Cleavage stimulation factor - Wikipedia
Cleavage stimulatory factor or cleavage stimulation factor (CstF or CStF) is a heterotrimeric protein, made up of the proteins CSTF1 (55kDa), CSTF2 (64kDa) and CSTF3 (77kDa), totalling about 200 kDa. It is involved in the cleavage of the 3 signaling region from a newly synthesized pre-messenger RNA (mRNA) molecule. CstF is recruited by cleavage and polyadenylation specificity factor (CPSF) and assembles into a protein complex on the 3 end to promote the synthesis of a functional polyadenine tail, which results in a mature mRNA molecule ready to be exported from the cell nucleus to the cytosol for translation. The amount of CstF in a cell is dependent on the phase of the cell cycle, increasing significantly during the transition from G0 phase to S phase in mouse fibroblast and human splenic B cells. CSTF1, CSTF2, CSTF3 Martincic, K.; Campbell, R.; Edwalds-Gilbert, G.; Souan, L.; Lotze, M. T.; Milcarek, C. (1998). Increase in the 64-kDa subunit of the polyadenylation/cleavage stimulatory factor ...
Polyadenylation-Dependent Control of Long Noncoding RNA Expression by the Poly(A)-Binding Protein Nuclear 1 | proLékaře.cz
1. WahleE (1991) A novel poly(A)-binding protein acts as a specificity factor in the second phase of messenger RNA polyadenylation. Cell 66: 759-768.. 2. KuhnU, NemethA, MeyerS, WahleE (2003) The RNA binding domains of the nuclear poly(A)-binding protein. J Biol Chem 278: 16916-16925.. 3. KerwitzY, KuhnU, LilieH, KnothA, ScheuermannT, et al. (2003) Stimulation of poly(A) polymerase through a direct interaction with the nuclear poly(A) binding protein allosterically regulated by RNA. Embo J 22: 3705-3714.. 4. KuhnU, GundelM, KnothA, KerwitzY, RudelS, et al. (2009) Poly(A) tail length is controlled by the nuclear poly(A)-binding protein regulating the interaction between poly(A) polymerase and the cleavage and polyadenylation specificity factor. J Biol Chem 284: 22803-22814.. 5. KuhnU, WahleE (2004) Structure and function of poly(A) binding proteins. Biochim Biophys Acta 1678: 67-84.. 6. ApponiLH, LeungSW, WilliamsKR, ValentiniSR, CorbettAH, et al. (2010) Loss of nuclear poly(A)-binding protein 1 ...
GABPA (GA binding protein transcription factor subunit alpha)
GABPA (GA binding protein transcription factor subunit alpha), Authors: Dessen P. Published in: Atlas Genet Cytogenet Oncol Haematol.
NS1 Protein Amino Acid Changes D189N and V194I Affect Interferon Responses, Thermosensitivity, and Virulence of Circulating...
Influenza virus NS1 protein is a nonstructural, multifunctional protein that counteracts host innate immune responses, modulating virus pathogenesis. NS1 protein variability in subjects infected with H3N2 influenza A viruses (IAVs) during the 2010/2011 season was analyzed, and amino acid changes in residues 86, 189, and 194 were found. The consequences of these mutations for the NS1-mediated inhibition of IFN responses and the pathogenesis of the virus were evaluated, showing that NS1 mutations D189N and V194I impaired the ability of the NS1 protein to inhibit general gene expression, most probably because these mutations decreased the binding of NS1 to the cleavage and polyadenylation specificity factor 30 (CPSF30). A recombinant A/Puerto Rico/8/34 (PR8) H1N1 virus encoding the H3N2 NS1-D189N protein was slightly attenuated, whereas the virus encoding the H3N2 NS1-V194I protein was further attenuated in mice. The higher attenuation of this virus could not be explained by differences in the ...
SNRPB - Small nuclear ribonucleoprotein-associated proteins B and B - Homo sapiens (Human) - SNRPB gene & protein
Core component of the spliceosomal U1, U2, U4 and U5 small nuclear ribonucleoproteins (snRNPs), the building blocks of the spliceosome. Thereby, plays an important role in the splicing of cellular pre-mRNAs. Most spliceosomal snRNPs contain a common set of Sm proteins SNRPB, SNRPD1, SNRPD2, SNRPD3, SNRPE, SNRPF and SNRPG that assemble in a heptameric protein ring on the Sm site of the small nuclear RNA to form the core snRNP. As part of the U7 snRNP it is involved in histone 3-end processing.
Serine-threonine kinase receptor-associated protein
The SMN complex plays a catalyst role in the assembly of small nuclear ribonucleoproteins (snRNPs), the building blocks of the spliceosome. Thereby, plays an important role in the splicing of cellular pre-mRNAs. Most spliceosomal snRNPs contain a common set of Sm proteins SNRPB, SNRPD1, SNRPD2, SNRPD3, SNRPE, SNRPF and SNRPG that assemble in a heptameric protein ring on the Sm site of the small nuclear RNA to form the core snRNP. In the cytosol, the Sm proteins SNRPD1, SNRPD2, SNRPE, SNRPF and SNRPG are trapped in an inactive 6S pICln-Sm complex by the chaperone CLNS1A that controls the assembly of the core snRNP. Dissociation by the SMN complex of CLNS1A from the trapped Sm proteins and their transfer to an SMN-Sm complex triggers the assembly of core snRNPs and their transport to the nucleus. STRAP plays a role in the cellular distribution of the SMN complex. Negatively regulates TGF-beta signaling but positively regulates the PDPK1 kinase activity by enhancing its autophosphorylation and by ...
RCSB PDB - Protein Feature View - Cleavage stimulation factor subunit 2 - P33240 (CSTF2 HUMAN)
The PDB archive contains information about experimentally-determined structures of proteins, nucleic acids, and complex assemblies. As a member of the wwPDB, the RCSB PDB curates and annotates PDB data according to agreed upon standards. The RCSB PDB also provides a variety of tools and resources. Users can perform simple and advanced searches based on annotations relating to sequence, structure and function. These molecules are visualized, downloaded, and analyzed by users who range from students to specialized scientists.
PDGFB Gene - GeneCards | PDGFB Protein | PDGFB Antibody
Complete information for PDGFB gene (Protein Coding), Platelet Derived Growth Factor Subunit B, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene Compendium
DFFA Gene - GeneCards | DFFA Protein | DFFA Antibody
Complete information for DFFA gene (Protein Coding), DNA Fragmentation Factor Subunit Alpha, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene Compendium
Cleavage and Polyadenylation Specific Factor 4, 30kDa (CPSF4) Antikörper
Reaktivität: Fledermaus, Huhn, Rind (Kuh) and more. 67 verschiedene CPSF4 Antikörper vergleichen. Alle direkt auf antikörper-online bestellbar!
Abnova Human CPSF3 Partial ORF (NP 057291, 585 a.a. - 684 a.a.) Recombinant | Fisher Scientific
Abnova Human CPSF3 Partial ORF (NP_057291, 585 a.a. - 684 a.a.) Recombinant Protein with GST-tag at N-terminal 25µg Life Sciences:Protein Biology:Proteins:Proteins A-Z:Proteins
Trans-splicing and operons
Besides the splice site itself, only two sequences on the pre-mRNA play an important role in SL2-specific trans-splicing: the two presumptive signals for 3 end formation of the gene just upstream (Figure 2; Huang et al., 2001; Kuersten et al., 1997; Liu et al., 2001; Liu et al., 2003). The AAUAAA just 5 of the cleavage site, which is absolutely required for 3 end formation, binds the cleavage and polyadenylation specificity factor (CPSF), and a U-rich sequence just 3 of the cleavage site binds the cleavage stimulatory factor (CstF). CPSF and CstF bind cooperatively to these two sites and together position the site of cleavage. When the AAUAAA is mutated, 3 end cleavage fails to occur, and trans-splicing just downstream becomes less efficient and less specific for SL2. Nevertheless, AAUAAA is not required for SL2 trans-splicing since SL2 trans-splicing downstream still occurs in its absence. CPSF bound to AAUAAA may act by facilitating binding of CstF to the U-rich sequence or by catalyzing ...
Gentaur Molecular :GenWay \ Cleavage stimulation factor 50 kDa subunit - CSTF 50 kDa subunit; CF-1 50 kDa subunit; CstF-50 \...
Gentaur molecular products has all kinds of products like :search , GenWay \ Cleavage stimulation factor 50 kDa subunit - CSTF 50 kDa subunit; CF-1 50 kDa subunit; CstF-50 \ 10-288-22329F for more molecular products just contact us
Dinesh Verma, PhD - Faculty Details - U of U School of Medicine - | University of Utah
Dr. Verma research involves understanding the pathogenesis of tumor viruses, specifically Epstein Barr Virus (EBV) and Kaposis sarcoma associated herpesvirus (KSHV). Both viruses undergo lytic replication in epithelial cells during primary infection and during reactivation from latent infection in B-lymphocytes. Epstein Barr virus SM is an RNA binding protein essential for viral replication that enhances EBV gene expression by enhancing RNA stability and RNA export. Dr. Verma has shown that SM interacts with cellular splicing factors and influences splicing of both EBV and cellular pre-mRNAs. Like EBV SM, KSHV ORF57 is also a post-transcriptional regulatory protein, essential for KSHV lytic replication and has high degree of gene specificity. His current research is focused on regulation of gene expression and antiviral drug screening in the following areas ...
Poliadenilación - Wikipedia, a enciclopedia libre
A maquinaria de poliadenilación no núcleo de eucariotas actúa sobre os produtos orixinados pola ARN polimerase II, como son os ARNm precursores. Aquí, un complexo multiproteico (cuxos compoñentes poden verse na táboa da dereita) clivan a parte final do extremo 3 do ARN que se acaba de formar, e poliadenila o extremo que se orixina por esta clivaxe. A clivaxe está catalizada polo encima CPSF[7] e ten lugar 10-30 nucleótidos corrente abaixo do seu sitio de unión.[12] Este sitio é xeralmente a secuencia AAUAAA do ARN, pero hai variantes del aos que tamén se une máis debilmente o CPSF.[13] Outras dúas proteínas que engaden especificidade á unión a un ARN son CstF e CFI. O CstF únese a unha rexión rica en GU situada máis corrente abaixo do sitio do CPSF.[14] O CFI recoñece un terceiro sitio no ARN (un conxunto de secuencias UGUAA en mamíferos[15][16][17]) e pode recrutar o CPSF mesmo se se perde a secuencia AAUAAA.[18][19] O sinal de poliadenilación (a secuencia motivo ...
CPSF3 Antibody
CPSF3 Polyclonal Antibody from Invitrogen for Western Blot applications. This antibody reacts with Human samples. Supplied as 100 µL purified antibody (1 mg/ml) in PBS with 1% BSA, 20% glycerol and 0.01% thimerosal; pH 7.
Human CLP1 protein | EUPROTEIN
Recombinant protein from the full-length sequence of homo sapiens cleavage and polyadenylation factor I subunit 1 (CLP1), transcript variant 1 (NM_006831), with a His tag., from EUPROTEIN
Permalien vers The ability of TNPO3-depleted cells to inhibit HIV-1 infection requires CPSF6
BACKGROUND: Expression of the cellular karyopherin TNPO3/transportin-SR2/Tnp3 is necessary for HIV-1 infection. Depletion of TNPO3 expression in mammalian
Mutagenetix > Incidental...
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the protein family comprised of both platelet-derived growth factors (PDGF) and vascular endothelial growth factors (VEGF). The encoded preproprotein is proteolytically processed to generate platelet-derived growth factor subunit A, which can homodimerize, or alternatively, heterodimerize with the related platelet-derived growth factor subunit B. These proteins bind and activate PDGF receptor tyrosine kinases, which play a role in a wide range of developmental processes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015 ...
CLNS1A - Methylosome subunit pICln - Homo sapiens (Human) - CLNS1A gene & protein
Involved in both the assembly of spliceosomal snRNPs and the methylation of Sm proteins (PubMed:21081503, PubMed:18984161). Chaperone that regulates the assembly of spliceosomal U1, U2, U4 and U5 small nuclear ribonucleoproteins (snRNPs), the building blocks of the spliceosome. Thereby, plays an important role in the splicing of cellular pre-mRNAs. Most spliceosomal snRNPs contain a common set of Sm proteins SNRPB, SNRPD1, SNRPD2, SNRPD3, SNRPE, SNRPF and SNRPG that assemble in a heptameric protein ring on the Sm site of the small nuclear RNA to form the core snRNP. In the cytosol, the Sm proteins SNRPD1, SNRPD2, SNRPE, SNRPF and SNRPG are trapped in an inactive 6S pICln-Sm complex by the chaperone CLNS1A that controls the assembly of the core snRNP. Dissociation by the SMN complex of CLNS1A from the trapped Sm proteins and their transfer to an SMN-Sm complex triggers the assembly of core snRNPs and their transport to the nucleus. May also indirectly participate in cellular volume control by activation
Protocol specific for CPSF4 RNAi (H00010898-R01): Novus Biologicals
Global antibody supplier and research reagent supplier to the life science community. Find antibodies and reagents all backed by our Guarantee+.
Control of mitochondrial transcription specificity factors (TFB1M and TFB2M) by nuclear respiratory factors (NRF-1 and NRF-2)...
PubMed comprises more than 30 million citations for biomedical literature from MEDLINE, life science journals, and online books. Citations may include links to full-text content from PubMed Central and publisher web sites.
Recognition of polyadenylation sites in yeast pre‐mRNAs by cleavage and polyadenylation factor | The EMBO Journal
EE, PE and poly(A)‐site signals were suggested to be sufficient to direct cleavage and polyadenylation of yeast pre‐mRNAs (Guo and Sherman, 1996b). CF IA, CF IB and CF II trans‐acting factors were initially defined as sufficient for cleavage in vitro (Kessler et al., 1996). Subsequent work showed, however, that CF IB is dispensable for cleavage activity and instead controls cleavage‐site selection (Minvielle‐Sebastia et al., 1998). These observations also resulted in the surprising finding that CYC1‐512 RNA is cleaved by CF IA and CF II in vitro when CF IB is absent, suggesting that both EE and PE are dispensable for cleavage.. We extended this observation by analysing cleavage of a short CYC1 substrate by CPF and CF IA in vitro. Consistent with previous results CF IB was not required for cleavage activity but restricted cleavage to the poly(A) site. While deletion of EE sequences in sCYC1 did not influence poly(A)‐site cleavage, removal of the PE had a strong effect. In contrast, ...
OriGene - Cstf3 (NM 177253) Human ORF cDNA Clone
Cstf3 - Cstf3 (GFP-tagged) - Mouse cleavage stimulation factor 3 pre-RNA subunit 3 (Cstf3) transcript variant 2, (10ug) available for purchase from OriGene - Your Gene Company.
OriGene - Cstf2 (BC036719) Human ORF cDNA Clone
Cstf2 - Lenti ORF clone of Cstf2 (mGFP-tagged) - Mouse cleavage stimulation factor, 3 pre-RNA subunit 2 (cDNA clone MGC:36412 IMAGE:5322335) available for purchase from OriGene - Your Gene Company.
Exogenous human granulocyte-colony stimulation factor ( | Open-i
Exogenous human granulocyte-colony stimulation factor (huG-CSF) restores autoantibody (autoAb) production in B6.Sle2c2 mice after induction of chronic graft vs
Targeted ubiquitination of CDT1 by the DDB1-CUL4A-ROC1 ligase in response to DNA damage
Cullins assemble a potentially large number of ubiquitin ligases by binding to the RING protein ROC1 to catalyse polyubiquitination, as well as binding to various specificity factors to recruit substrates. The Cul4A gene is amplified in human breast and liver cancers, and loss-of-function of Cul4 re …
The ability of TNPO3-depleted cells to inhibit HIV-1 infection requires CPSF6 • Research - Institut Pasteur
BACKGROUND: Expression of the cellular karyopherin TNPO3/transportin-SR2/Tnp3 is necessary for HIV-1 infection. Depletion of TNPO3 expression in mammalian
Putting an End to HIV mRNAs: capping and polyadenylation as potential therapeutic targets | AIDS Research and Therapy | Full...
The process of 3′ end formation/polyadenylation occurs co-transcriptionally on cellular and HIV mRNAs generated by RNA Pol II and influences the termination of transcription at a site several hundred bases downstream of the mature 3′ end of the mRNA [50]. The 3′ end of most human mRNAs is generated first by an endonucleolytic cleavage event (catalyzed by CPSF73, aka CPSF3) followed by the addition of 100-250 adenylate residues by poly(A) polymerase (PAP). A typical polyadenylation signal contains two types of elements. The core elements consist of an AAUAAA or similar hexanucleotide and a short (about 5 base long) U- or GU-rich tract located within approximately 25-30 bases upstream or downstream, respectively, of the site. The core elements serve as the assembly site of the complex of polyadenylation factors. Many polyadenylation signals also contain auxiliary elements that are located upstream or downstream of the core elements. These auxiliary elements bind to a variety of cellular ...
Polymorphism 10034C|T Is Located in a Functional Cleavage Stimulation Factor (CstF) Binding Site of the Fibrinogen Gamma Gene...
Abstract. Previously we found that haplotype 2 of the fibrinogen gamma gene (FGG-H2) is associated with an increased risk of deep venous thrombosis and with red
A plant-like mechanism coupling m6A reading to polyadenylation safeguards transcriptome integrity and developmental gene...
Correct 3end processing of mRNAs is one of the regulatory cornerstones of gene expression. In a parasite that must adapt to the regulatory requirements of its multi-host life style, there is a need to adopt additional means to partition the distinct transcriptional signatures of the closely and tandemly-arranged stage specific genes. In this study, we report our findings in T. gondii of an m6A-dependent 3end polyadenylation serving as a transcriptional barrier at these loci. We identify the core polyadenylation complex within T. gondii and establish CPSF4 as a reader for m6A-modified mRNAs, via a YTH domain within its C-terminus, a feature which is shared with plants. We bring evidence of the specificity of this interaction both biochemically, and by determining the crystal structure at high resolution of the T. gondii CPSF4-YTH in complex with an m6A modified RNA. We show that the loss of m6A, both at the level of its deposition or its recognition was associated with an increase in aberrantly ...
CSTF2 (Human) Recombinant Protein (P01) - (H00001478-P01) - Products - Abnova
Human CSTF2 full-length ORF ( AAH17712, 1 a.a. - 577 a.a.) recombinant protein with GST-tag at N-terminal. (H00001478-P01) - Products - Abnova
Sequence Detail
chr5:142990567-143005539, + strand. Annotation of mouse strain PWK/PhJ genome assembly provided by GENCODE consortium. Distributed via Ensembl Release 92. Gene type: protein coding gene; Gene Name: Cpsf4 ...
Targeting Toxoplasma gondii CPSF3 as a new approach to control toxoplasmosis | EMBO Molecular Medicine
Available drugs to treat toxoplasmosis have limitations in efficacy and can cause serious adverse effects. Moreover, toxoplasmosis is now recognized as a leading cause of foodborne illness in the United States (Scallan et al, 2011). Since a Toxoplasma vaccine for use in humans is not currently available, new classes of drugs, preferably directed against novel targets, are needed. Here we report that the benzoxaborole AN3661 inhibits Toxoplasma growth in vitro and, when orally administered to mice, is not only effective against otherwise lethal infections but also enables protective immunity against subsequent Toxoplasma infections. Genetic evidence reported herein supports the conclusion that AN3661 acts via the inhibition of a novel target of T. gondii, TgCPSF3, which is homologous to the endonuclease subunit (CPSF‐73) within the human CPSF complex that cleaves 3′‐mRNAs (Ryan et al, 2004; Mandel et al, 2006).. In another study, it is shown that AN3661 is also active against the human ...
Targeting Toxoplasma gondii CPSF3 as a new approach to control toxoplasmosis | EMBO Molecular Medicine
Available drugs to treat toxoplasmosis have limitations in efficacy and can cause serious adverse effects. Moreover, toxoplasmosis is now recognized as a leading cause of foodborne illness in the United States (Scallan et al, 2011). Since a Toxoplasma vaccine for use in humans is not currently available, new classes of drugs, preferably directed against novel targets, are needed. Here we report that the benzoxaborole AN3661 inhibits Toxoplasma growth in vitro and, when orally administered to mice, is not only effective against otherwise lethal infections but also enables protective immunity against subsequent Toxoplasma infections. Genetic evidence reported herein supports the conclusion that AN3661 acts via the inhibition of a novel target of T. gondii, TgCPSF3, which is homologous to the endonuclease subunit (CPSF‐73) within the human CPSF complex that cleaves 3′‐mRNAs (Ryan et al, 2004; Mandel et al, 2006).. In another study, it is shown that AN3661 is also active against the human ...
Contribution of noncanonical antigens to virulence and adaptive immunity in human infection with enterotoxigenic E. coli |...
Enterotoxigenic E. coli (ETEC) contribute significantly to the substantial burden of infectious diarrhea among children living in low and middle income countries. In the absence of a vaccine for ETEC, children succumb to acute dehydration as well as non-diarrheal sequelae related to these infections including malnutrition. The considerable diversity of ETEC genomes has complicated canonical vaccine development approaches defined by a subset of ETEC pathovar-specific antigens known as colonization factors (CFs). To identify additional conserved immunogens unique to this pathovar we employed an open-aperture approach to capture all potential conserved ETEC surface antigens in which we mined genomic sequences of 89 ETEC isolates, bioinformatically selected potential surface-exposed pathovar-specific antigens conserved in more than 40% of the genomes (n=118), and assembled the representative proteins onto microarrays, complemented with known or putative colonization factor subunit molecules ...
MLLT11/AF1q boosts oncogenic STAT3 activity through Src-PDGFR tyrosine kinase signaling - Semantic Scholar
Constitutive STAT3 activation by tyrosine phosphorylation of mutated or amplified tyrosine kinases (pYSTAT3) is critical for cancer initiation, progression, invasion, and motility of carcinoma cells. We showed that AF1q is associated with STAT3 signaling in breast cancer cells. In xenograft models, enhanced AF1q expression activated STAT3 and promoted tumor growth and metastasis in immunodeficient NSG mice. The cytokine secretory phenotype of MDA-MB-231LN breast cancer cells with altered AF1q expression revealed changes in expression of platelet-derived growth factor subunit B (PDGF-B). AF1q-induced PDGF-B stimulated motility, migration, and invasion of MDA-MB-231LN cells, and AF1q up-regulated platelet-derived growth factor receptor (PDGFR) signaling. Further, AF1q-induced PDGFR signaling enhanced STAT3 activity through Src kinase activation, which could be blocked by the Src kinase inhibitor PP1. Moreover, AF1q up-regulated tyrosine kinase signaling through PDGFR signaling, which was blockable by
JCI - Cleavage factor 25 deregulation contributes to pulmonary fibrosis through alternative polyadenylation
IPF is a deadly disease with a high prevalence (14.0-42.7 per 100,000 persons) and low survival rate (20%-40% 5-year survival rate) (1). The proliferation and activation of ECM-producing myofibroblasts is a central but not yet fully understood process that contributes to the progression of IPF. Thus, the identification of targets that promote abnormal myofibroblast proliferation and differentiation or enhance profibrotic gene expression could prove highly beneficial in designing therapies for pulmonary fibrosis. In our study, we explored the expression of a key APA complex in pulmonary fibrosis and showed, for the first time to our knowledge, that there is a significant decrease of CFIm components (CFIm25, CPSF59, and CPSF68) in myofibroblasts from the lungs of patients with IPF and mice with pulmonary fibrosis, suggesting a possible global 3′-UTR shortening during fibroblast-to-myofibroblast differentiation. In addition, downregulation of CFIm25 was sufficient to shorten the 3′-UTR of ...
CSTF Resuscitation Adults Levels 1, 2 & 3
CSTF Resuscitation Adults Levels 1, 2 & 3 - This course is a mandatory requirement for those who work in health and social care services, including but not l...
Anti-CPSF7 antibody (ab50965) | Abcam
Rabbit polyclonal CPSF7 antibody. Validated in WB, ELISA, IHC and tested in Human. Cited in 1 publication(s). Immunogen corresponding to synthetic peptide.
Messenger RNA Discovery Slows Brain Tumor Growth In Mice | Science 2.0
Much like using dimmer switches to brighten or darken rooms, biochemists have identified a protein called CFIm25 that can be used to slow down or speed up the growth of brain tumors in mice.
CSTF2 - PrimePCR Assay and Template | Life Science | Bio-Rad
Use Bio-Rads PrimePCR assays, controls, templates for your target gene. Every primer pair is optimized, experimentally validated, and performance guaranteed.
The 3′ processing factor CstF functions in the DNA repair response by Nurit Mirkin, Danae Fonseca et al.
Following DNA damage, mRNA levels decrease, reflecting a coordinated interaction of the DNA repair, transcription and RNA processing machineries. In this study, we provide evidence that transcription and polyadenylation of mRNA precursors are both affected in vivo by UV treatment. We next show that the polyadenylation factor CstF, plays a direct role in the DNA damage response. Cells with reduced levels of CstF display decreased viability following UV treatment, reduced ability to ubiquitinate RNA polymerase II (RNAP II), and defects in repair of DNA damage. Furthermore, we show that CstF, RNAP II and BARD1 are all found at sites of repaired DNA. Our results indicate that CstF plays an active role in the response to DNA damage, providing a link between transcription-coupled RNA processing and DNA repair.
The WD-repeat protein superfamily in Arabidopsis: conservation and divergence in structure and function | BMC Genomics | Full...
In several cases, the homologous WDR proteins are highly conserved throughout the length of the proteins, and appear to operate in highly analogous mechanisms, with specificity in function conferred by changes in upstream signaling pathways and/or downstream effectors. One case is AGB1, the only clear Arabidopsis ortholog of Gβ [31] (Fig. 1). Loss of AGB1 function leads to developmental pleiotropy including shortened fruits [32] and changes in patterns of cell division in the hypocotyl and root [33]. These phenotypes are associated with the derepression of genes that are normally turned on by auxin, suggesting a role for AGB1 as a negative regulator of auxin signaling [33]. There appears to be one Gα-like protein (GPA1) and two Gγ-like proteins (AGG1 and AGG2) in the Arabidopsis proteome [31], and molecular modeling and yeast two-hybrid studies of potential interactions among AGB1, GPA1 and AGG1 are not inconsistent with the possibility that these could form a heterotrimeric protein [33, 34]. ...
Blood atlas - CPSF4 - The Human Protein Atlas
RNA-Seq data generated by Monaco et al is reported as average pTPM.. The RNA-seq details section shows detailed information about the individual samples used for the transcript profiling and results of the RNA-seq analysis.. Information about each individual sample is listed below. pTPM (transcripts per million) values give a quantification of the gene abundance which is comparable between different genes and samples. Distribution across the dataset is visualized with box plots, shown as median and 25th and 75th percentiles. Points are displayed as outliers if they are above or below 1.5 times the interquartile range. pTPM values of the individual samples are presented next to the box plot ...
DNASU Plasmid | CSTF2 (Homo sapiens)...
HsCD00001919 ATGGCGGGTTTGACTGTGAGAGACCCAGCGGTGGATCGTTCTCTACGTTCTGTGTTCGTG NM_001325.2 ATGGCGGGTTTGACTGTGAGAGACCCAGCGGTGGATCGTTCTCTACGTTCTGTGTTCGTG ************************************************************ HsCD00001919 GGGAACATTCCTTATGAAGCTACTGAAGAGCAGTTGAAGGACATCTTTTCTGAGGTTGGA NM_001325.2 GGGAACATTCCTTATGAAGCTACTGAAGAGCAGTTGAAGGACATCTTTTCTGAGGTTGGA ************************************************************ HsCD00001919 CCTGTTGTTAGTTTCAGATTGGTATACGATAGAGAGACAGGAAAGCCAAAGGGTTATGGC NM_001325.2 CCTGTTGTTAGTTTCAGATTGGTATACGATAGAGAGACAGGAAAGCCAAAGGGTTATGGC ************************************************************ HsCD00001919 TTCTGTGAATACCAAGACCAAGAGACAGCACTTAGTGCCATGCGGAACCTGAATGGGCGC NM_001325.2 TTCTGTGAATACCAAGACCAAGAGACAGCACTTAGTGCCATGCGGAACCTGAATGGGCGC ************************************************************ HsCD00001919 GAATTCAGTGGGAGAGCACTTCGAGTGGACAATGCTGCCAGTGAAAAGAACAAAGAAGAG NM_001325.2 GAATTCAGTGGGAGAGCACTTCGAGTGGACAATGCTGCCAGTGAAAAGAACAAAGAAGAG ...
RAR1 and NDR1 Contribute Quantitatively to Disease Resistance in Arabidopsis, and Their Relative Contributions Are Dependent on...
The signaling pathways that lead to disease resistance are complex. Previous work had established that some Arabidopsis R genes require the function of NDR1 and others require EDS1. Additionally, some but not all R genes require salicylic acid accumulation and NPR1/NIM1 function (reviewed by Glazebrook, 2001). At least one R gene, RPP7, appears to use NDR1 and EDS1 in combination to mediate some or all of its function (McDowell et al., 2000; but see below). Finally, ethylene- and jasmonic acid-dependent signals also can influence R function (Clarke et al., 2000). Here, we provide compelling evidence that the Arabidopsis ortholog of barley RAR1 also is required for the action of several, but not all, tested R genes. Thus, a key step in R signaling is conserved evolutionarily. We further demonstrate that AtRAR1 and NDR1 contribute differently to the overall efficiency of the defense response, depending on the R function being assayed. This relative contribution can be simple and linear or ...
RAR1 and NDR1 Contribute Quantitatively to Disease Resistance in Arabidopsis, and Their Relative Contributions Are Dependent on...
The signaling pathways that lead to disease resistance are complex. Previous work had established that some Arabidopsis R genes require the function of NDR1 and others require EDS1. Additionally, some but not all R genes require salicylic acid accumulation and NPR1/NIM1 function (reviewed by Glazebrook, 2001). At least one R gene, RPP7, appears to use NDR1 and EDS1 in combination to mediate some or all of its function (McDowell et al., 2000; but see below). Finally, ethylene- and jasmonic acid-dependent signals also can influence R function (Clarke et al., 2000). Here, we provide compelling evidence that the Arabidopsis ortholog of barley RAR1 also is required for the action of several, but not all, tested R genes. Thus, a key step in R signaling is conserved evolutionarily. We further demonstrate that AtRAR1 and NDR1 contribute differently to the overall efficiency of the defense response, depending on the R function being assayed. This relative contribution can be simple and linear or ...
Regulation of Alternative Cleavage and Polyadenylation - Bin Tian
Pre-mRNA cleavage/polyadenylation (C/P) defines the 3end of a mature transcript. Over half of the human genes have multiple C/P sites (pAs), resulting in mRNA...
ELAC - HomeTheaterHifi.com
In a world of ever-changing brands, products and trends, ELAC builds on its heritage with vision to push thinking beyond the present. This is ELAC, founded on a commitment to making the best sound in the world. It began on September 1, 1926 in Kiel, Germany, when Electroacustic GmbH was founded to focus on the development of sonar technology and the research of signal and sound channels in air and water.. ELACs passion for music and fascination with sound followed with their first consumer audio product, the PW1 record player in 1948. ELAC continued to lead the burgeoning audio industry with innovative turntables and electronics. During the 1970s and 1980s, every serious music lover had a high-quality turntable, and the fortunate few owned an ELAC, the backbone of the finest sound systems.. ...