Hildebrandt, Nicole; Niehoff, Barbara; Sartoris, Franz-Josef (2014): Performance of the Arctic calanoid copepods Calanus glacialis and C. hyperboreus under elevated pCO2 and temperatures. PANGAEA, https://doi.org/10.1594/PANGAEA.834091, Supplement to: Hildebrandt, N et al. (2014): Long-term effects of elevated CO2 and temperature on the Arctic calanoid copepods Calanus glacialis and C. hyperboreus. Marine Pollution Bulletin, 80(1-2), 59-70, https://doi.org/10.1016/j.marpolbul.2014.01.050
The light intensity and spectral sensitivities of the calanoid copepod Acartia tonsa Dana were determined by measuring phototactic responses. Adult females
Kattner, G. and Krause, M. (1987): Changes in lipids during the development of Calanus finmarchicus s.l. from copepodid I to adult. , Marine Biology ...
Scanning electron micrograph (SEM) of Marine calanoid copepod (Euchaeta sp.). Euchaeta is a genus of the calanoid copepods in the family Euchaetidae (order Calanoida). Calanoida is an order of copepods that can live in both marine and freshwater. Calanoid copepods are dominant in the plankton in many parts of the worlds oceans (55%-95% of plankton). They are very important in the aquatic food chain. Commercial fish are dependent on calanoid copepods (larval or adult forms). Magnification x7 when shortest axis printed at 25 millimetres. - Stock Image C037/0487
Ohman, M. D. and Hirche, H. J. (2001): Density-dependent egg mortality in Calanus finmarchicus , ICES/GLOBEC Newsletter,8, December ...
Outcomes of infections with the salmon louse Lepeophtheirus salmonis vary considerably among its natural hosts (Salmo, Oncorhynchus spp.). Host-parasite interactions range from weak to strong host responses accompanied by high to low parasite abundances, respectively. Parasite behavioral studies indicate that the louse prefers the host Atlantic Salmon (Salmo salar), which is characterized by a weak immune response, and that this results in enhanced parasite reproduction and growth rates. Furthermore, parasite-derived immunosuppressive molecules (e.g., proteases) have been detected at higher amounts in response to the mucus of Atlantic Salmon relative to Coho Salmon (Oncorhynchus kisutch). However, the host-specific responses of the salmon louse have not been well characterized in either of the genetically distinct sub-species that occur in the Atlantic and Pacific Oceans. We assessed and compared the transcriptomic feeding response of the Pacific salmon louse (L. salmonis oncorhynchi,) while
We present an accurate, fast, simple and non-destructive photographic method to estimate wax ester and lipid content in single individuals of the calanoid copepod genus Calanus and test this method against gas-chromatographic lipid measurements ...
Marine calanoid copepod Acartia tonsa of known age are placed into test vessels containing a series of concentrations of the test material in water for 48 hours. The animals are observed after 24 and 48 hours and the number of mortalities in each vessel are recorded. EC50 values, NOECs and LOECs are estimated.. ...
ABSTRACT The diploid chromosome number 2n = 24 has been established in the harpacticoid copepod Tigriopus sp. coming from Kerguelen Island, while the population of Tigriopus inhabiting Crozet Island possesses the diploid number 2n = 22. The two populations differ also in homogeneity of the karyotype, thereby further supporting the hypothesis that these two populations belong to different species.
Walter, T. Chad (2013). Tigriopus fulvus adriatica Douwe, 1913. In: Walter, T.C. & Boxshall, G. (2017). World of Copepods database. Accessed at http://www.marinespecies.org/copepoda/aphia.php?p=taxdetails&id=363760 on 2017-12- ...
original description Chullasorn S., H.U. Dahms & P. Klangsina. (2013). A new species of Tigriopus (Copepoda: Harpacticoida: Harpacticidae) from Thailand with a key to the species of the genus. Journal of Natural History 47(5-12):427-447. , available online at https://doi.org/10.1080/00222933.2012.757660 [details] Available for editors ...
The oil exploration and search for new oil production fields is expanding further north and has reached the Arctic. Oil drilling activities release large amounts of produced water (PW) to the marine environment and sub-lethal effects on biota cannot be excluded. The polycyclic aromatic hydrocarbons (PAHs) present in PW have previously been shown to exhibit negative effects on growth, development and survival of aquatic organisms. The Arctic copepod Calanus glacialis is an abundant zooplankton species and holds a key position in the energy transfer from primary production to higher trophic levels. C. glacialis accumulates large volumes of lipids during late developmental stages which makes it prone to the uptake of lipophilic oil components. This study assesses the potential impact of PW-related PAHs on the metabolism of C. glacialis. In a semi-static setup, stage V C. glacialis copepodites from Kongsfjorden, Svalbard were exposed to the water soluble fraction of 11 selected PAHs (ΣPAH 7,90 µg ...
The salmon louse (Lepeophtheirus salmonis) is an ectoparasitic copepod feeding on skin, mucous and blood from salmonid hosts. Recently it was shown that L. salmonis infections in farmed fish induce epizootics in wild fish [1,2]. The life cycle of L.salmonis consists of 8 developmental stages separated by ecdysis [3,4] and after the final molt, females develop into mature adults that continuously produce eggs for life. The first free-living larvae (naupli I) hatch directly from egg-strings attached to adult females and all three larval stages (naupli I, naupli II and the infectious copepidid stage) can be transported by the ocean currents over large distances depending on hydrographical conditions [5]. After host settlement the infectious copepodids stage molt into chalimus. The two chalimus stages, all separated by molting, are anchored to the host by a frontal filament [6], which restricts the feeding area. However, in the succeeding pre-ad I and -II and adult stages the salmon louse can move ...
대전광역시 유성구 대학로 245 한국과학기술정보연구원TEL : 042.869.1234 서울시 동대문구 회기로 66NDSL고객센터 : 080.969.4114E-mail : [email protected] 대표자 : 한선화사업자등록번호 : 205-82-04043 ...
ABSTRACT: Fine-scale water column structure was mimicked in a laboratory plane jet flume to examine responses of the calanoid copepods Temora longicornis and Acartia tonsa to layers consisting of a velocity gradient, density gradient, phytoplankton exudates and food (phytoplankton). Copepods were exposed to isolated layers and combinations of cues as defined by in situ conditions. Behaviors elicited by the velocity gradient and chemical exudate layers included increased swimming speed and turn frequency consistent with excited area-restricted search behavior, which led to increased proportional residence time in the layers. Both species had significant responses to isolated layers of velocity gradients and chemical exudates, with T. longicornis responding more intensely to chemical cues than velocity gradients and A. tonsa responding equally to both. Combined fluid mechanical and chemical cues elicited species-specific responses. For T. longicornis, chemical presence induced responses that ...
Thermo Scientific™ Gaussia Luciferase Reporter Assay Vectors pMCS-Gaussia Luc Vector Thermo Scientific™ Gaussia Luciferase Reporter Assay Vectors...
Thermo Scientific™ Pierce™ Gaussia Luciferase Flash Assay Kit 100-rxn kit Thermo Scientific™ Pierce™ Gaussia Luciferase Flash Assay...
Use the simple Search box at the top of the page or the Advanced Search linked from the top of the page to find book and journal content. Refine results with the filtering options on the left side of the Advanced Search page or on your search results page. Click the Browse box to see a selection of books and journals by: Research Area, Titles A-Z, Publisher, Books only, or Journals only.. ...
The effects of Lepeophtheirus salmonis infections on the stress response and immunological status of Atlantic salmon (Salmo salar)
ABSTRACT: During mid-May-early June 1997 observations of hydrography, phytoplankton and nitrate concentrations, and abundance and stage distribution of Calanus finmarchicus populations were made in the Labrador Sea and south of Greenland. Egg production rates were also measured for isolated C. finmarchicus females. Surface nitrate and integrated phytoplankton concentrations indicated that, in the deep water, the phytoplankton bloom had ended in the north and east, was in progress in the north central Labrador Sea and near the basin margins, and had not yet become established in an area stretching from the central Labrador Sea to the south of Greenland. C. finmarchicus egg production rates and stage distributions at stations in the 3 areas designated as early, mid- and late/post-bloom zones, suggested that development rates of the overwintered G0 generation into mature adults (females and males) were probably low before the bloom, but accelerated during its development. Individual and areal rates ...
We developed a Gaussia luciferase (Gluc) reporter replicon of West Nile virus (WNV) and used it to quantify viral translation and RNA replication. The advantage of the Gluc replicon is that Gaussia luciferase is secreted into the culture medium from cells transfected with Gluc replicon RNA, and the medium can be assayed directly for luciferase activity. Using a known Flavivirus inhibitor (NITD008), we demonstrated that the Gluc-WNV replicon could be used for antiviral screening. The Gluc-WNV-Rep will be useful for research in antiviral drug development programs, as well as for studying viral replication and pathogenesis of WNV.
Phytoplankton color index from the Continuous Plankton Recorder transect across the Gulf of Maine is shown in the top panel. The decrease in spring chlorophyll concentration observed from satellites is also evident in the in situ data. Extremely low color indices were observed in the 1960s and early 1970s. There was then a rapid increase until about 1985 when a gradual decrease started. The decrease in color index seemed to accelerate in 2000 and low levels have been observed since. Abundances of two species of copepods from the Gulf of Maine Continuous Plankton Recorder transect are shown. Adult Calanus finmarchicus, which is a key indicator species for ecosystem status in the Gulf of Maine, has recently increases after a period of lower values in the 1990s. Smaller zooplankton, as exemplified by Oithona, have decreased after a period of higher values in the 1990s. These changes are indicators of shifts in community structure from larger bodied copepods, including Calanus in the 1980s, to ...
However, the actual feeding mechanisms employed by different zooplankters exert an overriding primary control that of food particle acquisition. It is in this context that we primarily attribute Ceratiums influence on zooplankton composition favouring Bosmina and calanoid copepods, while inhibiting Daphnia and Moina (as explained below).. Bosmina has been characterised as an undergrowth taxon able to find and feed on diffuse small food particles (including bacteria) in a nutritional environment overwhelmed by large, mostly inedible particles (Sommer et al., 1986). Similarly, the raptorial feeding mechanism of calanoid (and cyclopoid) copepods allows them to very selectively locate scarce suitable food particles (Koehl and Strickler, 1981; Strickler, 1984; Vanderploeg and Paffenhofer, 1985; Paffenhofer and Lewis, 1990; Brandl, 1998). Conversely, Daphnia employs non-selective bulk filtration, a mode of food collection that greatly compromises it when suspended particles are predominantly ...
The present study provides the first phylogenomic evidence to support the monophyletic origin of four major orders of copepods and the group of podopleans. The monophyletic status of Copepoda has been broadly accepted by both morphological [5, 14] and large-scale phylogenomic analyses [28-30]. Although this study does not include all copepod orders, there can be no doubt of the monophyly of copepods. The subclass Copepoda consists of two infraclasses, Progymnoplea and Neocopepoda, suggested by Huys and Boxshall [5]. The infraclass Neocopepoda can be further divided into two superorder groups, Gymnoplea and Podoplea (Fig. 1). The concept of this classification was proposed by Giesbrecht [67] and became generally accepted [5, 12, 68]. However, the naupliar musculature and the molecular phylogeny using partial nuclear 28S rRNA gene (a total aligned sequence length of 484 bp from the D9/D10 region) (Fig. 2A) showed conflicting results and suggested a possible paraphyletic origin of podopleans [15, ...
Salmonid aquaculture is an important industry on both sides of the North Atlantic, contributing to the local societies and producing highly demanded marine food. However, the industry has its environmental challenges, such as the ectoparasitic salmon louse (Lepeophtheirus salmonis). The salmon louse occurs naturally in the North Atlantic wherever there are wild salmonids. With the onset of salmonid farming in open net pens, the parasite obtained access to hosts held at high densities throughout the year. Fish farmers around the North Atlantic have since the 1970s used chemicals to control the number of lice in the fish pens. However, the salmon louse has developed resistance to four out of five chemical groups that have been available, forcing the industry to look for alternative non-chemical methods.. A fascinating aspect with the salmon louse is that there appears to be only one, pan-Atlantic, population. Because of the migratory life history of one of the main hosts, the wild Atlantic salmon, ...
TY - JOUR. T1 - Achiasmatic meiosis and complex heterozygosity in female cyclopoid copepods (Copepoda, Crustacea). AU - Chinnappa, C. C.. AU - Victor, Reginald. PY - 1979/1. Y1 - 1979/1. N2 - In Mesocyclops edax S.A. Forbes, 2n=14, a North American copepod, the females are heterozygous for several interchanges leading to the formation of large rings of chromosomes (rings of 14, or of 12 plus 1 bivalent) at meiotic metaphase, comparable to those of the plant Oenothera, although no chiasmata are present. The chromosomes are more or less metacentric and have large terminal H-segments. In the rings homologous arms are held together by connecting fibers which insert close to the euchromatin-heterochromatin junctions. Coordinated orientation of the zigzag type seems to be the role.. AB - In Mesocyclops edax S.A. Forbes, 2n=14, a North American copepod, the females are heterozygous for several interchanges leading to the formation of large rings of chromosomes (rings of 14, or of 12 plus 1 bivalent) at ...
JARAMILLO, R et al. Polysiphonia spp as epibiont of Caligus rogercresseyi (Crustacea: Copepoda) in Salmo salar farming centers. Arch. med. vet. [online]. 2016, vol.48, n.3, pp.321-324. ISSN 0301-732X. http://dx.doi.org/10.4067/S0301-732X2016000300013.. The association between Polysiphonia spp and ovigerous females of Caligus rogercresseyi is analysed. Females carrying egg sacs exhibited individuals of Polysiphonia spp externally attached to the cuticle of both dorsal cephalothorax and abdomen by a mounting disk without penetrating the tissues.. Palavras-chave : Polysiphonia; epibiont; Caligus; Salmo. ...
Wold, Anette; Darnis, Gerald; Søreide, Janne E; Leu, Eva; Philippe, Benoit; Fortier, Louis; Poulin, Michel; Kattner, Gerhard; Graeve, Martin; Falk-Petersen, Stig (2011): Diatom abundance and fatty acid composition of ice algae and of Calanus glacialis in samples obtained in 2008 in the eastern Beaufort Sea. PANGAEA, https://doi.org/10.1594/PANGAEA.817986, Supplement to: Wold, A et al. (2011): Life strategy and diet of Calanus glacialis during the winter-spring transition in Amundsen Gulf, south-eastern Beaufort Sea. Polar Biology, 34(12), 1929-1946, https://doi.org/10.1007/s00300-011-1062-6
1. Sodium uptake and loss rates are given for three gammarids acclimatized to media ranging from fresh water to undiluted sea water.. 2. In Gammarus zaddachi and G. tigrinus the sodium transporting system at the body surface is half-saturated at an external concentration of about 1 mM/l. and fully saturated at about 10 mM/l. sodium. In Marinogammarus finmarchicus the respective concentrations are six to ten times higher.. 3. M. finmarchicus is more permeable to water and salts than G. zaddachi and G. tigrinus. Estimated urine flow rates were equivalent to 6.5% body weight/hr./ osmole gradient at 10°C. in M. finmarchicus and 2.8% body weight/hr./osmole gradient in G. zaddachi. The permeability of the body surface to outward diffusion of sodium was four times higher in M. finmarchicus, but sodium losses across the body surface represent at least 50% of the total losses in both M. finmarchicus and G. zaddachi.. 4. Calculations suggest that G. zaddachi produces urine slightly hypotonic to the blood ...
Assessing the impact of global warming on the food web of the North Atlantic will require difficult-to-obtain physiological data on a key copepod crustacean, Calanus finmarchicus. The de novo transcriptome presented here represents a new resource for acquiring such data. It was produced from multiplexed gene libraries using RNA collected from six developmental stages: embryo, early nauplius (NI-II), late nauplius (NV-VI), early copepodite (CI-II), late copepodite (CV) and adult (CVI) female. Over 400,000,000 paired-end reads (100 base-pairs long) were sequenced on an Illumina instrument, and assembled into 206,041 contigs using Trinity software. Coverage was estimated to be at least 65%. A reference transcriptome comprising 96,090 unique components (
The copepod, Calanus finmarchicus is a keystone species for the North Atlantic. Because of recent changes in the geographic distribution of this species, there are questions as to how this organism ...
Abstract Copepodite stages V and females of four dominant Antarctic species of calanoid copepods were collected during various expeditions to the eastern Weddell Sea in mid-winter, late winter to early spring, summer and autumn. Analyses of total lipid content and sexual maturity showed some genera...
Startle responses in zooplankton and other organisms attempting to escape a predator are likely to be executed with the maximum muscular force and power output that the organism can produce. We have estimated these parameters from observed velocity variation during the course of copepod escape jumps by means of direct numerical simulations. Our method represents an advance over previous attempts (Vlymen 1970; Fields 2000) since we solve the Navier-Stokes equation directly and thus include the so-called history term. Our approach, however, ignores the motion of the swimming legs and the estimated parameters are, thus, preliminary and, presumably, conservative. We nevertheless have confidence in our estimates, because the estimate of forces compare well with-but are slightly smaller than-those measured experimentally in similar-sized copepods tethered to a force transducer (Lenz & Hartline 1999; Lenz et al. 2004) or a spring (Alcaraz & Strickler 1988). Specifically, the observations of Lenz et al. ...
Gaussia Luciferase (GLuc) reporter gene offers bright bioluminescence, either as a standalone expression monitor or as a fusion partner with other protein.
Calanus hyperboreus is a copepod found in the Arctic, and not further south than the Bering Strait in the Pacific and the Lofoten Islands in the Atlantic. It occurs up to a depth of 5,000 metres (16,000 ft). Mature females more often inhabit shallower waters. The size of C. hyperboreus varies with its geography; individuals located in more temperate waters usually range from just over 4 to 5.5 millimetres (0.16 to 0.22 in) in more temperate waters, whereas those in colder areas usually range from 6 to 7 millimetres (0.24 to 0.28 in). The length of its prosome can vary anywhere from 2.5 to 5.6 millimetres (0.098 to 0.220 in). The antennae are longer or of equal length to the body. This copepod is very clear, and is generally colourless. The gut walls and posterior may be orange to dark red in colour, with a prominent lipid sac that is usually red-orange. The borders between segments have a deep red pigment. This copepod spawns between October and March (winter), using lipid-reserves to fuel ...
Through their physiological processes, mesozooplankton can contribute significantly to the marine biogeochemical cycling of carbon and nitrogen. However some of these processes have been poorly parameterised in ecosystem models. Respiration in particular has been measured in terms of basal respiration which is related to temperature but independent of other metabolic activities such as feeding. This project will investigate the response of copepod physiology to food quality and temperature. A range of food quality (phytoplankton N:P ratio) will be achieved through sampling a latitudinal transect in the Atlantic Ocean (Atlantic Meridional Transect cruise, October 2010), a coastal time series station 20 km south of Plymouth, UK (spring, summer, autumn, winter sampling 2010-2011), and maintaining continuous cultures of selected species of phytoplankton under N and P limitation. Copepod (Calanus spp. and Oithona spp.) feeding rate, egg production, excretion and respiration rate will be determined across
xml version=1.0 encoding=UTF-8?,,EVENT,,EVENTLOG,,PORTALID,brill,/PORTALID,,SESSIONID,i3s5zl3hQ2JkFu9Er4OY24wq.x-brill-live-03,/SESSIONID,,USERAGENT,CCBot/2.0 (http://commoncrawl.org/faq/),/USERAGENT,,IDENTITYID,guest,/IDENTITYID,,IDENTITY_LIST,guest,/IDENTITY_LIST,,IPADDRESS,54.227.126.69,/IPADDRESS,,EVENTTYPE,PERSONALISATION,/EVENTTYPE,,CREATEDON,1512951278392,/CREATEDON,,/EVENTLOG,,EVENTLOGPROPERTY,,ITEM_ID,http://brill.metastore.ingenta.com/content/journals/10.1163/156854070x00149,/ITEM_ID,,TYPE,favourite,/TYPE,,/EVENTLOGPROPERTY,,/EVENT ...
Anthropic mechanisms : Transport in ships ballast, Opening of the Suez Canal, Indirect introduction - Diversity and Geographic Distribution of Pelagic Copepoda
ATGGCAAGTGGATATTATTATCCACCGGGTCGTACTAATGGAGGTGGGCG ACTCTATTGCGGTAAACGAGGCAACCCGAATTTGAGGGCTCGATTCCTGG AGAATAACAACGAAGACGATGAGTTGGATTTGTCTGAGGGGAGTTGTGTT GGGGAGAACGTGATTGAGGCTCTCAAGTACCTGTCCTCCAAAGGAGGGTC CAAGGGAAAGAAACTGGCCTATCTGAACGCACTCGTCAAAGTTCTCTTGG AACAGCGGAAGGATTCCTTGGAGGAGGATCTGTCTCTGGGCTTGAGGCTC AAGGAAATCATGCTTTGGTAAAGAGGGGAGTCACTGATTCAGTCATGGAG GGGATTCATTCCTTTGATTTCATTGCAGTCTCCGTATTCCTTTGACCCAT GAAGCGGCAGAAGTGCGAGCTGCGACTCTTCGTGTGTTTCGATACATTGT GGATCGTCCTTGCAGAGTCCAGGATTTCCTTCAAATCAATGCTCACCTCC TTGTTTCAAGATGCATCGACATCGACCTGGACAATCGAGTAGAAAGACTG CAAGCCCTGCGGTTCATCCGTAAACTCTTATTTTCTTGCCCCGAGTCCTT CCCTTCCTCTCTGTGCCGGAGTCTTATAGCCATTGCAGAGGGTGGGGTTA AAGAAAATGACCGTTTACTCAGGATCTCTTTAGCCATTCTTTGCGAAATA AGTAAGTTCATTCATTTTATAGAGAAATTTATATAGATAGTATCCATTGC TTTTTTCCCCCAGGTGTTTTGAACAGTACAGTGTTTATACTTTGTCAGGG TGTCAGAGCTTTAACAAATTCCTTACTTGATTGCTCAATGCCTCGAATGG CAGAGGCCATGATTGGATGCCTTTTACGCTTATTTAATAATCCTAAAACT AGGTCTATGGCTAATATTAATCTCGGAGTTGTGATCACCCCATTTACAGA ...
Hybrid breakdown is a pattern of postzygotic isolation that occurs during the early stages of allopatric divergence, and it is characterized by markedly reduced fitness in F2 and later generation hybrids [1]. Hybrid breakdown has been observed in a wide array of phenotypes, including fecundity [2], sperm swimming speed [3], offspring viability [4,5], growth rate [6] and stress response [7]. The genes involved in the early stages of reproductive isolation are likely to be found in the cellular and biochemical pathways underlying these phenotypes.. Hybrid breakdown is often explained by the Dobzhansky-Muller (DM) model; evolution results in coadaptation among interacting sets of alleles within diverging isolated populations, but incompatibilities are revealed in recombinant F2 genomes of interpopulation hybrids [8,9]. Although most investigations of DM incompatibilities have focused on interactions among nuclear genes [10], epistasis between nuclear and mitochondrial genomes may be particularly ...
The April-June report shows that sea lice numbers have generally remained low and that some improvements in numbers can be seen when comparing with the January-March 2014 report.. However, the Loch Long and Croe region, which is home to three active farms, has seen an increase in lice numbers from average numbers of 1.74 in April to 7.10 in June and Skye and Small Isles North region an increase from 2.33 to 7.95 over the same period.. In general, across all regions, sea lice numbers increased slightly from April to June 2014. Concerned over the effect of sea lice on wild salmon, the Scottish Salmon and Trout Association (SS&TA) stated that some farms are breaching industry sea-lice standards which may threaten the survival of migrating young wild salmon and sea-trout.. Looking specifically at the Special Area for Conservation on the Little Gruinard River in the Wester Ross region, Guy Linley-Adams, Solicitor to the SS&TA Aquaculture Campaign, said that sea lice have been over the threshold and ...
The half-life of GLuc remains unclear. All GLuc-expressing vectors available for mammalian expression at NEB harbor the humanized codons for GLuc in which the secreted GLuc has activity similar to that of the native protein. Once GLuc is secreted into the culture medium, it is very stable. For example, ~20% of the GLuc activity was detectable after incubating a GLuc-containing sample at 99˚C for 15 minutes ...
Barange M, Fernandes JA, Kay S, Hossain MAR, Ahmed M, Lauria V. 2018. Marine Ecosystems and Fisheries: Trends and Prospects. In: Nicholls, RJ; Hutton, CW; Adger, WN; Hanson, SE; Rahman, MM; Salehin, M, (eds.) Ecosystem Services for Well-Being in Deltas. Cham, Springer International Publishing, 469-488, 20pp. Ciavatta S, Brewin RJW, Skákala J, Polimene L, Artioli Y, Allen JI, de Mora L. 2018. Assimilation of ocean-colour plankton functional types to improve marine ecosystem simulations. Journal of Geophysical Research-Oceans. doi.org/10.1002/2017JC013490 Cornwell L, Findlay HS, Fileman ES, Smyth TJ, Hirst AG, Bruun JT, McEvoy AJ, Widdicombe CE, Castellani C, Lewis C, Atkinson A. 2018. Seasonality of Oithona similis and Calanus helgolandicus reproduction and abundance: contrasting responses to environmental variation at a shelf site. Journal of Plankton Research, 40 (3). 295-310. doi.org/10.1093/plankt/fby007 de Mora L, Yool A, Palmieri J, Sellar A, Kuhlbrodt T, Popova E, Jones C, and Allen JI. ...
The pCMV-GLuc 2 Control Plasmid is a mammalian expression vector that encodes the secreted luciferase from the copepod Gaussia princeps as a reporter, under the control of the constitutive CMV (cytomegalovirus) promoter. Gaussia luciferase (GLuc) is a 19 kDa protein encoded by a humanized sequence, and it contains a native signal peptide at the N-terminus that allows it to be secreted from mammalian cells into the cell culture medium. A neomycin resistance gene under the control of an SV40 promoter allows selection for stable integration of the plasmid into the mammalian cell genome using G418.
FIG 12 HRV16 infection does not block secretion of the Gaussia luciferase reporter. HeLa Ohio cells stably expressing the naturally secreted Gaussia luciferase (HeLa-Gluc) were infected with HRV16 (red squares) at an MOI of 20 for 1 h, followed by culture for the indicated periods of time up to 7 h postinfection (Time hpi). As controls, HeLa-Gluc cells were uninfected (blue circles) or uninfected but treated with BFA (green triangles). The cell culture medium was removed and replaced every 30 min, and the cells were harvested at 1-h intervals. The Gluc activity then was measured in the culture media and cell lysates. The cumulative secretion over time is calculated by adding each successive 30-min culture media sample to the previous total. Panel A shows Gluc activity in the cell lysate, and panel B shows secreted Gluc activity in the cell culture medium. Each point represents the mean relative light units (RLU) (± standard deviations) as a measure of Gluc activity from triplicate assay points ...
A new species of parasitic copepod, Caligus fajerae n. sp. (Caligidae), is described from Scomberomorus sierra Jordan & Starks (Scombridae) caught off the northwestern coast of Mexico. The new species morphologically resembles Caligus cybii Bassett-Smith, 1898, Caligus kanagurta Pillai, 1961, Caligus pelamydis Krøyer, 1863 and Caligus robustus Bassett-Smith, 1898, all of which have been reported from scombrid hosts. Caligus fajerae n. sp. differs from these species by having spinules on the abdomen and caudal ramus, two processes on the proximal antennulary segment, fine striations on the claw of the antenna and maxilliped, a stouter and more recurved maxillulary dentiform process, shorter tines on the sternal furca, two additional patches of spinules on the distal endopodal segment of leg 2, a sclerotised lobe on the anteromedian surface of the leg 3 protopod and serrations on both margins of the first exopodal spine of leg 3 ...
Trends in the dynamics of respiration rate and the efficiency of swimming in dependence on mechanical energy of locomotion were analyzed in six species of Black...
O rasprostranenii Tracheliastes maculatus Kollar 1836 (Copepoda Parasitica) v vodokhranilishchak Kharkovskoi oblasti i morfologii samki etogo vida. On the distribution of Tracheliastes maculatus Kollar, 1836 (Copepoda, Parasitica) in the reservoirs of the Kharkov province and the morphology of the female of this species ...
The attractiveness of secreted luciferases as reporters is a strong stimulus for the investigation and exploitation of new bioluminescent systems. Metridia longa is a small luminous marine copepod (Fig. 3D). The bioluminescence originates as a secretion from epidermal glands located in the head part and abdomen in response to mechanical, electrical, or chemical stimuli. Bioluminescence in Metridia longa may well serve as a defense mechanism against predators; the release of a luminous bolus from the animal is accompanied by rapid swimming that displaces the copepod away from its "glowing phantom". This luciferase emits light at a peak of 480 nm with a broad emission spectrum extending to 600 nm. Gaussia luciferase has been cloned, overexpressed in bacteria, and used as a sensitive analytical reporter for hybridization assays and monitoring of cellular expression in culture and in vivo (Tannous et al. 2005). 7 Coelenterazine Dependent Luciferases 9 Fig. 3 Origins of Glow-light reporter genes used ...
Every night across the worlds oceans, numerous marine animals arrive at the surface of the ocean to feed on plankton after an upward migration of hundreds of metres. Just before sunrise, this migration is reversed and the animals return to their daytime residence in the dark mesopelagic zone (at a depth of 200-1,000 m). This daily excursion, referred to as diel vertical migration (DVM), is thought of primarily as an adaptation to avoid visual predators in the sunlit surface layer1,2 and was first recorded using ship-net hauls nearly 200 years ago3. Nowadays, DVMs are routinely recorded by ship-mounted acoustic systems (for example, acoustic Doppler current profilers). These data show that night-time arrival and departure times are highly conserved across ocean regions4 and that daytime descent depths increase with water clarity4,5, indicating that animals have faster swimming speeds in clearer waters4. However, after decades of acoustic measurements, vast ocean areas remain unsampled and places for