The tissue distribution of type II and type IX collagen in 17-d-old chicken embryo was studied by immunofluorescence using polyclonal antibodies against type II collagen and a peptic fragment of type IX collagen (HMW), respectively. Both proteins were found only in cartilage where they were co-distributed. They occurred uniformly throughout the extracellular matrix, i.e., without distinction between pericellular, territorial, and interterritorial matrices. Tissues that undergo endochondral bone formation contained type IX collagen, whereas periosteal and membranous bones were negative. The thin collagenous fibrils in cartilage consisted of type II collagen as determined by immunoelectron microscopy. Type IX collagen was associated with the fibrils but essentially was restricted to intersections of the fibrils. These observations suggested that type IX collagen contributes to the stabilization of the network of thin fibers of the extracellular matrix of cartilage by interactions of its
Putative uncharacterized protein COL9A1 (Collagen, type IX, alpha 1, isoform CRA_b) contains a PF01391 domain.. Putative uncharacterized protein COL9A1 (Collagen, type IX, alpha 1, isoform CRA_b) contains a PF01391 domain.. Putative uncharacterized protein COL9A1 (Collagen, type IX, alpha 1, isoform CRA_b) contains a PF01391 domain.. Putative uncharacterized protein COL9A1 (Collagen, type IX, alpha 1, isoform CRA_b) contains a PF01391 domain.. Putative uncharacterized protein COL9A1 (Collagen, type IX, alpha 1, isoform CRA_b) contains a PF01391 domain.. Putative uncharacterized protein COL9A1 (Collagen, type IX, alpha 1, isoform CRA_b) contains a PF01391 domain.. Putative uncharacterized protein COL9A1 (Collagen, type IX, alpha 1, isoform CRA_b) contains a PF01391 domain.. Putative uncharacterized protein COL9A1 (Collagen, type IX, alpha 1, isoform CRA_b) contains a PF01391 domain.. Putative uncharacterized protein COL9A1 (Collagen, type IX, alpha 1, isoform CRA_b) contains a PF01391 ...
Autosomal recessive inheritance has been described in some Stickler syndrome families. Individuals in these families were reported to have clinical findings similar to STL1, STL2, and Marshall syndrome. The cause has been documented to be mutations in collagen IX genes. Collagen IX is a heterotrimeric molecule composed of α1(IX), α2(IX) and α3(IX) chains encoded by the COL9A1, COL9A2 and COL9A3 genes. Analysis of the collagen IX genes is indicated in those instances of Stickler syndrome where autosomal recessive inheritance is suspected. Autosomal dominant mutations in the collagen IX genes cause some cases of multiple epiphyseal dysplasia.. Copy number variation (CNV) analysis of the Stickler syndrome genes is also offered as a panel. Additionally, CTGT offers a comprehensive test (both NGS and CNV panels) for these genes. Panel genes are also offered as individual sequencing and deletion/duplication tests unless otherwise indicated.. Read less ...
This gene encodes one of the three alpha chains of type IX collagen, the major collagen component of hyaline cartilage. Type IX collagen, a heterotrimeric molecule, is usually found in tissues containing type II collagen, a fibrillar collagen. Mutations in this gene are associated with multiple epiphyseal dysplasia type 3.
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three alpha chains of type IX collagen, the major collagen component of hyaline cartilage. Type IX collagen, a heterotrimeric molecule, is usually found in tissues containing type II collagen, a fibrillar collagen. Mutations in this gene are associated with multiple epiphyseal dysplasia type 3. [provided by RefSeq, Jan 2010 ...
Human COL9A1 derived in Human Cells. The whole cell lysate is provided in 1X Sample Buffer.Browse all transfected cell lysate positive controls
Buy our Recombinant Human COL4A3BP protein. Ab95897 is a protein fragment produced in Escherichia coli and has been validated in SDS-PAGE, MS. Abcam provides…
Васильева, М. Ю., Князева, В. М., Александров, А. А. & Штыров, Ю. Ю., 2019, Центральные механизмы речи: Сборник материалов IX Всероссийской (с международным участием) научной конференции, посвященной памяти проф. Н.Н. Трауготт . Шеповальников, А. Н. (ред.). СПб.: Издательство «ВВМ», стр. 26 1 стр.. Результат исследований: Публикации в книгах, отчётах, сборниках, трудах конференций › иная часть книжной публикации ...
OBJECTIVE: Type IX collagen proteoglycan is an important protein in collagen networks and has been implicated in hip osteoarthritis (OA). We studied 2 COL9A1 markers (509-8B2 and 509-12B1) in relation to radiographic OA, within the framework of the Rotterdam Study, a population-based study of 7,983 subjects ages 55 years and older. METHODS: We used 2 different designs, as follows: 1) a linkage study of 83 probands with multiple joints affected with radiographic OA and their 221 siblings, yielding 445 sibpairs who participated in the study, and 2) an association study in a series of 71 patients with radiographic hip OA and 269 controls without radiographic OA. All subjects were characterized for the 2 COL9A1 markers, 509-8B2 and 509-12B1. The mean test was used to assess the proportion of alleles shared in concordantly affected and unaffected sibpairs. The chi-square test was used to compare the allele distributions in patients and controls. RESULTS: Affected sibpairs with radiographic hip OA shared
17. Alsalameh S, Mollenhauer J, et al: Preferential cellular and humoral immune reactivities to native and denatured. Collagen types IX and XI in patient with fatal relapsing polychondritis. J. Rheumatol, 1993; 20: 1419-24.. ...
Original concerns that cloning caused early-onset osteoarthritis in Dolly the sheep are unfounded, say experts at the University of Nottingham and the University of Glasgow.
The COL9A2 gene provides instructions for making part of a large molecule called type IX collagen. Learn about this gene and related health conditions.
Allen, KD, Griffin, TM, Rodriguiz, RM, Wetsel, WC, Kraus, VB, Huebner, JL, Boyd, LM, and Setton, LA. Decreased physical function and increased pain sensitivity in mice deficient for type IX collagen. Arthritis Rheum 60, no. 9 (September 2009): 2684-2693. Full Text ...
pep:known chromosome:VEGA66:2:180597790:180622189:1 gene:OTTMUSG00000016344 transcript:OTTMUST00000039291 gene_biotype:protein_coding transcript_biotype:protein_coding gene_symbol:Col9a3 description:procollagen type IX alpha 3 ...
Multiple epiphyseal dysplasia (MED) is a dominantly inherited chondrodysplasia characterized by mild short stature and early-onset osteoarthrosis. Some forms of MED clinically resemble another chondrodysplasia phenotype, the mild form of pseudoachondroplasia (PSACH). On the basis of their clinical
Mouse polyclonal antibody raised against a full-length human COL4A3 protein. COL4A3 (AAI56139.1, 1 a.a. ~ 1670 a.a) full-length human protein. (H00001285-B01P) - Products - Abnova
Human COL8A2 partial ORF ( NP_005193.1, 626 a.a. - 696 a.a.) recombinant protein with GST-tag at N-terminal. (H00001296-Q01) - Products - Abnova
Multiple Epiphyseal Dysplasia with Myopia and Conductive Deafness (Multiple Epiphyseal Dysplasia Type Beighton): Read more about Symptoms, Diagnosis, Treatment, Complications, Causes and Prognosis.
Studies have shown that both Type I and Type II Collagen undergo fibrillogenesis under similar conditions, namely at near normal body temperature and pH. It is understood that accessory proteins or chaperone proteins can either speed up or slow down fibrillogenesis in Type I Collagen. However, there is a lack of research on how these same proteins can regulate the kinetics of fibril formation in Type II Collagen. If certain proteins are found to speed up Type II fibril formation, they could greatly decrease the time required for healing in cartilage injuries or diseases, especially those due to the inherent lack of vascularity in cartilage. On the other hand, some proteins may slow down Type II fibril formation and have applications in diseases that are caused by excessive fibril formation such as fibrosis or scar formation. To test the effects of specific accessory proteins, recombinant forms of these proteins were added with Collagen Type II in a buffered solution at 7.4 pH, and a temperature of 25⁰
This gene encodes the alpha chain of type XIX collagen, a member of the FACIT collagen family (fibril-associated collagens with interrupted helices). Although the function of this collagen is not known, other members of this collagen family are found in association with fibril-forming collagens such as type I and II, and serve to maintain the integrity of the extracellular matrix. The transcript produced from this gene has an unusually large 3 UTR which has not been completely sequenced. [provided by RefSeq, Jul 2008 ...
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Horse Collagen Type I (COL1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species ...
Université de Liège - ULg , Département de langues et littératures romanes , Langues et littératures espagnoles et hispano-américaines ,] ...
ferrassin condimentada televisor autofinances ventilassis Eliana esmaluc maçonaré benzol desinterlineàreu coltellejàreu basculé[email protected] ...
Recent studies of OA cartilage have identified both messenger RNA (mRNA) and the protein for specific MMPs as well as a collagenase mediated type II collagen degradation product, suggesting that MMPs contribute to the intrinsic chondrocyte mediated degenerative changes of the cartilage matrix in OA.8,12,13 As yet the factors responsible for their expression remain uncertain, although the proinflammatory cytokines interleukin 1 (IL1) and tumour necrosis factor α (TNFα) have been implicated.1,8 The increased levels of histamine found in OA synovial fluids3 have suggested a role for this mediator in the pathophysiology of this disease. Evidence presented here shows that histamine up regulates both MMP-13 and MMP-3 production by chondrocytes. Both these MMPs are important in the degradation of articular cartilage; MMP-13 can degrade collagen type II, and MMP-3 can degrade proteoglycan and collagen types IX and XI, and activate procollagenase-1.14 Earlier studies have shown that chondrocytes ...
Lumbar Disc Disease Treatment procedures are available at Apollo Hospital Indraprastha from Price on request. Find out what other patients experienced and read their reviews.
Show moreCollagen XIV is a fibril-associated collagen with an interrupted triple helix (FACIT). Previous studies have shown that this collagen type regulates early stages of fibrillogenesis in connective tissues of high mechanical demand. Mice null for Collagen XIV are viable, however formation of the interstitial collagen network is defective in tendons and skin leading to reduced biomechanical function. The assembly of a tightly regulated collagen network is also required in the heart, not only for structural support but also for controlling cellular processes. Collagen XIV is highly expressed in the embryonic heart, notably within the cardiac interstitium of the developing myocardium, however its role has not been elucidated. To test this, we examined cardiac phenotypes in embryonic and adult mice devoid of Collagen XIV. From as early as E11.5, Col14a1(-/-) mice exhibit significant perturbations in mRNA levels of many other collagen types and remodeling enzymes (MMPs, TIMPs) within the ...
Collagen, type XV, alpha 1, also known as COL15A1, is a human gene.[1] This gene encodes the alpha chain of type XV collagen, a member of the FACIT collagen family (fibril-associated collagens with interrupted helices). Type XV collagen has a wide tissue distribution but the strongest expression is localized to basement membrane zones so it may function to adhere basement membranes to underlying connective tissue stroma. Mouse studies have shown that collagen XV deficiency is associated with muscle and microvessel deterioration.[1] ...
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Collagen Type VII (COL7) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species ...
Shop Ncell Collagen II Imucell - 120.0 Count from Albertsons. Browse our wide selection of Supplements for Delivery or Drive Up & Go to pick up at the store!
IX PAR CRANEAL GLOSOFARINGEO PDF - Nervio glosofaríngeo (par craneal IX) Nervio vago (par craneal X) pariasco nervio cardioneumogastroentérico. Nervio accesorio espinal (par craneal XI)
concretis entravessarem rasclats desfrunzeixes desemmandrís paleoplacer caseïficat infringien torcejam regulem trempant desrengués moltonegí possessionam@banyegaríemo.org ...
Study Design. Prospective cohort study. Objective. To study biomechanical factors in relation to symptomatic lumbar disc disease. Summary of Background Data. The importance of biomechanical factors in lumbar disc disease have been questioned the past decade and knowledge from large prospective studies is lacking.. Methods. The study basis is a cohort of 263 529 Swedish construction workers who participated in a national occupational health surveillance programme from 1971 until 1992. The workers job title, smoking habits, body weight, height and age were registered at the examinations. The occurrence of hospitalization due to lumbar disc disease from January 1 1987 until December 31 2003 was collected from a linkage with the Swedish Hospital Discharge Register.. Results. There was an increased risk for hospitalization due to lumbar disc disease for several occupational groups compared to white-collar workers and foremen. Occupational groups with high biomechanical loads had the highest risks, ...
Lumbar disc disease (LDD) is among the most common ailments in Western societies.1 In the military, LDD often results in significant impairments and contributes greatly to health care costs and disability.2 Military training often results in exacerbation or presentation of LDD related symptoms. LDD appears to be a multifactorial disorder in which genetics play an important role, as it is evident from several recent studies.3. Collagen is the most abundant structural component of the extracellular matrix. Changes in collagen cross linking have been identified in degenerative disc disease, and LDD was recently associated with a polymorphism of the collagen type IX (COL9A3) gene.3 Type I collagen is the major protein in skin, ligaments, and bone; both COL1A1 and COL1A2 are present in the main components of the intervertebral disc, the annulus fibrosus (primarily) and the nucleus pulposus (secondarily).4. A G→T polymorphism within the COL1A1 regulatory region that affects the recognition site for ...
Researchers from the University of Utah School of Medicine report that there is a heritable predisposition to lumbar disc disease, according to a Medscape Medical News article based on a study published this month in the Journal of Bone and Joint Surgery. For the study, authors analyzed data from the Utah Population Database, which allows medical information to be tracked on the states founding pioneers and their descendents, and the University of Utah Health Sciences Center data warehouse, which has diagnosis and procedure data on all patients treated at the university hospital. Together the databases contain information on more than 2.4 million patients. Researchers included only patients and control participants with at least 3 generations of genealogical data. Of the people who qualified for the study, 1,254 had at least 1 diagnosis of lumbar disc disease or lumbar disc herniation, along with the requisite genealogical data. The authors tested for heritability by estimating the relative ...
Researchers from the University of Utah School of Medicine report that there is a heritable predisposition to lumbar disc disease, according to a Medscape Medical News article based on a study published this month in the Journal of Bone and Joint Surgery. For the study, authors analyzed data from the Utah Population Database, which allows medical information to be tracked on the states founding pioneers and their descendents, and the University of Utah Health Sciences Center data warehouse, which has diagnosis and procedure data on all patients treated at the university hospital. Together the databases contain information on more than 2.4 million patients. Researchers included only patients and control participants with at least 3 generations of genealogical data. Of the people who qualified for the study, 1,254 had at least 1 diagnosis of lumbar disc disease or lumbar disc herniation, along with the requisite genealogical data. The authors tested for heritability by estimating the relative ...
Symptoms of lumbar disc disease include back and leg pain, which may radiate down into the hand. This pain may be associated with numbness and tingling over the leg and foot, which may feel like it is asleep. Additionally, weakness of the leg and foot muscles may develop.. It is important to recognize that the presence of a disc bulge or protrusion does not necessarily require surgical intervention. Many people who have degenerated or bulging discs that never develop symptoms, and most have only minor symptoms which can be treated with over-the-counter medications. Even those who develop more severe symptoms requiring a visit to their physician can be treated successfully with medication and physical therapy. We work with all of these health care practicioners to choose the treatment option that best meets our patients needs and desires.. ...
Siyatha Paththare 25-06-2021. col3negoriginal, col3negoriginal.com, col3, col3neg, col 3 neg original col3negoriginal. A place to watch and share Sri Lankan videos.
col3negoriginal, col3negoriginal.com, col3, col3neg, col 3 neg original col3negoriginal. A place to watch and share Sri Lankan videos.
col3negoriginal, col3negoriginal.com, col3, col3neg, col 3 neg original col3negoriginal. A place to watch and share Sri Lankan videos.
Hits of 76ix Par2 on Skam Records bBack In Stock/bbr br A secret track called Dancing Slag starts at 3:30 on track 17.br br
A collection of disease information resources and questions answered by our Genetic and Rare Diseases Information Specialists for Multiple epiphyseal dysplasia 6
Multiple epiphyseal dysplasia 1 (EDM1) [MIM:132400]: A generalized skeletal dysplasia associated with significant morbidity. Joint pain, joint deformity, waddling gait, and short stature are the main clinical signs and symptoms. Radiological examination of the skeleton shows delayed, irregular mineralization of the epiphyseal ossification centers and of the centers of the carpal and tarsal bones. Multiple epiphyseal dysplasia is broadly categorized into the more severe Fairbank and the milder Ribbing types. The Fairbank type is characterized by shortness of stature, short and stubby fingers, small epiphyses in several joints, including the knee, ankle, hand, and hip. The Ribbing type is confined predominantly to the hip joints and is characterized by hands that are normal and stature that is normal or near-normal. {ECO:0000269,PubMed:11084047, ECO:0000269,PubMed:11565064, ECO:0000269,PubMed:21922596, ECO:0000269,PubMed:7670472, ECO:0000269,PubMed:9021009, ECO:0000269,PubMed:9184241, ...
This study revealed that the Tt allele of the vitamin-D receptor gene was more frequently associated with multilevel and severe disc degeneration and disc herniation than was the TT allele, pointing to an increased risk of disc disease at an early age in subjects with the Tt allele in the vitamin-D …
Complete information for COMP gene (Protein Coding), Cartilage Oligomeric Matrix Protein, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene Compendium
TY - JOUR. T1 - Angel-shaped phalango-epiphyseal dysplasia (ASPED). T2 - Identification of a new genetic bone marker. AU - Giedion, A.. AU - Prader, A.. AU - Fliegel, C.. AU - Krasikov, N.. AU - Langer, L.. AU - Poznanski, A.. PY - 1993/1/1. Y1 - 1993/1/1. N2 - We describe a new mild malformation of the phalanx, which we call the angel-shaped phalanx (ASP) because of its resemblance to the little angels used for the decoration of Christmas trees. A particular middle phalangeal type of ASPs is found in a distinct variety of multiple epiphyseal dysplasia with marked retardation of bone age and severe coxarthrosis in adult life, previously reported as hereditary peripheral dysostosis [Bachman, 1967: Proc R Soc Med 60:21-22; Giedion, 1969: Fortschr Rontgenstr 110:507-524]. However, these authors overlooked the unique configuration of the middle phalanges. We renamed the condition angel-shaped phalango-epiphyseal dysplasia (ASPED), which may be transmitted in an autosomal-dominant manner. Six ...
Hiru Star 2 - 16-01-2021. col3negoriginal, col3negoriginal.com, col3, col3neg, col 3 neg original col3negoriginal. A place to watch and share Sri Lankan videos.
pQC NLS YFP IX sequence 7067 bps tccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtc aataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtattta cggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatg acggtaaatggcccgctctggcattatgcccagtacatgaccttatgggactttcctacttggcagtaca tctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcg gtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaat caacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggt gggaggtctatataagcagagctcaataaaagagcccacaacccctcactcggcgcgccagtcttccgat agactgcgtcgcccgggtacccgtattcccaataaagcctcttgctgtttgcatccgaatcgtggtctcg ctgttccttgggagggtctcctctgagtgattgactacccacgacgggggtctttcatttgggggctcgt ccgggatttggagacccctgcccagggaccaccgacccaccaccgggaggtaagctggccagcaacttat ctgtgtctgtccgattgtctagtgtctatgtttgatgttatgcgcctgcgtctgtactagttagctaact agctctgtatctggcggacccgtggtggaactgacgagttctgaacacccggccgcaaccctgggagacg ...
Oftpred Colírio is a medicine available in a number of countries worldwide. A list of US medications equivalent to Oftpred Colírio is available on the Drugs.com website.
Paseo Colón 70 is a 19-story high-rise building in San Javier, Región de Murcia, Spain. View a detailed profile of the structure 252187 including further data and descriptions in the Emporis database.
OBJECTIVE:,br /,To test the hypothesis that physiological cyclic loading during a 30-min walking exercise causes an increase in serum cartilage oligomeric matrix protein (COMP) concentration in a healthy population.,br /,METHODS:,br /,Blood samples (5 ml) were drawn from 10 physically active adults immediately before and after, and 0.5h, 1.5h, 3.5h and 5.5h after a 30-min walking exercise on a level outdoor walking track at self-selected normal speed. On a separate day, blood samples were drawn from the same 10 subjects during 6h while they were resting in a chair. Serum COMP concentrations were determined using a commercial enzyme-linked immunosorbent assay (COMP ELISA). An activity monitor was used to record basic time-distance measurements of gait. Serum COMP concentrations within the exercise protocol and within the resting protocol were compared using separate repeated measures analyses of variance (alpha=0.05).,br /,RESULTS:,br /,In the exercise protocol, a first increase (9.7%; P=0.003) ...
As a member of the wwPDB, the RCSB PDB curates and annotates PDB data according to agreed upon standards. The RCSB PDB also provides a variety of tools and resources. Users can perform simple and advanced searches based on annotations relating to sequence, structure and function. These molecules are visualized, downloaded, and analyzed by users who range from students to specialized scientists.
Coxa Valga Deformity with Epiphyseal Dysplasia & Hip Osteoarthritis (Early Onset) & lumbar and sacral arthritis Symptom Checker: Possible causes include Osteoarthritis. Check the full list of possible causes and conditions now! Talk to our Chatbot to narrow down your search.
What is Stickler Syndrome Stickler syndrome is a genetic condition that is characterized by serious problems in vision, hearing, problems of the joints and
Mechanical support in animals is performed by connective tissues. The soft tissues consist of collagen fibres embedded in a highly hydrated proteoglycan gel. By considering them as fibrous composite materials, a unifying theme can be found to explain their mechanical behaviour in terms of their structure and composition. Interactions between fibres and matrix are essential to their functioning in this way. Calculations are made of the maximum stress transfer per D-period required to enable collagen fibres of a given axial ratio to provide effective reinforcing. Weak non-specific interactions are shown to be sufficient. A mechanical function is proposed for type X collagen in the epiphyseal growth plate on the basis that it modifies and supplements the properties of the type II fibrils. This provides extra reinforcing and, hence, a greater stiffness to the cartilage to compensate for the reduced amount of extracellular matrix. ...
Garc a MM et al (2014) report a case of autosomal recessive multiple epiphyseal dysplasia (EDM4/rMED) due to paternal UPD. This disorder is characterised by childhood onset joint pain at the hips and knees, brachydactyly, shortened (or normal) stature and in some cases congenital clubfoot. ...
Individuals affected with pseudoachondroplasia are similar in height as those with achondroplasia, but their head size is the same as that of average-sized people. They also lack the facial features of patients with achondroplasia. It usually goes undiagnosed until the child is 2 to 3 years old.
public: HRG_RESULT Initialize (IX_DEV_ID device_id, const IX_INFO *p_info); HRG_RESULT StartTimer( ); HRG_RESULT StopTimer( ); HRG_RESULT GetElapsedSeconds(double *p_seconds); HRG_RESULT GetTreadmillInfo(IX_DEV_INFO *p_info); HRG_RESULT GeTreadmillStatus(IX_DEV_STATUS *p_status); HRG_RESULT GetSpeed(doulbe *p_speed); HRG_RESULT GetSpeedRange(IX_SCALAR_RANGE *p_range); HRG_RESULT GetSpeedUnits(IX_ITEM_UNITS *p_units); HRG_RESULT SetSpeed(double speed); HRG_RESULT GetIncline(double *p_incline); HRG_RESULT GetInclineRange((IX_SCALAR_RANGE *p_range); HRG_RESULT GetInclineUnits(IX_ITEM_UNITS *p_units); HRG_RESULT SetIncline(double incline); HRG_RESULT GetHeartRate(double *p_heart_rate); HRG_RESULT GetHeartRateRange(IX_SCALAR_RANGE *p_range); HRG_RESULT GetHeartRateUnits(IX_ITEM_UNITS *p_units); HRG_RESULT GetPower(double *p_power); HRG_RESULT GetPowerRange(IX_SCALAR_RANGE *p_range); HRG_RESULT GetPowerUnits(IX_ITEM_UNITS *p_units); HRG_RESULT GetPace(double *p_pace); HRG_RESULT ...
Mates L، Korpos E، Deak F، Liu Z، Beier DR، Aszodi A، Kiss I (Mar 2002). Comparative analysis of the mouse and human genes (Matn2 and MATN2) for matrilin-2, a filament-forming protein widely distributed in extracellular matrices. Matrix Biol. 21 (2): 163-74. PMID 11852232. doi:10.1016/S0945-053X(01)00194-9. ...
Colón y otros caníbales El libro del pensador nativo americano Jack Forbes, Colón y otros caníbales, era uno de los textos fundamentales del movimiento anticivilización cuando fue publicado por primera vez en 1978. Su historia del terrorismo, el genocidio
Rahman, Ricardo; Zalba, Javier; Bibiloni, Norma; Amoreo, Oscar; Ruscasso, Javier; Suárez, Ángela; Cobeñas, Carlos; Spízzirri, Ana ...
W: WibroTech 2008. XIV Konferencja Naukowa Wibroakustyki i Wibrotechniki. IX Og lnopolskie Seminarium Wibroakustyka w Systemach Technicznych, Krak w, 20-21 listopad 2008. Akademia G rniczo-Hutnicza w Krakowie. Katedra Mechaniki i Wibroakustyki [i in.]. Krak w : [b.w.], 2008, s. 119-120, bibliogr. 2 poz ...