PRIMARY OBJECTIVES:. I. To assess the safety and toxicity of cellular adoptive immunotherapy in melanoma patients using autologous CD4+ and CD8+ antigen-specific T cell clones.. II. To evaluate the antitumor effects of CD4+ and CD8+ antigen-specific T cells in patients with metastatic melanoma.. III. To determine the duration of in vivo persistence of adoptively transferred CD8+ antigen-specific T cell clones in the presence or absence of transferred CD4+ T cells.. SECONDARY OBJECTIVES:. I. To assess the in vivo antitumor efficacy of the infused autologous antigen-specific CD4+ T cells.. OUTLINE: This is a phase I study followed by a phase II study.. Beginning 48 hours before T-cell infusion, patients receive cyclophosphamide IV. Patients then receive antigen-specific CD8+ T cells IV alone or with CD4+ T helper clones over 1-2 hours on day 0. Patients also receive aldesleukin subcutaneously twice daily on days 0-13. Treatment repeats every 28 days for up to 3 courses in the absence of disease ...
Principal Investigator:YAMAMOTO Kazuhiko, Project Period (FY):1995 - 1997, Research Category:Grant-in-Aid for Scientific Research (A), Section:展開研究, Research Field:内科学一般
An experimental model of two interacting clones of T cells is described, which may be used for defining and exploring the T-cell immunoregulatory network. Mx9/9 is a CD4 clone bearing an antigen receptor recognized by the Mx9 anti-V beta 8 monoclonal antibody (MoAb). Anti-V beta 8 MoAbs activate and induce cell proliferation of this clone. Autologous clones were raised against Mx9/9 cells using the peripheral blood mononuclear (PBM) cells of the Mx9/9 clone donor (PBMjm). Some of these cloned anti-clone cells proliferated after stimulation with irradiated Mx9/9 cells, but not after stimulation with other autologous cloned T cells or heterologous PBM, suggesting that these clones recognize the T cell receptor (TCR) of the Mx9/9 cells. The proliferation of the Mx9/9 stimulated cloned anticlone cells was blocked by anti-class II MoAbs, indicating that the autoreactive clones recognize their target antigen in conjunction with HLA Class II products. The ability of clone Mx9/9 to proliferate after stimulation
Animals were immunized with the cloned cytotoxic T lymphocyte lines V4 and 243/2.5. Spleen cells were fused with Sp2/0-Ag14 myeloma cells.
Disclaimer Dharmacon is a distributor of multiple gene expression clone collections (cDNAs and ORFs). These clone collections were generated by groups outside of Dharmacon and thus the quality of the collections is largely dependent upon what Dharmacon received from these groups. Specific clone information and plate coordinates were provided to Dharmacon by the suppliers of these clone collections. Dharmacon has not sequence verified each individual clone from these collections. These collections and individual clones are distributed "as is" with no additional product validation or guarantees. Dharmacon has established quality procedures to ensure that individual clones are picked from the identified well in a plate, grown on the correct antibiotic, and are free of phage contamination. Due to the quality of the information provided to Dharmacon, the clone you receive might not match the expected clone. If this occurs, please contact Technical Support.. All clones and plates are provided as ...
Disclaimer Dharmacon is a distributor of multiple gene expression clone collections (cDNAs and ORFs). These clone collections were generated by groups outside of Dharmacon and thus the quality of the collections is largely dependent upon what Dharmacon received from these groups. Specific clone information and plate coordinates were provided to Dharmacon by the suppliers of these clone collections. Dharmacon has not sequence verified each individual clone from these collections. These collections and individual clones are distributed "as is" with no additional product validation or guarantees. Dharmacon has established quality procedures to ensure that individual clones are picked from the identified well in a plate, grown on the correct antibiotic, and are free of phage contamination. Due to the quality of the information provided to Dharmacon, the clone you receive might not match the expected clone. If this occurs, please contact Technical Support.. All clones and plates are provided as ...
If the clone is an EST clone, it can be ordered from ATCC or the evil Invitrogen empire, which also has other clones as well and a clone search engine. RIKEN clones must be ordered from Japan from the link HomeBrew listed or sometimes you can order from the German RZPD website. Google it to find the web address. Ive ordered from all except the Japanese place. And I highly recommend buying clones from ATCC before Invitrogen. Ive had clones from Invitrogen end up being the wrong clone many times. But thats a risk you take ordering clones from anyone ...
In this report, we describe the molecular and functional characterization of T-cell clones identified in peripheral blood from patients with relapsed myeloma responding to DLI. These clones were initially identified through analysis of TCR Vβ repertoire (spectratyping), a technique that provides a comprehensive characterization of the circulating T-cell compartment (21 , 24 , 25) . Serial analysis of T-cell repertoire in patient samples has also been used to detect the emergence of oligoclonal and clonal T cells at different times in vivo (18 , 26 , 27) . By combining analysis of TCR repertoire with clinical events, we observed the expansion of individual T-cell clones in peripheral blood that were temporally associated with the initiation of either a GVM or GVHD response (17) . However, despite the association of these T-cell clones with specific clinical responses, the functional specificity of these T cells was not established. Further studies were therefore undertaken to quantify the ...
Clouse KA, Powell D, Washington I, Poli G, Strebel K, Farrar W, Barstad P, Kovacs J, Fauci AS, Folks TM (1989). „Monokine regulation of human immunodeficiency virus-1 expression in a chronically infected human T cell clone". J Immunol. 142 (2): 431-8. PMID 2463307 ...
Agriyas Online Food Ordering Script is a well compiled Just Eat clone script to create a food ordering platform.With its advanced features and functionalities it strongly comes across as a swiggy and Foodpanda clone script also.
I have 3 questions if someone could help me with those please. 1. Could 2 different bands (size wise) be detected for the same protein using poly colonal and monoclonal antibodies? 2. If the samples are run on electrophoresis for too long, can the size of the protein show difference comparing to the previous (shorter) runs? 3. In siRNA , I have knock down my gene of interest at the mRNA level (70-80% according to quantitative PCR x2 experiments), but western blot of the same colony cell protein lysates show no or less ( only 30% ) decrement. Any explanation please? Thanks Laleh ...
CD4, PerCP-Cyanine5.5, clone: OKT4 (OKT-4), eBioscience™ 25 Tests; PerCP-Cyanine5.5 CD4, PerCP-Cyanine5.5, clone: OKT4 (OKT-4), eBioscience™ Primary...
As Orphan Black begins its fifth and final season, heres a reminder of the many clones that have appeared on the BBC America show.
CD223 (LAG-3), eFluor 450, clone: eBioC9B7W (C9B7W), eBioscience™ 100μg; eFluor 450 CD223 (LAG-3), eFluor 450, clone: eBioC9B7W (C9B7W), eBioscience™...
GenEZ™ ORF cDNA clones makes it easy to order customized expression-ready ORF clones from the worlds largest commercial ORF clone database.
GenEZ™ ORF cDNA clones makes it easy to order customized expression-ready ORF clones from the worlds largest commercial ORF clone database.
ㆍApplication: Highly homologous gene sequences, Low expressing genes, CDR sequences in T-cell clones, Small RNAs, Gene therapy ...
We are happy to introduce Theonlinemom Clone Script. Coded with high professional acumen to provide corporate networking solutions. Use this super-efficient script to fastrack launching of your own website. High in demand, this W3 compliant, search friendly, mobile responsive and easily editable product is indeed a users delight!
This lab is studying the function & pharmacology of heterologously expressed nAChRs in cloned cells & native nAChRs in neurons isolated from brain tissue.
Using a genome-scale approach to study transcription levels in a human CD8+ T-cell clone, a recent study has suggested that the repertoire of molecules on the surface of T cells …
Possibly a intersectClone or somesuch would be useful and could be faster, taking advantage of the fact that the text must be the same. Also, d.clone could be made faster by the asumption that once a cell is a clone of something, it will never change: the root clone stays. Tuomas ...
prior to its discontinuation, i had a lot of success with superdrol. i did two cycles, one bulking and one cutting. i followed all the advice given in
pF1KB6377 3926 bp GGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAA TTCCCCACTAGTAATAATTTTCTTTAACTTTAGTAAGGAGCGATCGCCATGGCCAAAGTT CCAGACATGTTTGAAGACCTGAAGAACTGTTACAGTGAAAATGAAGAAGACAGTTCCTCC ATTGATCATCTGTCTCTGAATCAGAAATCCTTCTATCATGTAAGCTATGGCCCACTCCAT GAAGGCTGCATGGATCAATCTGTGTCTCTGAGTATCTCTGAAACCTCTAAAACATCCAAG CTTACCTTCAAGGAGAGCATGGTGGTAGTAGCAACCAACGGGAAGGTTCTGAAGAAGAGA CGGTTGAGTTTAAGCCAATCCATCACTGATGATGACCTGGAGGCCATCGCCAATGACTCA GAGGAAGAAATCATCAAGCCTAGGTCAGCACCTTTTAGCTTCCTGAGCAATGTGAAATAC AACTTTATGAGGATCATCAAATACGAATTCATCCTGAATGACGCCCTCAATCAAAGTATA ATTCGAGCCAATGATCAGTACCTCACGGCTGCTGCATTACATAATCTGGATGAAGCAGTG AAATTTGACATGGGTGCTTATAAGTCATCAAAGGATGATGCTAAAATTACCGTGATTCTA AGAATCTCAAAAACTCAATTGTATGTGACTGCCCAAGATGAAGACCAACCAGTGCTGCTG AAGGAGATGCCTGAGATACCCAAAACCATCACAGGTAGTGAGACCAACCTCCTCTTCTTC TGGGAAACTCACGGCACTAAGAACTATTTCACATCAGTTGCCCATCCAAACTTGTTTATT GCCACAAAGCAAGACTACTGGGTGTGCTTGGCAGGGGGGCCACCCTCTATCACTGACTTT CAGATACTGGAAAACCAGGCGGTTTAAACGAATTCGAGCTCGGTACCCGGGGATCCTCTA ...
I ve asked this question before and i know there is not exact answer so I am hoping for a little speculation from the experts. If just harvested some
pF1KB0922 4148 bp GGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAA TTCCCCACTAGTAATAATTTTCTTTAACTTTAGTAAGGAGCGATCGCCATGGCCCGGCCG CAGAGGACTCCGGCGCGCAGTCCCGATAGCATCGTCGAGGTGAAGAGCAAATTTGACGCC GAGTTCCGACGCTTCGCGCTGCCTCGCGCTTCGGTGAGCGGCTTCCAGGAGTTCTCGCGG TTGCTGCGGGCGGTGCACCAGATCCCGGGCCTGGACGTGCTACTTGGCTATACGGATGCT CATGGCGACCTGCTGCCCCTCACCAACGACGACAGCCTGCACCGGGCCCTGGCCAGCGGG CCCCCGCCACTGCGCCTACTGGTGCAGAAGCGGGAAGCTGACTCCAGCGGCCTGGCTTTT GCCTCCAACTCTCTGCAGCGGCGCAAGAAAGGGCTCTTGCTGCGGCCAGTGGCACCCCTG CGCACCCGGCCACCCTTGCTAATCAGCCTGCCCCAAGATTTCCGCCAGGTTTCCTCAGTC ATAGACGTGGACCTACTGCCTGAGACCCACCGACGGGTGCGGCTGCACAAGCATGGTTCA GACCGCCCCCTGGGCTTCTACATCCGAGATGGCATGAGCGTGCGTGTGGCTCCCCAGGGC CTGGAGCGGGTTCCAGGAATCTTCATCTCCCGCCTGGTACGTGGGGGTCTGGCTGAGAGT ACAGGGCTGCTGGCGGTCAGTGATGAGATCCTCGAGGTCAATGGCATTGAAGTAGCCGGG AAGACCTTGGACCAAGTGACGGACATGATGGTTGCCAACAGCCATAACCTCATTGTCACT GTCAAGCCCGCCAACCAGCGCAATAACGTGGTGCGAGGGGCATCTGGGCGTTTGACAGGT CCTCCCTCTGCAGGGCCTGGGCCTGCTGAGCCTGATAGTGACGATGACAGCAGTGACCTG ...
https://kdvr.com/news/california-family-spends-50000-to-clone-dog-that-saved-their-lives/ I know a lot of PSers have e-rings that exceed 50K, so my...
Monoclonal expansion of B cells and plasma cells, producing antibodies against self molecules, can be found not only in different autoimmune diseases, such as peripheral neuropathy (PN), but also in malignancies, such as Waldenstr?ms macroglobulinaemia and B-type of chronic lymphocytic leukaemia (B-CLL), as well as in precancerous conditions including monoclonal gammopathy of undetermined significance (MGUS). time. PIK3CD The anti-P0 antibodies were of IgM- type. The antibodies belonged to the VH3gene family with presence of somatic mutations. The IgM reacted with P0 and myelin-associated glycoprotein (MAG), and showed no evidence for polyreactivity, in contrast to other IgM CD5+clones included in the study as controls. The expanded clones expressed CD80 and HLA-DR, which is compatible with properties of antigen-presenting cells. The immunomagnetic selection technique was successfully used for isolation SM-406 of antimyelin protein P0-specific clones. The cell lines may provide useful tools in ...
The role of clonal complexity has gradually been accepted in infection by Mycobacterium tuberculosis (MTB), although analyses of this issue are limited. We performed an in-depth study of a case of recurrent MTB infection by integrating genotyping, whole genome sequencing, analysis of gene expression and infectivity in in vitro and in vivo models. Four different clonal variants were identified from independent intrapatient evolutionary branches. One of the single-nucleotide polymorphisms in the variants mapped in mce3R, which encodes a repressor of an operon involved in virulence, and affected expression of the operon. Competitive in vivo and in vitro co-infection assays revealed higher infective efficiency for one of the clonal variants. A new clonal variant, which had not been observed in the clinical isolates, emerged in the infection assays and showed higher fitness than its parental strain. The analysis of other patients involved in the same transmission cluster revealed new clonal variants acquired
De heer, D H. and Edgington, T S., "Clonal heterogeneity of the anti-erythrocyte autoantibody responses of nzb mice." (1974). Subject Strain Bibliography 1974. 168 ...
Based on our knowledge of the cell division pattern of the early developing mandibular region (see above) we were able to look at its morphogenesis at a very high level of resolution. By means of single cell labeling with the fluorescent dye DiI we were able to reconstruct and analyze the clonal composition of the mandibular region from the beginning of ectodermal proliferation up to the differentiation of the mouthparts. The cell labeling reveals that the paragnaths have their origin in the area I and area II which comprises columns 1 to 3 of region E(0). The mandibles originate from cells of the areas II and III (columns 2 to 4). Areas I and II contribute also to the sternal region and the mandibular ganglia whereas area III forms parts of the tergites as well. In more posterior segments, columns 1 and 2 mainly contribute to the formation of segmental ganglia and probably sternites, and columns 3 to 5 mainly give rise to limbs [36, 46]. Hence, when compared with clonal composition of the ...
Townsend, A R. and Skehel, J J., "Influenza a specific cytotoxic t-cell clones that do not recognize viral glycoproteins." (1982). Subject Strain Bibliography 1982. 1222 ...
Here we analyzed the phenotype, functionality, and clonal composition of influenza virus-specific lung-resident memory CD8+ Trm cells. We show that human lung tissue contains a population of CD8+ Trm cells that are highly proliferative and whose progeny are polyfunctional. We observe an enrichment of influenza virus-specific CD8+ T cells within the Trm cell compartment and show that different specificities of influenza virus-specific CD8+ T cell differentiated into Trm cells with varying degrees of efficiency. Ex vivo single-cell analysis of TCRαβ clonotypes within the influenza virus-specific lung CD8+ Trm cell compartment provides clear evidence for the maintenance of TCRαβ diversity within the long-lived CD8+ Trm cell pool, with no indication of clonal skewing or TCR repertoire narrowing.. The assessment of the effector function of the progeny of Trm cells has been difficult to measure using mouse models. This is because murine Trm cells are difficult to expand ex vivo and are highly ...
Here we analyzed the phenotype, functionality, and clonal composition of influenza virus-specific lung-resident memory CD8+ Trm cells. We show that human lung tissue contains a population of CD8+ Trm cells that are highly proliferative and whose progeny are polyfunctional. We observe an enrichment of influenza virus-specific CD8+ T cells within the Trm cell compartment and show that different specificities of influenza virus-specific CD8+ T cell differentiated into Trm cells with varying degrees of efficiency. Ex vivo single-cell analysis of TCRαβ clonotypes within the influenza virus-specific lung CD8+ Trm cell compartment provides clear evidence for the maintenance of TCRαβ diversity within the long-lived CD8+ Trm cell pool, with no indication of clonal skewing or TCR repertoire narrowing.. The assessment of the effector function of the progeny of Trm cells has been difficult to measure using mouse models. This is because murine Trm cells are difficult to expand ex vivo and are highly ...
Here we analyzed the phenotype, functionality, and clonal composition of influenza virus-specific lung-resident memory CD8+ Trm cells. We show that human lung tissue contains a population of CD8+ Trm cells that are highly proliferative and whose progeny are polyfunctional. We observe an enrichment of influenza virus-specific CD8+ T cells within the Trm cell compartment and show that different specificities of influenza virus-specific CD8+ T cell differentiated into Trm cells with varying degrees of efficiency. Ex vivo single-cell analysis of TCRαβ clonotypes within the influenza virus-specific lung CD8+ Trm cell compartment provides clear evidence for the maintenance of TCRαβ diversity within the long-lived CD8+ Trm cell pool, with no indication of clonal skewing or TCR repertoire narrowing.. The assessment of the effector function of the progeny of Trm cells has been difficult to measure using mouse models. This is because murine Trm cells are difficult to expand ex vivo and are highly ...
Here we analyzed the phenotype, functionality, and clonal composition of influenza virus-specific lung-resident memory CD8+ Trm cells. We show that human lung tissue contains a population of CD8+ Trm cells that are highly proliferative and whose progeny are polyfunctional. We observe an enrichment of influenza virus-specific CD8+ T cells within the Trm cell compartment and show that different specificities of influenza virus-specific CD8+ T cell differentiated into Trm cells with varying degrees of efficiency. Ex vivo single-cell analysis of TCRαβ clonotypes within the influenza virus-specific lung CD8+ Trm cell compartment provides clear evidence for the maintenance of TCRαβ diversity within the long-lived CD8+ Trm cell pool, with no indication of clonal skewing or TCR repertoire narrowing.. The assessment of the effector function of the progeny of Trm cells has been difficult to measure using mouse models. This is because murine Trm cells are difficult to expand ex vivo and are highly ...
Cancer progression in humans is difficult to infer because we do not routinely sample patients at multiple stages of their disease. However, heterogeneous breast tumors provide a unique opportunity to study human tumor progression because they still contain evidence of early and intermediate subpopulations in the form of the phylogenetic relationships. We developed a method we call Sector-Ploidy-Profiling to study the clonal composition of breast tumors. SPP involves macro-dissecting tumors, flow-sorting genomic subpopulations by DNA content, and profiling genomes using comparative genomic hybridization. Breast carcinomas display two classes of genomic structural variation: (1) monogenomic and (2) polygenomic. Monogenomic tumors appear to contain a single major clonal subpopulation with a highly stable chromosome structure. Polygenomic tumors contain multiple clonal tumor subpopulations, which may occupy the same sectors, or separate anatomic locations. In polygenomic tumors, we show that ...
A human CD4 clone (Mx9/9) using the V beta 8 receptor was used as antigen to generate autologous clones (termed anti-Mx9/9 clones) which proliferate in response to this clone, but not other autologous clones. This was used as an experimental model to explore the specific interactions between autologous T cells. Anti-HLA-DR monoclonal antibodies inhibited the response of the anti-Mx9/9 clones, suggesting that these clones recognize their target antigen in association with HLA-DR. Because of the specificity of the anti-Mx9/9 clones for the initiating clone (Mx9/9), but not any other autologous V beta 8- or V beta 8+ CD4 clones, the target antigen seems to be part of the T cell receptor, but not V beta 8 itself. However, the anti-Mx9/9 clones responded also to the autologous EBV line, and thus the target antigen is not known. The regulatory activity of the anti-Mx9/9 clones was assayed by coculture with their target clone. A variety of responses were seen, both inhibitory and stimulatory, which varied
A T cell clone (ACH-2) derived from T cells infected with HIV-1 was found to produce HIV-1 in response to stimulation with a monokine-enriched supernatant prepared by culturing human monocyte/macrophages with bacterial LPS (LPS-MO SN). Monokine induction of ACH-2 cells resulted in augmented virus production reflected by an increase in reverse transcriptase activity and in the synthesis of all major viral proteins. Examination of the cells by indirect immunofluorescence revealed that 10 to 15% of uninduced cells constitutively expressed HIV proteins, whereas 100% showed positive immunofluorescence in response to LPS-MO SN. This induction of virus by LPS-MO SN resulted in approximately a 100-fold increase of infectious virus production over uninduced ACH-2 cells. LPS alone could not induce HIV-1 expression, whereas LPS-MO SN resulted in the greatest virus expression. Cell separation studies confirmed the source of the inducing factor(s) to be cells bearing the mature monocyte/macrophage marker, ...
Deleting CD98hc in T cells blocks their ability to cause autoimmune diabetes, and CD98-null T cells exhibit defective clonal expansion but intact effector function. Therefore, we asked whether the clonal expansion defect explained the protection from T1D observed with the loss of T cell CD98hc. First we examined the ability of OT-1, dLck-Cre+, Slc3a2fl/fl T cells to home and to proliferate in the pancreatic lymph nodes of RIPmOVA recipient mice. CD98hc-null OT-1 CFSE-labeled T cells homed efficiently, as evidenced by similar numbers of purified naive OT-1, dLck-Cre+, Slc3a2fl/fl or control OT-1, Slc3a2fl/fl T cells in pancreatic draining lymph nodes 2 d after transfer (Figs. 1C, bar graph, 7A, graph). However, control OT-1, Slc3a2fl/fl T cells were beginning to divide at 2 d after transfer, whereas the CD98-null cells were not (Fig. 7A), despite becoming activated in pancreatic lymph nodes. The results of this clonal expansion defect were apparent 4 d after transfer when the abundance of CD98+ ...
I am presently looking at cytokine mediated differential gene expression in T cells. Ideally I would like to use human T cell clones derived from subjects with rheumatoid arthritis. I dont have much experience in T cell cloning and I am led to believe that it is very time consuming and not always successful. Any help along this line would be most appreciated, particularly a contact address/number for someone who may have developed such clones already. I can be contacted directly at dh5 at holyrood.ed.ac.uk Thanx in advance, Dave Hunter ...
IL-17 producing γδ T cells (γδT17) promote numerous autoimmune diseases such as psoriasis and arthritis, as well as, cancers of the colon, lung and breasts. Yet γδT17 peripheral regulation has yet to be thoroughly explored. In mice deficient in IL-17 signaling, we observed expansion of γδT17 in all major tissues. However, γδT17 expansion was not uniformly distributed systemically and was most prominent in oral draining cervical lymph nodes (LNs) with monoclonal expansion of Vγ6 γδT17. In vitro proliferation assays of these cervical LNs showed endogenous proliferation by γδT17 dependent on cell-to-cell contact with CD103+ DCs. CD86+ and CD80+ activated CD103+ DCs are increased in the oral draining LNs suggesting that perhaps microbiota-activated CD103+ DC expand γδT17. 16s rRNA FISH hybridization shows increase in 16s rRNA in oral draining LNs. Treatment of mice deficient in IL-17 signaling with α-LTBR-Ig (to remove LNs) or oral broad-spectrum antibiotics abrogates γδT17 expansion.
Milli-Mark Anti-CD38-FITC Antibody, clone AT13/5 is an antibody against CD38 for use in FC. Find MSDS or SDS, a COA, data sheets and more information.
The organization seeks to identify new anti-cancer drugs that contain the cancer, develop natural immunity to the cells, and reduce the emergence of tumor cell clones.. Parents and families around the globe, including over 200 children in Arizona every year, are desperately searching for help, answers and treatment when their child is diagnosed with cancer and the Steele Childrens Research Center strives to provide them with the most current and effective cures that will keep their families whole.. Since its founding, the Phoenix Womens Board of the Steele Childrens Research Center, known as PANDA (People Acting Now Discover Answers), has raised more than $5.25 million to improve treatments and cures for devastating childhood diseases as well as to fund and recruit internationally recognized pediatric physicians and scientists to Arizona, providing local families with the most cutting-edge medical care.. Last year, they opened an office in the Arcadia neighborhood of Phoenix, located at 4455 ...
Purified helper-inducer (T4+) and suppressor-cytotoxic (T8+) lymphocytes from eight patients with acquired immunodeficiency syndrome (AIDS) and eight healthy heterosexual donors were examined by limiting dilution analysis for their ability to be clonally expanded. It was demonstrated that viable T4+ and T8+ lymphocytes from patients with AIDS had markedly reduced proportions of clonable cells compared to the healthy donors (T4 = 1:255 vs. 1:34, P = 0.06; T8 = 1:355 vs. 1:55, P = 0.01). However, the cloned T cells that were obtained from the patients with AIDS demonstrated normal proliferation in response to phytohemagglutinin and alloantigen, and normal ability to help or suppress pokeweed mitogen-driven IgG synthesis. These results strongly suggest that, in addition to a quantitative diminution of T4+ lymphocytes in AIDS, there is an intrinsic functional defect in the surviving T4+ and T8+ lymphocytes, which is reflected by a severe decrease in their potential for clonal expansion. ...
This track shows the location of fluorescent in situ hybridization (FISH)-mapped clones along the assembly sequence. The locations of these clones were obtained from the NCBI Human BAC Resource here. Earlier versions of this track obtained this information directly from the paper Cheung, et al. (2001). More information about the BAC clones, including how they may be obtained, can be found at the Human BAC Resource and the Clone Registry web sites hosted by NCBI. To view Clone Registry information for a clone, click on the clone name at the top of the details page for that item.. ...
This track shows the location of fluorescent in situ hybridization (FISH)-mapped clones along the assembly sequence. The locations of these clones were obtained from the NCBI Human BAC Resource here. Earlier versions of this track obtained this information directly from the paper Cheung, et al. (2001). More information about the BAC clones, including how they may be obtained, can be found at the Human BAC Resource and the Clone Registry web sites hosted by NCBI. To view Clone Registry information for a clone, click on the clone name at the top of the details page for that item.. ...
I disagreed wih the the production of human clones. One reason was that I could not think of a practical reason to make more people. Dont we have enough already? One might say that we can, in a way, bring people back from the dead. I know thats probably not a good way to put it, but Im hoping that you get the jist of what Im saying. I dont think people would accept clones the way they accept real people; its just not the same thing. I dont think many people would like to buy a clone. I know I wouldnt. So really, I think making clones is a waste of time. Theres no real purpose for it, and its a waste of money (we brought up the topic of space travel at this point...). Making clones for a war, like Star Wars, also seemed pretty bizzare. If one were to create a million clones to go to war, Im not sure they would obey. Their purpose is to die, or to kill. As blan as the clones would be, their sense of moral would be intact Im sure. You cant order a living thing to die in these ...
Although there is multiple evidence for the functional heterogeneity and polyclonality of TRAb (1 - 3) both statements are questioned by some investigators (4, 5). Furthermore there is growing...
Clonal competition in cancer describes the process in which the progeny of a cell clone supersedes or succumbs to other competing clones due to differences in their functional characteristics, mostly based on subsequently acquired mutations. Even though the patterns of those mutations are well explored in many tumors, the dynamical process of clonal selection is underexposed. We studied the dynamics of clonal competition in a BcrAbl-induced leukemia using a γ-retroviral vector library encoding the oncogene in conjunction with genetic barcodes. To this end, we studied the growth dynamics of transduced cells on the clonal level both in vitro and in vivo in transplanted mice. While we detected moderate changes in clonal abundancies in vitro, we observed monoclonal leukemias in 6/30 mice after transplantation, which intriguingly were caused by only two different BcrAbl clones. To analyze the success of these clones, we applied a mathematical model of hematopoietic tissue maintenance, which indicated that a
A phase 0, exploratory study of the pharmacodynamics of a single intratumoral dose of IMCgp100, a monoclonal T cell receptor anti-CD3 scFv fusion protei