Bergen Open Research Archive: Clonal heterogeneity reflected by pi3k-akt-mtor signaling in human acute myeloid leukemia cells...
Clonal heterogeneity detected by karyotyping is a biomarker associated with adverse prognosis in acute myeloid leukemia (AML). Constitutive activation of the phosphatidylinositol-3-kinase-Akt-mechanistic target of rapamycin (PI3K-Akt-mTOR) pathway is present in AML cells, and this pathway integrates signaling from several upstream receptors/mediators. We suggest that this pathway reflects biologically important clonal heterogeneity. We investigated constitutive PI3K-Akt-mTOR pathway activation in primary human AML cells derived from 114 patients, together with 18 pathway mediators. The cohort included patients with normal karyotype or single karyotype abnormalities and with an expected heterogeneity of molecular genetic abnormalities. Clonal heterogeneity reflected as pathway mediator heterogeneity was detected for 49 patients. Global gene expression profiles of AML cell populations with and without clonal heterogeneity differed with regard to expression of ectopic olfactory receptors (a subset ...
Measurement of Cancer Cell Growth Heterogeneity through Lentiviral Barcoding Identifies Clonal Dominance as a Characteristic of...
Advances in the fields of cancer initiating cells and high-throughput in vivo shRNA screens have highlighted a need to observe the growth of tumor cells in cancer models at the clonal level. While in vivo cancer cell growth heterogeneity in xenografts has been described, it has yet to be measured. Here, we tested an approach to quantify the clonal growth heterogeneity of cancer cells in subcutaneous xenograft mouse models. Using a high-throughput sequencing method, we followed the fate in vitro and in vivo of ten thousand HCT-116 cells individually tagged with a unique barcode delivered by lentiviral transduction. While growth in vitro was less homogeneous than anticipated, we still find that 95% of the final cells derived from 80% of the original cells. In xenografts, however, 95% of the retrieved barcoded cells originated from only 6% of the initially injected cells, an effect we term clonal dominance. We observed this clonal dominance in two additional xenograft models (MDA-MB-468 and ...
Laboratory-Treated T Cells and Aldesleukin After Cyclophosphamide in Treating Patients With Stage IV Melanoma - Tabular View -...
PRIMARY OBJECTIVES:. I. To assess the safety and toxicity of cellular adoptive immunotherapy in melanoma patients using autologous CD4+ and CD8+ antigen-specific T cell clones.. II. To evaluate the antitumor effects of CD4+ and CD8+ antigen-specific T cells in patients with metastatic melanoma.. III. To determine the duration of in vivo persistence of adoptively transferred CD8+ antigen-specific T cell clones in the presence or absence of transferred CD4+ T cells.. SECONDARY OBJECTIVES:. I. To assess the in vivo antitumor efficacy of the infused autologous antigen-specific CD4+ T cells.. OUTLINE: This is a phase I study followed by a phase II study.. Beginning 48 hours before T-cell infusion, patients receive cyclophosphamide IV. Patients then receive antigen-specific CD8+ T cells IV alone or with CD4+ T helper clones over 1-2 hours on day 0. Patients also receive aldesleukin subcutaneously twice daily on days 0-13. Treatment repeats every 28 days for up to 3 courses in the absence of disease ...
Antibodies to CD44 Trigger Effector Functions of Human T Cell Clones - Fingerprint - Italian Ministry of Health
Fingerprint Dive into the research topics of Antibodies to CD44 Trigger Effector Functions of Human T Cell Clones. Together they form a unique fingerprint. ...
KAKEN - Research Projects | Development of a laboratory examination system for T cell clonality analysis. (KAKENHI-PROJECT...
Principal Investigator:YAMAMOTO Kazuhiko, Project Period (FY):1995 - 1997, Research Category:Grant-in-Aid for Scientific Research (A), Section:展開研究, Research Field:内科学一般
T-cell clone anti-clone interactions. Effects on suppressor and helper activities. - Nuffield Department of Orthopaedics,...
An experimental model of two interacting clones of T cells is described, which may be used for defining and exploring the T-cell immunoregulatory network. Mx9/9 is a CD4 clone bearing an antigen receptor recognized by the Mx9 anti-V beta 8 monoclonal antibody (MoAb). Anti-V beta 8 MoAbs activate and induce cell proliferation of this clone. Autologous clones were raised against Mx9/9 cells using the peripheral blood mononuclear (PBM) cells of the Mx9/9 clone donor (PBMjm). Some of these cloned anti-clone cells proliferated after stimulation with irradiated Mx9/9 cells, but not after stimulation with other autologous cloned T cells or heterologous PBM, suggesting that these clones recognize the T cell receptor (TCR) of the Mx9/9 cells. The proliferation of the Mx9/9 stimulated cloned anticlone cells was blocked by anti-class II MoAbs, indicating that the autoreactive clones recognize their target antigen in conjunction with HLA Class II products. The ability of clone Mx9/9 to proliferate after stimulation
We record that individual T cells persistently contaminated with primate foamy | Epigenetic regulation of CpG promoter...
We record that individual T cells persistently contaminated with primate foamy pathogen type 1 (PFV-1) display an elevated capacity to bind individual immunodeficiency pathogen type 1 (HIV-1), leading to improved cell permissiveness to HIV-1 infection and improved cell-to-cell pathogen transmission. replication could be modulated by the current presence of either homologous faulty viral genomes or infections of specific classes with the capacity of interfering with particular levels of the pathogen routine in dually contaminated organisms. It really is set up that coinfection with various other retroviruses (individual T-cell leukemia pathogen types 1 and 2) (31), individual herpesviruses (individual herpesvirus type 6 [HHV-6], HHV-7, and HHV-8) (4, 7, 9, 12, 32), or non-pathogenic flavivirus GB pathogen (30) influences development of individual immunodeficiency pathogen type 1 (HIV-1) disease. Foamy infections (FVs) are innocuous complicated retroviruses that create lifelong persistent ...
GK1.5 ATCC ® TIB-207™ Rattus norvegicus (B cell); Mus muscul
Animals were immunized with the cloned cytotoxic T lymphocyte lines V4 and 243/2.5. Spleen cells were fused with Sp2/0-Ag14 myeloma cells.
Xenopus
Disclaimer Dharmacon is a distributor of multiple gene expression clone collections (cDNAs and ORFs). These clone collections were generated by groups outside of Dharmacon and thus the quality of the collections is largely dependent upon what Dharmacon received from these groups. Specific clone information and plate coordinates were provided to Dharmacon by the suppliers of these clone collections. Dharmacon has not sequence verified each individual clone from these collections. These collections and individual clones are distributed as is with no additional product validation or guarantees. Dharmacon has established quality procedures to ensure that individual clones are picked from the identified well in a plate, grown on the correct antibiotic, and are free of phage contamination. Due to the quality of the information provided to Dharmacon, the clone you receive might not match the expected clone. If this occurs, please contact Technical Support.. All clones and plates are provided as ...
Xenopus
Disclaimer Dharmacon is a distributor of multiple gene expression clone collections (cDNAs and ORFs). These clone collections were generated by groups outside of Dharmacon and thus the quality of the collections is largely dependent upon what Dharmacon received from these groups. Specific clone information and plate coordinates were provided to Dharmacon by the suppliers of these clone collections. Dharmacon has not sequence verified each individual clone from these collections. These collections and individual clones are distributed as is with no additional product validation or guarantees. Dharmacon has established quality procedures to ensure that individual clones are picked from the identified well in a plate, grown on the correct antibiotic, and are free of phage contamination. Due to the quality of the information provided to Dharmacon, the clone you receive might not match the expected clone. If this occurs, please contact Technical Support.. All clones and plates are provided as ...
Monoclonal expansion of B cells and plasma cells, producing antibodies against - GLO1 inhibitors for neuropsychiatric
Monoclonal expansion of B cells and plasma cells, producing antibodies against self molecules, can be found not only in different autoimmune diseases, such as peripheral neuropathy (PN), but also in malignancies, such as Waldenstr?ms macroglobulinaemia and B-type of chronic lymphocytic leukaemia (B-CLL), as well as in precancerous conditions including monoclonal gammopathy of undetermined significance (MGUS). time. PIK3CD The anti-P0 antibodies were of IgM- type. The antibodies belonged to the VH3gene family with presence of somatic mutations. The IgM reacted with P0 and myelin-associated glycoprotein (MAG), and showed no evidence for polyreactivity, in contrast to other IgM CD5+clones included in the study as controls. The expanded clones expressed CD80 and HLA-DR, which is compatible with properties of antigen-presenting cells. The immunomagnetic selection technique was successfully used for isolation SM-406 of antimyelin protein P0-specific clones. The cell lines may provide useful tools in ...
In-Depth Characterization and Functional Analysis of Clonal Variants in a Mycobacterium tuberculosis Strain Prone to...
The role of clonal complexity has gradually been accepted in infection by Mycobacterium tuberculosis (MTB), although analyses of this issue are limited. We performed an in-depth study of a case of recurrent MTB infection by integrating genotyping, whole genome sequencing, analysis of gene expression and infectivity in in vitro and in vivo models. Four different clonal variants were identified from independent intrapatient evolutionary branches. One of the single-nucleotide polymorphisms in the variants mapped in mce3R, which encodes a repressor of an operon involved in virulence, and affected expression of the operon. Competitive in vivo and in vitro co-infection assays revealed higher infective efficiency for one of the clonal variants. A new clonal variant, which had not been observed in the clinical isolates, emerged in the infection assays and showed higher fitness than its parental strain. The analysis of other patients involved in the same transmission cluster revealed new clonal variants acquired
Clonal heterogeneity of the anti-erythrocyte autoantibody responses of by D H. De heer and T S. Edgington
De heer, D H. and Edgington, T S., Clonal heterogeneity of the anti-erythrocyte autoantibody responses of nzb mice. (1974). Subject Strain Bibliography 1974. 168 ...
Specific recognition of influenza virus polymerase protein (PB1) by a murine cytotoxic T-cell clone. - Immunology
Cytotoxic T-cell clones were raised in CBA mice that recognised both A/X31 and A/JAP/305/1957 influenza virus. Here, we describe one CTL clone that recognises target cells infected with a recombinant vaccinia virus expressing influenza PB1.
Cell lineage analysis of the mandibular segment of the amphipod Orchestia cavimana reveals that the crustacean paragnaths are...
Based on our knowledge of the cell division pattern of the early developing mandibular region (see above) we were able to look at its morphogenesis at a very high level of resolution. By means of single cell labeling with the fluorescent dye DiI we were able to reconstruct and analyze the clonal composition of the mandibular region from the beginning of ectodermal proliferation up to the differentiation of the mouthparts. The cell labeling reveals that the paragnaths have their origin in the area I and area II which comprises columns 1 to 3 of region E(0). The mandibles originate from cells of the areas II and III (columns 2 to 4). Areas I and II contribute also to the sternal region and the mandibular ganglia whereas area III forms parts of the tergites as well. In more posterior segments, columns 1 and 2 mainly contribute to the formation of segmental ganglia and probably sternites, and columns 3 to 5 mainly give rise to limbs [36, 46]. Hence, when compared with clonal composition of the ...
Influenza a specific cytotoxic t-cell clones that do not recognize vir by A R. Townsend and J J. Skehel
Townsend, A R. and Skehel, J J., Influenza a specific cytotoxic t-cell clones that do not recognize viral glycoproteins. (1982). Subject Strain Bibliography 1982. 1222 ...
Role of IL-1 in the activation and inactivation of human T-cell clones: Relevance to rheumatological disease - Department of...
Interleukin-1 has a key role in the initial activation of T cells. However, its role, once T cells are fully activated, is not known. Human T-cell clones, driven with antigen and antigen-presenting cells once a week, and twice weekly with interleukin-2, are the most activated T cells known. We thus tested whether IL-1 was necessary for the activation of T-cell clones, using mouse L cells (incapable of producing human IL-1) transfected with human HLA-DP genes. No requirement for exogenous IL-1 was detected for induction of proliferation. In contrast to the lack of a requirement for IL-1 in T-cell activation, T-cell tolerance, the state of antigen-specific antigen-induced unresponsiveness, was partly blocked by IL-1 indicating that these cells can still respond to IL-1 in the appropriate circumstances. Blockage of tolerance induction by IL-1 may be one of the mechanisms underlying the maintenance of the autoimmune process.
Expanded CD4+ and CD8+ T cell clones in elderly humans. | The Journal of Immunology
The diversity of the human TCR repertoire in aging has been studied by examining the profiles of complementarity-determining region 3 (CDR3) sizes expressed by the BV families. The TCRBV CDR3 profile, which shows size heterogeneity in young adult humans, is significantly restricted in aged humans. Clonal T cell expansions were identified using a PCR-based approach, in one or more BV families from all 14 healthy persons over the age of 65 that we studied. CD4+ T cell expansions were identified in 8 of 11 donors and CD8+ T cell expansions in 7 of 10 donors. These clonal expansions were stable during a 2-year period. Interestingly, more than half of the aged persons had clonal expansions within the BV3, -14, -16, and -23 families. Although there was no homology among the eight CDR3 sequences identified in clonal T cells from 8 aged persons, selective pressure on the expanded T cell clones was suggested by the fact that the BV families used by the T cell clones were not proportional to the number of ...
JCI - Influenza-specific lung-resident memory T cells are proliferative and polyfunctional and maintain diverse TCR profiles
Here we analyzed the phenotype, functionality, and clonal composition of influenza virus-specific lung-resident memory CD8+ Trm cells. We show that human lung tissue contains a population of CD8+ Trm cells that are highly proliferative and whose progeny are polyfunctional. We observe an enrichment of influenza virus-specific CD8+ T cells within the Trm cell compartment and show that different specificities of influenza virus-specific CD8+ T cell differentiated into Trm cells with varying degrees of efficiency. Ex vivo single-cell analysis of TCRαβ clonotypes within the influenza virus-specific lung CD8+ Trm cell compartment provides clear evidence for the maintenance of TCRαβ diversity within the long-lived CD8+ Trm cell pool, with no indication of clonal skewing or TCR repertoire narrowing.. The assessment of the effector function of the progeny of Trm cells has been difficult to measure using mouse models. This is because murine Trm cells are difficult to expand ex vivo and are highly ...
JCI - Influenza-specific lung-resident memory T cells are proliferative and polyfunctional and maintain diverse TCR profiles
Here we analyzed the phenotype, functionality, and clonal composition of influenza virus-specific lung-resident memory CD8+ Trm cells. We show that human lung tissue contains a population of CD8+ Trm cells that are highly proliferative and whose progeny are polyfunctional. We observe an enrichment of influenza virus-specific CD8+ T cells within the Trm cell compartment and show that different specificities of influenza virus-specific CD8+ T cell differentiated into Trm cells with varying degrees of efficiency. Ex vivo single-cell analysis of TCRαβ clonotypes within the influenza virus-specific lung CD8+ Trm cell compartment provides clear evidence for the maintenance of TCRαβ diversity within the long-lived CD8+ Trm cell pool, with no indication of clonal skewing or TCR repertoire narrowing.. The assessment of the effector function of the progeny of Trm cells has been difficult to measure using mouse models. This is because murine Trm cells are difficult to expand ex vivo and are highly ...
JCI - Influenza-specific lung-resident memory T cells are proliferative and polyfunctional and maintain diverse TCR profiles
Here we analyzed the phenotype, functionality, and clonal composition of influenza virus-specific lung-resident memory CD8+ Trm cells. We show that human lung tissue contains a population of CD8+ Trm cells that are highly proliferative and whose progeny are polyfunctional. We observe an enrichment of influenza virus-specific CD8+ T cells within the Trm cell compartment and show that different specificities of influenza virus-specific CD8+ T cell differentiated into Trm cells with varying degrees of efficiency. Ex vivo single-cell analysis of TCRαβ clonotypes within the influenza virus-specific lung CD8+ Trm cell compartment provides clear evidence for the maintenance of TCRαβ diversity within the long-lived CD8+ Trm cell pool, with no indication of clonal skewing or TCR repertoire narrowing.. The assessment of the effector function of the progeny of Trm cells has been difficult to measure using mouse models. This is because murine Trm cells are difficult to expand ex vivo and are highly ...
JCI - Influenza-specific lung-resident memory T cells are proliferative and polyfunctional and maintain diverse TCR profiles
Here we analyzed the phenotype, functionality, and clonal composition of influenza virus-specific lung-resident memory CD8+ Trm cells. We show that human lung tissue contains a population of CD8+ Trm cells that are highly proliferative and whose progeny are polyfunctional. We observe an enrichment of influenza virus-specific CD8+ T cells within the Trm cell compartment and show that different specificities of influenza virus-specific CD8+ T cell differentiated into Trm cells with varying degrees of efficiency. Ex vivo single-cell analysis of TCRαβ clonotypes within the influenza virus-specific lung CD8+ Trm cell compartment provides clear evidence for the maintenance of TCRαβ diversity within the long-lived CD8+ Trm cell pool, with no indication of clonal skewing or TCR repertoire narrowing.. The assessment of the effector function of the progeny of Trm cells has been difficult to measure using mouse models. This is because murine Trm cells are difficult to expand ex vivo and are highly ...
Inferring Tumor Progression from Genomic Heterogeneity
Cancer progression in humans is difficult to infer because we do not routinely sample patients at multiple stages of their disease. However, heterogeneous breast tumors provide a unique opportunity to study human tumor progression because they still contain evidence of early and intermediate subpopulations in the form of the phylogenetic relationships. We developed a method we call Sector-Ploidy-Profiling to study the clonal composition of breast tumors. SPP involves macro-dissecting tumors, flow-sorting genomic subpopulations by DNA content, and profiling genomes using comparative genomic hybridization. Breast carcinomas display two classes of genomic structural variation: (1) monogenomic and (2) polygenomic. Monogenomic tumors appear to contain a single major clonal subpopulation with a highly stable chromosome structure. Polygenomic tumors contain multiple clonal tumor subpopulations, which may occupy the same sectors, or separate anatomic locations. In polygenomic tumors, we show that ...
IL-4 is an essential factor for the IgE synthesis induced in vitro by human T cell clones and their supernatants. | The Journal...
The property of 109 CD4+ T cell clones (TCC) to induce IgE synthesis in vitro in human B cells was compared with their ability to produce IL-2, IL-4, and IFN-gamma in their supernatants (SUP) after 24-h stimulation with PHA. A significant positive correlation was found between the property of TCC to induce or enhance spontaneous IgE synthesis and their ability to release IL-4. In contrast, there was an inverse relationship between the IgE helper activity of TCC and their ability to release IFN-gamma, whereas no statistical correlation between the property to induce IgE synthesis and to produce IL-2 was observed. The ability of PHA-SUP from 71 CD4+ TCC to induce IgE synthesis in B cells was also investigated. Twenty-nine SUP (all derived from TCC active on IgE synthesis) induced production of substantial amounts of IgE in target B cells. There was a correlation between the amount of IgE synthesized by B cells in response to these SUP and their IL-4 content. An even higher correlation was found ...
Interactions between autologous T cell clones. - The Kennedy Institute of Rheumatology
A human CD4 clone (Mx9/9) using the V beta 8 receptor was used as antigen to generate autologous clones (termed anti-Mx9/9 clones) which proliferate in response to this clone, but not other autologous clones. This was used as an experimental model to explore the specific interactions between autologous T cells. Anti-HLA-DR monoclonal antibodies inhibited the response of the anti-Mx9/9 clones, suggesting that these clones recognize their target antigen in association with HLA-DR. Because of the specificity of the anti-Mx9/9 clones for the initiating clone (Mx9/9), but not any other autologous V beta 8- or V beta 8+ CD4 clones, the target antigen seems to be part of the T cell receptor, but not V beta 8 itself. However, the anti-Mx9/9 clones responded also to the autologous EBV line, and thus the target antigen is not known. The regulatory activity of the anti-Mx9/9 clones was assayed by coculture with their target clone. A variety of responses were seen, both inhibitory and stimulatory, which varied
T AND B CELL CLONALITY
ID:1,Note:Day(s) Test Set up: Last updated on 16/01/17.,Date:2017-01-16T03:55:00.000Z,Deleted:false,IsNew:false},{ID:2,Note:,font face=\Times New Roman\,\n,font face=\Calibri\,Day(s) Test Set-Up has been last updated on 05/02/21.,/font,,/font,,font face=\Times New Roman\,\n\n,/font,,Date:2021-02-05T07:00:00.000Z,Deleted:false,IsNew:true ...
Actin (muscle specific)Clone: HHF35
Actin (muscle specific)Clone: HHF35Species reactivity: Human, rabbit, rat.Host: MouseDescription: Actin is a major component of the cytoskeleton. This antibody recognizes actin of skeletal, cardiac, and smooth muscle cells. It is not reactive with other mesenchymal cells except for myoepithelium. Anti-Muscle-Specific Actin recognizes alpha and gamma isotypes of all muscle groups. Non-muscle cells such as vascular endothelial cells and connective tissues are non-reactive. Also, neoplastic cells of non-muscle-derived tissue such as carcinomas, melanomas, and lymphomas are negative. This antibody is useful in the identification of rhabdoid cellular elements.
Wanted - T cell clones, rheumatoid arthritis
I am presently looking at cytokine mediated differential gene expression in T cells. Ideally I would like to use human T cell clones derived from subjects with rheumatoid arthritis. I dont have much experience in T cell cloning and I am led to believe that it is very time consuming and not always successful. Any help along this line would be most appreciated, particularly a contact address/number for someone who may have developed such clones already. I can be contacted directly at dh5 at holyrood.ed.ac.uk Thanx in advance, Dave Hunter ...
Anti-CD8 antibodies can inhibit or enhance peptide-MHC class I (pMHCI) multimer binding: this is paralleled by their effects on...
Cytotoxic T lymphocytes recognize short peptides presented in association with MHC class I (MHCI) molecules on the surface of target cells. The Ag specificity of T lymphocytes is conferred by the TCR, but invariable regions of the peptide-MHCI (pMHCI) molecule also interact with the cell surface glycoprotein CD8. The distinct binding sites for CD8 and the TCR allow pMHCI to be bound simultaneously by both molecules. Even before it was established that the TCR recognized pMHCI, it was shown that CTL exhibit clonal heterogeneity in their ability to activate in the presence of anti-CD8 Abs. These Ab-based studies have since been interpreted in the context of the interaction between pMHCI and CD8 and have recently been extended to show that anti-CD8 Ab can affect the cell surface binding of multimerized pMHCI Ags. In this study, we examine the role of CD8 further using point-mutated pMHCI Ag and show that anti-CD8 Abs can either enhance or inhibit the activation of CTL and the stable cell surface binding of
immuneACCESS Data | Association of Tumor Microenvironment T-Cell Repertoire and Mutational Load With Clinical Outcome After...
Open-access immunosequencing data | Weber, Jeffrey | Cancer Immunology Research | Adaptive Biotechnologies | To understand prognostic factors for outcome between differentially sequenced nivolumab and ipilimumab in a randomized phase II trial, we measured T-cell infiltration and PD-L1 by immunohistochemistry, T-cell repertoire metrics, and mutational load within the tumor. We used next-generation sequencing (NGS) and assessed the association of those parameters with response and overall survival. Immunosequencing of the T-cell receptor -chain locus (TCR) from DNA of 91 pretreatment tumor samples and an additional 22 pairs of matched pre- and post treatment samples from patients who received nivolumab followed by ipilimumab (nivo/ipi), or the reverse (ipi/nivo), was performed to measure T cell clonality and fraction. Mutational and neoantigen load were also assessed by NGS in 82 of the 91 patients. Tumors were stained using immunohistochemistry for PD-L1+ and CD8+ T cells. Pretreatment tumor TCR
Microbiota activated CD103+ DCS stemming from oral microbiota adaptati by Christopher Jay Fleming
IL-17 producing γδ T cells (γδT17) promote numerous autoimmune diseases such as psoriasis and arthritis, as well as, cancers of the colon, lung and breasts. Yet γδT17 peripheral regulation has yet to be thoroughly explored. In mice deficient in IL-17 signaling, we observed expansion of γδT17 in all major tissues. However, γδT17 expansion was not uniformly distributed systemically and was most prominent in oral draining cervical lymph nodes (LNs) with monoclonal expansion of Vγ6 γδT17. In vitro proliferation assays of these cervical LNs showed endogenous proliferation by γδT17 dependent on cell-to-cell contact with CD103+ DCs. CD86+ and CD80+ activated CD103+ DCs are increased in the oral draining LNs suggesting that perhaps microbiota-activated CD103+ DC expand γδT17. 16s rRNA FISH hybridization shows increase in 16s rRNA in oral draining LNs. Treatment of mice deficient in IL-17 signaling with α-LTBR-Ig (to remove LNs) or oral broad-spectrum antibiotics abrogates γδT17 expansion.
Milli-Mark™ Anti-CD38-FITC Antibody, clone AT13/5 | FCMAB194F
Milli-Mark Anti-CD38-FITC Antibody, clone AT13/5 is an antibody against CD38 for use in FC. Find MSDS or SDS, a COA, data sheets and more information.
16th annual PANDA fashion show benefits childrens research center - Paradise Valley Independent | Paradise Valley Independent
The organization seeks to identify new anti-cancer drugs that contain the cancer, develop natural immunity to the cells, and reduce the emergence of tumor cell clones.. Parents and families around the globe, including over 200 children in Arizona every year, are desperately searching for help, answers and treatment when their child is diagnosed with cancer and the Steele Childrens Research Center strives to provide them with the most current and effective cures that will keep their families whole.. Since its founding, the Phoenix Womens Board of the Steele Childrens Research Center, known as PANDA (People Acting Now Discover Answers), has raised more than $5.25 million to improve treatments and cures for devastating childhood diseases as well as to fund and recruit internationally recognized pediatric physicians and scientists to Arizona, providing local families with the most cutting-edge medical care.. Last year, they opened an office in the Arcadia neighborhood of Phoenix, located at 4455 ...
Supplementary MaterialsSupplementary Materials: Supplementary Figure 1: T cell colonies under treatment of parental and...
Supplementary MaterialsSupplementary Materials: Supplementary Figure 1: T cell colonies under treatment of parental and gastrospheres conditioned media in ratios of 1 1?:?1, 1?:?5, and 1?:?10 in MLR. anti-CD3/CD28 beads. The proliferation was evaluated using CFSE staining; the percentages of CD4+CD25+FoxP3+ Treg and CD4+IL-17+ Th17 cells and IFN-and death induction in target cells. All these changes were related to the upregulation of IL-6, IL-10, and IL-22 in gastrospheres compared to parental cells. Conclusion Our study showed that the condition media of gastrospheres can potentially induce Th17 with increasing in their cytotoxic effect. Based on our knowledge, the present study is the first study that emphasizes the role of gastrospheres in the induction of antitumor Th17 cells. However, it should be confirmed with complementary studies tridimensional (3D) culture model of gastric CSCs with stemness properties [3]. In general, CSCs employ several mechanisms to evade the immune system such as ...
JCI - Clonal analysis of T lymphocytes in the acquired immunodeficiency syndrome. Evidence for an abnormality affecting...
Purified helper-inducer (T4+) and suppressor-cytotoxic (T8+) lymphocytes from eight patients with acquired immunodeficiency syndrome (AIDS) and eight healthy heterosexual donors were examined by limiting dilution analysis for their ability to be clonally expanded. It was demonstrated that viable T4+ and T8+ lymphocytes from patients with AIDS had markedly reduced proportions of clonable cells compared to the healthy donors (T4 = 1:255 vs. 1:34, P = 0.06; T8 = 1:355 vs. 1:55, P = 0.01). However, the cloned T cells that were obtained from the patients with AIDS demonstrated normal proliferation in response to phytohemagglutinin and alloantigen, and normal ability to help or suppress pokeweed mitogen-driven IgG synthesis. These results strongly suggest that, in addition to a quantitative diminution of T4+ lymphocytes in AIDS, there is an intrinsic functional defect in the surviving T4+ and T8+ lymphocytes, which is reflected by a severe decrease in their potential for clonal expansion. ...
FISH Clones Track Settings
This track shows the location of fluorescent in situ hybridization (FISH)-mapped clones along the assembly sequence. The locations of these clones were obtained from the NCBI Human BAC Resource here. Earlier versions of this track obtained this information directly from the paper Cheung, et al. (2001). More information about the BAC clones, including how they may be obtained, can be found at the Human BAC Resource and the Clone Registry web sites hosted by NCBI. To view Clone Registry information for a clone, click on the clone name at the top of the details page for that item.. ...
FISH Clones Track Settings
This track shows the location of fluorescent in situ hybridization (FISH)-mapped clones along the assembly sequence. The locations of these clones were obtained from the NCBI Human BAC Resource here. Earlier versions of this track obtained this information directly from the paper Cheung, et al. (2001). More information about the BAC clones, including how they may be obtained, can be found at the Human BAC Resource and the Clone Registry web sites hosted by NCBI. To view Clone Registry information for a clone, click on the clone name at the top of the details page for that item.. ...
Clones : The Academy
I disagreed wih the the production of human clones. One reason was that I could not think of a practical reason to make more people. Dont we have enough already? One might say that we can, in a way, bring people back from the dead. I know thats probably not a good way to put it, but Im hoping that you get the jist of what Im saying. I dont think people would accept clones the way they accept real people; its just not the same thing. I dont think many people would like to buy a clone. I know I wouldnt. So really, I think making clones is a waste of time. Theres no real purpose for it, and its a waste of money (we brought up the topic of space travel at this point...). Making clones for a war, like Star Wars, also seemed pretty bizzare. If one were to create a million clones to go to war, Im not sure they would obey. Their purpose is to die, or to kill. As blan as the clones would be, their sense of moral would be intact Im sure. You cant order a living thing to die in these ...
Antiidiotypic Blocking of Graves′ Disease Biologic Activity with Autologous Sera But Not Consistently with Homologous Sera:...
Although there is multiple evidence for the functional heterogeneity and polyclonality of TRAb (1 - 3) both statements are questioned by some investigators (4, 5). Furthermore there is growing...
Clonal competition in BcrAbl-driven leukemia: how transplantations can accelerate clonal conversion | Molecular Cancer | Full...
Clonal competition in cancer describes the process in which the progeny of a cell clone supersedes or succumbs to other competing clones due to differences in their functional characteristics, mostly based on subsequently acquired mutations. Even though the patterns of those mutations are well explored in many tumors, the dynamical process of clonal selection is underexposed. We studied the dynamics of clonal competition in a BcrAbl-induced leukemia using a γ-retroviral vector library encoding the oncogene in conjunction with genetic barcodes. To this end, we studied the growth dynamics of transduced cells on the clonal level both in vitro and in vivo in transplanted mice. While we detected moderate changes in clonal abundancies in vitro, we observed monoclonal leukemias in 6/30 mice after transplantation, which intriguingly were caused by only two different BcrAbl clones. To analyze the success of these clones, we applied a mathematical model of hematopoietic tissue maintenance, which indicated that a
IMCgp100 in Advanced Unresectable Melanoma
A phase 0, exploratory study of the pharmacodynamics of a single intratumoral dose of
IMCgp100, a monoclonal T cell receptor anti-CD3 scFv fusion protei
HELIOS, APC-eFluor 780, clone: 22F6, eBioscience™ 100 Tests; APC-eFluor 780 HELIOS, APC-eFluor 780, clone: 22F6, eBioscience™
HELIOS, APC-eFluor 780, clone: 22F6, eBioscience™ 100 Tests; APC-eFluor 780 HELIOS, APC-eFluor 780, clone: 22F6, eBioscience™ Primary Antibodies He to Hf
CD39 Mouse anti-Human, PE, Clone: eBioA1 (A1), eBioscience™ 100 tests; PE CD39 Mouse anti-Human, PE, Clone: eBioA1 (A1),...
CD39 Mouse anti-Human, PE, Clone: eBioA1 (A1), eBioscience™ 100 tests; PE CD39 Mouse anti-Human, PE, Clone: eBioA1 (A1), eBioscience™ Primary Antibodies...
CD36 Mouse anti-Human, Clone: eBioNL07 (NL07), eBioscience™ 100 μg; Unconjugated CD36 Mouse anti-Human, Clone: eBioNL07 (NL07),...
CD36 Mouse anti-Human, Clone: eBioNL07 (NL07), eBioscience™ 100 μg; Unconjugated CD36 Mouse anti-Human, Clone: eBioNL07 (NL07), eBioscience™ Primary...
Genetically Modified Peripheral Blood Stem Cell Transplant in Treating Patients With HIV-Associated Non-Hodgkin or Hodgkin...
PRIMARY OBJECTIVES:. I. To determine the safety and feasibility of infusing gene-modified, human immunodeficiency virus (HIV)-protected hematopoietic stem cells (HSC) after high-dose chemotherapy for treatment of acquired immunodeficiency syndrome (AIDS)-related lymphoma.. II. To determine the dose of carmustine (BCNU) in combination with O^6-benzylguanine (O6BG) that results in selection in vivo of gene-modified HIV-resistant cells.. III. To estimate the effect of HIV infection on the presence of HIV-resistant blood cells as measured by genetic marking for vector sequences before and after antiviral treatment interruption.. SECONDARY OBJECTIVES:. I. Evaluate the molecular and clonal composition of gene-modified cells after hematopoietic cell transplant (HCT).. II. Evaluate the molecular and clonal composition of gene-modified cells after O6BG/BCNU.. III. Determine the correlation of the level of O6-methylguanine- methyltransferase (MGMT) (P140K) marking with toxicity and response.. IV. ...
Brief report: a single neoplastic clone in sequential biopsy specimens from a patient with primary gastric-mucosa-associated...
Brief report: a single neoplastic clone in sequential biopsy specimens from a patient with primary gastric-mucosa-associated lymphoid-tissue lymphoma and Sjögrens syndrome. New England Journal of Medicine New England Journal of Medicine 0028-4793 10.1056/NEJM199307153290305
Tumor clone characteristics: Cytogenetics analysed by FISH | Tumor clone characteristics | The European Myeloma Network
During this time, a hot line with a reference lab will be established to answer technical questions.. A meeting six months later will concentrate on evaluating the results from each laboratory, the consistency of the results and potential for applying within trials. At this meeting an approach to external quality control will be established. At year one a further meeting will evaluate the results, the functioning of the EQUAS and value of each of the probe sets. At this point we will initiate a program to develop and optimize the probes. At year one we will start to map and recruit laboratories to the assay network. By 18 months we will have a fully established network into which we can introduce the necessary technology. ...
Murine hepatic accessory cells support the proliferation of Th1 but not Th2 helper T lymphocyte clones. | Journal of...
The liver is the major site of clearance and degradation of foreign antigens from the portal circulation. Despite the presence of hepatic accessory cells, antibody responses to orally administered antigens are uncommon. To ascertain if hepatic accessory cells are incapable of stimulating specific subsets of T lymphocytes, freshly isolated hepatic nonparenchymal and splenic cells were cultured with a panel of antigen-specific, H-2-restricted Th1 and Th2 HTL clones. Whereas spleen cells stimulated the proliferation of both Th1 and Th2 clones, hepatic nonparenchymal cells (NPC) stimulated the proliferation of only Th1 and not Th2 clones. Adding rIL-1, rIL-6, and rIL-7, alone or in combination, to the cultures did not result in proliferation of the Th2 clones. Despite the absence of Th2 proliferation, NPC were able to stimulate the secretion of IL-3 and IL-4 by Th2 clones in the presence of antigen. Moreover, adding hepatic NPC did not inhibit spleen cells from stimulating Th2 clones in the presence ...
Evidence for common clonal origin of multifocal lung cancers<...
TY - JOUR. T1 - Evidence for common clonal origin of multifocal lung cancers. AU - Wang, Xiaoyan. AU - Wang, Mingsheng. AU - MacLennan, Gregory T.. AU - Abdul-Karim, Fadi W.. AU - Eble, John N.. AU - Jones, Timothy D.. AU - Olobatuyi, Felix. AU - Eisenberg, Rosana. AU - Cummings, Oscar W.. AU - Zhang, Shaobo. AU - Lopez-Beltran, Antonio. AU - Montironi, Rodolfo. AU - Zheng, Suqin. AU - Lin, Haiqun. AU - Davidson, Darrell D.. AU - Cheng, Liang. PY - 2009/4/1. Y1 - 2009/4/1. N2 - Background Lung cancer is the most common cause of cancer death in the United States. Multiple anatomically separate but histologically similar lung tumors are often found in the same patient. The clonal origin of multiple lung tumors is uncertain. Methods We analyzed 70 lung tumors from 30 patients (23 females and seven males) who underwent surgical resection for lung epithelial tumors, of whom 26 had non-small cell carcinomas and four had carcinoid/atypical carcinoid tumors. All patients had multiple tumors (two to ...
Asymmetry in skeletal distribution of mouse hematopoietic stem cell clones and their equilibration by mobilizing cytokines | JEM
Understanding the kinetics and molecular events underlying trafficking of HSCs is important both in basic hematology research and for implementation and interpretation of experimental and clinical BM transplantation protocols. Here, we studied posttransplantation skeletal distribution of hundreds of HSC clones to address the extent of migration in steady-state conditions and upon G-CSF-induced mobilization. Genetic barcoding of highly purified hematopoietic cells was used to quantitatively analyze HSC clone sizes in different bones and contributions of these clones to blood.. Our findings demonstrate that at very extended time intervals (at least 11 mo) after transplantation, the distribution of both old and young HSC clones across multiple skeletal sites is highly skewed. This is in line with data showing relatively slow rates of HSC equilibration in parabiotic mice (Abkowitz et al., 2003). However, our findings are in contrast with a study that suggested that 1-5% of HSC pool circulates daily ...
Epitope specificity and relative clonal abundance do not affect CD8 differentiation patterns during lymphocytic...
To evaluate the impact of immunodominance on CD8 T-cell properties, we compared the functional properties of dominant and subdominant populations in the response to lymphocytic choriomeningitis virus (LCMV). To improve functional discrimination, in addition to the usual tests of phenotype and function, we used a sensitive technique that allows the screening of all CD8 effector genes simultaneously in single cells. Surprisingly, these methods failed to reveal a major impact of clonal dominance in CD8 properties throughout the response. Aiming to increase clonal dominance, we examined high-frequency transferred P14 T-cell receptor transgenic (TCR Tg) cells. Under these conditions LCMV is cleared faster, and accordingly we found an accelerated response. However, when Tg and endogenous cells were studied in the same mice, where they should be subjected to the same antigen load, they showed overlapping properties, and the presence of P14 cells did not modify endogenous responses to other LCMV epitopes or a
Regulatory interactions among autologous T cell clones. Human bifunctional T cell clones regulate the activity of an autologous...
In contrast to the ease of cloning and characterizing, at the molecular level, helper and cytotoxic T cells, suppressor T cells remain an enigma, and their existence as discrete entities is being increasingly challenged. Here we review evidence that CD4+ regulatory clones, capable of expressing both helper and suppressor functions, may account for much of the suppressor function. It is suggested that a single T cell clone, depending on the signals it receives from its environment, may release either helper or suppressor cytokines. Studying such clones under defined conditions (providing suppressor signals), may preclude detection of their helper capacity. Since some therapeutic approaches in various human diseases are based on the manipulation of helper and suppressor functions, the question whether committed suppressor cells exist has important practical implications in medicine.
Andreas Wack | Crick
Andreas Wack was born in Frankfurt, studied biology in Konstanz and got his first degree based upon a thesis on the clonal composition of T cell populations in the elderly. He performed his PhD work at the Medical Research Council National Institute for Medical Research (now part of the Francis Crick Institute) under the supervision of Dimitris Kioussis on thymocyte lineage decisions and went on to do a postdoc and work as a staff scientist in the research institute of Novartis Vaccines, formely Chiron, in Siena, Italy.. The focus of his work there was the modulation of T and NK cell function by the hepatitis C virus, human dendritic cell subsets and their crosstalk, the mechanism of action of mucosal and parenteral vaccine adjuvants, and next generation influenza vaccines.. His current research interests at the Crick include the understanding of pathogenesis and protection in influenza infection and influenza-bacterial coinfection. He is also interested in the anti-influenza response of airway ...
Tavaré Group | Cancer Research UK Cambridge Institute
Figure 1. Stem cell dynamics in tumour initiation illustrated by quantifying the clonal benefit of KrasG12D (from Vermeulen et al., Science 2013; 342: 995). (A) Intestinal stem cells are equipotent and continuously replace each other in a stochastic fashion. (B) Confocal images of SI crypt bottoms of AhCreER/tdTom-/fl mice (WT) and AhCreER/tdTom-/fl/Kras-G12Dfl (KrasG12D) at the indicated time points after clone induction. Clone sizes are indicated as fractions (in eighths) of the crypt circumference. Blue, nuclear stain (DAPI); red, tdTom expression; scale bars represent 30mm. (C and D) The distribution of clone sizes and the corresponding distribution changes caused by the activation of Kras can be captured using stochastic models. The models describe the competition between the stem cells and summarise the fitness of the mutant stem cell via PR, the probability that the mutant will replace its neighbour. A value of PR = 0.5 means that the mutant stem cell is as fit as the WT cells and a value ...
Functional polymorphism of each of the two HLA-DR beta chain loci demonstrated with antigen-specific DR3- and DRw52-restricted...
HLA-DR3- and HLA-DRw52-associated functional polymorphism was investigated with selected tetanus toxoid (TT)-specific T cell clones. We have shown earlier that HLA-DR antigens are encoded by two distinct loci, DR beta I and DR beta III. The alloantigenic determinant(s) defined by the serological HLA-DR3 specificity map to the former, while the supratypic HLA-DRw52 determinants map to DR beta III. Furthermore, we have recently recognized by DNA sequencing three alleles of HLA-DRw52 at locus DR beta III, referred to as 52 a, b, and c. Our objective was to correlate the pattern of T cell restriction with the gene products of individual DR beta chain loci and with the three newly described alleles of locus DR beta III. Among the selected T cell clones, 5 reacted exclusively when TT was presented by HLA-DR3+ APCs (TT-DR3-APC). In contrast, two T cell clones were stimulated by TT-DRw52-APC. More specifically, these two T cell clones (Clones 10 and 16) were stimulated by different subsets of ...
A SMALL FRACTION OF PROVIRUSES IN EXPANDED CLONES EXPRESS UNSPLICED HIV RNA IN VIVO | CROI Conference
The vast majority of proviruses that persist on ART are defective. Of the minority that are intact (~2%), the fractions that are latent or transcriptionally active are not known. To address this question, we determined the fraction of proviruses that express HIV RNA in vivo in cell populations carrying either intact or defective proviruses.. PBMC were obtained from Patient #1 in Maldarelli, et al. (Science, 2014). This donor had multiple clones of cells that contain intact or defective proviruses. Proviral expression was determined by single-genome pro-pol sequencing (SGS) of HIV DNA and RNA from multiple aliquots of PBMC diluted to an endpoint such that each aliquot contained one to a few HIV RNA expressing cells. Intact proviruses were identified using viral outgrowth assays (VOA). The levels and fractions of cells expressing HIV RNA were determined for probable clones (identified by identical sequence matches) carrying intact and defective proviruses.. A total of 77 million PBMC were ...
Plus it
Tumor cell clones isolated from a rat 13762NF mammary adenocarcinoma and its spontaneous metastases were heterogeneous in their survival responses to continuous 42° heating. Clones MTLn3 and MTF7 had similar initial survival responses; they were significantly less sensitive than clone MTC. Following the first decrease in survival, different magnitudes of induced thermal resistance were observed. When ratios of the first and resistant slopes of survival curves were compared (the thermotolerance ratio), the order of induced thermal resistance was MTLn3 , MTF7 , MTC.. These clones were compared for the rates of synthesis of heat stress proteins (HSP). The same four major HSP at Mr 112,000, 90,000, 70,000, and 22,000 were induced or enhanced in all 3 clones. The rates of synthesis of these HSP were analyzed through a unique system of computer-assisted video densitometry and digitization. When all 4 HSP were analyzed as a group, the rates were significantly different (p , 0.017), and the rank order ...
Longitudinal fluorescence in situ hybridization reveals cytogenetic evolution in myeloma relapsing after autologous...
The outcome of patients with MM has improved substantially during the last decades as a result of drug development and progress in the understanding of disease biology.11,12 However, even in the era of novel agents some patients with high-risk cytogenetic abnormalities or early relapse after first-line treatment have a dismal outcome.13,14 Clonal heterogeneity and evolution are contributors to disease progression and ultimately refractoriness in MM.6 So far, there are only limited data available that proved clonal evolution in patients relapsing after ASCT for newly diagnosed disease. With our current analysis of 128 patients with FISH data at primary diagnosis and relapse after ASCT we demonstrate that high-risk cytogenetic abnormalities occur more frequently at relapse. This observation was especially due to de novo gains of chromosome 1q and new deletions of chromosome 17p. No changes were observed between primary diagnosis and relapse for defined IGH translocations, including t(4;14).. A ...
Detection of identical T cell clones in peritumoral pleural effusion and pneumonitis lesions in a cancer patient during immune...
https://doi.org/10.18632/oncotarget.25743 Kentaro Tanaka, Toyoshi Yanagihara, Yuki Ikematsu, Hiroyuki Inoue, Keiichi Ota, Eiji Kashiwagi, Kunihiro Suzuki, Naoki Hamada, Ario Takeuchi, Katsunori...
Isolation of myoblastic, fibro-adipogenic, and fibroblastic clonal cell lines from a common precursor and study of their...
TY - JOUR. T1 - Isolation of myoblastic, fibro-adipogenic, and fibroblastic clonal cell lines from a common precursor and study of their requirements for growth and differentiation. AU - Darmon, Michel. AU - Serrero, Ginette. AU - Rizzino, Angie. AU - Sato, Gordon. N1 - Funding Information: We thank Dr H. Jakob for the gift of the T984 cell line and for the stimulatingd iscussionswhich led to this study and also Drs H. E&en, J.-F. Nicolas, M. H. But and F. Jacob for stimulatingd iscussions. We thank Dr R. Bloch for his assistancei n performing experimentsw ith rhodamine-labeleda BT and Drs J. Orly, D. McClure, and D. Barnes for their valuable help during this work. We thank Dr D. Weinstein for helu in oreoarine delioidated and delioooroteinized sera and-D; S. Cohenfor the gift of high molecular weight EGF. These experimentsw ere conductedd ur-ingthe tenure of an ACS-Eleanor Roosevelt lnter- national Cancer Fellowship awarded by the Intema-tional Union Against Cancer to M. D. USPHS-CA 19731a nd ...
PATCH 0/6] Update clone3 self-tests
Re: [PATCH 1/6] selftests/clone3: convert test modes into an enum 2019-09-10 12:03 ` [PATCH 1/6] selftests/clone3: convert test modes into an enum Eugene Syromiatnikov @ 2019-09-16 16:28 ` shuah 0 siblings, 0 replies; 13+ messages in thread From: shuah @ 2019-09-16 16:28 UTC (permalink / raw) To: Eugene Syromiatnikov, linux-kernel, Christian Brauner, linux-kselftest Cc: Adrian Reber, shuah On 9/10/19 6:03 AM, Eugene Syromiatnikov wrote: , * tools/testing/selftests/clone3/clone3.c (CLONE3_ARGS_NO_TEST, , CLONE3_ARGS_ALL_0, CLONE3_ARGS_ALL_1): Change into an enum. , (call_clone3): Change test_mode parameter type to enum test_mode; , use switch statement for actions that dependent on test_mode selection. , (test_clone3): Change test_mode parameter type to enum test_mode. , You dont need the file name in the commit log. Please describe what you are fixing/doing in the commit. Describing the actual code changes doesnt help. Including why these changes are needed as opposed the actual changes will ...
The mutational landscape of normal human endometrial epithelium | Nature
All normal somatic cells are thought to acquire mutations, but understanding of the rates, patterns, causes and consequences of somatic mutations in normal cells is limited. The uterine endometrium adopts multiple physiological states over a lifetime and is lined by a gland-forming epithelium1,2. Here, using whole-genome sequencing, we show that normal human endometrial glands are clonal cell populations with total mutation burdens that increase at about 29 base substitutions per year and that are many-fold lower than those of endometrial cancers. Normal endometrial glands frequently carry driver mutations in cancer genes, the burden of which increases with age and decreases with parity. Cell clones with drivers often originate during the first decades of life and subsequently progressively colonize the epithelial lining of the endometrium. Our results show that mutational landscapes differ markedly between normal tissues-perhaps shaped by differences in their structure and physiology-and indicate
Cell Cloning Cylinders | Laboratory Microbiology Lab Supplies | Spectrum Chemical
Get Cell Cloning Cylinders at Spectrum Chemical. SpectrumChemical.com carries a full line of fine chemicals, lab appliances and lab supplies. Spectrum Chemical has a complete line of laboratory supplies, equipment and safety items.
Long Live the Clones | DiscoverMagazine.com
Over the past two years, a team led by biologist Teruhiko Wakayama at the University of Hawaii has produced six generations of cloned mice clones of clones of clones of clones of clones of clones. The researchers paid particular attention to the animals telomeres, the caps at the tips of their chromosomes. These genetic caps are associated with aging. They grow shorter over time and are thought to contribute to cell death as they wear away. In conventional reproduction, telomeres are restored during the formation of sperm and egg cells, but cloning bypasses that process. We might therefore expect telomeres to become shorter and shorter in successive generations of clones, says Tony Perry of Rockefeller University, one of Wakayamas collaborators. Bafflingly, they seem to get longer ...
IRJPAS
Effective neutralization of different strains of HIV virus is shown by neutralizing antibodies against HIV-1 envelope glycoproteins. It has been demonstrated that gp41 is involved in virus mediated membrane fusion which results in HIV-entry into target cells. Recombinant single chain antibodies (scFvs) with high specificity and high affinity properties have been identified as useful agents in anti-viral targeted therapy. In this study we selected specific scFvs against a conserved neutralizing epitope of gp41. Four rounds of panning were performed to select the specific clones. The reactivity of the selected scFvs against the corresponding epitope was tested in ELISA. Results demonstrated that the specific clones were selected with the frequencies of 65% and 30%. The ELISA evaluation demonstrated significant higher OD of scFvs in reaction with the corresponding epitope than the negative control. Specific scFvs against conserved neutralizing epitope of gp41 of HIV has the potential to be ...
MOVIMIENTO FENIX DE PUERTO RICO: ALMAS O ESPIRITUS, AJUSTADORES DE PENSAMIENTO, CHISPAS DIVINAS, MUERTE, ROBOTOIDES, CLONES,...
Nov 13, 2007, 22:49. Todo lo que Tú Querías Saber Sobre los Robotoides y Clones. Por Candace. 2007-11-10. Hola a todos, puesto que recientemente Patrick Bellringer ha estado haciendo énfasis en los clones, es tiempo de aclarar más completamente los misterios. Primero usemos dos términos diferentes: clones y Robotoides. Un clon ç en esta discusión significará los clones que ustedes ven en el gobierno, tales como el residente y no-electro clon que funciona en la Casa Blanca, y todos sus cómplices clones. La mayoría de estos clones son hechos en cuestión de algunas semanas, de células tomadas del cuerpo original, ya sean que se trate de humanos reales o robotoides. ¿Así que entonces que es un robotoides? No es exactamente un clon, como se describe arriba. Aproximadamente en el año 2500 A.C.a los propietarios del planeta les preocupaba que aquellos sobrevivientes del último viaje a través del Cinturón de Fotones, del gran diluvio y de otras calamidades se volviera nuevamente por ...
Whats App Clone Script | Chat Clone Script | Grow Wider
Get a chat clone script from Grow Wider that is a highly reliable and secure messaging app. Contact for Whatsapp clone, wechat clone and telegram clone script with android and ios app.
Jobs at Immunocore
Based in Abingdon (UK) and Philadelphia (USA) were a privately owned biotechnology company developing innovative biological therapeutics for the treatment of a range of serious diseases. Our world-leading T cell receptor technology exploits the power of the bodys own immune system to find and kill diseased cells. Weve established a robust technology platform which combines monoclonal T cell receptor (mTCR) targeting technology with an effector technology, anti-CD3 scFv, that catalyses the killing of the targeted diseased cells by the hosts own non-specific cytotoxic T cells. And were developing a portfolio of products from the platform, called ImmTACs, for the treatment of cancer, chronic infectious disease and diabetes.. ...
MB monoclonal antibody, clone AT6E10 - (MAB12457) - Products - Abnova
Mouse monoclonal antibody raised against full length recombinant human MB. Recombinant protein corresponding to full length of human MB. (MAB12457) - Products - Abnova
PNPLA2 monoclonal antibody, clone AT2G2 - (MAB3210) - Products - Abnova
Mouse monoclonal antibody raised against partial recombinant PNPLA2 . Recombinant protein corresponding to amino acids 30-504 of human PNPLA2 . (MAB3210) - Products - Abnova
Prostate Cancer: In Search of Predictive Biomarkers for Immunotherapy - Cancer Therapy Advisor
Scientists are testing immune checkpoint proteins, CD8 T cell clonal expansion, mutational load, and PSA levels as predictive biomarkers.
JCI - Inositol-triphosphate 3-kinase B confers cisplatin resistance by regulating NOX4-dependent redox balance
Reagents. shRNA lentiviral constructs targeting ITPKB, NOX4, NOX1, IPMK, and TRC Human Kinase shRNA Gene Family Library were purchased from GE Healthcare Dharmacon. sgRNA lentiviral constructs to target ITPKB were obtained from Genecopoeia. The shRNA sense strand sequences were ACAGCTATGGAAATTGACAAA (ITPKB shRNA clone 1), GCCTTCAGAGAGTTCACTAAA (ITPKB shRNA clone 2), CCCTCAACTTCTCAGTGAATT (NOX4 shRNA clone 1), CAGAGTTTACCCAGCACAAAT (NOX4 shRNA clone 2), CCGCACACTGAGAAAGCAATT (NOX1 shRNA clone 1), CCAAGGTTGTTATGCACCCAT (NOX1 shRNA clone 2), GCCCTGTATAATGGATGTAAA (IPMK shRNA clone 1), and GCAAGTTCATTACTCTTTGTT (IPMK shRNA clone 2). ITPKB sgRNA sequences were AGCCGAGTCGCTGTCCCCCG (ITPKB sgRNA clone 1) and CGGGGGCGTCTCGCTGCCAC (ITPKB sgRNA clone 2). Primers for ITPKB shRNA-resistant silent mutant and ITPKB kinase-dead D897N mutant were obtained from Integrated DNA Technologies. Bt2-Ins (1345) P4/PM was obtained from SiChem. GKT137831, Z-VAD-fmk, cyclosporin A, and necrostatin-1 were from Selleckchem. ...
clone Archives - ExtremeTech
For some time, scientists have been able to craft precise genetic copies of many creatures. Whether they are animals, or single cells, they are similarly refereed to as clones. For various technical and perceived ethical reasons, the procedures involved have been difficult to replicate for humans. A new paper published in the journal Cell shares the work of a group of researchers in Oregon who have grown a human clone - at least up to a couple hundred cells.. ...
Steve Sailer: iSteve: Clone of Contention
Remember also that gene expression in behavior is not mathematically precise. In other words, you could have responded many different ways to different environments (within definite biologically determined boundaries). The clone would not be you; he or she might unpredictably behave differently from you. Lets say both you and therefore (presumably) your clone have a rebellious streak under certain circumstances, and have an orderly streak under others. You were reared, lets say, in a permissive environment, and your coping response was to call on your orderly streak, leading you to blossom into the upright example you doubtless are at present. But supposing you were to raise your clone in a (even only infinitesimally) more restrictive, less permissive environment. (Such as an enviroment in which your every move, feeling, and thought were anxiously monitored and commented upon by a weirdo parent.) In that case, the clones prevalent coping response may be to call upon his/your rebellious ...
Clonal nature of the immune response. II. The effect of immunization of clonal commitment
An inbred strain can produce several hundred different anti-group A carbohydrate (GAC) antibodies, as analyzed by isoelectric focusing. However, each individual mouse produces the bulk of its anti-GAC antibody as only one or two different spectrotypes, which appear to be randomly chosen. By using adoptive transfer techniques, we have observed that clonal commitment occurs very early in immunization, sometimes even before immunization, and thus does not result from competition among B cells for antigen ...
ISSUE-22: Should CryptoOperations be clonable - Web Cryptography Working Group Tracker
Some members have expressed a desire to have CryptoOperation objects be clone-able, so that the same operation may be re-used for multiple data streams, without affecting the state of the original object ...
Plus it
T cells engineered to express the α and β chains of antigen-specific T cell receptors (TCRs) have shown promise as a cancer immunotherapy treatment; however, durable responses have been limited by poor persistence of gene-modified T cells. Additionally, severe toxicities, including patient deaths, have occurred upon infusion of large numbers of TCR-modified T cells. To enhance T cell persistence while providing a safeguard against life-threatening toxicity, we developed a dual-switch αβ TCR platform that uses a rapamycin (Rap)-induced caspase-9 (iRC9) together with a rimiducid (Rim)-controlled activation switch, inducible MyD88/CD40 (iMC).. The αβ TCR sequence derived from an HLA-A2-restricted, PRAME-specific T cell clone was synthesized and placed in-frame with iMC, comprising signaling domains from MyD88 and CD40 fused to tandem Rim-binding mutant FKBP12v36 domains to generate the iMC-PRAME TCR. Caspase-9 was fused to FRB and wild-type FKBP12 domains and cloned in-frame with a selectable ...
Mystery Rays from Outer Space - Meddling with things mankind is not meant to understand. Also, pictures of my kids » 2009 »...
At the peak of an immune response, hundreds of thousands of identical T cells are scampering about, searching out the pathogen and doing their own special T cell things to try to get rid of it. We know that these hundreds of thousands of cells werent there at the onset of infection; the whole T cell schtick involves rapid expansion of very, very rare cells. Only a very few T cells are able to recognize any particular antigen; but within a few days, the progeny of those rare cells are now common, and all retain their ability to recognize the same antigen. 1. In the past few years, weve learned a little more, quantitatively, just how dramatic this expansion phase is. Delicate work has established that there are maybe 20 to 1000 potentially-reactive T cells in a mouse, before infection (see my discussion here and here). Those few cells are the precursors of the huge numbers of T cells a week or so after infection.. If you think about it, its pretty remarkable that these few T cells, hidden ...
CD66b, PE, clone: G10F5, eBioscience™ 100 Tests; PE CD66b, PE, clone: G10F5, eBioscience™
CD66b, PE, clone: G10F5, eBioscience™ 100 Tests; PE CD66b, PE, clone: G10F5, eBioscience™ Primary Antibodies CD51 to CD100
CD284 (TLR4), PE, clone: HTA125, eBioscience™ 25 Tests; PE CD284 (TLR4), PE, clone: HTA125, eBioscience™
CD284 (TLR4), PE, clone: HTA125, eBioscience™ 25 Tests; PE CD284 (TLR4), PE, clone: HTA125, eBioscience™ Primary Antibodies CD251 to CD400