The sodium-driven chloride/bicarbonate exchanger (NDCBE), a member of the SLC4 family of bicarbonate transporters, was recently found to modulate excitatory neurotransmission in hippocampus. et al., 2008). Comparable Na+-driven exchangers have been shown to regulate pH in invertebrate neuronal systems, including molluscan neurons and the squid giant axon (Boron and De Weer, 1976; Thomas, 1977). However, recent work raises the possibility that NDCBE may influence neurotransmission impartial of its effects on pH (Kim and Trussell, 2009). NDCBE and NDCBE-like activity has been detected in multiple brain regions in both rodents and humans (Baxter and Church, 1996; Chen et al., 2008; Damkier et al., 2007; Schwiening and Boron, 1994). The present study reveals a highly selective targeting of NDCBE to axon terminals, where it is closely associated with synaptic vesicles. Because NDCBE is an integral membrane protein, we conclude that this large majority of the vesicle-associated pool must be inserted ...
Signs of Congenital chloride diarrhea including medical signs and symptoms of Congenital chloride diarrhea, symptoms, misdiagnosis, tests, common medical issues, duration, and the correct diagnosis for Congenital chloride diarrhea signs or Congenital chloride diarrhea symptoms.
Congenital chloride diarrhea (CLD) is an autosomal recessive disorder characterized by life-long, severe diarrhea with intestinal Cl- malabsorption. It results from a reduced activity of the down regulated in adenoma exchanger (DRA), due to mutations in the solute carrier family 26, member 3 (SLC26A3) gene. Currently available therapies are not able to limit the severity of diarrhea in CLD. Conflicting results have been reported on the therapeutic efficacy of oral butyrate. We investigated the effect of oral butyrate (100 mg/kg/day) in seven CLD children with different SLC26A3 genotypes. Nasal epithelial cells were obtained to assess the effect of butyrate on the expression of the two main Cl- transporters: DRA and putative anion transporter-1 (PAT-1). A variable clinical response to butyrate was observed regarding the stool pattern and fecal ion loss. The best response was observed in subjects with missense and deletion mutations. Variable response to butyrate was also observed on SLC26A3 (DRA) and
Chloride is an anion in the human body needed for metabolism (the process of turning food into energy). It also helps keep the bodys acid-base balance. The amount of serum chloride is carefully controlled by the kidneys. Chloride ions have important physiological roles. For instance, in the central nervous system, the inhibitory action of glycine and some of the action of GABA relies on the entry of Cl− into specific neurons. Also, the chloride-bicarbonate exchanger biological transport protein relies on the chloride ion to increase the bloods capacity of carbon dioxide, in the form of the bicarbonate ion; this is the mechanism underpinning the chloride shift occurring as the blood passes through oxygen-consuming capillary beds. The normal blood reference range of chloride for adults in most labs is 96 to 106 milliequivalents (mEq) per liter. The normal range may vary slightly from lab to lab. Normal ranges are usually shown next to results in the lab report. A diagnostic test may use a ...
Cl-/HCO3- exchangers are expressed abundantly in cardiac muscle, suggesting that HCO3- extrusion serves an important function in heart. Mice lacking Anion Exchanger Isoform 3 (AE3), a major cardiac Cl-/HCO3- exchanger, appear healthy, but loss of AE3 causes decompensation in a hypertrophic cardiomyopathy (HCM) model. Using intra-ventricular pressure analysis, in vivo pacing, and molecular studies we identified physiological and biochemical changes caused by loss of AE3 that may contribute to decompensation in HCM. AE3-null mice had normal cardiac contractility under basal conditions and after -adrenergic stimulation, but pacing of hearts revealed that frequency-dependent inotropy was blunted, suggesting that AE3-mediated HCO3- extrusion is required for a robust force-frequency response (FFR) during acute biomechanical stress in vivo. Modest changes in expression of proteins that affect Ca2+-handling were observed, but Ca2+-transient analysis of AE3-null myocytes showed normal twitch-amplitude and Ca2
Genetic disruption of slc4a10, which encodes the sodium-dependent chloride/bicarbonate exchanger Ncbe, leads to a major decrease in Na+-dependent HCO3− import into choroid plexus epithelial cells in mice and to a marked reduction in brain intraventricular fluid volume. This suggests that Ncbe functionally is a key element in vectorial Na+ transport and thereby for cerebrospinal fluid secretion in the choroid plexus. However, slc4a10 disruption results in severe changes in expression of Na+,K+-ATPase complexes and other major transport proteins, indicating that profound cellular changes accompany the genetic manipulation. A tandem mass tag labeling strategy was chosen for quantitative mass spectrometry. Alterations in the broader patterns of protein expression in the choroid plexus in response to genetic disruption of Ncbe was validated by semi-quantitative immunoblotting, immunohistochemistry and morphometry. The abundance of 601 proteins were found significantly altered in the choroid plexus from
A collection of disease information resources and questions answered by our Genetic and Rare Diseases Information Specialists for Congenital chloride diarrhea
Worldwide, diarrhea claims several million lives annually, mostly those of infants. Although its incidence is much lower in the more affluent nations, diarrhea remains one of the two most common visits to pediatric emergency rooms and is also common among the institutionalized elderly. Diarrhea is caused by a decrease in net salt and fluid absorption, which can result from either a decrease in salt absorption or an increase in anion secretion, or both. The major pathway for sodium and water absorption in the intestine is thought involve Na+/H+ exchanger type 3 (NHE3) in the brush border membrane of enterocytes where it acts in concert with an anion exchanger to mediate electroneutral NaCl absorption. NHE3 is regulated by many factors, including bacterial toxins, steroids, insulin, cytokines, and osmotic stress. The precise mechanisms underlying the regulation of NHE3 are still under investigation, but emerging themes include transcriptional regulation, changes in phosphorylation of NHE3 ...
4,4-Diisothiocyano-2,2-stilbenedisulfonic acid (DIDS) is an anion exchange inhibitor, blocking reversibly, and later irreversibly, exchangers such as chloride-bicarbonate exchanger. Jessen, Flemming; Sjøholm, C; Hoffmann, EK (1986), "Identification of the anion exchange protein of ehrlich cells: A kinetic analysis of the inhibitory effects of 4,4′-diisothiocyano-2,2′-stilbene-disulfonic acid (DIDS) and labeling of membrane proteins with3H-DIDS", Journal of Membrane Biology, 92 (3): 195, doi:10.1007/BF01869388, PMID 3783658 Lane, Michelle; Baltz, Jay M.; Bavister, Barry D. (1999), "Bicarbonate/Chloride Exchange Regulates Intracellular pH of Embryos but Not Oocytes of the Hamster", Biology of Reproduction, 61 (2): 452-457, doi:10.1095/biolreprod61.2.452, PMID 10411526 ...
Results Forty-three patients (28M/15F) had CCD. Fifteen patients (35%) were diagnosed after one year of age (late referral or misdiagnosis as Bartter syndrome). Premature delivery in 24 cases (55.8%). Polyhydramnios in 26 pregnancies. All patients were distributed among 19 families with 33 children being the outcome of consanguineous marriages. Intractable diarrhea was the presenting symptom in 40patients (93%), Biochemical data revealed: Serum potassium (1.3-4.1, mean 2.4Mmol/l), s. chloride (39-95, mean76.2Mmol/l), s.bicarbonate (22-54) meam-37.6 Mmol/). Fecal chloride (134±21.6, mean±SD)(range 90-205). The fecal chloride over fecal sodium plus potassium ratio was 0.6 (1.1±0.3, mean ± SD)(N.=0.2). Associated disorders were: chronic renal failure 7 (16%), congenital anomalies 8 (19%), mental retardation4 (9.3%) seizures 8 (19%), and brain atrophy 4 (9%). Complications were seen mostly among patients with late referral or poor compliance. At diagnosis, 35 (81.4%) cases were below -2SD for ...
The protein encoded by this gene is a transmembrane glycoprotein that transports chloride ions across the cell membrane in exchange for bicarbonate ions. It is localized to the mucosa of the lower intestinal tract, particularly to the apical membrane of columnar epithelium and some goblet cells. The protein is essential for intestinal chloride absorption, and mutations in this gene have been associated with congenital chloride diarrhea. [provided by RefSeq, Oct 2008 ...
The CLCN5 gene provides instructions for making a protein called ClC-5 that transports charged atoms (ions) across cell membranes. Specifically, ClC-5 exchanges negatively charged atoms of chlorine (chloride ions) for positively charged atoms of hydrogen (protons or hydrogen ions). Based on this function, ClC-5 is known as a H+/Cl- exchanger.. ClC-5 is found primarily in the kidneys, particularly in structures called proximal tubules. These structures help to reabsorb nutrients, water, and other materials that have been filtered from the bloodstream. The kidneys reabsorb needed materials into the blood and excrete everything else into the urine.. Within proximal tubule cells, ClC-5 is embedded in specialized compartments called endosomes. Endosomes are formed at the cell surface to carry proteins and other molecules to their destinations within the cell. ClC-5 transports hydrogen ions into endosomes and chloride ions out, which helps these compartments maintain the proper acidity level (pH). ...
Get an answer for What causes a infant to have congential chloride diarrhea? and find homework help for other Science questions at eNotes
Disease: (OMIM: 126650 214700) Defects in SLC26A3 are the cause of diarrhea type 1 (DIAR1) [MIM:214700]; also known as congenital chloride diarrhea (CLD). DIAR1 is a disease characterized by voluminous watery stools containing an excess of chloride. The children with this disease are often premature ...
Mutations in several SLC26 transporters are linked to human diseases, most of which involve epithelia dysfunction in specific organs. This indicates that SLC26 transporters play a central role in transepithelial fluid and electrolyte transport, including Cl− absorption and HCO3− secretion by the kidney, the GI tract, and secretory glands (Kunzelmann and Mall, 2002; Ko et al., 2004; Melvin et al., 2005; Steward et al., 2005). To understand the function of the SLC26 transporters in epithelial Cl− absorption and HCO3− secretion, it is essential to know their transport mechanism and Cl−/HCO3− transport stoichiometry. Two of the most studied SLC26 transporters are slc26a3 and slc26a6. Both were shown to function as Cl−/HCO3− exchangers (Melvin et al., 1999; Ko et al., 2002; Wang et al., 2002) and as electrogenic transporters (Ko et al., 2002; Xie et al., 2002) with isoform-specific stoichiometry (Ko et al., 2002). However, the electrogenicity of the transporters was called into ...
Congenital Chloride diarrhea (CLD) is an intestinal transport defect of chloride ions. Retention of intestinal chloride causes water retention, which leads to watery diarrhea with an abnormally high chloride concentration. This defect presents in utero, with hydramnion presumably due to intrauterine diarrhea. The gestational period is shortened, and newborn babies have abdominal distension and chronic watery diarrhea. If untreated the condition leads to severe electrolyte changes with a fatal outcome, or to permanent damage of kidneys and brain. Treatment with chloride substitution and control of electrolyte balance is effective and patients can live an almost normal life complicated only by relatively loose stools.
Congenital chloride diarrhea is an autosomal recessive type of chronic diarrhea characterized by voluminous watery stool containing high levels of chloride. It can present in patients of any age from newborns to adults, but onset is most often in the first weeks to months of life. Clinically, congenital chloride diarrhea is similar to Bartter syndrome, except these patients do not have calcium dysregulation ...
1. Na+/H+ antiport activity was measured in peripheral blood polymorphonuclear and mononuclear cells of 12 healthy subjects by using an intracellular pH clamp technique to determine the external Na(+)-dependent H+ efflux rate in cells loaded with a pH-sensitive fluorescent dye, bis(carboxyethyl)carboxyfluorescein. The change in external Na+ concentrations for all pH measurements was similar in both cell types. 2. A significant difference between the two types of cells was found, the polymorphonuclear leucocytes having a higher Na+/H+ antiport activity than the lymphocytes. Cellular intrinsic buffering capacity measured in the absence of HCO3- was also higher in the polymorphonuclear cells than in the lymphocytes. 3. These differences may be associated with a difference in the role of the Na+/H+ exchanger in these two types of cells, although in vivo the presence of HCO3-/Cl- exchangers may also contribute to intracellular pH homoeostasis.
SLC9A1 (NHE1), a member of the Na+/H+ exchanger family, is a ubiquitous membrane protein that regulates intracellular pH and cell volume. Furthermore, SLC9A1 is known to
Book an appointment with Dra. Raquel Ancin Viguiristi. Find verified patient reviews, where to go, insurers, prices, and treatments.
购买SLC35D1兔多克隆抗体(ab106523),SLC35D1抗体经WB验证,可与人,小鼠,大鼠样本反应。产品出库一年都在质保范围内。中国现货速达。
SLC39A10兔多克隆抗体(ab83947)可与小鼠, 大鼠, 人样本反应并经WB, ELISA, ICC实验严格验证。所有产品均提供质保服务,中国75%以上现货。
Rabbit anti Human SLC5A9 antibody recognizes sodium dependent glucose transporter 4 (SGLT4), also known as SLC5A9, a ~76 kDa member o
View Slc34a1/Slc34a1 Slc34a3/Slc34a3 B6.129-Slc34a3 Slc34a1: phenotypes, images, diseases, and references.
Addgene NGS Result CTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGC CGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGC CTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAG TGAGCGCAACGCAATTAATACGCGTACCGCTAGCCAGGAAGAGTTTGTAGAAACGCAAAAAGGCCATCCG TCAGGATGGCCTTCTGCTTAGTTTGATGCCTGGCAGTTTATGGCGGGCGTCCTGCCCGCCACCCTCCGGG CCGTTGCTTCACAACGTTCAAATCCGCTCCCGGCGGATTTGTCCTACTCAGGAGAGCGTTCACCGACAAA CAACAGATAAAACGAAAGGCCCAGTCTTCCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCAGTTCCCT ACTCTCGCGTTAACGCTAGCATGGATGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTCTTAAGC TCGGGCCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACACATTGATGAGCAATG CTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGGCTCCACCATGTCCCTGCTGGGCAGGGACTACAAC TCTGAGCTGAATAGCCTGGATAACGGCCCTCAGTCCCCATCTGAGAGCTCCTCTAGCATCACATCTGAGA ATGTGCACCCAGCAGGAGAGGCAGGACTGAGCATGATGCAGACCCTGATCCACCTGCTGAAGTGCAATAT CGGAACAGGACTGCTGGGACTGCCACTGGCCATCAAGAACGCAGGACTGCTGGTGGGACCCGTGAGCCTG ...
Browse Sigma-Aldrichs Anion Exchange Media to find products in Amberlite Strong Anion Exchangers, Amberlite® Weak Anion Exchangers, Diaion® Strong Anion Exchanger, Diaion® Weak Anion Exchangers, Dowex® Strong Anion Exchangers, Dowex® Weak Anion Exchangers, Lewatit® Strong Anion Exchanger, Lewatit® Weak Anion Exchanger
Previous studies that have evaluated the Na(+)-H+ antiporter in cells from hypertensive subjects were generally performed under conditions in which HCO3-CO2, the physiological buffer system, was absent from the assay media. The objective of this study was to evaluate the activity of the Na(+)-H+ antiporter and that of the Na(+)-dependent and Na(+)-independent Cl(-)-HCO3- exchangers in cells assayed in the presence of HCO3-CO2 in the media. Lymphocytes from 6- to 8-week-old spontaneously hypertensive rats (SHR) and age-matched Wistar-Kyoto (WKY) rats were obtained from the thymus gland and assayed immediately after isolation. The activity of the Na(+)-H+ antiporter after stimulation by cell acidification (pHi approximately 6.4) was similar in SHR and WKY rats (18.67 +/- 1.03 and 16.12 +/- 0.92 mmol H+/L per minute, respectively). Recovery from cell alkalinization was effected by an Na(+)-independent Cl(-)-HCO3- exchanger, with maximal activity at an alkaline pHi (approximately 7.7). The ...
Mutations of SLC4A1 (AE1) encoding the kidney anion (Cl(-)/HCO(3) (-)) exchanger 1 (kAE1 or band 3) can result in either autosomal dominant (AD) or autosomal recessive (AR) distal renal tubular acidosis (dRTA). The molecular mechanisms associated with SLC4A1 mutations resulting in these different modes of inheritance are now being unveiled using transfected cell systems. The dominant mutants kAE1 R589H, R901X and S613F, which have normal or insignificant changes in anion transport function, exhibit intracellular retention with endoplasmic reticulum (ER) localization in cultured non-polarized and polarized cells, while the dominant mutants kAE1 R901X and G609R are mis-targeted to apical membrane in addition to the basolateral membrane in cultured polarized cells ...
Buy Sylvania / Osram DRA (300W/120V) Lamp features GX6.35 Base, T6 Shape. Review Sylvania / Osram Presentation Lamps & Bulbs, Projector & Presentation Lamps
Request an appointment with Dra. Adriana Geri Nieto. Find verified patient reviews, where to go, insurers, prices, and treatments.
Clone REA368 recognizes the human CD233 antigen, a multi-pass membrane protein also known as anion exchange protein 1 (AE1) or solute carrier family 4 member 1 (SLC4A1). CD233 is a phylogenetically preserved transport protein responsible for mediating the electroneutral anion exchange of chloride for bicarbonate across a plasma membrane. It is the major integral membrane glycoprotein of the erythrocyte membrane and is required for the normal flexibility and stability of the erythrocyte membrane as well as for the normal erythrocyte shape via the interactions of its cytoplasmic domain with cytoskeletal proteins, glycolytic enzymes, and hemoglobin. CD233 mediates the chloride-bicarbonate exchange in the kidney, and is required for the normal acidification of the urine. Additional information: Clone REA368 displays negligible binding to Fc receptors. - Belgique
View mouse Slc4a1 Chr11:102348820-102365281 with: phenotypes, sequences, polymorphisms, proteins, references, function, expression
weak anion exchanger, suspension in 20% ethanol and 150 mM NaCl (40-90 µm) Find MSDS or SDS, a COA, data sheets and more information.
Im looking for methods/references regarding the techniques for measuring intracellular pH. Any info would be greatly appreciated. Thanks, Bob McNulty bmcnulty at oavax.csuchico.edu ...
J Mater Sci. DOI 10.1007/s10853-014-8333-x. Adsorption characteristics of noble metals on the strongly basic anion exchanger Purolite A-400TL. A. Wolowicz • Z. Hubicki. Received: 14 March 2014/Accepted: 16 May 2014. © The Author(s) 2014. This article is published with open access at Springerlink.com. Abstract Ion exchange is an alternative process for uptake of noble metals from aqueous solutions. In the present study, the sorption ofPd(II), Pt(IV), and Au(III) ions from aqueous solution was investigated by using Purolite A-400TL (strongly basic anion exchanger, gel, type I) in a batch adsorption system as a function of time (1 min-4 h). Initial Pd(II) concentration (100-1000 mg/L), beads size (0.425-0.85 mm), rate of phases mixing (0-180 rpm), and temperatures (ambient, 313 K) were taken into account during the Pd(II) sorption process. Moreover, the column flow adsorption study was carried out, and the breakthrough curves were obtained for Pd(II) ions. The equilibrium, kinetic, desorption, ...
Tumor hypoxia is associated clinically with therapeutic resistance and poor patient outcomes. One feature of tumor hypoxia is activated expression of carbonic anhydrase IX (CA9), a regulator of pH and tumor growth. In this study, we investigated the hypothesis that impeding the reuptake of bicarbonate produced extracellularly by CA9 could exacerbate the intracellular acidity produced by hypoxic conditions, perhaps compromising cell growth and viability as a result. In 8 of 10 cancer cell lines, we found that hypoxia induced the expression of at least one bicarbonate transporter. The most robust and frequent inductions were of the sodium-driven bicarbonate transporters SLC4A4 and SLC4A9, which rely upon both HIF1α and HIF2α activity for their expression. In cancer cell spheroids, SLC4A4 or SLC4A9 disruption by either genetic or pharmaceutical approaches acidified intracellular pH and reduced cell growth. Furthermore, treatment of spheroids with S0859, a small-molecule inhibitor of sodium-driven
Chronic cerebral hypoperfusion is believed to cause white matter lesions (WMLs), leading to cognitive impairment. Previous studies have shown that inflammation and apoptosis of oligodendrocytes (OLs) are involved in the pathogenesis of WMLs, but effective treatments have not been studied. In this study, 4,4-diisothiocyanostilbene-2,2-disulfonic acid (DIDS), a chloride (Cl−) channel blocker, was injected into chronic cerebral ischemia-hypoxia rat models at different time points. Our results showed that DIDS significantly reduced the elevated mRNA levels and protein expression of chloride channel 2 (ClC-2) in neonatal rats induced by ischemia-hypoxia. Meanwhile, DIDS application significantly decreased the concentrations of reactive oxygen species (ROS); and the mRNA levels of inducible nitric oxide synthase (iNOS) and tumor necrosis factor-alpha TNF-α in neonatal rats with hypoxic-ischemic damage. Myelin staining was weaker in neonatal rats with hypoxic-ischemic damage compared to normal controls
Catalysis of the transfer of a solute or solutes from one side of a membrane to the other according to the reaction: inorganic anion A(out) + inorganic anion B(in) = inorganic anion A(in) + inorganic anion B(out).
Background: Some respiratory diseases may induce alveolar hypoxia thereby hypoxic pulmonary vasoconstriction (HPV). This study was the first to investigate the role of anion exchanger in sustained HPV.. Methods: Experiments were performed in the isolated perfused rabbit lung. In the HCO3- free groups, HEPES were added to the perfusate instead of bicarbonate. In the HEPES1 and HEPES2 groups, the lungs were ventilated with hypoxic gas with or without CO2 respectively.. Results: Ventilation the lungs with hypoxic gas resulted in biphasic HPV. No alteration in both phases of HPV was detected by DIDS (anion exchanger inhibitor,200 microM). However, DIDS (400 microM), extended ascending part of acute HPV until min 24. Both phases of HPV were decreased in the HEPES1 group. But in the HEPES 2 group, HPV tended to increase significantly during rising part of acute phase with no change during sustained phase.. Conclusions: This study is suggesting that anion exchanger may modulate HPV especially during ...
Pendrin is a Cl-/HCO3- exchanger expressed in the apical regions of renal intercalated cells. Following pendrin gene ablation, blood pressure falls, in part, from reduced renal NaCl absorption. We asked if pendrin is expressed in vascular tissue and if the lower blood pressure observed in pendrin null mice is accompanied by reduced vascular reactivity. Thus, the contractile responses to KCl and phenylephrine (PE) were examined in isometrically mounted thoracic aortas from wild-type and pendrin null mice. Although pendrin expression was not detected in the aorta, pendrin gene ablation changed contractile protein abundance and increased the maximal contractile response to PE when normalized to cross sectional area (CSA). However, the contractile sensitivity to this agent was unchanged. The increase in contractile force/cross sectional area observed in pendrin null mice was due to reduced cross sectional area of the aorta and not from increased contractile force per vessel. The pendrin-dependent ...
Human SLC transporter inhibition assay for OATP1B1, OATP1B3, OAT1, OAT3, OCT1, OCT2, MATE1, MATE2-K, OATP1A2, OATP2B1, OAT2, OAT4, OCTN2, PEPT1, PEPT2, NTCP - assay protocol, data and your questions answered.
All of the shorter proteins specific improperly to the mobile area.We even further characterized pH regulation in the AP1 cell line that contains the NHE1 6747-15-5 protein with the MEDChem Express 1009298-09-2 sequence shortened to amino acid 735. In Fig 3C we illustrate the Na+/H+ exchanger activity of the protein that was corrected for the sum of NHE1 protein expressed and focused to the mobile area. The effects demonstrate that the level of action of this protein is nonetheless reduced relative to that of the management.We when compared the intracellular pH of wild type cells with that of the NHE1 protein with the sequence shortened to amino acid 735. Equally the resting intracellular pH, prior to ammonium chloride treatment method, and the degree of acidification induced by ammonium chloride , did not change amongst wild form and 735-NHE1 protein that contains cells. Cells recovering from an acute acid load induced by ammonium chloride, attain a plateau three minutes after recovery ...
Before you buy Polarwrap The Exchanger Mask, Exchanger II Model, Mossy Oak Breakup, Medium, 1 Mask, check out Influenster reviews.
The CCDS database identifies a core set of human protein coding regions that are consistently annotated by multiple public resources and pass quality tests.
The CCDS database identifies a core set of human protein coding regions that are consistently annotated by multiple public resources and pass quality tests.
View Notes - Answers for Assignment_9 (Fall 2008) from BBA STAS2126 at Laurentian. STAS2126 Assignment#9 (Fall 2008) Submit to Dropbox not by emailUse your first and last name as the file name Do NOT
Considering the performance of parent Fe(III)-Cu(II) binary oxide nanoparticles in removing numerous contaminants from water, in order to prevent the release of the nanostructures into the cleaned water a deposit with the same composition was introduced into the matrix of a synthetic porous material (ion exchange resin), whereby a hybrid ion exchanger (HIX) was obtained. Amberlite 900 Cl, a commercially available strongly basic macroreticular anion exchanger, was used as the supporting material. The inorganic deposit was introduced into its structure in two steps performed batchwise at ambient temperature. Fe(III)-Cu(II) binary oxide could be deposited into the matrix of the strongly basic anion exchanger owing to the affinity of its functional groups for FeCl4− and CuCl42− ions. When in the ion exchange reaction the anion exchanger bound both the ions and the reaction medium alkalized, the respective oxides FeOOH and CuO precipitated in its structure. The oxide deposit was introduced into ...
We used the pH-sensitive fluorescent dye BCECF to study intracellular pH (pHi) regulation in primary cultures of rat astrocytes and C6 glioma cells. Both cell types contain three pH-regulating transporters: (1) alkalinizing Na+/H+ exchange; (2) alkalinizing Na+ + HCO3 −/Cl−exchange; and (3) acidifying Cl−/HCO3− exchange. Na+/H+ exchange was most evident in the absence of CO2; recovery from acidification was Na+ dependent and amiloride sensitive. Exposure to CO2 caused a cell alkalinization that was inhibited by DIDS, dependent on external Na+, and inhibited 75% in the absence of Cl− (thus mediated by Na+ + HCO3−/Cl− exchange). When pHi was increased above the normal steady-state pHi, a DIDS-inhibitable and Na+ -independent acidifying recovery was evident, indicating the presence of Cl− /HCO3−exchange. Astrocytes, but not C6 cells, contain a fourth pH-regulating transporter, Na+ −HCO3− cotransport; in the presence of CO2, depolarization caused an alkalinization of 0.12 +− 0.01 (n
They administered in excess of 3100 mmol of chloride to their patient (mostly in the form of normal saline) causing the plasma chloride to increase from 90 to 128 mM. They noted a metabolic acidosis (pH, 7.16; HCO3, 13.2 mEq/l; base deficit, 14.5 mEq/l) and attributed this to dilution of the extracellular HCO3 pool by expansion of the extracellular space. This is incorrect. If this was the mechanism involved, then an acidosis should also occur with pure water expansion of the extracellular space such as in SIADH or psychogenic polydipsia. No acidosis is seen in these disorders. The actual mechanism involved is related to chloride-bicarbonate exchange ...