This gene is located on the long arm of chromosome 4 in a region that is associated with susceptibility to celiac disease. The encoded protein is similar to a Chinese hamster protein that is associated with spermatocyte and adipocyte differentiation. The C-terminus of the protein is also similar to a Caenorhabditis elegans protein that plays a role in lipid storage. In mammals, this protein is thought to function in the regulation of epithelial growth and differentiation, and in tumor development ...
Several of the RNAi candidates (dve-1; lin-40; nhr-49; ceh-20; lin-11; and nhr-77) appeared to non-discriminately shorten lifespan in all strains tested, suggesting that the corresponding transcription factors are broadly required for survival. Interestingly, four RNAi clones (ZC123.3; nhr-119; ceh-37; and aha-1) affected wild-type and isp-1;ctb-1 mutant worms lifespan to the same extent but exerted only a moderate or no effect on daf-16 and age-1 mutant longevity ...
Positioning edgetic residues in CED-9 structures. (a) Positions of edgetic residues in the CED-9 sequence. The portion of CED-9 present in the crystal (PDB ID c
1. Baldwin, J.G., Nadler, S.A., and Wall, D.H. 1997. Nematodes: Pervading the Earth and Linking all Life. Pp. 176-191. In: Raven, P.H. (ed.). National Academy Press, Washington, D.C. 625 pp.. 2. Bargmann, C. I. 1998. Neurobiology of the Caenorhabditis elegans genome. Science 282:2028-2033.. 3. Bargmann, C. I. And Mori, I. 1997. Chemotaxis and Thermotaxis. Pp. 717-737. In: Riddle, D.L., Blumenthal, T., Meyer, B.J. and Priess, J.R. (eds). C. elegans II. Cold Spring Harbor Laboratory Press, Plainview, NY 1222 pp.. 4. Bird, D.M. and Opperman, C. H. 1998. Caenorhabditis elegans. J. Nematol. 30:299-308.. 5. Bird, D.M., Opperman, C.H., Jones S.J.M., and Baillie, D.L. 1999. The Caenorhabditis elegans gemome: a guide in the post genomics age. Annu. Rev. Phytopathol. 37:247-265.. 6. Blaxter, M. 1998. Caenorhabditis elegans is a nematode. Science 282:2041-2046.. 7. Blaxter, M. and Bird, D. 1997. Parasitic nematodes. Pp. 851-878. In: Riddle, D.L., Blumenthal, T., Meyer, B.J. and Priess, J.R. (eds). C. ...
The molecular mechanisms underlying muscle atrophy during spaceflight are not well understood. We have analyzed the effects of a 10-day spaceflight on Caenorhabditis elegans muscle development. DNA microarray, real-time quantitative PCR, and quantitative western blot analyses revealed that the amount of MHC in both body-wall and pharyngeal muscle decrease in response to spaceflight. Decreased transcription of the body-wall myogenic transcription factor HLH-1 (CeMyoD) and of the three pharyngeal myogenic transcription factors, PEB-1, CEH-22 and PHA-4 were also observed. Upon return to Earth animals displayed reduced rates of movement, indicating a functional defect. These results demonstrate that C. elegans muscle development is altered in response to spaceflight. This altered development occurs at the level of gene transcription and was observed in the presence of innervation, not simply in isolated cells. This important finding coupled with past observations of decreased levels of the same ...
The germ cells of multicellular organisms protect their developmental potential through specialized mechanisms. A shared feature of germ cells from worms to humans is the presence of nonmembrane-bound, ribonucleoprotein organelles called germ granules. Depletion of germ granules in Caenorhabditis elegans (i.e., P granules) leads to sterility and, in some germlines, expression of the neuronal transgene unc-119::gfp and the muscle myosin MYO-3. Thus, P granules are hypothesized to maintain germ cell totipotency by preventing somatic development, although the mechanism by which P granules carry out this function is unknown. In this study, we performed transcriptome and single molecule RNA-FISH analyses of dissected P granule-depleted gonads at different developmental stages. Our results demonstrate that P granules are necessary for adult germ cells to downregulate spermatogenesis RNAs and to prevent the accumulation of numerous soma-specific RNAs. P granule-depleted gonads that express the ...
rdf:RDF xmlns:dcterms="http://purl.org/dc/terms/" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" xmlns:bibo="http://purl.org/ontology/bibo/" xmlns:dspace="http://digital-repositories.org/ontologies/dspace/0.1.0#" xmlns:foaf="http://xmlns.com/foaf/0.1/" xmlns:void="http://rdfs.org/ns/void#" xmlns:xsd="http://www.w3.org/2001/XMLSchema#" , ,rdf:Description rdf:about="https://kops.uni-konstanz.de/rdf/resource/123456789/34900", ,bibo:uri rdf:resource="https://kops.uni-konstanz.de/handle/123456789/34900"/, ,dc:creator,Deehan, Kevin,/dc:creator, ,dc:creator,Wilson, Kristy J.,/dc:creator, ,dc:language,eng,/dc:language, ,dcterms:abstract xml:lang="eng",UNC-89 is a giant polypeptide located at the sarcomeric M-line of Caenorhabditis elegans muscle. The human homologue is obscurin. To understand how UNC-89 is localized and functions, we have been identifying its binding partners. Screening a yeast two-hybrid library revealed that UNC-89 interacts with ...
Centrioles are microtubule-based organelles crucial for cell division, sensing and motility. In Caenorhabditis elegans, the onset of centriole formation requires notably the proteins SAS-5 and SAS-6, which have functional equivalents across eukaryotic evolution. Whereas the molecular architecture of SAS-6 and its role in initiating centriole formation are well understood, the mechanisms by which SAS-5 and its relatives function is unclear. Here, we combine biophysical and structural analysis to uncover the architecture of SAS-5 and examine its functional implications in vivo. Our work reveals that two distinct self-associating domains are necessary to form higher-order oligomers of SAS-5: a trimeric coiled coil and a novel globular dimeric Implico domain. Disruption of either domain leads to centriole duplication failure in worm embryos, indicating that large SAS-5 assemblies are necessary for function in vivo. Rogala, Kacper B; Dynes, Nicola J; Hatzopoulos, Georgios N; Yan, Jun; Pong, Sheng Kai;
The nematode worm Caenorhabditis elegans is a model system for the study of the genetic basis of aging. Maternal-effect mutations in four genes-clk-1, clk-2, clk-3, and gro-1- interact genetically to determine both the duration of development and life-span. Analysis of the phenotypes of these mutants suggests the existence of a general physiological clock in the worm. Mutations in certain genes involved in dauer formation (an alternative larval stage induced by adverse conditions in which development is arrested) can also extend life-span, but the life extension of Clock mutants appears to be independent of these genes. The daf-2(e1370) clk-1(e2519) worms, which carry life-span-extending mutations from two different pathways, live nearly five times as long as wild-type worms.. ...
The vaccinia-related kinases (VRKs) are highly conserved throughout the animal kingdom and phosphorylate several chromatin proteins and transcription factors. In early Caenorhabditis elegans embryos, VRK-1 is required for proper nuclear envelope formation. In this work, we present the first investigation of the developmental role of VRKs by means of a novel C. elegans vrk-1 mutant allele. We found that VRK-1 is essential in hermaphrodites for formation of the vulva, uterus, and utse and for development and maintenance of the somatic gonad and thus the germ line. VRK-1 regulates anchor cell polarity and the timing of anchor cell invasion through the basement membranes separating vulval and somatic gonadal cells during the L3 larval stage. VRK-1 is also required for proper specification and proliferation of uterine cells and sex myoblasts. Expression of the fibroblast growth factor-like protein EGL-17 and its receptor EGL-15 is reduced in vrk-1 mutants, suggesting that VRK-1 might act at least ...
A genetic screen for Caenorhabditis elegans mutants with enhanced susceptibility to killing by Pseudomonas aeruginosaled to the identification of two genes required for pathogen resistance: sek-1, which encodes a mitogen-activated protein (MAP) kinase kinase, and nsy-1, which encodes a MAP kinase kinase kinase. RNA interference assays and biochemical analysis established that a p38 ortholog, pmk-1, functions as the downstream MAP kinase required for pathogen defense. These data suggest that this MAP kinase signaling cassette represents an ancient feature of innate immune responses in evolutionarily diverse species. ...
Mouse mAb M38 was used in indirect immunofluorescence experiments to detect a stage-specific antigen on the surface of the first larval stage (L1) of the free-living nematode Caenorhabditis elegans, and to detect alterations in the apparent expression of this antigen in two distinct classes of C. elegans mutants. In previously described srf-2 and srf-3 mutants (Politz S. M., M. T. Philipp, M. Estevez, P.J. OBrien, and K. J. Chin. 1990. Proc. Natl. Acad. Sci. USA. 87:2901-2905), the antigen is not detected on the surface of any stage. Conversely, in srf-(yj43) and other similar mutants, the antigen is expressed on the surface of the first through the fourth (L4) larval stages. To understand the molecular basis of these alterations, the antigen was characterized in gel immunoblotting experiments. After SDS-PAGE separation and transfer to nitrocellulose, M38 detected a protein antigen in extracts of wild-type L1 populations. The antigen was sensitive to digestion by Pronase and O-glycanase ...
During the course of normal embryonic and post-embryonic development, 131 cells in a Caenorhabditis elegans hermaphrodite undergo programmed cell death. Loss of function mutations in either of the genes ced-3 or ced-4 abolish cell deaths, enabling these undead cells to survive and be incorporated into the adult with no obvious deleterious consequences. Ultrastructural reconstructions have shown that undead cells exhibit many differentiated characteristics. Most of the reconstructed cells appeared to be neurons with all the characteristic features associated with such cells, such as processes, synaptic vesicles and presynaptic specializations. However, clear morphological differences were seen among the undead neurons, suggesting a diversity of cell type. One of the reconstructed cells was a rectal epithelial cell, which had displaced its lineal sister that normally functions in this role. Removal of the ability to undergo programmed cell death by mutation therefore reveals a diversity of ...
Members of the Hox gene family encode transcription factors that specify positional identity along the anterior-posterior axis of nearly all metazoans. One among the Caenorhabditis elegans Hox genes is egl-5. A deletion allele of egl-5 was isolated in a screen for animals which fail to develop swollen tails when exposed to the bacterial pathogen Microbacterium nematophilum. We show that compromised rectal development, which occurs as a result of loss of egl-5 function, results in a failure of rectal epithelial cells to express the ERK MAP kinase mpk-1, which was previously shown to mediate tail-swelling in response to bacterial infection. Tissue-specific rescue experiments demonstrated that egl-5 and mpk-1 act autonomously in rectal cells in the morphological response. The weak egl-5 allele (n1439), which does not compromise rectal development, fails to affect tail-swelling. We find that this allele carries an inserted repeat element approximately 13.8 kb upstream of the egl-5 open reading frame, which
Aging is characterized by general physiological decline over time. A hallmark of human senescence is the onset of various age-related afflictions including neurodegeneration, cardiovascular disease and cancer. Although environmental and stochastic factors undoubtedly contribute to the increased incidence of disease with age, recent studies suggest that intrinsic genetic determinants govern both life span and overall health. Current aging research aims at achieving the longevity dividend, in which life span extension in humans is accomplished with a concomitant increase in the quality of life (Olshansky et al., 2007). Significant progress has been made using model organisms, especially the nematode worm Caenorhabditis elegans, to delineate the genetic and biochemical pathways involved in aging to identify strategies for therapeutic intervention in humans. In this review, we discuss how C. elegans has contributed to our understanding of insulin signaling and aging. ...
Defining a behavior that requires the function of specific neurons in the free-living nematode Caenorhabditis elegans can allow one to screen for mutations that disrupt the specification or function of those neurons. We identified serotonin-immunoreactive neurons required for tail curling or turnin …
RNA interference (RNAi) is a widespread and widely exploited phenomenon which has potential as a strategy for both the treatment of disease and pest control. RNAi results in down‐regulation of a specific gene in response to the production of small interfering RNAs (siRNAs). RNAi is one of a family of processes mediated by small non‐coding RNAs [1], [2]. In Caenorhabditis elegans, and in a number of other organisms, RNAi is systemic so that the introduction of dsRNA into one tissue triggers gene silencing in other tissues [3], [4], [5], [6], [7]. Furthermore, systemic RNAi enables C. elegans and other organisms to exhibit environmental RNAi [5]. For example, feeding C. elegans on bacteria expressing dsRNA initiates a widespread RNAi response [8], [9]. Studies in C. elegans and other organisms have provided mechanistic insights into RNAi [4], [10], [11], [12], [13], although the role of exogenous RNAi in the normal life of C. elegans and other animals remains unclear [14].. Whilst C. elegans ...
Independent reversions of mutations affecting three different Caenorhabditis elegans genes have each yielded representatives of the same set of extragenic suppressors. Mutations at any one of six loci act as allele-specific recessive suppressors of certain allels of unc-54 (a myosin heavy chain gene), lin-29 (a heterochronic gene), and tra-2 (a sex determination gene). The same mutations also suppress certain alleles of another sex determination gene, tra-1, and of a morphogenetic gene, dpy-5. In addition to their suppression phenotype, the suppressor mutations cause abnormal morphogenesis of the male bursa and the hermaphrodite vulva. We name these genes smg-1 through smg-6 (suppressor with morphogenetic effect on genitalia), in order to distinguish them from mab (male abnormal) genes that can mutate to produce abnormal genitalia but which do not act as suppressors (smg-1 and smg-2 are new names for two previously described genes, mab-1 and mab-11). The patterns of suppression, and the ...
Mutations in the gene unc-53 of Caenorhabditis elegans result in behavioral and anatomical abnormalities. Immunocytochemistry and electron microscopy revealed neuroanatomical defects in all main longitudinal nervous tracts. Whole tracts were found to
Caenorhabditis elegans MIG-13 protein: required for positioning of Q neuroblasts and their descendents along the anteroposterior axis; isolated from Caenorhabditis elegans; amino acid sequence in first source; GenBAnk AF150958
As a consequence of the Earths axial rotation, organisms display daily recurring rhythms in behavior and biochemical properties, such as hormone titers. The neuronal system controlling such changes is best studied in the fruit fly Drosophila melanogaster. In the nematode worm Caenorhabditis elegans, most homologs of these genes function in the heterochronic pathway controlling the (timing of) developmental events. Recent data indicate that in the worm at least one of the genes involved in developmental timing is also active in circadian rhythm control, thereby opening up new perspectives on a central (neuronal) timer interfering with many processes. Also, new neuropeptidergic clock homologs have been identified in nematodes, supporting the idea of a broad range of clock-regulated targets. We will describe the current knowledge on homologous clock genes in C. elegans with a focus on the recently discovered pigment dispersing factor gene homologs. Similarities between developmental and daily ...
Genetic studies have identified over a dozen genes that function in programmed cell death (apoptosis) in the nematode Caenorhabditis elegans(1-3). Although the ultimate effects on cell survival or engulfment of mutations in each cell death gene have been extensively described, much less is known about how these mutations affect the kinetics of death and engulfment, or the interactions between these two processes. We have used four-dimensional-Nomarski time-lapse video microscopy to follow in detail how cell death genes regulate the extent and kinetics of apoptotic cell death and removal in the early C. elegans embryo. Here we show that blocking engulfment enhances cell survival when cells are subjected to weak pro-apoptotic signals. Thus, genes that mediate corpse removal can also function to actively kill cells.. ...
A specific behavioural response of Caenorhabditis elegans, the rapid increase of locomotion in response to anoxia/reoxygenation called the O2-ON response, has been used to model key aspects of ischaemia/reperfusion injury. A genetic suppressor screen demonstrated a direct causal role of CYP (cytochrome P450)-13A12 in this response and suggested that CYP-eicosanoids, which in mammals influence the contractility of cardiomyocytes and vascular smooth muscle cells, might function in C. elegans as specific regulators of the body muscle cell activity. In the present study we show that co-expression of CYP-13A12 with the NADPH-CYP-reductase EMB-8 in insect cells resulted in the reconstitution of an active microsomal mono-oxygenase system that metabolized EPA (eicosapentaenoic acid) and also AA (arachidonic acid) to specific sets of regioisomeric epoxy and hydroxy derivatives. The main products included 17,18-EEQ (17,18-epoxyeicosatetraenoic acid) from EPA and 14,15-EET (14,15-epoxyeicosatrienoic acid) ...
Benzimidazole anti-microtubule drugs, such as benomyl, induce paralysis and slow the growth of the nematode Caenorhabditis elegans. We have identified 28 mutations in C. elegans that confer resistance to benzimidazoles. All resistant mutations map to a single locus, ben-1. Virtually all these mutations are genetically dominant. Molecular cloning and DNA sequence analysis established that ben-1 encodes a beta-tubulin. Some resistant mutants are completely deleted for the ben-1 gene. Since the deletion strains appear to be fully resistant to the drugs, the ben-1 product appears to be the only benzimidazole-sensitive beta-tubulin in C. elegans. Furthermore, since animals lacking ben-1 are viable and coordinated, the ben-1 beta-tubulin appears to be nonessential for growth and movement. The ben-1 function is likely to be redundant in the nematode genome. ...
Caenorhabditis elegans shares several molecular and physiological homologies with humans and thus plays a key role in studying biological processes. As a consequence, much progress has been made in automating the analysis of C. elegans. However, there is still a strong need to achieve more progress in automating the analysis of static images of adult worms. In this paper, a three-phase semi-automated system has been proposed. As a first phase, a novel segmentation framework, based on variational level sets and local pressure force function, has been introduced to handle effectively images corrupted with intensity inhomogeneity. Then, a set of robust invariant symbolic features for high-throughput screening of image-based C. elegans phenotypes are extracted. Finally, a classification model is applied to discriminate between the different subsets. The proposed system demonstrates its effectiveness in measuring morphological phenotypes in individual worms of C. elegans.. ...
Cytoskeletal regulation is important in cell migration. The Caenorhabditis elegans gonadal distal tip cells (DTCs) offer a simple model with which to investigate the mechanism of cell migration in organogenesis. Here, we report that one of the spectraplakin isoforms, VAB-10B1, plays an essential role in cell and nuclear migration of DTCs by regulating the actin and microtubule (MT) cytoskeleton. In the vab-10(tk27) mutant, which lacks VAB-10B1, alignment of filamentous (F)-actin and MTs was weakly and severely disorganized, respectively, which resulted in a failure to translocate the DTC nucleus and a premature termination of DTC migration. An MT growing-tip marker, EBP-2-GFP, revealed that polarized outgrowth of MTs towards the nuclei of migrating DTCs was strikingly impaired in tk27 animals. A vab-10 mini-gene encoding only the actin- and MT-binding domains significantly rescued the gonadal defects, suggesting that VAB-10B1 has a role in linking actin and MT filaments. These results suggest ...
Amino Acid Sequence, Animals, Apoptosis/*physiology, Apoptosis Regulatory Proteins, Caenorhabditis/genetics, Caenorhabditis elegans/embryology/genetics/*physiology, Caenorhabditis elegans Proteins/genetics/metabolism/*physiology, DNA/genetics/radiation effects, DNA Damage, Gene Deletion, Gene Expression Regulation; Developmental/radiation effects, Heat-Shock Proteins/genetics, Models; Biological, Molecular Sequence Data, Mutation, Proto-Oncogene Proteins/genetics/metabolism, Repressor Proteins/genetics, Sequence Homology; Amino Acid, Tumor Suppressor Protein p53/genetics/physiology, X-Rays ...
Gene expression is regulated at multiple levels, including transcription and translation, as well as mRNA and protein stability. Although systems-level functions of transcription factors and microRNAs are rapidly being characterized, few studies have focused on the posttranscriptional gene regulation by RNA binding proteins (RBPs). RBPs are important to many aspects of gene regulation. Thus, it is essential to know which genes encode RBPs, which RBPs regulate which gene(s), and how RBP genes are themselves regulated. Here we provide a comprehensive compendium of RBPs from the nematode Caenorhabditis elegans (wRBP1.0). We predict that as many as 887 (4.4%) of C. elegans genes may encode RBPs ~250 of which likely function in a gene-specific manner. In addition, we find that RBPs, and most notably gene-specific RBPs, are themselves enriched for binding and modification by regulatory proteins, indicating the potential for extensive regulation of RBPs at many different levels. wRBP1.0 will provide a
Cell invasion is a tightly controlled process occurring during development and tumor progression. The nematode Caenorhabditis elegans serves as a genetic model to study cell invasion during normal development. In the third larval stage, the anchor ce
A search of the C. elegans genome for potential homologues of the yeast MEN/SIN genes revealed several candidate genes, although for some of these genes the sequence similarities were only limited and for TEM1, CDC15, and BFA1 no putative homologues could be identified (Table I). All candidate genes were tested in C. elegans for a possible function in a hypothetical MEN/SIN-like regulatory network, using RNAi to deplete the corresponding products. For depletion of putative MEN/SIN gene products, both RNAi feeding and injection methods (Montgomery and Fire, 1998; Timmons et al., 2001) were tried to maximize the probability of functional inactivation. The results of these experiments are summarized in Table I. A priori, we had expected that depletion of a gene product required for the regulation of mitotic exit or the onset of cytokinesis should result in embryonic lethality. However, of all components tested, only the depletion of the C. elegans homologue of the budding yeast Cdc14p phosphatase ...
The pace of technical developments allowing the direct manipulation of genome sequences has seen a marked acceleration in recent years with the emergence of RNA-targeted nucleases derived from bacterial immune systems (Doudna and Charpentier 2014; Zetsche et al. 2015). In particular, the binary system relying on the Streptococcus pyogenes Cas9 endonuclease targeted by CRISPR (clustered, regularly interspaced, short, palindromic repeat) RNAs has been successfully used to generate point mutations, deletion, or DNA insertions in an ever-growing number of experimental systems. S. pyogenes CRISPR/Cas9 has been adapted early on in the model nematode Caenorhabditis elegans (Friedland et al. 2013; Dickinson et al. 2013; Chen et al. 2013; Frøkjær-Jensen 2013; Dickinson and Goldstein 2016). Previously, heritable genome engineering could only be achieved in C. elegans by remobilizing a Drosophila Mos1 transposon, which could be inserted and excised in the germline (Robert and Bessereau 2007; ...
BACKGROUND : The nematode Caenorhabditis elegans has been used extensively to identify the genetic requirements for proper nervous system development and function. Key to this process is the direction of vesicles to the growing axons and dendrites, which is required for growth-cone extension and synapse formation in the developing neurons. The contribution and mechanism of membrane traffic in neuronal development are not fully understood, however. RESULTS : We show that the C. elegans gene unc-69 is required for axon outgrowth, guidance, fasciculation and normal presynaptic organization. We identify UNC-69 as an evolutionarily conserved 108-amino-acid protein with a short coiled-coil domain. UNC-69 interacts physically with UNC-76, mutations in which produce similar defects to loss of unc-69 function. In addition, a weak reduction-of-function allele, unc-69(ju69), preferentially causes mislocalization of the synaptic vesicle marker synaptobrevin. UNC-69 and UNC-76 colocalize as puncta in ...
C elegans Lin-3 protein: amino acid sequence given in first source; lin-3 encodes an inductive signal for vulval development; from Caenorhabditis elegans
Buy or Rent Caenorhabditis elegans: Modern Biological Analysis of an Organism: Caenorhibditus Elegans: Modern Biological Analysis of an Organism as an eTextbook and get instant access. With VitalSource, you can save up to 80% compared to print.
We are studying the development of the intestine in the small free-living nematode worm Caenorhabditis elegans. The worm intestine develops as a simple clone of cells, entirely deriving from a single cell in the eight-cell embryo. We mainly focus on the transcription factor network that drives development of the intestine. From our work and that of others, we now know all the core transcription factors that control intestinal genes, from specification to differentiation, and they all are "GATA factors" similar to the factors that are central to the development of the human intestine. We are now trying to figure out how these factors actually work, i.e. to define the molecular and thermodynamic basis of developmental specificity. Does all the specificity reside in the DNA binding domain? And if so, how much does the binding free energy to an intestinal gene differ from the binding free energy to a gene expressed in a different lineage, e.g. the hypodermis (skin)? Are there other protein domains ...
TY - JOUR. T1 - Cis-regulatory mechanisms of gene expression in an olfactory neuron type in Caenorhabditis elegans. AU - Nokes, Eva B.. AU - Van Der Linden, Alexander M.. AU - Winslow, Caron. AU - Mukhopadhyay, Saikat. AU - Ma, Kristin. AU - Sengupta, Piali. PY - 2009/12. Y1 - 2009/12. N2 - The generation of cellular diversity is dependent on the precise spatiotemporal regulation of gene expression by both cis- and trans-acting mechanisms. The developmental principles regulating expression of specific gene subsets in individual cell types are not fully understood. Here we define the cis-regulatory mechanisms driving expression of cell-selective and broadly expressed genes in vivo in the AWB olfactory neuron subtype in C. elegans. We identify an element that is necessary to drive expression of neuron-selective chemoreceptor genes in the AWB neurons, and show that this element functions in a context-dependent manner. We find that the expression of broadly expressed sensory neuronal genes in the ...
Many crucial events in metazoan development and physiology are governed by diffusible signals that trigger specific responses in highly restricted subsets of cells. This exquisite specificity of intercellular signaling requires precisely controlled expression of receptors and downstream signaling components that effect appropriate responses. The nematode Caenorhabditis elegans has proven a valuable model for the study of signaling specificity, notably for mechanisms of signaling through the Epidermal growth factor (EGF) receptor (for a review, see Moghal and Sternberg, 2003). The sole EGF-like ligand and EGF receptor in the C. elegans genome are encoded by the genes lin-3 and let-23, respectively (Hill and Sternberg, 1992; Aroian et al., 1990) (Wormbase WS210). Recently we described a role for LET-23 in the regulation of C. elegans behavior (Van Buskirk and Sternberg, 2007). Caenorhabditis elegans develops through four larval stages before adulthood, and each larval molt is preceded by ...
LAG1 is a longevity gene, the first such gene to be identified and cloned from the yeast Saccharomyces cerevisiae. A close homolog of this gene, which we call LAC1, has been found in the yeast genome. We have cloned the human homolog of LAG1 with the ultimate goal of examining its possible function in human aging. In the process, we have also cloned a homolog from the nematode worm Caenorhabditis elegans. Both of these homologs, LAG1Hs and LAG1Ce-1, functionally complemented the lethality of a lag1delta lac1delta double deletion, despite low overall sequence similarity to the yeast proteins. The proteins shared a short sequence, the Lag1 motif, and a similar transmembrane domain profile. Another, more distant human homolog, TRAM, which lacks this motif, did not complement. LAG1Hs also restored the life span of the double deletion, demonstrating that it functions in establishing the longevity phenotype in yeast. LAG1Hs mapped to 19p12, and it was expressed in only three tissues: brain, skeletal ...
To survive, animals must properly sense their surrounding environment. The types of sensation that allow for detecting these changes can be categorized as tactile, thermal, aural, or olfactory. Olfaction is one of the most primitive senses, involving the detection of environmental chemical cues. Organisms must sense and discriminate between abiotic and biogenic cues, necessitating a system that can react and respond to changes quickly. The nematode, Caenorhabditis elegans, offers a unique set of tools for studying the biology of olfactory sensation.The olfactory system in C. elegans is comprised of 14 pairs of amphid neurons in the head and two pairs of phasmid neurons in the tail. The male nervous system contains an additional 89 neurons, many of which are exposed to the environment and contribute to olfaction. The cues sensed by these olfactory neurons initiate a multitude of responses, ranging from developmental changes to behavioral responses. Environmental cues might initiate entry into or exit
Abstract. Studies of the molecular mechanisms that are involved in stress responses (environmental or physiological) have long been used to make links to disease states in humans. The nematode model organism, Caenorhabditis elegans, undergoes a state of hypometabolism called the dauer stage. This period of developmental arrest is characterized by a significant reduction in metabolic rate, triggered by ambient temperature increase and restricted oxygen/ nutrients. C. elegans employs a number of signal transduction cascades in order to adapt to these unfavourable conditions and survive for long times with severely reduced energy production. The suppression of cellular metabolism, providing energetic homeostasis, is critical to the survival of nematodes through the dauer period. This transition displays molecular mechanisms that are fundamental to control of hypometabolism across the animal kingdom. In general, mammalian systems are highly inelastic to environmental stresses (such as extreme ...
TY - JOUR. T1 - The novel C. elegans gene sop-3 modulates Wnt signaling to regulate Hox gene expression. AU - Zhang, H.. AU - Emmons, S. W.. PY - 2001/4/2. Y1 - 2001/4/2. N2 - We describe the properties of a new gene, sop-3, that is required for the regulated expression of a C. elegans Hox gene, egl-5, in a postembryonic neuroectodermal cell lineage. Regulated expression of egl-5 in this cell lineage is necessary for development of the sensory rays of the male tail. sop-3 encodes a predicted novel protein of 1475 amino acids without clear homologs in other organisms. However, the sequence contains motifs consisting of homopolymeric runs of amino acids found in several other transcriptional regulators, some of which also act in Hox gene regulatory pathways. The genetic properties of sop-3 are very similar to those of sop-1, which encodes a component of the transcriptional Mediator complex, and mutations in the two genes are synthetic lethal. This suggests that SOP-3 may act at the level of the ...
Caenorhabditis elegans offers an array of advantages to investigate the roles of uptake transporters. Herein, an epifluorescent microscopy approach was developed to monitor the uptake of the autofluorescent anticancer drug, doxorubicin, into the pharynx of C. elegans by organic cation transporters.
gi,17559712,ref,NP_506256.1, CaDHerin family member (cdh-6) [Caenorhabditis elegans] gi,7499172,pir,,T20968 hypothetical protein F15B9.7 - Caenorhabditis elegans gi,3875964,emb,CAB01427.1, Hypothetical protein F15B9.7 [Caenorhabditis elegans] gi,3880568,emb,CAB01449.1, C. elegans CDH-6 protein (corresponding sequence F15B9.7) [Caenorhabditis elegans ...
For the first days, we will introduce students to the nematode C. elegans. Students will work with different experimental set-ups that will allow us to explore a variety of C. elegans behavior. We will analyze C. elegans behavior in response to thermal, mechanical and chemical stimuli. The transparency of the animal makes it feasible to use genetically encoded calcium sensors to monitor neural activity in response to sensory stimuli. Transgenic expression of light-activated ion channels, allows us to turn neurons on and off. These optogenetic experiments will be used to define neural requirements of sensory processing. Students will use these techniques to determine 1) how C. elegans responds and remembers the temperature at which was raised; 2) analyze the neural dynamics of a compound motor sequence that is evoked by touch; 3) determine the neural requirements of calcium channels chemosensation. These experiments are an ideal introduction to Calcium imaging optogenetics in a genetically ...
Pun, P.B.L., Gruber, J., Tang, S.Y., Ng, L.F., Cheah, I., Halliwell, B., Ong, R.L.S., Fong, S. (2010). Ageing in nematodes: Do antioxidants extend lifespan in Caenorhabditis elegans?. Biogerontology 11 (1) : 17-30. [email protected] Repository. https://doi.org/10.1007/s10522-009-9223- ...
Bacaj, T., M. Tevlin, Y. Lu, and S. Shaham. 2008. Glia are essential for sensory organ function in C. elegans. Science. 322(5902):744-747.. Heiman, M. G., and S. Shaham. 2007. Ancestral roles of glia suggested by the nervous system of Caenorhabditis elegans. Neuron Glia Biology. 3(1):55-61. (Request copy of article from the Markus Library). Shaham, S. 2006. Glia-neuron interactions in the nervous system of Caenorhabditis elegans. Current Opinion in Neurobiology. 16(5): 522-528.. Shaham, S. 2005. Glia-neuron interactions in nervous system function and development. Current Topics in Developmental Biology. 69:39-66.. Wang, Y., A. Apicella Jr., S. -K Lee, M. Ezcurra, R. D. Slone, M. Goldmit, W. R. Schafer, S. Shaham, M. Driscoll, and L. Bianchi. 2008. A glial DEG/ENaC channel functions with neuronal channel DEG-1 to mediate specific sensory functions in C. elegans. EMBO Journal. 27(18):2388-2399.. Wang, Y., A. Apicella Jr., S. -K Lee, M. Ezcurra, R. D. Slone, M. Goldmit, W. R. Schafer, S. Shaham, M. ...
Comments on Hoppe PE et al. (2000) Genetics "A region of the myosin rod important for interaction with paramyosin in Caenorhabditis elegans striated muscle." ...
RNA-mediated interference (RNAi) has emerged recently as one of the most powerful functional genomics tools. RNAi has been particularly effective in the nematode worm C. elegans where RNAi has been used to analyse the loss-of-function phenotypes of almost all predicted genes. In this review, we illustrate how RNAi has been used to analyse gene function in C. elegans as well as pointing to some future directions for using RNAi to examine genetic interactions in a systematic manner.. ...
TY - JOUR. T1 - Global regulation of Hox gene expression in C. elegans by a SAM domain protein. AU - Zhang, Hong. AU - Azevedo, Ricardo B R. AU - Lints, Robyn. AU - Doyle, Christina. AU - Teng, Yingqi. AU - Haber, Daniel. AU - Emmons, Scott W.. PY - 2003/6/1. Y1 - 2003/6/1. N2 - Polycomb group (PcG)-mediated repression of C. elegans Hox genes has not been demonstrated, and genes homologous to components of one of the PcG complexes (PRC1) have not been identified in the C. elegans genome. We find that a mechanism of general Hox gene repression exists in C. elegans, carried out in part by SOP-2, a protein related to, but not orthologous with, any PcG protein. sop-2 mutations lead to widespread ectopic expression of Hox genes and homeotic transformations. SOP-2 contains a SAM domain, a self-associating protein domain found in other repressors, including a core component of PRC1 and ETS transcription factors. Phylogenetic analysis indicates that this domain is more closely related to those of the ...
To generate pmec-17LMP-1∷GFP, we fused GFP at the COOH terminus of the C. elegans LMP-1 protein. The translational fusion includes the entire LMP-1 coding sequence lacking the stop codon, a Gly-Ser-Ser-Pro-Gly-Leu-Ala-Lys-Gly-Pro-Lys-Gly linker, and GFP. The resulting chimera was expressed in touch receptor neurons under the control of the mec-17 promoter. The plasmid carrying the reporter fusion was constructed in two steps. First, the mec-17 promoter was amplified from N2 genomic DNA with the primers 5′ CGGGATCCGAATCGTCTCACAACTGATCC 3′ and 5′ AACTGCAGGTGACTACTTGAGACCTG 3′. A 1,900-bp PstI-BamHI fragment was cloned into the promoterless gfp vector pPD95.77 (Fire et al., 1990). Second, the LMP-1 coding region was amplified from genomic DNA using the primers 5′ CGGGATCCGACGCTGGCATATCCTTGTCTC 3′ and 5′ CGGGATCCAATTGAACTATGTTGAAATCG 3′. A BamHI PCR fragment was cloned downstream of the mec-17 promoter on the pPD95.77 plasmid vector. For RNAi experiments, we used HT115(DE3) ...
It is significant that the majority of the processes involved in the integration of the CS and US in associative learning and in nonassociative memory formation ostensibly occurs within the AWC sensory neuron itself. Indeed, all the genes discussed in our model are known to be expressed in and required within or act on, in the case of ins-1, the AWC to mediate olfactory adaptation (Colbert et al., 1997; LEtoile et al., 2002; Palmitessa et al., 2005; Chalasani et al., 2010; Lin et al., 2010), lending support to the remarkable notion that the majority of processing occurs within the primary olfactory neuron. Indeed, this appears to be a common theme in a number of paradigms in C. elegans. For example, work by the Iino group has suggested that salt starvation associative learning requires insulin signaling within the salt-sensing ASE sensory neuron (Tomioka et al., 2006). Furthermore, food starvation associative learning leads to a modulation of the temperature at which the temperature-sensing AFD ...
In the nematode Caenorhabditis elegans, inactivating mutations in the insulin/IGF-1 receptor, DAF-2, result in a 2-fold increase in lifespan mediated by DAF-16, a FOXO-family transcription factor. Downstream protein activities that directly regulate longevity during impaired insulin/IGF-1 signaling (IIS) are poorly characterized. Here, we use global cysteine-reactivity profiling to identify protein activity changes during impaired IIS. Upon confirming that cysteine reactivity is a good predictor of functionality in C. elegans, we profiled cysteine-reactivity changes between daf-2 and daf-16;daf-2 mutants, and identified 40 proteins that display a | 2-fold change. Subsequent RNAi-mediated knockdown studies revealed that lbp-3 and K02D7.1 knockdown caused significant increases in lifespan and dauer formation. The proteins encoded by these two genes, LBP-3 and K02D7.1, are implicated in intracellular fatty acid transport and purine metabolism, respectively. These studies demonstrate that cysteine
The nematode Caenorhabditis elegans may hold the key to brain-like computational architectures: Si elegans will provide the scientific community with a reconfigurable, scalable and modular neuromimetic open-access computational platform to explore neural principles that give rise to complex behaviour and to derive a neuro-inspired technological blueprint for a new era of brain-like computational architectures.The Si elegans project started on April 1st 2013. ...
The purpose of the dataset C. elegans muscle aging is to deduce the age of the nemathode based on images of muscles. Images of C. elegans were taken ...
The purpose of the dataset C. elegans muscle aging is to deduce the age of the nemathode based on images of muscles. Images of C. elegans were taken ...
Much of the material taken into cells by endocytosis is rapidly returned to the plasma membrane by the endocytic recycling pathway. Although recycling is vital for the correct localization of cell membrane receptors and lipids, the molecular mechanisms that regulate recycling are only partially understood. Here we show that in C. elegans, endocytic recycling is inhibited by NUM-1A, the nematode Numb homologue. NUM-1A::GFP fusion protein is localized to the baso-lateral surfaces of many polarized epithelial cells including the hypodermis and the intestine. We show that increased NUM-1A levels cause morphological defects in these cells similar to those caused by loss-of-function mutations in rme-1, a positive regulator of recycling both in C. elegans and mammals. We describe the isolation of worms lacking num-1A activity and show that, consistent with a model in which NUM-1A negatively regulates recycling in the intestine, loss of num-1A function bypasses the requirement for RME-1. Genetic ...
1PEV: Identification of functional residues on Caenorhabditis elegans actin-interacting protein 1 (UNC-78) for disassembly of actin depolymerizing factor/cofilin-bound actin filaments.
C. elegans worms. Light microscopy of Caenorhabditis elegans worms. This is a soil-dwelling hermaphrodite nematode worm and one of the most studied animals in biological and genetic research. A tendency to reproduce by self-fertilisation (resulting in identical offspring), along with the short time taken to reach maturity, make this tiny worm an ideal subject. - Stock Video Clip K002/8244
Genetic and epidemiological studies have found that variations in the amyloid precursor protein (APP) and the apoliopoprotein E (APOE) genes represent major modifiers of the progressive neurodegeneration in Alzheimers disease (AD). An extra copy of or gain-of-function mutations in APP correlate with early onset AD. Compared to the other variants (APOE2 and APOE3), the ε4 allele of APOE (APOE4) hastens and exacerbates early and late onset forms of AD. Convenient in vivo models to study how APP and APOE4 interact at the cellular and molecular level to influence neurodegeneration are lacking. Here, we show that the nematode C. elegans can model important aspects of AD including age-related, patterned neurodegeneration that is exacerbated by APOE4. Specifically, we found that APOE4, but not APOE3, acts with APP to hasten and expand the pattern of cholinergic neurodegeneration caused by APP. Molecular mechanisms underlying how APP and APOE4 synergize to kill some neurons while leaving others ...
The FOXO transcription factor DAF-16 is required for the metabolic, developmental, and longevity phenotypes produced by reductions in daf-2 insulin/IGF-1-like receptor or germline stem cell signaling (Hsin and Kenyon, 1999; Kenyon et al., 1993; Riddle et al., 1981). The homology between DAF-16 and human FOXO transcription factors make C. elegans an important model for the study of their regulation by signaling pathways or interacting proteins (Lin et al., 1997; Ogg et al., 1997). The daf-16(mgDf50) allele is a commonly used daf-16 null allele due to the presence of a large deletion within the gene (Ogg et al., 1997). While the deleted region is thought to span the entire daf-16 coding region, the precise endpoints are still unknown. Thus, the only way to confirm the presence of the mgDf50 allele following genetic crosses is to identify the homozygous mutant through either the presence of daf-16 phenotypes (such as the loss of constitutive dauer arrest in daf-2 mutants) or the lack of PCR ...
Aging in C. elegans involves measurable declines in morphology, reproduction, and behavior. Understanding the cellular and molecular processes leading to senescence in this nematode began in the early 1980s with the targeted identification of mutants that extended life span (an AGE phenotype). These studies identified at least two key regulators of life span, DAF-2, an insulin/IGF receptor ortholog, and DAF-16, a Forkhead-related transcription factor. Since then many more genes and pathways involved in senescence have been identified. Almost all of these genes play important roles in cellular and organismal-level processes other than aging, such as dauer formation, stress response, feeding, and chemosensation ...
Mutations in clk-1 slow down development and extend lifespan by 30% [946]. Food restriction by eat-2 mutation does not further extend the long lifespan of clk-1 mutant [1820]. DR and clk-1 mutations may extend lifespan by a similar process. DR by intermittent fasting significantly extends lifespan of clk-1 mutants, but to a lesser extent than that of wild-type [2566]. clk-1 mutants do not respond to solid DR-induced lifespan extension [2568]. clk-1 mutants have a decreased pharyngeal pumping that may provoke voluntary DR [1820]. ...
A one-millimeter worm, the nematode Caenorhabditis elegans, is an animal model widely used in biomedical research by hundreds of laboratories around the world. Surprisingly, it has approximately the same number of genes that humans have, about 20,000. In addition, most human disease-causing genes have their counterparts, or orthologs, in C. elegans worms.. Thus, for example, the human SF3B1 gene, which is mutated in different types of cancers, mainly in leukemia but also in some breast or prostate tumors, is very similar to the sftb-1 gene of C. elegans worms. In fact, 89 percent of the amino acid sequence of the human SF3B1 protein in its most cancer-affected region are identical. Some of these amino acids are conserved from worms to humans, including those that are mutated in some tumors.. A group of researchers led by Dr. Julián Cerón of the Bellvitge Biomedical Research Institute (IDIBELL), has taken advantage of the similarity between these amino acids and their experience in CRISPR gene ...
gi,17508791,ref,NP_492239.1, C-x8-C-x5-C-x3-H type zinc finger containing protein (76.1 kD) (1I793) [Caenorhabditis elegans] gi,7506947,pir,,T24365 hypothetical protein T02E1.3b - Caenorhabditis elegans gi,3879305,emb,CAB04666.1, Hypothetical protein T02E1.3b [Caenorhabditis elegans ...
Src homology 3 (SH3) domains bind peptides to mediate protein-protein interactions that assemble and regulate dynamic biological processes. We surveyed the repertoire of SH3 binding specificity using peptide phage display in a metazoan, the worm Caenorhabditis elegans, and discovered that it structurally mirrors that of the budding yeast Saccharomyces cerevisiae.We then mapped the worm SH3 interactome using stringent yeast two-hybrid and compared it with the equivalent map for yeast.We found that the wormSH3 interactome resembles the analogous yeast network because it is significantly enriched for proteins with roles in endocytosis. Nevertheless, orthologous SH3 domain mediated interactions are highly rewired. Our results suggest a model of network evolution where general function of the SH3 domain network is conserved over its specific form.
Fig. 27 - Longitudinal section taken near the midline showing a sagittal view of the ventral muscle plate (region enclosed by arrows, MP). The most obvious deviation from a purely commisural nature of the ring occurs in its participation in the integration of sensory input and cephalic muscle motor output. Primary input is effected by synapses formed by the posterior processes of the bipolar papillary neurons whose cell hody locations have been described. The entry of these fibers into the ring is shown in the three parts of figure 28. In figure 28A the subdorsal papillary fibers are grouped as a bundle outside of the circumferential fibers of the nerve ring, but nonetheless within the thin glial sheath formed by the four LSM pocket cell bodies. In figure 28B at the posterior edge of the ring they are seen to turn from a longitudinal to a radial dIrection and plunge into the center of the circumferential fibers. At the level of figure 28C, taken anterior to figure 28A, all fibers except for ...
PubMed comprises more than 30 million citations for biomedical literature from MEDLINE, life science journals, and online books. Citations may include links to full-text content from PubMed Central and publisher web sites.
The C. elegans grinder is an intricately designed, macromolecular structure located in the terminal bulb of the pharynx. It acts as the teeth of C. elegans, crushing bacteria before they are passed to the intestine. The ...
With the aid of a pair of sensory neurons, the nematode worm C. elegans is able to detect the Earths magnetic field and use it to navigate towards food sources.
With the aid of a pair of sensory neurons, the nematode worm C. elegans is able to detect the Earths magnetic field and use it to navigate towards food sources.
Critical role in assembling adherens junctions; adapter protein involved in polarizing protein trafficking in epithelial cells. Necessary to maintain, not establish, the entire terminal web (organelle-depleted, intermediate filament-rich layer of cytoplasm that underlies the apical microvilli of polarized epithelial cells) or brush border assembly at the apical surface gut cells. Required for correct localization of ifb-2 intermediate filaments in the terminal web.
Description. C. elegans, one of the most attractive and popular genetic model organisms, is used to address questions and advance our understanding of several complex biological processes. The course will provide a general practical introduction to using C. elegans in research. It will cover the pros and cons of using C. elegans compared to other model organisms. The course participants will have hands on experience with popular techniques such as RNAi, genetic crosses, transgenic and GFP reporter strains. Thus, during the course the participants will not only be familiarized with using C. elegans as model organism but also be able to interact and network with experts in the field. The practical part of this course is complemented by lectures given by several internationally renowned C. elegans researchers.. The experiments will include the studies of the life cycle and early development of wild type worms and the phenotypic analysis of mutants.. It will cover:. Maintenance, decontamination and ...
A mutation in the let-653 gene of Caenorhabditis elegansresults in larval death. The lethal arrest is concurrent with the appearance of a vacuole anterior to the lower pharyngeal bulb. The position...
Acts downstream of PI3 kinase age-1 and kinase pdk-1 in the daf-2/insulin receptor-like transduction pathway (PubMed:15068796). Essential role in regulating development, stress response, and longevity (PubMed:15068796, PubMed:18782349). Phosphorylates Forkhead-related daf-16 and the longevity-promoting skn-1 transcription factors, which inhibits their entry into the nucleus and antagonizes their function (PubMed:18358814). Acts downstream of rict-1 to regulate fat storage, size, and development (PubMed:19240135, PubMed:19260765). Downstream of age-1 and together with akt-1/2, promotes cell survival during embryonic development (PubMed:25383666). Does not appear to play a role in immune function (PubMed:18782349).
During the development of the nematode Caenorhabditis elegans cell death occurs in a highly reproducible manner, and this is one of the reasons why the worm
Please note: Your browser does not support the features used on Addgenes website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more ...
Parkinsons disease (PD) is a neurodegenerative disorder with symptoms that progressively worsen with age. Pathologically, PD is characterized by the aggregation of α-synuclein in cells of the substantia nigra in the brain and loss of dopaminergic neurons. This pathology is associated with impaired movement and reduced cognitive function. The etiology of PD can be attributed to a combination of environmental and genetic factors. A popular animal model, the nematode roundworm Caenorhabditis elegans, has been frequently used to study the role of genetic and environmental factors in the molecular pathology and behavioral phenotypes associated with PD. The current review summarizes cellular markers and behavioral phenotypes in transgenic and toxin-induced PD models of C. elegans.
El nemátodo Caernorhabditis elegans ofrece la posibilidad de estudiar el desarrollo embrionario con una resolución celular. En esta tesis, describo el uso de un algoritmo semi-automático de seguimiento nuclear para analizar movimientos celulares en el embrión temprano, así como la manera en que el embrión responde a deformaciones mecánicas y a perturbaciones genéticas. Durante el proceso de gastrulación, observamos que ciertas células no solo ingresan al interior del embrión, pero también egresan hasta la superficie. Asimismo, identificamos linajes celulares que llevan a cabo ambos tipos de movimientos direccionales, esto es, primero internalizan y luego la continuan su movimiento hasta finalmente re-emerger en la superficie, "transgressing" o "tunneling" a través del embrión. Hemos descubierto que los movimientos estereotípicos de rotación en el embrión temprano, descritos previamente, son altamente variables en ausencia de compresión y esta variabilidad total en la rotación ...
I am staining some protein molecules in C. elegans body wall muscle. I aslo want to check the GFP after immunostaining.( It is a GFP fusion protein rescue line. ) Unfortunately the GFP is bleached. I have tried to incubate the 1st Antibody 1 hour, 2hours or overnight. It doesnt help a lot if I shorten the incubation time, actually it makes the staining worse. I fix the embryo in 4%PFA. I am thinking to do GFP and my protein of insterest double staining if I cant solve the GFP bleaching problem. It is important for me to check my GFP fusion protein and other protein molecules co-localization ...
To study the relationship between protein homeostasis, stress and aging, we monitored changes in protein folding by following protein...
The goal of this research is to develop methods for the precise modification of specific target genes in two important genetic model organisms, the nematode Caenorhabditis elegans and the zebrafish Danio rerio. Both nematodes and fish are powerful experimental systems that combine elegant developmental biology with large scale genetics. Both systems have contributed to our understanding of fundamental problems in cancer biology, including programmed cell death, the control of organogenesis, the interaction of cancer susceptibility genes with the environment, and the genetics of melanoma. An important limitation of these model systems is that techniques for site-specific manipulation of the genome are not currently available in either nematodes or fish. Thus, in contrast to murine embryonic stem cells and the yeast S. cerevisiae, it is not possible to knock out specific genes or to precisely control the time and place of gene expression. In the last two years, a powerful new approach to ...
PubMed comprises more than 30 million citations for biomedical literature from MEDLINE, life science journals, and online books. Citations may include links to full-text content from PubMed Central and publisher web sites.
Molecular and Cellular Biology Zhong, Mei; Niu, Wei; Lu, Zhi John; Sarov, Mihail; Janette, Judith; Raha, Debasish; Sheaffer, Karyn L.; Lam, Hugo Y. K.; Preston, Elicia; Slightham, Cindie; Hillier, LaDeana W.; Agarwal, Ashish; Auerbach, Raymond; Hyman, Anthony A.; Gerstein, Mark; Kim, Stuart K.; Waterston, Robert H.; Reinke, Valerie; Snyder, Michael; Murray, John I.; Mango, Susan; Brock, Trisha Jane
Next-day shipping cDNA ORF clones derived from nck-1 NCK (Non-Catalytic region of tyrosine Kinase) adaptor protein family available at GenScript, starting from $99.00.
Protein homology searches were performed using individual members of the NR family compared against the human genome database (HTG section from GenBank) using TBLASTN [8]. Results of all sequence hits were stored in an in-house Oracle database. Homologous sequences (those with a BLAST expectation value of 0.1 or lower) were then compared with the entire query NR data set using BLASTN [8]. By choosing the criteria on the basis of automated assessment for 95% sequence identity over 200 base pairs (bp) at the nucleotide level, we could map these hits to individual members of the protein family (bins). Those sequence hits that could not automatically be placed in bins on the basis of the selected criteria were either mapped to other protein families (if their sequences matched a known gene in GenBank), considered as potentially novel NR sequences (when key domains were present) or deemed irrelevant (no match to anything). We then applied Hidden Markov Models (HMMs) built on the DBD and LBD domains ...
Forward genetic analysis using chemical mutagenesis in model organisms is a powerful tool for investigation of molecular mechanisms in biological systems
Soil nematode about 1mm long that lives in temperate regions. Doesnt really have a common name... except maybe tiny worm or something generic like th...
Please note: Your browser does not support the features used on Addgenes website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more ...
The SWISS-MODEL Repository is a database of annotated 3D protein structure models generated by the SWISS-MODEL homology-modelling pipeline
Automated behavioural fingerprinting of C. elegans mutants: Rapid advances in genetics, genomics, and imaging have given insight into the molecular and cellular
Sreekanth Chalasani uses an organism with a much simpler nervous system than humans to answer questions about neuroscience: the roundworm Caenorhabditis elegans. This animal has only 302 neurons and a few thousand connections between these cells. Each neuron is mapped and named, making it easier to study the effect of environment or gene changes at the resolution of individual cells. But despite its simplicity, the C. elegans nervous system has commonalities with a human brain: if you give a worm a dose of the antidepressant Prozac, for example, it becomes less fearful of predators; and if you mutate a gene linked to autism in humans, the worm shows less interest in other worms.. Among other studies, Chalasanis lab is asking how the roundworm nervous system, one of the simplest in nature, gives rise to such behaviors as fear and aggression. He is exploring what these tiny creatures can tell us about human aggressions and fears, emotions and behaviors often necessary for our survival, but which ...
Caenorhabditis Elegans has been a popular model organism for biological research for over thirty years and has been used to investigate many aspects of animal development, for example apoptosis, the Hox genes, signal transduction pathways, and the development of the nervous system. It has recently taken on new importance with the publication of the entire genome sequence in 1998. The first chapter gives all the basic information on C.
Department of Biology. Cover Photo: Green fluorescent protein (GFP) has revolutionized molecular biology by allowing scientists to label individual proteins in a cell or, as in this photo, entire organisms. Here, the nematode Caenorhabditis elegans, a common model organism in the study of developmental biology and genetics, is labeled with GFP to provide a clear view of its body plan. The photograph was taken in the Fall 2014 semester in Gilmer Hall at Hampden-Sydney. Note the unborn C. elegans that can be seen developing inside the adult nematodes. (From Grayland W. Godfrey 15). ...
2016. Research Papers. Gendrel M, Atlas EG, Hobert O. (2016) "A cellular and regulatory map of the GABAergic nervous system of C. elegans." eLife. 2016 Oct.. Oren-Suissa M, Bayer EA, Hobert O. (2016) "Sexually dimorphic synaptic connectivity established by sex-specific synapse pruning in C. elegans." Nature. 2016 May.. Reviews & Commentaries. Hobert O, Glenwinkel L, White J. (2016) "Revisiting Neuronal Cell Type Classification in Caenorhabditis elegans." Curr. Biol. 2016 Nov.. Hobert O. (2016) "A map of terminal regulators of neuronal identity in C.elegans." WIREs Dev. Biol. 2016 May.. Hobert O. (2016) "Terminal selectors of neuronal identity." Curr. Top. Dev. Biol. 2016 Jan.. Howell K and Hobert O. (2016) "Small Immunoglobulin domain proteins at synapses and the maintenance of neuronal features." Neuron. 2016 Jan.. 2015. Research Papers. Pereira L, Kratsios P, Serrano-Saiz E, Sheftel H, Mayo A, Hall DH, White JG, LeBoeuf B, Garcia LR, Alon U, Hobert O. (2015) "A cellular and regulatory map of ...
ODR-8, the C. elegans ortholog of Ufm1 specific protease 2, promotes ER maturation of G-protein coupled receptors by a non-catalytic, Ufm1-independent mechanism ...
Genetic analysis in C. elegans has led to the identification of splicing regulatory pathways. MEC-8 is a two RNA recognition motif (RRM)-containing, nuclear protein. Mutations in mec-8 lead to mechanosensory and other defects. Mutations in mec-8 are synthetically lethal with viable mutations in the unc-52 gene (Lundquist et al., 1996). UNC-52 is a homolog of the mammaliam perlecan protein, an extracellular matrix molecule important in muscle anchorage (Rogalski et al., 1993). These viable unc-52 mutations occur in the alternatively spliced exons 17 and 18 (Figure 4b). Every possible combination of inclusion or skipping of exons 16, 17 and 18 has been detected (Rogalski et al., 1995). Skipping of exons 17 and 18 is dependent on the function of mec-8 (Lundquist et al., 1996). MEC-8 protein is found in all nuclei in embryos, but only in a subset of mechanosensory neurons and hypodermal cells in adults (Spike et al., 2002). unc-52 mutant alleles with stop codons in exons 17 and 18 develop a ...
Caenorhabditis elegans germ-line proliferation is controlled by an inductive interaction between the somatic distal tip cell and the germ line. GLP-1, a member of the Notch family of transmembrane receptors, is required continuously in the germ line to transduce the proliferative signal. In the absence of GLP-1, all proliferative germ cells exit the mitotic cell cycle and enter meiotic prophase. We have characterized an activating mutation in glp-1, oz112gf, that has the opposite phenotype. Homozygous glp-1(oz112gf) hermaphrodites and males have a completely tumorous germ line in which germ cells never leave the mitotic cycle. In glp-1(oz112gf) heterozygotes, germ-line polarity is established correctly, but as adults age, the distal proliferative population expands leading to a late-onset tumorous phenotype. The mutant receptor is constitutively active, promoting proliferation in the absence of ligand. The normal distal-proximal spatial restriction of GLP-1 expression is lost in tumorous and ...
Purpose: this database is used to evaluate the image segmentation algorithms for Caenorhabditis elegans (C-elegans) UNC-59 and UNC-61, the nematode worms used in biology for investigation of neural system functions ...
The let-7 miRNA was originally discovered in the nematode Caenorhabditis elegans, where it regulates cell proliferation and differentiation, but subsequent work has shown that both its sequence and its function are highly conserved in mammals ...
The main focus of our research is the study of neuronal function and dysfunction, using the nematode Caenorhabditis elegans as a model organism. Among...