Steady state P-450 and epoxide hydrolase mRNA levels, as well as ethoxyresorufin-O-deethylase and nifedipine oxidation activities, which are mainly supported by CYP1A1/1A2 and CYP3A, respectively, were measured. Interleukin-1 beta, interleukin-6, and tumor necrosis factor-alpha were found to be the most potent depressors of P-450 enzymes. After 3 days of treatment, both mRNA levels and enzyme activities were depressed, typically by at least 40%, whatever the cytokine and the enzyme considered. Interferon-gamma also suppressed CYP1A2 and CYP2E1 mRNA levels and ethoxyresorufin-O-deethylase activity ...
2,4,5-TCP 4-monooxygenase (TftD) and 2,4,6-TCP 4-monooxygenase (TcpA) have been discovered in the biodegradation of 2,4,5-trichlorophenol (2,4,5-TCP) and 2,4,6-trichlorophenol (2,4,6-TCP). TcpA and TftD belong to the reduced flavin adenine dinucleotide (FADH2)-dependent monooxygenases and both use 2,4,6-TCP as a substrate; however, the two enzymes produce different end products. TftD catalyzes a typical monooxygenase reaction, while TcpA catalyzes a typical monooxygenase reaction followed by a hydrolytic dechlorination. We have previously reported the 3D structure of TftD and confirmed the catalytic residue, His289. Here we have determined the crystal structure of TcpA and investigated the apparent differences in specificity and catalysis between these two closely related monooxygenases through structural comparison. Our computational docking results suggest that Ala293 in TcpA (Ile292 in TftD) is possibly responsible for the differences in substrate specificity between the two monooxygenases. We have
TY - JOUR. T1 - Cloning of rat cytochrome P450RAI (CYP26) cDNA and regulation of its gene expression by all-trans-retinoic acid in vivo. AU - Wang, Y.. AU - Zolfaghari, R.. AU - Catharine, Ross A.. PY - 2002/5/15. Y1 - 2002/5/15. N2 - A novel retinoic acid (RA)-inducible cytochrome P450 (P450 RAI or CYP26), previously cloned from human, zebra fish, and mouse, functions in the metabolism of all-trans-RA to polar metabolites including 4-hydroxy-RA and 4-oxo-RA. To further study CYP26 in the rat model, we first cloned rat CYP26 cDNA. The nucleotide sequence predicts a 497-amino-acid protein whose sequence is 95% identical to mouse and 91% homologous to human CYP26. Animal studies showed that CYP26 mRNA expression is very low (0.01 ± 0.008; P , 0.05) in vitamin-A-deficient rats compared to pair-fed vitamin-A-sufficient rats (defined as 1.0). In a kinetic study, vitamin-A-deficient rats were treated with ∼ 100 μg of all-trans-RA and liver was collected after 3-72 h for analysis of CYP26 mRNA by ...
Expression and monooxygenase activity of various cytochrome P450 (CYP) enzymes along with constitutive androstane (CAR) and the pregnane X (PXR) receptors were investigated in the brain of control and phenobarbital-treated rabbits (80 mg/kg for 4 days). RT-PCR analysis, using specific primers, demonstrated that in control rabbits mRNAs of CYP 2A10, 2B4/5 and 3A6 were expressed, though to a different extent, in the liver, as well as in brain cortex, midbrain, cerebellum, striatum, hippocampus and hypothalamus, whilst CYP2A11 and 4B1 were not expressed in the hypothalamus. CAR was expressed in liver and all the brain regions examined, whereas the PXR was expressed only in liver and cortex. Real time RT-PCR analysis demonstrated that in vivo treatment with phenobarbital, in contrast with what happened in liver, did not induce the expression of CYP 2B4/5 mRNA in cortex, midbrain and cerebellum. NADPH cytochrome c reductase and some other enzymatic activities markers of CYP 2A, 2B, 3A and 4B ...
Many studies using mammalian cellular and subcellular systems have demonstrated that polycyclic aromatic hydrocarbons, including benzo[a]pyrene (BaP), are metabolically activated by cytochrome P450s (CYPs). In order to evaluate the role of hepatic versus extra-hepatic metabolism of BaP and its pharmacokinetics, we used the hepatic cytochrome P450 reductase null (HRN) mouse model, in which cytochrome P450 oxidoreductase, the unique electron donor to CYPs, is deleted specifically in hepatocytes, resulting in the loss of essentially all hepatic CYP function. HRN and wild-type (WT) mice were treated intraperitoneally (i.p.) with 125 mg/kg body wt BaP daily for up to 5 days. Clearance of BaP from blood was analysed by high-performance liquid chromatography with fluorescence detection. DNA adduct levels were measured by 32P-post-labelling analysis with structural confirmation of the formation of 10-(deoxyguanosin-N2-yl)-7,8,9-trihydroxy-7,8,9,10-tetrahydrobenzo[a]pyrene by liquid chromatography-tandem ...
In vitro studies were conducted to investigate the potential of gabapentin to inhibit the major cytochrome P450 enzymes (CYP1A2, CYP2A6, CYP2C9, CYP2C19, CYP2D6, CYP2E1, and CYP3A4) that mediate drug and xenobiotic metabolism using isoform selective marker substrates and human liver microsomal preparations! Meldonium is a white crystalline powder, with a melting point of 87 °C (189 °F)! Although prescription anti-fungal drugs play an important role in the treatment of a yeast infection, tenormin price philippines prominently they still do not address the underlying cause of the overgrowth of Candida in the first place? Pharmacology and Physiology for Anesthesia: Foundations and Clinical Applications! What Is Meldonium, And Why Do Athletes Like Maria Sharapova Take It. For example, tab dutas t composition I could give a 10 patients sugar pills, and tell them that it may cause some gastrointestinal discomfort? Psilocybin is the major hallucinognic constituent of the mushrooms and psilocin is ...
Cytochrome P-450 (P-450) 2A6 was purified by chromatography of human liver microsomes. The final preparation was electrophoretically homogeneous and contained 16 nmol of P-450/mg of protein. The amino-terminal amino acid sequence of the protein (first 13 residues) matched that of the reported cDNA exactly. The UV-visible spectrum indicated that the isolated hemoprotein was in the low-spin form. The protein was recognized by rabbit antibodies raised against rat P-450 2A1, and a rabbit antiserum against the P-450 2A6 preparation was also prepared. With these antibodies, it was estimated that P-450 2A6 accounted for a maximum of 1% of the total P-450 present in the human liver microsomes; the level varied greater than 100-fold among the 20 samples examined. Purified P-450 2A6 catalyzed coumarin 7-hydroxylation and 7-ethoxycoumarin O-deethylation at rates similar to those measured in the human liver sample used to prepare P-450 2A6, and these two microsomal activities were strongly inhibited by the ...
HETEROLOGE GENEXPRESSION, EXPRESSION VON FREMDGENEN (GENETIK); SACCHAROMYCES (MYKOLOGIE); CYTOCHROM-P-450-ABHÄNGIGE MONOOXYGENASEN (ENZYME); HETEROLOGOUS GENE EXPRESSION + EXPRESSION OF FOREIGN GENES (GENETICS); SACCHAROMYCES (MYCOLOGY); CYTOCHROME P-450 DEPENDENT MONOOXYGENASES (ENZYMES ...