Cytochrome b-245, cytochrome b(558) alpha chain, Cytochrome b558 Subunit Alpha, Cytochrome b558 Subunit Beta, cytochrome b-245 beta polypeptide, cytochrome b-245 heavy chain, Commercial Antibodies, cpg2 Antibodies
The expression of recombinant protein is essential for the investigation of the functions and properties of heme-containing protein as an electron carrier. For the expression of fully active recombinant protein, conversion of the expressed apoprotein into holoprotein is the most important and difficult problem. In this study, a system was developed for the production of heme-containing protein in a pure, recombinant holoprotein form, using the bovine cytochrome b5 tryptic fragment and Escherichia coli bacterioferritin as heterologous and homologous heme-containing model proteins, respectively. This system is based on the slow synthesis of recombinant apoprotein, which can maintain the balanced consumption of amino acids between protein synthesis and heme synthesis, so that the synthesized apoprotein continues to act as a heme sink. From a 1-l culture, 15 mg of cytochrome b5 and 40 mg of bacterioferritin were purified as pure holoprotein forms. Our expression system provides a rapid and simple ...
1I5U: Effects of charged amino-acid mutation on the solution structure of cytochrome b(5) and binding between cytochrome b(5) and cytochrome c.
1EHB: Crystal structure of recombinant trypsin-solubilized fragment of cytochrome b(5) and the structural comparison with Val61His mutant.
Ahuja, S., Jahr, N., Im, SC., Vivekanandan, S., Popovych, N., Le Clair, S., Huang, R., Soong, R., Xu, J., Yamamoto, K., Nanga, RP., Bridges, A., Waskell, L. and Ramamoorthy, A. A model of the membrane-bound cytochrome b5-cytochrome P450 complex from NMR and mutagenesis data. J. Biol. Chem. (in press) ...
The KOMP Repository is located at the University of California Davis and Childrens Hospital Oakland Research Institute. Question? Comments? For Mice, Cells, and germplasm please contact us at [email protected], US 1-888-KOMP-MICE or International +1-530-752-KOMP, or for vectors [email protected] or +1-510-450-7917 ...
Sulc M, Jecmen T, Snajdrova R, Novak P, Martinek V, Hodek P, Stiborova M, Hudecek J. Mapping of interaction between cytochrome P450 2B4 and cytochrome b5: the first evidence of two mutual orientations. Neuro Endocrinol Lett. 2012 Jan; 33(Suppl 3): 41-47 ...
The data consists of molecular sequences (cytochrome b, ND4, and R35) the final processing of which was done here at NCEAS. As is required for publication in most journals, the sequences have been depsoited in GENBANK. HTML links to GENBANK and preliminary list of accession numbers is provided.. ...
The bacterioferritin (BFR) of Escherichia coli is an iron-storage protein containing 24 identical subunits and between three and 11 protohaem IX groups per molecule. Titration with additional haem gave a maximum loading of 12-14 haems per molecule. The e.p.r. spectra and magnetic c.d. spectra of the protein-bound haem show it to be low-spin Fe(III), and coordinated by two methionine residues as previously reported for BFRs isolated from Pseudomonas aeruginosa and Azotobacter vinelandii [Cheesman, Thomson, Greenwood, Moore and Kadir, Nature (London) (1990) 346, 771-773]. A recent sequence alignment indicated that BFR may be structurally related to ferritin. The molecular model proposed for E. coli BFR has a four-alpha-helix-bundle subunit conformation and a quaternary structure similar to those of mammalian ferritins. In this model there are two types of hydrophobic pocket within which two methionine residues are correctly disposed to bind haem. The e.p.r. spectra also reveal a monomeric non-haem ...
5.B.2 The Eukaryotic Cytochrome b561 (Cytb561) Family. Cytochromes b561 are a family of transmembrane proteins found in many eukaryotic cells. Three evolutionarily related mammalian cytochromes b561 , are the chromaffin granule cytochrome b, duodenal cytochrome b, and lysosomal cytochrome b (Lane and Lawen, 2009; Oakhill et al., 2008; Su et al., 2006; Su and Asard, 2006; Zhang et al., 2006). They contain two haem b prosthetic groups per molecule coordinated with four His residues from four different transmembrane alpha-helices. Cytochromes b561, residing in chromaffin vesicles, are known to have a role for a neuroendocrine-specific transmembrane electron transfer from extravesicular ascorbate to an intravesicular monodehydroascorbate radical to regenerate ascorbate. Some members of the family lack the sequence for putative ascorbate-binding and exhibit a transmembrane ferrireductase activity. Nakanishi et al. (2007) proposed that cytochrome b561 has a specific function facilitating the concerted ...
Order Cytochrome B Reductase 1 ELISA Kits for many Reactivities. Human, Mouse and more. Compare Cytochrome B Reductase 1 ELISA Kits and find the right product on antibodies-online.com.
In bc complexes, cytochrome b plays a major role in electron transfer and in proton translocation across the membrane. Several inhibitor-resistant and respiratory-deficient mutants have already been used to study the structure-function relationships of this integral membrane protein. We describe here the selection and the molecular analysis of revertants from a thermo-sensitive mit-mutant of known nucleotide changes. Among 80 independent pseudo-wild type revertants screened by DNA-labelled oligonucleotide hybridization, 33 have been sequenced. Eight suppressor mutations, affecting a region critical for both the function and the binding of center o inhibitors (end of helix C) were identified. Two of them were found to be more resistant to myxothiazol. ...
Sigma-Aldrich offers abstracts and full-text articles by [Bin Deng, Sudharsan Parthasarathy, WenFang Wang, Brian R Gibney, Kevin P Battaile, Scott Lovell, David R Benson, Hao Zhu].
Cytochrome b reductase 1兔多克隆抗体(ab66048)可与小鼠, 人样本反应并经WB, IHC, ICC/IF实验严格验证并得到2个独立的用户反馈。所有产品均提供质保服务,中国75%以上现货。
Cytochromes |i|b|/i| |sub|561|/sub| constitute a novel class of transmembrane electron transport proteins present in large variety of eukaryotic cells, wit
Rabbit Polyclonal Anti-Cytochrome b reductase 1 Antibody. Validated: WB. Tested Reactivity: Human, Rhesus Macaque. 100% Guaranteed.
InterPro provides functional analysis of proteins by classifying them into families and predicting domains and important sites. We combine protein signatures from a number of member databases into a single searchable resource, capitalising on their individual strengths to produce a powerful integrated database and diagnostic tool.
Principal Investigator:YUBISUI Toshitsugu, Project Period (FY):1997 - 1998, Research Category:Grant-in-Aid for international Scientific Research, Section:Joint Research, Research Field:Functional biochemistry
Principal Investigator:YUBISUI Toshitsugu, Project Period (FY):1991 - 1992, Research Category:Grant-in-Aid for General Scientific Research (C), Research Field:General medical chemistry
An improved method for introducing point mutations into the mitochondrial cytochrme b gene to facilitate studying the role of cytochrome b in the formation of reactive oxygen species / B. Trumpower28 ...
Fig. 4. MAb B6.1 given i.p. protects mice against vaginal infection due to C. albicans (A) or C. tropicalis(B). Pseudoestrus mice were given MAb B6.1 or B6 i.p. before an i.vg. challenge with yeast. Negative controls were treated with DPBS alone or with hybridoma culture medium (HB101) that was concentrated and prepared as for antibody production. In panel A, additional controls received either MAb S9, which is specific for type III group B streptococcus polysaccharide, or MAb 54.1, which is specific for human neutrophil cytochrome b. MAb B6.1-treated and MAb B6-treated mice developed approximately 91 and 51% fewer CFU, respectively, than the DPBS negative controls (P , 0.001 and P , 0.01, respectively). The medium alone and the irrelevant MAbs were not protective (A). A similar result was observed with vaginal infection due to C. tropicalis (B). The differences between MAb B6.1-treated mice and control mice were statistically significant (P , 0.01), but the differences between MAb B6-treated ...
Gentaur molecular products has all kinds of products like :search , EIAab \ COB,Complex III subunit 3,Complex III subunit III,CYTB,Cytochrome b,Cytochrome b-c1 complex subunit 3,Homo sapiens,Human,MTCYB,MT-CYB,Ubiquinol-cytochrome-c reductase complex cytochrome b subunit \ EIAAB10234 for more molecular products just contact us
Cytochrome b-245 heavy chain also known as cytochrome b(558) subunit beta or NADPH oxidase 2 or Nox2 is a protein that in humans is encoded by the CYBB gene. The protein is a super-oxide generating enzyme which forms reactive oxygen species (ROS). Nox2, or Cytochrome b (-245) is composed of cytochrome b alpha (CYBA) and beta (CYBB) chain. It has been proposed as a primary component of the microbicidal oxidase system of phagocytes. Nox2 is the catalytic, membrane-bound subunit of NADPH oxidase. It is inactive until it binds to the membrane-anchored p22phox, forming the heterodimer known as flavocytochrome b558. After activation, the regulatory subunits p67phox, p47phox, p40phox and a GTPase, typically Rac, are recruited to the complex to form NADPH oxidase on the plasma membrane or phagosomal membrane. Nox2 itself is composed of an N-terminal transmembrane domain that binds two heme groups, and a C-terminal domain that is able to bind to FAD and NADPH. There has been recent evidence that it plays ...
It has two subspecies: G. c. canorus, native to mainland Asia, and G. c. owstoni of Hainan Island. The Taiwan hwamei (Leucodioptron taewanum) was formerly considered to be a subspecies of the Chinese hwamei but has recently been split as a separate species. Based on a study of the mitochondrial cytochrome b gene, Li et al. (2006) suggested that the two species diverged about 1.5 million years ago with the two Chinese hwamei subspecies diverging about 600,000 years ago.[3] The two were formerly placed in the genus Garrulax with the other laughingthrushes but have recently been moved to a new genus Leucodioptron.. The Chinese hwamei was introduced to Taiwan in large numbers in the 1980s and hybridization with the native Taiwan hwamei is occurring which may threaten the genetic uniqueness of the latter form.[4]. ...
Component of the ubiquinol-cytochrome c reductase complex (complex III or cytochrome b-c1 complex) that is part of the mitochondrial respiratory chain. The b-c1 complex mediates electron transfer from ubiquinol to cytochrome c. Contributes to the generation of a proton gradient across the mitochondrial membrane that is then used for ATP synthesis ...
Zhang H.; Somerville C., 1988: The primary structure of chicken liver cytochrome b 5 deduced from the dna sequence of complementary dna clone
Please be advised that we experienced an unexpected issue that occurred on Saturday and Sunday January 20th and 21st that caused the site to be down for an extended period of time and affected the ability of users to access content on Wiley Online Library. This issue has now been fully resolved. We apologize for any inconvenience this may have caused and are working to ensure that we can alert you immediately of any unplanned periods of downtime or disruption in the future ...
Formation of the N-N bond from nitric oxide by a membrane-bound cytochrome bc complex of nitrate-respiring (denitrifying) Pseudomonas ...
Expression of CYBRD1 (CYB561A2, DCYTB, FLJ23462, FRRS3) in adrenal gland tissue. Antibody staining with HPA014757 in immunohistochemistry.
Expression of CYBRD1 (CYB561A2, DCYTB, FLJ23462, FRRS3) in placenta tissue. Antibody staining with HPA014757 in immunohistochemistry.
InterPro provides functional analysis of proteins by classifying them into families and predicting domains and important sites. We combine protein signatures from a number of member databases into a single searchable resource, capitalising on their individual strengths to produce a powerful integrated database and diagnostic tool.
Searching For Genes By AGI Locus Number To search for a gene using the AGI Locus number, simply put the Locus Number in the Text To Search For box, and select either All of the Site or the specific gene family (eg. Arabidopsis P450 pages) for the Where To Search box. ...
p>The checksum is a form of redundancy check that is calculated from the sequence. It is useful for tracking sequence updates.,/p> ,p>It should be noted that while, in theory, two different sequences could have the same checksum value, the likelihood that this would happen is extremely low.,/p> ,p>However UniProtKB may contain entries with identical sequences in case of multiple genes (paralogs).,/p> ,p>The checksum is computed as the sequence 64-bit Cyclic Redundancy Check value (CRC64) using the generator polynomial: x,sup>64,/sup> + x,sup>4,/sup> + x,sup>3,/sup> + x + 1. The algorithm is described in the ISO 3309 standard. ,/p> ,p class="publication">Press W.H., Flannery B.P., Teukolsky S.A. and Vetterling W.T.,br /> ,strong>Cyclic redundancy and other checksums,/strong>,br /> ,a href="http://www.nrbook.com/b/bookcpdf.php">Numerical recipes in C 2nd ed., pp896-902, Cambridge University Press (1993),/a>),/p> Checksum:i ...
encoding the small sub-unit, p22-phox protein, of the cytochrome b 558 of the NADPH oxidase that plays a crucial role in NADPH-dependent reactive oxygen species ...
Gene target information for CYB561D1 - cytochrome b561 family member D1 (human). Find diseases associated with this biological target and compounds tested against it in bioassay experiments.
Use Bio-Rads PrimePCR assays, controls, templates for your target gene. Every primer pair is optimized, experimentally validated, and performance guaranteed.
Buy PETG Sheet online at Curbell Plastics. Large or small orders, cut to size. Stocked inventory. ISO certified plastic supplier, US locations.
The major b-type cytochrome in microsomal membrane preparations from developing endosperm of castor bean (Ricinus communis) was cytochrome b5. Cytochrome P-450 was also present. The microsomal membranes had delta 12-hydroxylase activity and catalysed the NAD(P)H-dependent hydroxylation of oleate to yield ricinoleic acid. CO had no effect on the hydroxylase activity. Rabbit polyclonal antibodies were raised against the hydrophilic cytochrome b5 fragment purified from cauliflower (Brassica oleracea) floret microsomes. The anti-(cytochrome b5) IgG inhibited delta 12-hydroxylase, delta 12-desaturase and cytochrome c reductase activity in the microsomes. The results indicate that electrons from NAD(P)H were transferred to the site of hydroxylation via cytochrome b5 and that cytochrome P-450 was not involved. ...
Arabidopsis has four putative, di-heme cytochrome b561 proteins, including one localized in the tonoplast (TCytb). From a comparative electron paramagnetic resonance (EPR), UVVis absorption and resonance Raman study, on wild type, H83A/H156A-TCytb and H83L/H156L-TCytb double mutants, it follows that the H83 and H156 residues are binding one of the two hemes. These measurements show that the high-potential heme site is situated at the cytoplasmic side of the membrane and allow the unambiguous differentiation between two models on the heme localization in cytochrome b561 proteins. ...
Shop Probable Ni/Fe-hydrogenase 1 B-type cytochrome ELISA Kit, Recombinant Protein and Probable Ni/Fe-hydrogenase 1 B-type cytochrome Antibody at MyBioSource. Custom ELISA Kit, Recombinant Protein and Antibody are available.
References for Abcams Recombinant Human Cytochrome b5 protein (ab56987). Please let us know if you have used this product in your publication
We have previously described the development of genetic models to study the in vivo functions of the hepatic cytochrome P450 system, through the hepatic deletion of either cytochrome P450 oxidoreductase (POR; HRN line) or cytochrome b5 (Cyb5; HBN line). However, HRN mice still exhibit low levels of mono-oxygenase activity, in spite of the absence of detectable reductase protein. To investigate whether this is because cytochrome b5 and cytochrome b5 reductase can act as sole electron donors to the P450 system, we have crossed HRN with HBN mice to generate a line lacking hepatic expression of both electron donors (HBRN). HBRN mice exhibited exacerbation of the phenotypic characteristics of the HRN line - liver enlargement, hepatosteatosis and increased expression of certain cytochrome P450s. Also, drug metabolising activities in vitro were further reduced relative to the HRN model, in some cases to undetectable levels. Pharmacokinetic studies in vivo demonstrated that midazolam half-life, Cmax and ...
colored green, blue and red) of each monomeric unit have a direct role in the passage of electrons in the respiratory chain. The grey peptides are not assigned a function in the current mechanism of redox reactions of Complex III, but they do have other catalytic activities and functions. For the most part, the two subunits of cytochrome b (colored green) are buried in the complex and have minimal exposure to the intermembrane space and matrix. Cytochrome c1 subunits are positioned on top of cytochrome b and their outer surfaces are exposed to the intermembrane space. They are held in place by helical tails that extend deep into the complex and the membrane. The Rieske subunits are Fe/S proteins with three domains: membrane domain - long helical segment that extends into the membrane, hinge domain - short segment between the membrane and head domains, and head domain - contains the Fe/S center and occupies space in the other monomeric unit. Therefore, as will be shown below, the Fe/S center ...
Cytochrome P450s (cyt.P450s) are a class of hemoprotein enzymes found in a wide variety of organisms, where they play an important role in endogenous metabolism and the metabolism of xenobiotic...
1999 (English)In: Biochemistry, ISSN 0006-2960, E-ISSN 1520-4995, Biochem, Vol. 38, 10578-10584 p.Article in journal (Refereed) Published ...
Cytochrome b reductase 1 antibody [C2C3], C-term (cytochrome b reductase 1) for WB. Anti-Cytochrome b reductase 1 pAb (GTX104793) is tested in Human samples. 100% Ab-Assurance.
Cytochrome b reductase 1 antibody, C-term (cytochrome b reductase 1) for IHC-P. Anti-Cytochrome b reductase 1 pAb (GTX89592) is tested in Human, Mouse samples. 100% Ab-Assurance.
Thank you for your interest in spreading the word about Biochemical Journal.. NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address.. ...
Using complete cytochrome b sequence data, we determined that the genus Calcarius, as presently recognized, is paraphyletic. Calcarius plus Plectrophenax form a highly supported clade composed of two subclades, a
Cytochrome P450 17A1 Proteins available through Novus Biologicals. Browse our Cytochrome P450 17A1 Protein catalog backed by our Guarantee+.
Mohon maaf, kami belum menyediakan peta untuk retret 21-22 Juli ini. Peta yang Bapak lihat adalah peta tempat retret yang sebelumnya ...
购买我们的重组人Cytochrome P450 4A11/22蛋白。Ab114572为全长蛋白,在小麦胚芽中生产并经过SDS-PAGE, Western blot, ELISA实验验证。Abcam提供免费的实验方案,操作技巧及专业的支持。
MetabolismEnergy metabolismElectron transportcytochrome aa3 quinol oxidase, subunit IV (TIGR02901; EC 1.10.3.-; HMM-score: 104.3) ...
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.. ...
There are well-known difficulties in using the cytochrome oxidase I (COI) mitochondrial gene region for population genetics and DNA barcoding in corals. A recent study of species divergence in the endemic Caribbean genus Agaricia reinforced such knowledge. However, the growing availability of whole mitochondrial genomes may help indicate more promising gene regions for species delineation. I assembled the whole mitochondrial genome for Agaricia fragilis from Illumina single-end 250bp reads and compared this sequence to that of the congener A. humilis. Although these data suggest that the cytochrome b (CYB) gene region is more promising, comparison of all available Scleractinian CYB sequence data indicates that multilocus approaches are still probably necessary for phylogenetic and population genetic analysis of recently-diverged coral taxa.
article{914d9e2c-3c9b-4351-8914-f4d9ab597cb6, abstract = {Research in avian blood parasites has seen a remarkable increase since the introduction of polymerase chain reaction-based methods for parasite identification. New data are revealing complex multihost-multiparasite systems which are difficult to understand without good knowledge of the host range and geographical distribution of the parasite lineages. However, such information is currently difficult to obtain from the literature, or from general repositories such as GenBank, mainly because (i) different research groups use different parasite lineage names, (ii) GenBank entries frequently refer only to the first host and locality at which each parasite was sampled, and (iii) different researchers use different gene fragments to identify parasite lineages. We propose a unified database of avian blood parasites of the genera Plasmodium, Haemoproteus and Leucocytozoon identified by a partial region of their cytochrome b sequences. The ...
Abstract. Cytochrome b (cyt b) gene complete sequences (1143bp) of Takydromus sylvaticus were sequenced. In order to clarify the phylogenetic position of the Takydromus sylvaticus, we investigated the phylogeny of 15 Takydromus spp. distributed in East-Asia by Maximum Parsimony (MP), Bayesian Inference (BI), and Maximum Likelihood (ML) methods using DNA fragments of cyt b genes. The results supported that the Platyplacopus merged into Takydromus and negated the validity of Platyplacopus. Furthermore, the prediction of tertiary structures of cyt b exhibited the CD loop region contain two short helices forming a hairpin arrangement, namely cd1 and cd2. Thermostability analysis shows that the CD-loop region is unstable thermodynamically and may provide mobility to amino acids located at the heme, and might provide high flexibility to the top of ISP (iron-sulfur protein) and the cavity region of Qo binding site. It suggested that the two short helices of CD loop region of cyt b was a dominating ...
Authors: SERAP MUTUN, HÜLYA KARAGÖZOĞLU Abstract: Abstract: Genetic diversity and diversification of the Anatolian populations of Andricus lignicola (Hartig, 1840) (Hymenoptera: Cynipidae) were investigated using 433 base pairs of the mitochondrial cytochrome b gene. Eighteen distinct haplotypes from 15 populations were determined. Analyses indicated average haplotype and nucleotide diversity as 0.325 and 0.008, respectively. Phylogenetic analyses conducted through the application of maximum likelihood and maximum parsimony produced similar topologies with two major clade structures supported by high bootstrap values. Bayesian analysis produced more polytomies without major basal groupings of the haplotypes. Parsimony network analysis revealed four haplogroups, and the largest group comprised half of the haplotypes. Our preliminary ABGD analysis implied the presence of four hidden lineages with the possibility of a cryptic species complex within A. lignicola. Hierarchical F-statistics (AMOVA) ...
Nucleotide sequences of a 0.7kb portion of the mitochondrial cytochrome b gene were analyzed using Japanese species of water striders belonging to the subgenus Macrogerris. Although the sequences were rather homogeneous among individuals within both Gerris gracilicornis and G. yezoensis, considerable variation was observed among insects showing conventionally recognized diagnostic characteristics of G. insularis. Results of molecular phylogenetic analyses clearly indicated that there are three distinct lineages, designated as types A, B, and C, among these latter insects. Comparisons of nucleotide sequences indicated that genetic distances among these lineages were much larger than those between G. gracilicornis and G. yezoensis. From PCR-RFLP analyses of insects collected from 35 localities, it was revealed that the geographic distributions of types B and C were divided between northeastern Honshu island and western Japan including Kyushu island and central to western Honshu island, whereas ...
MalaCards based summary : Chronic Granulomatous Disease, Autosomal, Due to Deficiency of Cyba, is also known as granulomatous disease, chronic, autosomal recessive, cytochrome b-negative, and has symptoms including hepatomegaly, splenomegaly and hepatic abscesses due to immunodeficiency. An important gene associated with Chronic Granulomatous Disease, Autosomal, Due to Deficiency of Cyba is CYBA (Cytochrome B-245 Alpha Chain). Affiliated tissues include neutrophil, testes and skin ...
Autor: Kobayashi, K. et al.; Genre: Zeitschriftenartikel; Im Druck veröffentlicht: 2002-08; Titel: Monolayer formation of cytochrome b(562) on gold surfaces and its reconstitution reaction, studied by surface plasmon resonance spectroscopy
Mitochondrial 12S and cytochrome B sequences were identical in all four animals and confirmed that the monkeys were M. sphinx [9, 10]. In addition, the cytochrome B sequences were indistinguishable from the recently described northern mandrill haplotype (Figure 1B) [10], suggesting that the captive animals descended from founders originating from a locale north of the Ogooué River (see Figure 1A). SIV-pol fragments could be amplified from PBMC of both adult mandrills CAS and REB with the primer set specific for SIVmnd2, but not with SIVmnd1 specific primers. However, analysis of the cloned fragments showed that these were 96-97% identical to SIVdrl-1FAO (GenBank acc. no. AY159321) isolated from a drill monkey (Mandrillus leucophaeus), with a lower sequence identity to SIVmnd2 (± 85% to GenBank acc. no. AF367411), and to SIVmnd1 (,64% to GenBank acc. no. M27470). Although SIVmnd2 and SIVdrl are more closely related to each other than the two SIVmnd strains, SIVdrl has several mismatches with ...
The evolutionary relationships among the Carnivora were studied in a phylogenetic analysis based on the complete mitochondrial cytochrome bgene. The study, which addressed primarily the...
article{44846ede-d441-4e41-b7e9-5579df433b3c, abstract = {Heme A is a prosthetic group of many respiratory oxidases. It is synthesized from protoheme IX (heme B) seemingly with heme O as a stable intermediate. The Bacillus subtilis ctaA and ctaB genes are required for heme A and heme O synthesis, respectively (B. Svensson, M. Lubben, and L. Hederstedt, Mol. Microbiol. 10:193-201, 1993). Tentatively, CtaA is involved in the monooxygenation and oxidation of the methyl side group on porphyrin ring D in heme A synthesis from heme B. B. subtilis ctaA and ctaB on plasmids in both B. subtilis and Escherichia coli were found to result in a novel membrane-bound heme-containing protein with the characteristics of a low-spin b type cytochrome. It fan be reduced via the respiratory chain, and in the reduced state it shows light absorption maxima at 428, 528, and 558 nm and the or-band is split. Purified cytochrome isolated from both B. subtilis and E. coli membranes contained one polypeptide identified as ...
ENCODES a protein that exhibits superoxide-generating NADPH oxidase activator activity (inferred); INVOLVED IN phagocytosis (inferred); positive regulation of catalytic activity (inferred); respiratory burst (inferred); PARTICIPATES IN Leishmaniasis pathway; ASSOCIATED WITH 1q24 Deletion Syndrome (ortholog); Acute Otitis Media (ortholog); Alzheimers disease (ortholog); FOUND IN NADPH oxidase complex (inferred)
De begeleider en/of auteur heeft geen toestemming gegeven tot het openbaar maken van de scriptie. The supervisor and/or the author did not authorize public publication of the thesis.. ...
Thank you for sharing this Journal of Pharmacology and Experimental Therapeutics article.. NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.. ...
This gene is a member of the cytochrome b(561) family that encodes an iron-regulated protein. It highly expressed in the duodenal brush border membrane. It has ferric reductase activity and is believed to play a physiological role in dietary iron absorption. [provided by RefSeq, Jul 2008] ...
Chronic granulomatous disease (CGD) refers to heterogeneous group of inherited immune deficiency disorders characterised by inability to destroy phagocyted catalase positive bacterias due to lack of NADPH oxidase which results in formation of gra...
Learn more about Chronic Granulomatous Disease at Grand Strand Medical Center DefinitionCausesRisk FactorsSymptomsDiagnosisTreatmentPreventionrevision ...
Chronic Granulomatous Disease information including symptoms, diagnosis, misdiagnosis, treatment, causes, patient stories, videos, forums, prevention, and prognosis.
Learn more about Chronic Granulomatous Disease at West Hills Hospital DefinitionCausesRisk FactorsSymptomsDiagnosisTreatmentPreventionrevision ...
... , somatic Cytochrome c with heme Available structures: 1j3s, 2b4z Identifiers Symbol(s) CYCS; HCS; CYC External IDs OMIM: 123970
Mexicos |a href=http://www.volcano.si.edu/world/volcano.cfm?vnum=1401-09=|Popocatépetl|/a| always gets peoples attention - this is |a href=http://bigthink.com/ideas/38717|thanks to its proximity|/a| to Mexico City. Whenever you juxtapose an active volcano with one of the worlds most populous cities, you know that the news will latch onto any activity quickly. This is why we saw a blast of article late ...
Cytochrome P450 tests - Overview covers definition and results of tests that analyze the effectiveness of certain antidepressants.
Cytochrome P450 tests - Overview covers definition and results of tests that analyze the effectiveness of certain antidepressants.
CYBB - CYBB (GFP-tagged) - Human cytochrome b-245, beta polypeptide (CYBB) available for purchase from OriGene - Your Gene Company.
human NCF2 protein: neutrophil cytosolic factor 2 (65kDa, chronic granulomatous disease, autosomal 2); RefSeq NM_000433.2; NP_000424.2
cytochrome P450 [cytochrome P450 hydroxylase PiKC] GTGCGCCGTACCCAGCAGGGAACGACCGCTTCTCCCCCGGTACTCGACCTCGGGGCCCTG GGGCAGGATTTCGCGGCCGATCCGTATCCGACGTACGCGAGACTGCGTGCCGAGGGTCCG GCCCACCGGGTGCGCACCCCCGAGGGGGACGAGGTGTGGCTGGTCGTCGGCTACGACCGG GCGCGGGCGGTCCTCGCCGATCCCCGGTTCAGCAAGGACTGGCGCAACTCCACGACTCCC CTGACCGAGGCCGAGGCCGCGCTCAACCACAACATGCTGGAGTCCGACCCGCCGCGGCAC ACCCGGCTGCGCAAGCTGGTGGCCCGTGAGTTCACCATGCGCCGGGTCGAGTTGCTGCGG CCCCGGGTCCAGGAGATCGTCGACGGGCTCGTGGACGCCATGCTGGCGGCGCCCGACGGC CGCGCCGATCTGATGGAGTCCCTGGCCTGGCCGCTGCCGATCACCGTGATCTCCGAACTC CTCGGCGTGCCCGAGCCGGACCGCGCCGCCTTCCGCGTCTGGACCGACGCCTTCGTCTTC CCGGACGATCCCGCCCAGGCCCAGACCGCCATGGCCGAGATGAGCGGCTATCTCTCCCGG CTCATCGACTCCAAGCGCGGGCAGGACGGCGAGGACCTGCTCAGCGCGCTCGTGCGGACC AGCGACGAGGACGGCTCCCGGCTGACCTCCGAGGAGCTGCTCGGTATGGCCCACATCCTG CTCGTCGCGGGGCACGAGACCACGGTCAATCTGATCGCCAACGGCATGTACGCGCTGCTC TCGCACCCCGACCAGCTGGCCGCCCTGCGGGCCGACATGACGCTCTTGGACGGCGCGGTG GAGGAGATGTTGCGCTACGAGGGCCCGGTGGAATCCGCGACCTACCGCTTCCCGGTCGAG ...
MetabolismEnergy metabolismElectron transportcytochrome aa3 quinol oxidase, subunit III (TIGR02897; EC 1.10.3.-; HMM-score: 359) ...
Microsomal cytochrome b (5) is a ubiquitous, 15.2 kDa haemoprotein implicated in a number of cellular processes such as fatty acid desaturation, drug metabolism, steroid hormone biosynthesis and methaemoglobin reduction. As a consequence of these functions this protein has been considered essential for life. Most of the ascribed functions of cytochrome b (5), however, stem from in vitro studies and for this reason we have carried out a germline deletion of this enzyme. We have unexpectedly found that cytochrome b (5) null mice were viable and fertile, with pups being born at expected Mendelian ratios. However, a number of intriguing phenotypes were identified, including altered drug metabolism, methaemoglobinemia and disrupted steroid hormone homeostasis. In addition to these previously identified roles for this protein, cytochrome b (5) null mice displayed skin defects closely resembling those observed in autosomal recessive congenital ichthyosis and retardation of neonatal development, ...
To elucidate the phylogenetic relationships among four species belonging to the genus Petaurista (P. alborufus castaneus, P. alborufus lena, P. leucogenys leucogenys, P. leucogenys nikkonis, P. petaurista melanotus, and P. philippensis grandis), we investigated the partial sequences (1,068 bp) of the mitochondrial cytochrome b gene for these giant flying squirrels. Phylogenetic trees (NJ, MP, and ML trees) constructed from cytochrome b sequences indicated that P. leucogenys was grouped independently with other species, and that P. philippensis was most closely related to P. petaurista with 99-100% bootstrap values. In addition, two subspecies of P. alborufus did not form a single clade : P. alborufus castaneus from China was most distantly related to the other species, whereas P. alborufus lena from Taiwan was closely related to P. petaurista and P. philippensis with 82-90% bootstrap values. This result suggests that it is reasonable to regard P. alborufus lena as a distinct species from P. alborufus
Chronic granulomatous disease is a disorder that causes the immune system to malfunction, resulting in a form of immunodeficiency. Immunodeficiencies are conditions in which the immune system is not able to protect the body from foreign invaders such as bacteria and fungi. Individuals with chronic granulomatous disease may have recurrent bacterial and fungal infections. People with this condition may also have areas of inflammation (granulomas) in various tissues that can result in damage to those tissues. The features of chronic granulomatous disease usually first appear in childhood, although some individuals do not show symptoms until later in life.. People with chronic granulomatous disease typically have at least one serious bacterial or fungal infection every 3 to 4 years. The lungs are the most frequent area of infection; pneumonia is a common feature of this condition. Individuals with chronic granulomatous disease may develop a type of fungal pneumonia, called mulch pneumonitis, which ...
A gene encoding Bfr (bacterioferritin) was identified and isolated from the genome of Desulfovibrio vulgaris cells, and overexpressed in Escherichia coli. In vitro, H(2)O(2) oxidizes Fe(2+) ions at much higher reaction rates than O(2). The H(2)O(2) oxidation of two Fe(2+) ions was proven by Mossbauer spectroscopy of rapid freeze-quenched samples. On the basis of the Mossbauer parameters of the intermediate species we propose that D. vulgaris Bfr follows a mineralization mechanism similar to the one reported for vertebrate H-type ferritins subunits, in which a diferrous centre at the ferroxidase site is oxidized to diferric intermediate species, that are subsequently translocated into the inner nanocavity. D. vulgaris recombinant Bfr oxidizes and stores up to 600 iron atoms per protein. This Bfr is able to bind DNA and protect it against hydroxyl radical and DNase deleterious effects. The use of H(2)O(2) as an oxidant, combined with the DNA binding and protection activities, seems to indicate a ...
Iron-storage protein, whose ferroxidase center binds Fe(2+) ions, oxidizes them by dioxygen to Fe(3+), and participates in the subsequent Fe(3+) oxide mineral core formation within the central cavity of the protein complex.
Looking for online definition of cytochrome p450 XVIIA1 in the Medical Dictionary? cytochrome p450 XVIIA1 explanation free. What is cytochrome p450 XVIIA1? Meaning of cytochrome p450 XVIIA1 medical term. What does cytochrome p450 XVIIA1 mean?
Sell PETG Container/ Cosmetic/ Ointment(id:10686292) - Selling Leads posted by Zhejiang Jinsheng Packaging Co., Ltd.. Source for PETG container, Cosmetic PETG Jar, Plastic Cosmetic Container, Ointment Container here.
This gene encodes the smallest known component of the ubiquinol-cytochrome c reductase complex, which forms part of the mitochondrial respiratory chain. The encoded protein may function as a binding factor for the iron-sulfur protein in this complex. [provided by RefSeq, Oct 2009 ...
Learn more about Chronic Granulomatous Disease at LewisGale Regional Health System DefinitionCausesRisk FactorsSymptomsDiagnosisTreatmentPreventionrevision ...
Biogenesis of respiratory cytochromes is defined as consisting of the posttranslational processes that are necessary to assemble apoprotein, heme, and sometimes additional cofactors into mature enzyme complexes with electron transfer functions. Different biochemical reactions take place during maturation: (i) targeting of the apoprotein to or through the cytoplasmic membrane to its subcellular destination; (ii) proteolytic processing of precursor forms; (iii) assembly of subunits in the membrane and oligomerization; (iv) translocation and/or modification of heme and covalent or noncovalent binding to the protein moiety; (v) transport, processing, and incorporation of other cofactors; and (vi) folding and stabilization of the protein. These steps are discussed for the maturation of different oxidoreductase complexes, and they are arranged in a linear pathway to best account for experimental findings from studies concerning cytochrome biogenesis. The example of the best-studied case, i.e., ...
Autori: Cojocaru V., Balali-Mood K., Sansom M.S.P., Wade R.C.. Editorial: PLoS Computational Biology, 7(8):e1002152, 2011.. Rezumat:. The microsomal, membrane-bound, human cytochrome P450 (CYP) 2C9 is a liver-specific monooxygenase essential for drug metabolism. CYPs require electron transfer from the membrane-bound CYP reductase (CPR) for catalysis. The structural details and functional relevance of the CYP-membrane interaction are not understood. From multiple coarse grained molecular simulations started with arbitrary configurations of protein-membrane complexes, we found two predominant orientations of CYP2C9 in the membrane, both consistent with experiments and conserved in atomic-resolution simulations. The dynamics of membrane-bound and soluble CYP2C9 revealed correlations between opening and closing of different tunnels from the enzymes buried active site. The membrane facilitated the opening of a tunnel leading into it by stabilizing the open state of an internal aromatic gate. Other ...
Buy our Recombinant human FES protein. Ab51411 is an active full length protein produced in Baculovirus infected Sf9 cells and has been validated in FuncS…
The structural features of cytochrome oxidases are reviewed in light of their evolution. The substrate specificity (quinol vs. cytochromec) is reflected in
Your doctor may use cytochrome P450 tests (CYP450 tests) to help determine how your body processes (metabolizes) a drug. Our bodies contain numerous P450 enzymes to process medications. Because of inherited (genetic) traits which cause variations in these enzymes, medications affect each person differently.
This study demonstrated that Aβ binding to RAGE at the CECs and astrocytes surface is required for NADPH oxidase complex assembling, resulting in subsequent ROS generation and phosphorylation of cPLA2α. Therefore, understanding precise molecular mechanisms underlying Aβ mediated oxidative damage may provide new insights into the development of preventive and treatment strategies for AD ...
This is beyond tasteless, but what can we expect from the wide-eyed chinchilla-buggerers at Peta? Now if youll excuse me, Im going to eat an entire fuckin…
The evolutionary origin of photosynthetic reaction centers has long remained elusive. Here, we use sequence and structural analysis to demonstrate an evolutionary link between the cytochrome b subunit of the cytochrome bc(1) complex and the core polypeptides of the photosynthetic bacterial reaction center. In particular, we have identified an area of significant sequence similarity between a three contiguous membrane-spanning domain of cytochrome b, which contains binding sites for two hemes, and a three contiguous membrane-spanning domain in the photosynthetic reaction center core subunits, which contains binding sites for cofactors such as (bacterio)chlorophylls, (bacterio)pheophytin and a non-heme iron. Three of the four heme ligands in cytochrome b are found to be conserved with the cofactor ligands in the reaction center polypeptides. Since cytochrome b and reaction center polypeptides both bind tetrapyrroles and quinones for electron transfer, the observed sequence, functional and ...
In order to elucidate the phylogenetic relationships in European ratsnakes of the genus Elaphe, we analyzed a 597 bp part of the mitochondrial cytochrome b gene of eight West Eurasian and one East Asian species. Lampropeltis served as outgroup. Maximum parsimony and maximum likelihood suggest the existence of four lineages: 1) E. scalaris; 2) the E. longissima species group comprising E. longissima, E. lineata, E. situla, E. hohenackeri, and E. persica; 3) E. quatuorlineata and 4) E. dione as a sister group to 3). Elaphe scalaris is basal and shows no closer affiliation with any other analyzed species. The Middle Eastern E. persica and E. hohenackeri appear basal within the E. longissima group. Elaphe lineata differs by 8% nucleotide substitutions from E. longissima, supporting the hypothesis that both taxa represent distinct species. Elaphe situla is associated with Elaphe longissima and E. lineata. Three analyzed subspecies of E. quatuorlineata are represented by distinct haplotypes. The extent of
Atovaquone is a new broad-spectrum antiprotozoal drug with high in vitro activity against multidrug-resistant Plasmodium falciparum. Its specific action against protozoans is based on the inhibition of the parasite cytochrome bc1 complex of the mitochondrial electron transport system. Protozoans may develop atovaquone resistance by the selection of a mutant cytochrome b gene. With the increasing availability of atovaquone-proguanil combination for prophylaxis and treatment of malarial infections, it is necessary to establish baseline data on atovaquone sensitivity before the drug is introduced massively in an endemic region. For this purpose, the activity of atovaquone was assessed indirectly by in vitro drug sensitivity assays with several serum substitutes and DNA sequencing of the cytochrome b gene. Using the standard in vitro assay procedures with 10% human serum, the geometric mean 50% inhibitory concentration (IC50) for atovaquone was calculated to be 1.15 nM (range = 0.460-4.17 nM), while the use