1. Baldwin, J.G., Nadler, S.A., and Wall, D.H. 1997. Nematodes: Pervading the Earth and Linking all Life. Pp. 176-191. In: Raven, P.H. (ed.). National Academy Press, Washington, D.C. 625 pp.. 2. Bargmann, C. I. 1998. Neurobiology of the Caenorhabditis elegans genome. Science 282:2028-2033.. 3. Bargmann, C. I. And Mori, I. 1997. Chemotaxis and Thermotaxis. Pp. 717-737. In: Riddle, D.L., Blumenthal, T., Meyer, B.J. and Priess, J.R. (eds). C. elegans II. Cold Spring Harbor Laboratory Press, Plainview, NY 1222 pp.. 4. Bird, D.M. and Opperman, C. H. 1998. Caenorhabditis elegans. J. Nematol. 30:299-308.. 5. Bird, D.M., Opperman, C.H., Jones S.J.M., and Baillie, D.L. 1999. The Caenorhabditis elegans gemome: a guide in the post genomics age. Annu. Rev. Phytopathol. 37:247-265.. 6. Blaxter, M. 1998. Caenorhabditis elegans is a nematode. Science 282:2041-2046.. 7. Blaxter, M. and Bird, D. 1997. Parasitic nematodes. Pp. 851-878. In: Riddle, D.L., Blumenthal, T., Meyer, B.J. and Priess, J.R. (eds). C. ...
WormBase is an online biological database about the biology and genome of the nematode model organism Caenorhabditis elegans and contains information about other related nematodes. WormBase is used by the C. elegans research community both as an information resource and as a place to publish and distribute their results. The database is regularly updated with new versions being released every two months. WormBase is one of the organizations participating in the Generic Model Organism Database (GMOD) project. WormBase comprises the following main data sets: The annotated genomes of Caenorhabditis elegans, Caenorhabditis briggsae, Caenorhabditis remanei, Caenorhabditis brenneri, Caenorhabditis angaria, Pristionchus pacificus, Haemonchus contortus, Meloidogyne hapla, Meloidogyne incognita, Brugia malayi and Onchocerca volvulus; Hand-curated annotations describing the function of ~20,500 C. elegans protein-coding genes and ~16,000 C. elegans non-coding genes; Gene families; Orthologies; Genomic ...
The molecular mechanisms underlying muscle atrophy during spaceflight are not well understood. We have analyzed the effects of a 10-day spaceflight on Caenorhabditis elegans muscle development. DNA microarray, real-time quantitative PCR, and quantitative western blot analyses revealed that the amount of MHC in both body-wall and pharyngeal muscle decrease in response to spaceflight. Decreased transcription of the body-wall myogenic transcription factor HLH-1 (CeMyoD) and of the three pharyngeal myogenic transcription factors, PEB-1, CEH-22 and PHA-4 were also observed. Upon return to Earth animals displayed reduced rates of movement, indicating a functional defect. These results demonstrate that C. elegans muscle development is altered in response to spaceflight. This altered development occurs at the level of gene transcription and was observed in the presence of innervation, not simply in isolated cells. This important finding coupled with past observations of decreased levels of the same ...
The nematode worm Caenorhabditis elegans is a model system for the study of the genetic basis of aging. Maternal-effect mutations in four genes-clk-1, clk-2, clk-3, and gro-1- interact genetically to determine both the duration of development and life-span. Analysis of the phenotypes of these mutants suggests the existence of a general physiological clock in the worm. Mutations in certain genes involved in dauer formation (an alternative larval stage induced by adverse conditions in which development is arrested) can also extend life-span, but the life extension of Clock mutants appears to be independent of these genes. The daf-2(e1370) clk-1(e2519) worms, which carry life-span-extending mutations from two different pathways, live nearly five times as long as wild-type worms.. ...
The germ cells of multicellular organisms protect their developmental potential through specialized mechanisms. A shared feature of germ cells from worms to humans is the presence of nonmembrane-bound, ribonucleoprotein organelles called germ granules. Depletion of germ granules in Caenorhabditis elegans (i.e., P granules) leads to sterility and, in some germlines, expression of the neuronal transgene unc-119::gfp and the muscle myosin MYO-3. Thus, P granules are hypothesized to maintain germ cell totipotency by preventing somatic development, although the mechanism by which P granules carry out this function is unknown. In this study, we performed transcriptome and single molecule RNA-FISH analyses of dissected P granule-depleted gonads at different developmental stages. Our results demonstrate that P granules are necessary for adult germ cells to downregulate spermatogenesis RNAs and to prevent the accumulation of numerous soma-specific RNAs. P granule-depleted gonads that express the ...
TY - JOUR. T1 - The Caenorhabditis elegans AMP-activated protein kinase AAK-2 is phosphorylated by LKB1 and is required for resistance to oxidative stress and for normal motility and foraging behavior. AU - Lee, Hyojin. AU - Jeong, Soo Cho. AU - Lambacher, Nils. AU - Lee, Jieun. AU - Lee, Se Jin. AU - Tae, Hoon Lee. AU - Gartner, Anton. AU - Koo, Hyeon Sook. PY - 2008/5/30. Y1 - 2008/5/30. N2 - AAK-2 is one of two α isoforms of the AMP-activated protein kinase in Caenorhabditis elegans and is involved in life span maintenance, stress responses, and germ cell cycle arrest upon dauer entry. We found that AAK-2 was phosphorylated at threonine 243 in response to paraquat treatment and that this phosphorylation depends on PAR-4, the C. elegans LKB1 homologue. Both aak-2 mutation and par-4 knockdown increased the sensitivity of C. elegans worms to paraquat, and the double deficiency did not further increase sensitivity, indicating that aak-2 and par-4 act in a linear pathway. Both mutations also ...
Brenner, S. (1974). The genetics of Caenorhabditis elegans. Genetics 77, 71-94.. Chitwood, B. G., and Chitwood, M. B. (1974). Introduction to Nematology. University Park Press, Baltimore.. Hodgkin, J. A. (1974). Genetic and Anatomical Aspects of the Caenorhabditis elegans Male, Ph.D. thesis. University of Cambridge, Cambridge, England.. Hodgkin, J. A., and Brenner, S. (1977). Mutations causing transformation of sexual phenotype in the nematode Caenorhabditis elegans. Genetics 86, 275-287.. Kimble, J., and Hirsh, D. (1979). The Postembryonic cell lineages of the hermaphrodite and male gonads in Caenorhabditis elegans. Develop. Biol. 70, 396-417.. Klass, M., Wolf, N., and Hirsh, D. (1976). Development of the male reproductive system and sexual transformation in the nematode Caenorhabditis elegans. Develop. Biol. 52, 1-18.. Seligman, I. M., Filshie, B. K., Doy, F. A., and Crossley, A. C. (1975). Hormonal control of mor-phogenetic cell death of the wing hypodermis in Lucilia cuprina. Tissue Cell ...
Defining a behavior that requires the function of specific neurons in the free-living nematode Caenorhabditis elegans can allow one to screen for mutations that disrupt the specification or function of those neurons. We identified serotonin-immunoreactive neurons required for tail curling or turnin …
Mouse mAb M38 was used in indirect immunofluorescence experiments to detect a stage-specific antigen on the surface of the first larval stage (L1) of the free-living nematode Caenorhabditis elegans, and to detect alterations in the apparent expression of this antigen in two distinct classes of C. elegans mutants. In previously described srf-2 and srf-3 mutants (Politz S. M., M. T. Philipp, M. Estevez, P.J. OBrien, and K. J. Chin. 1990. Proc. Natl. Acad. Sci. USA. 87:2901-2905), the antigen is not detected on the surface of any stage. Conversely, in srf-(yj43) and other similar mutants, the antigen is expressed on the surface of the first through the fourth (L4) larval stages. To understand the molecular basis of these alterations, the antigen was characterized in gel immunoblotting experiments. After SDS-PAGE separation and transfer to nitrocellulose, M38 detected a protein antigen in extracts of wild-type L1 populations. The antigen was sensitive to digestion by Pronase and O-glycanase ...
P-glycoproteins can cause multidrug resistance in mammalian tumor cells by active extrusion of cytotoxic drugs. The natural function of these evolutionarily conserved, membrane-bound ATP binding transport proteins is unknown. In mammals, P-glycoproteins are abundantly present in organs associated with the digestive tract. We have studied the tissue-specific expression of Caenorhabditis elegans P-glycoprotein genes pgp-1 and pgp-3 by transformation of nematodes with pgp-lacZ gene fusion constructs in which the promoter area of the pgp genes was fused to the coding region of lacZ. Expression of pgp-1 and pgp-3, as inferred from pgp-lacZ transgenic nematodes, was confined to the intestinal cells. The expression patterns of both genes were virtually indistinguishable. Quantitative analysis of pgp mRNA levels during development showed that pgp-1, -2, and -3 were expressed throughout the life cycle of C.elegans, albeit with some variation indicating developmental regulation. The expression of P-glycoprotein
Aging is characterized by general physiological decline over time. A hallmark of human senescence is the onset of various age-related afflictions including neurodegeneration, cardiovascular disease and cancer. Although environmental and stochastic factors undoubtedly contribute to the increased incidence of disease with age, recent studies suggest that intrinsic genetic determinants govern both life span and overall health. Current aging research aims at achieving the longevity dividend, in which life span extension in humans is accomplished with a concomitant increase in the quality of life (Olshansky et al., 2007). Significant progress has been made using model organisms, especially the nematode worm Caenorhabditis elegans, to delineate the genetic and biochemical pathways involved in aging to identify strategies for therapeutic intervention in humans. In this review, we discuss how C. elegans has contributed to our understanding of insulin signaling and aging. ...
rdf:RDF xmlns:dcterms="http://purl.org/dc/terms/" xmlns:dc="http://purl.org/dc/elements/1.1/" xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" xmlns:bibo="http://purl.org/ontology/bibo/" xmlns:dspace="http://digital-repositories.org/ontologies/dspace/0.1.0#" xmlns:foaf="http://xmlns.com/foaf/0.1/" xmlns:void="http://rdfs.org/ns/void#" xmlns:xsd="http://www.w3.org/2001/XMLSchema#" , ,rdf:Description rdf:about="https://kops.uni-konstanz.de/rdf/resource/123456789/34900", ,bibo:uri rdf:resource="https://kops.uni-konstanz.de/handle/123456789/34900"/, ,dc:creator,Deehan, Kevin,/dc:creator, ,dc:creator,Wilson, Kristy J.,/dc:creator, ,dc:language,eng,/dc:language, ,dcterms:abstract xml:lang="eng",UNC-89 is a giant polypeptide located at the sarcomeric M-line of Caenorhabditis elegans muscle. The human homologue is obscurin. To understand how UNC-89 is localized and functions, we have been identifying its binding partners. Screening a yeast two-hybrid library revealed that UNC-89 interacts with ...
Ninety-five mutants of the nematode Caenorhabditis elegans altered in the cell lineages of the vulva have been isolated on the basis of their displaying one of two phenotypes, Vulvaless or Multivulva. In Vulvaless mutants, which define 12 genes, no vulva is present. In Multivulva mutants, which define ten genes, one or more supernumerary vulva-like protrusions are located along the ventral side of the animal. A single recessive mutation is responsible for the phenotypes of most, but not all, of these strains. Fifteen of these 22 genes are represented by multiple alleles. We have shown by a variety of genetic criteria that mutations that result in a Vulvaless or Multivulva phenotype in six of the 22 genes most likely eliminate gene function. In addition, Vulvaless or Multivulva mutations in seven of the other genes most likely result in a partial reduction of gene function; the absence of the activity of any of these genes probably results in lethality or sterility. Our results suggest that we ...
As a consequence of the Earths axial rotation, organisms display daily recurring rhythms in behavior and biochemical properties, such as hormone titers. The neuronal system controlling such changes is best studied in the fruit fly Drosophila melanogaster. In the nematode worm Caenorhabditis elegans, most homologs of these genes function in the heterochronic pathway controlling the (timing of) developmental events. Recent data indicate that in the worm at least one of the genes involved in developmental timing is also active in circadian rhythm control, thereby opening up new perspectives on a central (neuronal) timer interfering with many processes. Also, new neuropeptidergic clock homologs have been identified in nematodes, supporting the idea of a broad range of clock-regulated targets. We will describe the current knowledge on homologous clock genes in C. elegans with a focus on the recently discovered pigment dispersing factor gene homologs. Similarities between developmental and daily ...
The pace of technical developments allowing the direct manipulation of genome sequences has seen a marked acceleration in recent years with the emergence of RNA-targeted nucleases derived from bacterial immune systems (Doudna and Charpentier 2014; Zetsche et al. 2015). In particular, the binary system relying on the Streptococcus pyogenes Cas9 endonuclease targeted by CRISPR (clustered, regularly interspaced, short, palindromic repeat) RNAs has been successfully used to generate point mutations, deletion, or DNA insertions in an ever-growing number of experimental systems. S. pyogenes CRISPR/Cas9 has been adapted early on in the model nematode Caenorhabditis elegans (Friedland et al. 2013; Dickinson et al. 2013; Chen et al. 2013; Frøkjær-Jensen 2013; Dickinson and Goldstein 2016). Previously, heritable genome engineering could only be achieved in C. elegans by remobilizing a Drosophila Mos1 transposon, which could be inserted and excised in the germline (Robert and Bessereau 2007; ...
The vaccinia-related kinases (VRKs) are highly conserved throughout the animal kingdom and phosphorylate several chromatin proteins and transcription factors. In early Caenorhabditis elegans embryos, VRK-1 is required for proper nuclear envelope formation. In this work, we present the first investigation of the developmental role of VRKs by means of a novel C. elegans vrk-1 mutant allele. We found that VRK-1 is essential in hermaphrodites for formation of the vulva, uterus, and utse and for development and maintenance of the somatic gonad and thus the germ line. VRK-1 regulates anchor cell polarity and the timing of anchor cell invasion through the basement membranes separating vulval and somatic gonadal cells during the L3 larval stage. VRK-1 is also required for proper specification and proliferation of uterine cells and sex myoblasts. Expression of the fibroblast growth factor-like protein EGL-17 and its receptor EGL-15 is reduced in vrk-1 mutants, suggesting that VRK-1 might act at least ...
Mutations in the gene unc-53 of Caenorhabditis elegans result in behavioral and anatomical abnormalities. Immunocytochemistry and electron microscopy revealed neuroanatomical defects in all main longitudinal nervous tracts. Whole tracts were found to
Large-conductance calcium and voltage-activated potassium channels, termed SLO-1 (or BK), are pivotal players in the regulation of cell excitability across the animal phyla. Furthermore, emerging evidence indicates that these channels are key mediators of a number of neuroactive drugs, including the most recent new anthelmintic, the cyclo-octadepsipeptide emodepside. Detailed reviews of the structure, function and pharmacology of BK channels have recently been provided (Salkoff et al. in Nat Rev Neurosci 7:921-931, 2006; Ghatta et al. in Pharmacol Ther 110:103-116, 2006) and therefore these aspects will only briefly be covered here. The purpose of this review is to discuss how SLO-1 channels might function as regulators of neural transmission and network activity. In particular, we focus on the role of SLO-1 in the regulation of Caenorhabditis elegans behaviour and highlight the role of this channel as an effector for pleiotropic actions of neuroactive drugs, including emodepside. On the premise ...
Microsporidia comprise a phylum of obligate intracellular pathogens related to fungi that infect virtually all animals. Recently, the nematode Caenorhabditis elegans has been developed as a convenient model for studying microsporidia infection in a whole-animal host through the identification and characterization of a natural microsporidian pathogen of this commonly studied laboratory organism. The C. elegans natural microsporidian pathogen is named Nematocida parisii, and it causes a lethal intestinal infection in C. elegans. Comparison of the genomes of N. parisii and its closely related species Nematocida sp. 1, together with the genomes of other microsporidian species, has provided insight into the evolutionary events that led to the emergence of the large, specialized microsporidia phylum. Cell biology studies of N. parisii infection in C. elegans have shown how N. parisii restructures host intestinal cells and, in particular, how it hijacks host exocytosis for nonlytic exit to facilitate
RNA interference (RNAi) is a widespread and widely exploited phenomenon which has potential as a strategy for both the treatment of disease and pest control. RNAi results in down‐regulation of a specific gene in response to the production of small interfering RNAs (siRNAs). RNAi is one of a family of processes mediated by small non‐coding RNAs [1], [2]. In Caenorhabditis elegans, and in a number of other organisms, RNAi is systemic so that the introduction of dsRNA into one tissue triggers gene silencing in other tissues [3], [4], [5], [6], [7]. Furthermore, systemic RNAi enables C. elegans and other organisms to exhibit environmental RNAi [5]. For example, feeding C. elegans on bacteria expressing dsRNA initiates a widespread RNAi response [8], [9]. Studies in C. elegans and other organisms have provided mechanistic insights into RNAi [4], [10], [11], [12], [13], although the role of exogenous RNAi in the normal life of C. elegans and other animals remains unclear [14].. Whilst C. elegans ...
During the course of normal embryonic and post-embryonic development, 131 cells in a Caenorhabditis elegans hermaphrodite undergo programmed cell death. Loss of function mutations in either of the genes ced-3 or ced-4 abolish cell deaths, enabling these undead cells to survive and be incorporated into the adult with no obvious deleterious consequences. Ultrastructural reconstructions have shown that undead cells exhibit many differentiated characteristics. Most of the reconstructed cells appeared to be neurons with all the characteristic features associated with such cells, such as processes, synaptic vesicles and presynaptic specializations. However, clear morphological differences were seen among the undead neurons, suggesting a diversity of cell type. One of the reconstructed cells was a rectal epithelial cell, which had displaced its lineal sister that normally functions in this role. Removal of the ability to undergo programmed cell death by mutation therefore reveals a diversity of ...
We are studying the development of the intestine in the small free-living nematode worm Caenorhabditis elegans. The worm intestine develops as a simple clone of cells, entirely deriving from a single cell in the eight-cell embryo. We mainly focus on the transcription factor network that drives development of the intestine. From our work and that of others, we now know all the core transcription factors that control intestinal genes, from specification to differentiation, and they all are "GATA factors" similar to the factors that are central to the development of the human intestine. We are now trying to figure out how these factors actually work, i.e. to define the molecular and thermodynamic basis of developmental specificity. Does all the specificity reside in the DNA binding domain? And if so, how much does the binding free energy to an intestinal gene differ from the binding free energy to a gene expressed in a different lineage, e.g. the hypodermis (skin)? Are there other protein domains ...
LAG1 is a longevity gene, the first such gene to be identified and cloned from the yeast Saccharomyces cerevisiae. A close homolog of this gene, which we call LAC1, has been found in the yeast genome. We have cloned the human homolog of LAG1 with the ultimate goal of examining its possible function in human aging. In the process, we have also cloned a homolog from the nematode worm Caenorhabditis elegans. Both of these homologs, LAG1Hs and LAG1Ce-1, functionally complemented the lethality of a lag1delta lac1delta double deletion, despite low overall sequence similarity to the yeast proteins. The proteins shared a short sequence, the Lag1 motif, and a similar transmembrane domain profile. Another, more distant human homolog, TRAM, which lacks this motif, did not complement. LAG1Hs also restored the life span of the double deletion, demonstrating that it functions in establishing the longevity phenotype in yeast. LAG1Hs mapped to 19p12, and it was expressed in only three tissues: brain, skeletal ...
Caenorhabditis elegans MIG-13 protein: required for positioning of Q neuroblasts and their descendents along the anteroposterior axis; isolated from Caenorhabditis elegans; amino acid sequence in first source; GenBAnk AF150958
For the first days, we will introduce students to the nematode C. elegans. Students will work with different experimental set-ups that will allow us to explore a variety of C. elegans behavior. We will analyze C. elegans behavior in response to thermal, mechanical and chemical stimuli. The transparency of the animal makes it feasible to use genetically encoded calcium sensors to monitor neural activity in response to sensory stimuli. Transgenic expression of light-activated ion channels, allows us to turn neurons on and off. These optogenetic experiments will be used to define neural requirements of sensory processing. Students will use these techniques to determine 1) how C. elegans responds and remembers the temperature at which was raised; 2) analyze the neural dynamics of a compound motor sequence that is evoked by touch; 3) determine the neural requirements of calcium channels chemosensation. These experiments are an ideal introduction to Calcium imaging optogenetics in a genetically ...
Caenorhabditis elegans shares several molecular and physiological homologies with humans and thus plays a key role in studying biological processes. As a consequence, much progress has been made in automating the analysis of C. elegans. However, there is still a strong need to achieve more progress in automating the analysis of static images of adult worms. In this paper, a three-phase semi-automated system has been proposed. As a first phase, a novel segmentation framework, based on variational level sets and local pressure force function, has been introduced to handle effectively images corrupted with intensity inhomogeneity. Then, a set of robust invariant symbolic features for high-throughput screening of image-based C. elegans phenotypes are extracted. Finally, a classification model is applied to discriminate between the different subsets. The proposed system demonstrates its effectiveness in measuring morphological phenotypes in individual worms of C. elegans.. ...
Genetic studies have identified over a dozen genes that function in programmed cell death (apoptosis) in the nematode Caenorhabditis elegans(1-3). Although the ultimate effects on cell survival or engulfment of mutations in each cell death gene have been extensively described, much less is known about how these mutations affect the kinetics of death and engulfment, or the interactions between these two processes. We have used four-dimensional-Nomarski time-lapse video microscopy to follow in detail how cell death genes regulate the extent and kinetics of apoptotic cell death and removal in the early C. elegans embryo. Here we show that blocking engulfment enhances cell survival when cells are subjected to weak pro-apoptotic signals. Thus, genes that mediate corpse removal can also function to actively kill cells.. ...
A specific behavioural response of Caenorhabditis elegans, the rapid increase of locomotion in response to anoxia/reoxygenation called the O2-ON response, has been used to model key aspects of ischaemia/reperfusion injury. A genetic suppressor screen demonstrated a direct causal role of CYP (cytochrome P450)-13A12 in this response and suggested that CYP-eicosanoids, which in mammals influence the contractility of cardiomyocytes and vascular smooth muscle cells, might function in C. elegans as specific regulators of the body muscle cell activity. In the present study we show that co-expression of CYP-13A12 with the NADPH-CYP-reductase EMB-8 in insect cells resulted in the reconstitution of an active microsomal mono-oxygenase system that metabolized EPA (eicosapentaenoic acid) and also AA (arachidonic acid) to specific sets of regioisomeric epoxy and hydroxy derivatives. The main products included 17,18-EEQ (17,18-epoxyeicosatetraenoic acid) from EPA and 14,15-EET (14,15-epoxyeicosatrienoic acid) ...
Benzimidazole anti-microtubule drugs, such as benomyl, induce paralysis and slow the growth of the nematode Caenorhabditis elegans. We have identified 28 mutations in C. elegans that confer resistance to benzimidazoles. All resistant mutations map to a single locus, ben-1. Virtually all these mutations are genetically dominant. Molecular cloning and DNA sequence analysis established that ben-1 encodes a beta-tubulin. Some resistant mutants are completely deleted for the ben-1 gene. Since the deletion strains appear to be fully resistant to the drugs, the ben-1 product appears to be the only benzimidazole-sensitive beta-tubulin in C. elegans. Furthermore, since animals lacking ben-1 are viable and coordinated, the ben-1 beta-tubulin appears to be nonessential for growth and movement. The ben-1 function is likely to be redundant in the nematode genome. ...
Approximately 10% of Caenorhabditis elegans nervous system synapses are electrical, that is, gap junctions composed of innexins. The locomotory nervous system consists of several pairs of interneurons and three major classes of motor neurons, all with stereotypical patterns of connectivity that include gap junctions. Mutations in the two innexin genes unc-7 and unc-9 result in identical uncoordinated movement phenotypes, and their respective gene products were investigated for their contribution to electrical synapse connectivity. unc-7 encodes three innexin isoforms. Two of these, UNC-7S and UNC-7SR, are functionally equivalent and play an essential role in coordinated locomotion. UNC-7S and UNC-7SR are widely expressed and co-localize extensively with green fluorescent protein-tagged innexin UNC-9 in the ventral and dorsal nerve cords. A subset of UNC-7S/SR expression visualizes gap junctions formed between the AVB forward command interneurons and their B class motor neuron partners. Experiments
Many crucial events in metazoan development and physiology are governed by diffusible signals that trigger specific responses in highly restricted subsets of cells. This exquisite specificity of intercellular signaling requires precisely controlled expression of receptors and downstream signaling components that effect appropriate responses. The nematode Caenorhabditis elegans has proven a valuable model for the study of signaling specificity, notably for mechanisms of signaling through the Epidermal growth factor (EGF) receptor (for a review, see Moghal and Sternberg, 2003). The sole EGF-like ligand and EGF receptor in the C. elegans genome are encoded by the genes lin-3 and let-23, respectively (Hill and Sternberg, 1992; Aroian et al., 1990) (Wormbase WS210). Recently we described a role for LET-23 in the regulation of C. elegans behavior (Van Buskirk and Sternberg, 2007). Caenorhabditis elegans develops through four larval stages before adulthood, and each larval molt is preceded by ...
β-Amyloid (Aβ)-induced toxicity and oxidative stress have been postulated to play critical roles in the pathogenic mechanism of Alzheimer disease (AD). We investigated the in vivo ability of a mitochondria-targeted antioxidant, MitoQ, to protect against Aβ-induced toxicity and oxidative stress in a …
C. elegans worms. Light microscopy of Caenorhabditis elegans worms. This is a soil-dwelling hermaphrodite nematode worm and one of the most studied animals in biological and genetic research. A tendency to reproduce by self-fertilisation (resulting in identical offspring), along with the short time taken to reach maturity, make this tiny worm an ideal subject. - Stock Video Clip K002/8244
Fig. 7 Two-dimensional plot of track curvature versus centroid velocity.. In the drug environment, the worm is classified as active, semiactive, or inactive as demonstrated in Fig. 4, and the plot is accordingly segregated into the three areas of activity. We are primarily interested in combinations that induce inactivity in the worm. (A) In iteration 1, two combinations (that is, P1 and T3) are able to make the worm inactive. Besides in P3, the active worm does not succumb to any other combination and is classified as being active. (B) In iteration 2, only P1 makes the worm inactive. The rest of the combinations do not seem to affect the active worm. (C) In iteration 3, the worm is in a semiactive or active state for all combinations. (D) In iteration 4, three combinations (T1, T2, and T3) are able to make the worm inactive, and the winning combination is chosen as T3. ...
The nematode Caenorhabditis elegans is a genetically tractable model organism to investigate sterol transport. In vivo imaging of the fluorescent sterol, dehydroergosterol (DHE), is challenged by C. elegans high autofluorescence in the same spectral region as emission of DHE. We present a method to detect DHE selectively, based on its rapid bleaching kinetics compared to cellular autofluorescence. Worms were repeatedly imaged on an ultraviolet-sensitive wide field (UV-WF) microscope, and bleaching kinetics of DHE were fitted on a pixel-basis to mathematical models describing the intensity decay. Bleach-rate constants were determined for DHE in vivo and confirmed in model membranes. Using this method, we could detect enrichment of DHE in specific tissues like the nerve ring, the spermateca and oocytes. We confirm these results in C. elegans gut-granule-loss (glo) mutants with reduced autofluorescence and compare our method with three-photon excitation microscopy of sterol in selected tissues. Bleach
The nematode Caenorhabditis elegans is a genetically tractable model organism to investigate sterol transport. In vivo imaging of the fluorescent sterol, dehydroergosterol (DHE), is challenged by C. elegans high autofluorescence in the same spectral region as emission of DHE. We present a method to detect DHE selectively, based on its rapid bleaching kinetics compared to cellular autofluorescence. Worms were repeatedly imaged on an ultraviolet-sensitive wide field (UV-WF) microscope, and bleaching kinetics of DHE were fitted on a pixel-basis to mathematical models describing the intensity decay. Bleach-rate constants were determined for DHE in vivo and confirmed in model membranes. Using this method, we could detect enrichment of DHE in specific tissues like the nerve ring, the spermateca and oocytes. We confirm these results in C. elegans gut-granule-loss (glo) mutants with reduced autofluorescence and compare our method with three-photon excitation microscopy of sterol in selected tissues. Bleach
Normal locomotion of the nematode Caenorhabditis elegans requires transmission of contractile force through a series of mechanical linkages from the myofibrillar lattice of the body wall muscles, across an intervening extracellular matrix and epithel
Gene expression is regulated at multiple levels, including transcription and translation, as well as mRNA and protein stability. Although systems-level functions of transcription factors and microRNAs are rapidly being characterized, few studies have focused on the posttranscriptional gene regulation by RNA binding proteins (RBPs). RBPs are important to many aspects of gene regulation. Thus, it is essential to know which genes encode RBPs, which RBPs regulate which gene(s), and how RBP genes are themselves regulated. Here we provide a comprehensive compendium of RBPs from the nematode Caenorhabditis elegans (wRBP1.0). We predict that as many as 887 (4.4%) of C. elegans genes may encode RBPs ~250 of which likely function in a gene-specific manner. In addition, we find that RBPs, and most notably gene-specific RBPs, are themselves enriched for binding and modification by regulatory proteins, indicating the potential for extensive regulation of RBPs at many different levels. wRBP1.0 will provide a
Strains. Nematodes were grown at 20°C under standard conditions that included uncrowded conditions and the presence of ample food (the Escherichia coli strain OP50). Wild-type nematodes were C. elegans strain N2. Mutant strains were obtained from the Caenorhabditis Genetic Center.. cDNA clones and expression constructs. Using degenerate oligonucleotide primers designed to amplify conserved regions of ionotropic glutamate receptors, we amplified DNA fragments from first-strand mixed-stage C. elegans cDNA that encoded portions of glr-3 and glr-5. These partial gene products were used to screen cDNA libraries at high stringency. After screening ∼106 clones, we obtained several partial cDNAs for each gene, indicating that mRNA encoding these glutamate receptor subunits is present at relatively low levels. Hence, we were unable to isolate full-length cDNAs using this approach. We also searched the published C. elegans genome for genes related in sequence to glr-1, glr-3, andglr-5 and identified ...
A genetic screen for Caenorhabditis elegans mutants with enhanced susceptibility to killing by Pseudomonas aeruginosaled to the identification of two genes required for pathogen resistance: sek-1, which encodes a mitogen-activated protein (MAP) kinase kinase, and nsy-1, which encodes a MAP kinase kinase kinase. RNA interference assays and biochemical analysis established that a p38 ortholog, pmk-1, functions as the downstream MAP kinase required for pathogen defense. These data suggest that this MAP kinase signaling cassette represents an ancient feature of innate immune responses in evolutionarily diverse species. ...
Members of the Hox gene family encode transcription factors that specify positional identity along the anterior-posterior axis of nearly all metazoans. One among the Caenorhabditis elegans Hox genes is egl-5. A deletion allele of egl-5 was isolated in a screen for animals which fail to develop swollen tails when exposed to the bacterial pathogen Microbacterium nematophilum. We show that compromised rectal development, which occurs as a result of loss of egl-5 function, results in a failure of rectal epithelial cells to express the ERK MAP kinase mpk-1, which was previously shown to mediate tail-swelling in response to bacterial infection. Tissue-specific rescue experiments demonstrated that egl-5 and mpk-1 act autonomously in rectal cells in the morphological response. The weak egl-5 allele (n1439), which does not compromise rectal development, fails to affect tail-swelling. We find that this allele carries an inserted repeat element approximately 13.8 kb upstream of the egl-5 open reading frame, which
Buy or Rent Caenorhabditis elegans: Modern Biological Analysis of an Organism: Caenorhibditus Elegans: Modern Biological Analysis of an Organism as an eTextbook and get instant access. With VitalSource, you can save up to 80% compared to print.
Caenorhabditis elegans offers an array of advantages to investigate the roles of uptake transporters. Herein, an epifluorescent microscopy approach was developed to monitor the uptake of the autofluorescent anticancer drug, doxorubicin, into the pharynx of C. elegans by organic cation transporters.
Abstract. Studies of the molecular mechanisms that are involved in stress responses (environmental or physiological) have long been used to make links to disease states in humans. The nematode model organism, Caenorhabditis elegans, undergoes a state of hypometabolism called the dauer stage. This period of developmental arrest is characterized by a significant reduction in metabolic rate, triggered by ambient temperature increase and restricted oxygen/ nutrients. C. elegans employs a number of signal transduction cascades in order to adapt to these unfavourable conditions and survive for long times with severely reduced energy production. The suppression of cellular metabolism, providing energetic homeostasis, is critical to the survival of nematodes through the dauer period. This transition displays molecular mechanisms that are fundamental to control of hypometabolism across the animal kingdom. In general, mammalian systems are highly inelastic to environmental stresses (such as extreme ...
Cytoskeletal regulation is important in cell migration. The Caenorhabditis elegans gonadal distal tip cells (DTCs) offer a simple model with which to investigate the mechanism of cell migration in organogenesis. Here, we report that one of the spectraplakin isoforms, VAB-10B1, plays an essential role in cell and nuclear migration of DTCs by regulating the actin and microtubule (MT) cytoskeleton. In the vab-10(tk27) mutant, which lacks VAB-10B1, alignment of filamentous (F)-actin and MTs was weakly and severely disorganized, respectively, which resulted in a failure to translocate the DTC nucleus and a premature termination of DTC migration. An MT growing-tip marker, EBP-2-GFP, revealed that polarized outgrowth of MTs towards the nuclei of migrating DTCs was strikingly impaired in tk27 animals. A vab-10 mini-gene encoding only the actin- and MT-binding domains significantly rescued the gonadal defects, suggesting that VAB-10B1 has a role in linking actin and MT filaments. These results suggest ...
TY - JOUR. T1 - Cis-regulatory mechanisms of gene expression in an olfactory neuron type in Caenorhabditis elegans. AU - Nokes, Eva B.. AU - Van Der Linden, Alexander M.. AU - Winslow, Caron. AU - Mukhopadhyay, Saikat. AU - Ma, Kristin. AU - Sengupta, Piali. PY - 2009/12. Y1 - 2009/12. N2 - The generation of cellular diversity is dependent on the precise spatiotemporal regulation of gene expression by both cis- and trans-acting mechanisms. The developmental principles regulating expression of specific gene subsets in individual cell types are not fully understood. Here we define the cis-regulatory mechanisms driving expression of cell-selective and broadly expressed genes in vivo in the AWB olfactory neuron subtype in C. elegans. We identify an element that is necessary to drive expression of neuron-selective chemoreceptor genes in the AWB neurons, and show that this element functions in a context-dependent manner. We find that the expression of broadly expressed sensory neuronal genes in the ...
To survive, animals must properly sense their surrounding environment. The types of sensation that allow for detecting these changes can be categorized as tactile, thermal, aural, or olfactory. Olfaction is one of the most primitive senses, involving the detection of environmental chemical cues. Organisms must sense and discriminate between abiotic and biogenic cues, necessitating a system that can react and respond to changes quickly. The nematode, Caenorhabditis elegans, offers a unique set of tools for studying the biology of olfactory sensation.The olfactory system in C. elegans is comprised of 14 pairs of amphid neurons in the head and two pairs of phasmid neurons in the tail. The male nervous system contains an additional 89 neurons, many of which are exposed to the environment and contribute to olfaction. The cues sensed by these olfactory neurons initiate a multitude of responses, ranging from developmental changes to behavioral responses. Environmental cues might initiate entry into or exit
A search of the C. elegans genome for potential homologues of the yeast MEN/SIN genes revealed several candidate genes, although for some of these genes the sequence similarities were only limited and for TEM1, CDC15, and BFA1 no putative homologues could be identified (Table I). All candidate genes were tested in C. elegans for a possible function in a hypothetical MEN/SIN-like regulatory network, using RNAi to deplete the corresponding products. For depletion of putative MEN/SIN gene products, both RNAi feeding and injection methods (Montgomery and Fire, 1998; Timmons et al., 2001) were tried to maximize the probability of functional inactivation. The results of these experiments are summarized in Table I. A priori, we had expected that depletion of a gene product required for the regulation of mitotic exit or the onset of cytokinesis should result in embryonic lethality. However, of all components tested, only the depletion of the C. elegans homologue of the budding yeast Cdc14p phosphatase ...
Because C. elegans chromosomes are holocentric and lack centromeric heterochromatin, HP1 proteins are dispensable for chromosome segregation and mitotic viability in this organism [23, 25]. We have exploited this fact to examine in detail the role of one of the C. elegans HP1 homologues, HPL-2, in regulating developmental pathways of gene expression, a second physiological function ascribed to heterochromatin. By comparing the effects of hpl-2 deletion at different stages of development, we have shed light on a novel role for this HP1 family member in dauer diapause, longevity and lipid metabolism. These three processes have in common an extremely tight response to environmental factors. Thus, our data link a response to environmental factors to the epigenetic regulator HPL-2. At least some of the genes identified in this study are shown by CHIP-on chip to be bound by HPL-2, and are therefore likely to represent direct targets.. We show that hpl-2 plays a role in the choice between dauer and ...
Parkinsons disease (PD) is a neurodegenerative disorder with symptoms that progressively worsen with age. Pathologically, PD is characterized by the aggregation of α-synuclein in cells of the substantia nigra in the brain and loss of dopaminergic neurons. This pathology is associated with impaired movement and reduced cognitive function. The etiology of PD can be attributed to a combination of environmental and genetic factors. A popular animal model, the nematode roundworm Caenorhabditis elegans, has been frequently used to study the role of genetic and environmental factors in the molecular pathology and behavioral phenotypes associated with PD. The current review summarizes cellular markers and behavioral phenotypes in transgenic and toxin-induced PD models of C. elegans.
gi,17559712,ref,NP_506256.1, CaDHerin family member (cdh-6) [Caenorhabditis elegans] gi,7499172,pir,,T20968 hypothetical protein F15B9.7 - Caenorhabditis elegans gi,3875964,emb,CAB01427.1, Hypothetical protein F15B9.7 [Caenorhabditis elegans] gi,3880568,emb,CAB01449.1, C. elegans CDH-6 protein (corresponding sequence F15B9.7) [Caenorhabditis elegans ...
ALBERTSON, D. G., and J. N. THOMSON. 1976. The pharynx of Caenorhabditis elegans. Philos. Trans. R. Soc. London, Ser. B, 275: 299-325.. ANDERSON, R. V., and J. R. BYERS. 1975. Ultrastructure of the esophageal procorpus in the plant parasite nematode, Tylenchorhynchus dubius, and functional aspects in relation to feeding. Can. J. Zool. 53: 1581-1595. BALDWIN, J. G., H. HIRSCHMANN, and A. C. TRIANTAPHYL-LOU. 1977. Comparative fine structure of the esophagus of males of Heterodera glycines and Meloidogyne incognita. Nematologica, 23: 239-252. COOMANS, A. 1963. Stoma structure in members of the dorylaimina. Nematologica, 9: 587-601. COOMANS, A., L. DE CONINCK, and C. HEIP. 1978. Round table discussions: first workshop on systematics of marine free-living nematodes. Ann. Soc. Zool. Belg. 108:109-113. DE CONINCK, L. 1965. Structures cephalique and Appareil digestif, cavite buccale. In Traite de zoologie. Edited ...
Eit vakse individ har kring 1 000 seller, og dette talet er konstant; vaksne individ veks berre ved at sellene vert større.[2][3] C. elegans har to kjønnskategoriar: tvikjønn og hankjønn. Tvikjønna makkar kan fræva seg sjølve, medan hannmakkar berre kan fræva tvikjønna makkar.[4] Meltesystemet til C. elegans har 20 epitelseller som liknar på dei ein finn hjå menneske. C. elegans har ikkje immunseller.[2] Det ytre laget av C. elegans vert laga og skilt ut av 12 seller med til saman 157 sellekjernar.[3] Langs sidene av vaksne C. elegans-individ går det òg to band kalla alae, skilte ut av samansmelta saumseller.[5] Nervesystemet til C. elegans er det mest komplekse vevet i organismen. Hjå tvikjønna makkar utgjer det kring 37% av alle kroppssellene. Tvikjønna makkar har 302 nerveseller fordelte på 118 ulike typar og 56 gliaseller. Hannar har 385 nerveseller og soleis fleire enn tvikjønna. Dei fleste ekstra nervesellene hjå hannane sit i halen. Hannane har åtferd knytt til ...
Measurements of interference entail a comparison of the product of individual two-point recombination frequencies between markers with the corresponding double-crossover frequency. We used standard genetic crosses to measure the frequency of single and multiple crossover events. Because C. elegans is a hermaphroditic species, we assayed frequencies in hermaphrodite oogenesis, male spermatogenesis, and in an aggregate measure that combines hermaphrodite spermatogenesis and oogenesis (Figure 1, B, C, and E, respectively).. Figure 1B presents the set of results observed in oogenesis. The observed oocyte two-factor recombination frequencies in our experiments were 13.1% [in agreement with results reported by Hammarlund et al. (2005)] and 36.2%, respectively, for the unc-60(e723)-to-dpy-11(e224) (interval L) and dpy-11(e224)-to-rol-9(sc148) (interval R) intervals (95% C.I.s, 10.3%-16.42% and 31.9%-40.6%, respectively) (Clopper and Pearson 1934). In the absence of crossover interference, one would ...
Pun, P.B.L., Gruber, J., Tang, S.Y., Ng, L.F., Cheah, I., Halliwell, B., Ong, R.L.S., Fong, S. (2010). Ageing in nematodes: Do antioxidants extend lifespan in Caenorhabditis elegans?. Biogerontology 11 (1) : 17-30. [email protected] Repository. https://doi.org/10.1007/s10522-009-9223- ...
Extra copies of the SIR2 gene in yeast increase the number of times a mother yeast can reproduce by budding. This is the operational definition of aging in yeast (see article by Gems). Overexpression of the worm gene with the most similarity to yeast SIR2 called sir-2.1 also increased life-span in the worm Caenorhabditis elegans. The increased life-span required a functional forkhead transcription factor, DAF-16, whose activity is inhibited by the insulin-like pathway in the worm. Mutations in the insulin-like signaling pathway also affect worm life-span by a mechanism requiring DAF-16. Sir-2.1 appears to be a regulator of the insulin-like pathway based on several criteria, including synergism with the genetic mutants of the TGF-β pathway and a lack of synergism with mutants of the insulin-like receptor gene daf-2. In yeast, SIR2 alters chromatin structure, resulting in gene silencing. Tissenbaum and Guarente suggest that Sir-2.1 may repress the expression of factors involved in activating the ...
Amino Acid Sequence, Animals, Apoptosis/*physiology, Apoptosis Regulatory Proteins, Caenorhabditis/genetics, Caenorhabditis elegans/embryology/genetics/*physiology, Caenorhabditis elegans Proteins/genetics/metabolism/*physiology, DNA/genetics/radiation effects, DNA Damage, Gene Deletion, Gene Expression Regulation; Developmental/radiation effects, Heat-Shock Proteins/genetics, Models; Biological, Molecular Sequence Data, Mutation, Proto-Oncogene Proteins/genetics/metabolism, Repressor Proteins/genetics, Sequence Homology; Amino Acid, Tumor Suppressor Protein p53/genetics/physiology, X-Rays ...
Comments on Hoppe PE et al. (2000) Genetics "A region of the myosin rod important for interaction with paramyosin in Caenorhabditis elegans striated muscle." ...
C elegans Lin-3 protein: amino acid sequence given in first source; lin-3 encodes an inductive signal for vulval development; from Caenorhabditis elegans
PubMedID: 23350972 | Laboratory adapted Escherichia coli K-12 becomes a pathogen of Caenorhabditis elegans upon restoration of O antigen biosynthesis. | Molecular microbiology | 3/1/2013
Bacaj, T., M. Tevlin, Y. Lu, and S. Shaham. 2008. Glia are essential for sensory organ function in C. elegans. Science. 322(5902):744-747.. Heiman, M. G., and S. Shaham. 2007. Ancestral roles of glia suggested by the nervous system of Caenorhabditis elegans. Neuron Glia Biology. 3(1):55-61. (Request copy of article from the Markus Library). Shaham, S. 2006. Glia-neuron interactions in the nervous system of Caenorhabditis elegans. Current Opinion in Neurobiology. 16(5): 522-528.. Shaham, S. 2005. Glia-neuron interactions in nervous system function and development. Current Topics in Developmental Biology. 69:39-66.. Wang, Y., A. Apicella Jr., S. -K Lee, M. Ezcurra, R. D. Slone, M. Goldmit, W. R. Schafer, S. Shaham, M. Driscoll, and L. Bianchi. 2008. A glial DEG/ENaC channel functions with neuronal channel DEG-1 to mediate specific sensory functions in C. elegans. EMBO Journal. 27(18):2388-2399.. Wang, Y., A. Apicella Jr., S. -K Lee, M. Ezcurra, R. D. Slone, M. Goldmit, W. R. Schafer, S. Shaham, M. ...
A one-millimeter worm, the nematode Caenorhabditis elegans, is an animal model widely used in biomedical research by hundreds of laboratories around the world. Surprisingly, it has approximately the same number of genes that humans have, about 20,000. In addition, most human disease-causing genes have their counterparts, or orthologs, in C. elegans worms.. Thus, for example, the human SF3B1 gene, which is mutated in different types of cancers, mainly in leukemia but also in some breast or prostate tumors, is very similar to the sftb-1 gene of C. elegans worms. In fact, 89 percent of the amino acid sequence of the human SF3B1 protein in its most cancer-affected region are identical. Some of these amino acids are conserved from worms to humans, including those that are mutated in some tumors.. A group of researchers led by Dr. Julián Cerón of the Bellvitge Biomedical Research Institute (IDIBELL), has taken advantage of the similarity between these amino acids and their experience in CRISPR gene ...
RNA-mediated interference (RNAi) has emerged recently as one of the most powerful functional genomics tools. RNAi has been particularly effective in the nematode worm C. elegans where RNAi has been used to analyse the loss-of-function phenotypes of almost all predicted genes. In this review, we illustrate how RNAi has been used to analyse gene function in C. elegans as well as pointing to some future directions for using RNAi to examine genetic interactions in a systematic manner.. ...
We report that the effects of RJ and enzyme-treated RJ (eRJ) on life span and health span in Caenorhabditis elegans (C elegans) are modulated by the sophisticated interplays of DAF-16, SIR-2.1, HCF-1, and 14-3-3 proteins. Dietary supplementation with RJ or eRJ increased C. elegans life span in a dose-dependent manner. The RJ and eRJ consumption increased the tolerance of C elegans to oxidative stress, ultraviolet irradiation, and heat shock stress. Our genetic analyses showed that RJ/eRJ-mediated life-span extension requires insulin/IGF-1 signaling and the activities of DAF-16, SIR-2.1, HCF-1, and FTT-2, a 14-3-3 protein. Earlier studies reported that DAF-16/FOXO, SIR-2.1/SIRT1, FTT-2, and HCF-1 have extensive interplays in worms and mammals. Our present findings suggest that RJ/eRJ-mediated promotion of longevity and stress resistance in C elegans is dependent on these conserved interplays. ...
For many organisms the ability to transduce light into cellular signals is crucial for survival. Light stimulates DNA repair and metabolism changes in bacteria, avoidance responses in single-cell organisms, attraction responses in plants, and both visual and nonvisual perception in animals. Despite these widely differing responses, in all of nature there are only six known families of proteins that can transduce light. Although the roundworm Caenorhabditis elegans has none of the known light transduction systems, we show here that C. elegans strongly accelerates its locomotion in response to blue or shorter wavelengths of light, with maximal responsiveness to ultraviolet light. Our data suggest that C. elegans uses this light response to escape the lethal doses of sunlight that permeate its habitat. Short-wavelength light drives locomotion by bypassing two critical signals, cyclic adenosine monophosphate (cAMP) and diacylglycerol (DAG), that neurons use to shape and control behaviors. C. elegans ...
For many organisms the ability to transduce light into cellular signals is crucial for survival. Light stimulates DNA repair and metabolism changes in bacteria, avoidance responses in single-cell organisms, attraction responses in plants, and both visual and nonvisual perception in animals. Despite these widely differing responses, in all of nature there are only six known families of proteins that can transduce light. Although the roundworm Caenorhabditis elegans has none of the known light transduction systems, we show here that C. elegans strongly accelerates its locomotion in response to blue or shorter wavelengths of light, with maximal responsiveness to ultraviolet light. Our data suggest that C. elegans uses this light response to escape the lethal doses of sunlight that permeate its habitat. Short-wavelength light drives locomotion by bypassing two critical signals, cyclic adenosine monophosphate (cAMP) and diacylglycerol (DAG), that neurons use to shape and control behaviors. C. elegans ...
C. elegans provides a powerful model system in which to define the genes and molecular mechanisms underlying fundamental biological processes, such as oscillatory Ca2+ signaling. We describe here a novel isolated intestine preparation that allows physiological access to the intestinal epithelium and characterization of intracellular Ca2+ oscillations in wild-type, mutant, and transgenic worms as well as worms in which gene expression has been disrupted selectively by RNAi.. Isolated intestines exhibit spontaneous Ca2+ oscillations (e.g., Fig. 2). Oscillations were only observed in intestines left attached to the rectum and posterior end of the animal (Fig. 1 A), suggesting that oscillations may be triggered by a factor secreted from an unidentified posterior cell type. Alternatively, a pacemaker cell analogous to the interstitial cells of Cajal that regulate rhythmic smooth muscle contraction in the mammalian gut (Camborova et al., 2003) could be located in or adjacent to the posterior end of ...
Author SummaryEukaryotic genes contain introns, which are intervening sequences that are excised from a gene transcript with the concomitant ligation of flanking segments called exons. The process of removing introns is called splicing. It involves biochemical mechanisms that to date are too complex to be modeled comprehensively and accurately. However, abundant sequencing results can serve as a blueprint database exemplifying what this process accomplishes. Using this database, we employ discriminative machine learning techniques to predict the mature mRNA given the unspliced pre-mRNA. Our method utilizes support vector machines and recent advances in label sequence learning, originally developed for natural language processing. The system, called mSplicer, was trained and evaluated on the genome of the nematode C. elegans, a well-studied model organism. We were able to show that mSplicer correctly predicts the splice form in most cases. Surprisingly, our predictions on currently unconfirmed genes
BACKGROUND : The nematode Caenorhabditis elegans has been used extensively to identify the genetic requirements for proper nervous system development and function. Key to this process is the direction of vesicles to the growing axons and dendrites, which is required for growth-cone extension and synapse formation in the developing neurons. The contribution and mechanism of membrane traffic in neuronal development are not fully understood, however. RESULTS : We show that the C. elegans gene unc-69 is required for axon outgrowth, guidance, fasciculation and normal presynaptic organization. We identify UNC-69 as an evolutionarily conserved 108-amino-acid protein with a short coiled-coil domain. UNC-69 interacts physically with UNC-76, mutations in which produce similar defects to loss of unc-69 function. In addition, a weak reduction-of-function allele, unc-69(ju69), preferentially causes mislocalization of the synaptic vesicle marker synaptobrevin. UNC-69 and UNC-76 colocalize as puncta in ...
Description. C. elegans, one of the most attractive and popular genetic model organisms, is used to address questions and advance our understanding of several complex biological processes. The course will provide a general practical introduction to using C. elegans in research. It will cover the pros and cons of using C. elegans compared to other model organisms. The course participants will have hands on experience with popular techniques such as RNAi, genetic crosses, transgenic and GFP reporter strains. Thus, during the course the participants will not only be familiarized with using C. elegans as model organism but also be able to interact and network with experts in the field. The practical part of this course is complemented by lectures given by several internationally renowned C. elegans researchers.. The experiments will include the studies of the life cycle and early development of wild type worms and the phenotypic analysis of mutants.. It will cover:. Maintenance, decontamination and ...
Src homology 3 (SH3) domains bind peptides to mediate protein-protein interactions that assemble and regulate dynamic biological processes. We surveyed the repertoire of SH3 binding specificity using peptide phage display in a metazoan, the worm Caenorhabditis elegans, and discovered that it structurally mirrors that of the budding yeast Saccharomyces cerevisiae.We then mapped the worm SH3 interactome using stringent yeast two-hybrid and compared it with the equivalent map for yeast.We found that the wormSH3 interactome resembles the analogous yeast network because it is significantly enriched for proteins with roles in endocytosis. Nevertheless, orthologous SH3 domain mediated interactions are highly rewired. Our results suggest a model of network evolution where general function of the SH3 domain network is conserved over its specific form.
1PEV: Identification of functional residues on Caenorhabditis elegans actin-interacting protein 1 (UNC-78) for disassembly of actin depolymerizing factor/cofilin-bound actin filaments.
Our senses dull as we age; we dont see as well, hear as well, or smell or taste as well. Insights from aging in the worm Caenorhabditis elegans connect oxidative damage of potassium channels to this process. The potassium channel KVS-1 is present in the worms nervous system and in the ASE neurons that mediate the chemotactic response to food substances. Cai and Sesti found that, in a reconstituted system, KVS-1s electrophysiological properties were altered by oxidation (application of chloramine T or hydrogen peroxide). Oxidation increased KVS-1 conductance, which would decrease the excitability of the neuron, a change that was due to Cys113, because a C113S mutant channel was resistant to oxidation-mediated changes in electrophysiological properties. By expressing either the wild-type KVS-1 channel or the C113S-KVS-1 channel in kvs-1-knockout worms, the authors showed that the loss of chemotactic response due to exposure to oxidants was much more pronounced in the worms expressing wild-type ...
May 18, 2014 Researchers at MIT and the University of Vienna have created an imaging system that reveals neural activity throughout the brains of living animals. This technique, the first that can generate 3-D movies of entire brains at the millisecond timescale, could help scientists discover how neuronal networks process sensory information and generate behavior.. The team used the new system to simultaneously image the activity of every neuron in the worm Caenorhabditis elegans, as well as the entire brain of a zebrafish larva, offering a more complete picture of nervous system activity than has been previously possible.. "Looking at the activity of just one neuron in the brain doesnt tell you how that information is being computed; for that, you need to know what upstream neurons are doing. And to understand what the activity of a given neuron means, you have to be able to see what downstream neurons are doing," says Ed Boyden, an associate professor of biological engineering and brain and ...
The nematode Caenorhabditis elegans may hold the key to brain-like computational architectures: Si elegans will provide the scientific community with a reconfigurable, scalable and modular neuromimetic open-access computational platform to explore neural principles that give rise to complex behaviour and to derive a neuro-inspired technological blueprint for a new era of brain-like computational architectures.The Si elegans project started on April 1st 2013. ...
Sreekanth Chalasani uses an organism with a much simpler nervous system than humans to answer questions about neuroscience: the roundworm Caenorhabditis elegans. This animal has only 302 neurons and a few thousand connections between these cells. Each neuron is mapped and named, making it easier to study the effect of environment or gene changes at the resolution of individual cells. But despite its simplicity, the C. elegans nervous system has commonalities with a human brain: if you give a worm a dose of the antidepressant Prozac, for example, it becomes less fearful of predators; and if you mutate a gene linked to autism in humans, the worm shows less interest in other worms.. Among other studies, Chalasanis lab is asking how the roundworm nervous system, one of the simplest in nature, gives rise to such behaviors as fear and aggression. He is exploring what these tiny creatures can tell us about human aggressions and fears, emotions and behaviors often necessary for our survival, but which ...
TY - JOUR. T1 - The novel C. elegans gene sop-3 modulates Wnt signaling to regulate Hox gene expression. AU - Zhang, H.. AU - Emmons, S. W.. PY - 2001/4/2. Y1 - 2001/4/2. N2 - We describe the properties of a new gene, sop-3, that is required for the regulated expression of a C. elegans Hox gene, egl-5, in a postembryonic neuroectodermal cell lineage. Regulated expression of egl-5 in this cell lineage is necessary for development of the sensory rays of the male tail. sop-3 encodes a predicted novel protein of 1475 amino acids without clear homologs in other organisms. However, the sequence contains motifs consisting of homopolymeric runs of amino acids found in several other transcriptional regulators, some of which also act in Hox gene regulatory pathways. The genetic properties of sop-3 are very similar to those of sop-1, which encodes a component of the transcriptional Mediator complex, and mutations in the two genes are synthetic lethal. This suggests that SOP-3 may act at the level of the ...
It is significant that the majority of the processes involved in the integration of the CS and US in associative learning and in nonassociative memory formation ostensibly occurs within the AWC sensory neuron itself. Indeed, all the genes discussed in our model are known to be expressed in and required within or act on, in the case of ins-1, the AWC to mediate olfactory adaptation (Colbert et al., 1997; LEtoile et al., 2002; Palmitessa et al., 2005; Chalasani et al., 2010; Lin et al., 2010), lending support to the remarkable notion that the majority of processing occurs within the primary olfactory neuron. Indeed, this appears to be a common theme in a number of paradigms in C. elegans. For example, work by the Iino group has suggested that salt starvation associative learning requires insulin signaling within the salt-sensing ASE sensory neuron (Tomioka et al., 2006). Furthermore, food starvation associative learning leads to a modulation of the temperature at which the temperature-sensing AFD ...
To generate pmec-17LMP-1∷GFP, we fused GFP at the COOH terminus of the C. elegans LMP-1 protein. The translational fusion includes the entire LMP-1 coding sequence lacking the stop codon, a Gly-Ser-Ser-Pro-Gly-Leu-Ala-Lys-Gly-Pro-Lys-Gly linker, and GFP. The resulting chimera was expressed in touch receptor neurons under the control of the mec-17 promoter. The plasmid carrying the reporter fusion was constructed in two steps. First, the mec-17 promoter was amplified from N2 genomic DNA with the primers 5′ CGGGATCCGAATCGTCTCACAACTGATCC 3′ and 5′ AACTGCAGGTGACTACTTGAGACCTG 3′. A 1,900-bp PstI-BamHI fragment was cloned into the promoterless gfp vector pPD95.77 (Fire et al., 1990). Second, the LMP-1 coding region was amplified from genomic DNA using the primers 5′ CGGGATCCGACGCTGGCATATCCTTGTCTC 3′ and 5′ CGGGATCCAATTGAACTATGTTGAAATCG 3′. A BamHI PCR fragment was cloned downstream of the mec-17 promoter on the pPD95.77 plasmid vector. For RNAi experiments, we used HT115(DE3) ...
The purpose of the dataset C. elegans muscle aging is to deduce the age of the nemathode based on images of muscles. Images of C. elegans were taken ...
The purpose of the dataset C. elegans muscle aging is to deduce the age of the nemathode based on images of muscles. Images of C. elegans were taken ...
Author Summary X chromosomes differ in number between the sexes and differ from autosomes in their associated proteins and gene regulatory properties. In C. elegans both X chromosomes are partially silenced in hermaphrodite germlines. Germline-expressed and essential genes are autosome-enriched and are thought to have fled the X chromosome during evolution because silencing these genes would result in sterility or lethality. We discovered that the C. elegans DRM complex, which controls transcription of genes implicated in development and cancer, avoids the X chromosome. We first describe how DNA-binding components of the DRM complex together recognize DNA sequences upstream of its target genes, and we describe that DRM controls different target genes in the germline versus the soma. We show that the DRM binding motif, the genes bound by DRM, and the embryonic genes regulated by DRM are all under-represented on the X chromosome. Interestingly, compromising DRM function in the germline enhances X
Much of the material taken into cells by endocytosis is rapidly returned to the plasma membrane by the endocytic recycling pathway. Although recycling is vital for the correct localization of cell membrane receptors and lipids, the molecular mechanisms that regulate recycling are only partially understood. Here we show that in C. elegans, endocytic recycling is inhibited by NUM-1A, the nematode Numb homologue. NUM-1A::GFP fusion protein is localized to the baso-lateral surfaces of many polarized epithelial cells including the hypodermis and the intestine. We show that increased NUM-1A levels cause morphological defects in these cells similar to those caused by loss-of-function mutations in rme-1, a positive regulator of recycling both in C. elegans and mammals. We describe the isolation of worms lacking num-1A activity and show that, consistent with a model in which NUM-1A negatively regulates recycling in the intestine, loss of num-1A function bypasses the requirement for RME-1. Genetic ...
Learning, knowledge, research, insight: welcome to the world of UBC Library, the second-largest academic research library in Canada.
TY - JOUR. T1 - Global regulation of Hox gene expression in C. elegans by a SAM domain protein. AU - Zhang, Hong. AU - Azevedo, Ricardo B R. AU - Lints, Robyn. AU - Doyle, Christina. AU - Teng, Yingqi. AU - Haber, Daniel. AU - Emmons, Scott W.. PY - 2003/6/1. Y1 - 2003/6/1. N2 - Polycomb group (PcG)-mediated repression of C. elegans Hox genes has not been demonstrated, and genes homologous to components of one of the PcG complexes (PRC1) have not been identified in the C. elegans genome. We find that a mechanism of general Hox gene repression exists in C. elegans, carried out in part by SOP-2, a protein related to, but not orthologous with, any PcG protein. sop-2 mutations lead to widespread ectopic expression of Hox genes and homeotic transformations. SOP-2 contains a SAM domain, a self-associating protein domain found in other repressors, including a core component of PRC1 and ETS transcription factors. Phylogenetic analysis indicates that this domain is more closely related to those of the ...
The goal of this research is to develop methods for the precise modification of specific target genes in two important genetic model organisms, the nematode Caenorhabditis elegans and the zebrafish Danio rerio. Both nematodes and fish are powerful experimental systems that combine elegant developmental biology with large scale genetics. Both systems have contributed to our understanding of fundamental problems in cancer biology, including programmed cell death, the control of organogenesis, the interaction of cancer susceptibility genes with the environment, and the genetics of melanoma. An important limitation of these model systems is that techniques for site-specific manipulation of the genome are not currently available in either nematodes or fish. Thus, in contrast to murine embryonic stem cells and the yeast S. cerevisiae, it is not possible to knock out specific genes or to precisely control the time and place of gene expression. In the last two years, a powerful new approach to ...
PubMed comprises more than 30 million citations for biomedical literature from MEDLINE, life science journals, and online books. Citations may include links to full-text content from PubMed Central and publisher web sites.
The sys-1 gene encodes a highly divergent β-catenin (6, 8). Several lines of evidence support the idea that SYS-1 is a functional β-catenin. First, transgenic SYS-1 can rescue a null mutant of bar-1, which encodes a typical β-catenin. Second, SYS-1 binds the β-catenin binding domain of POP-1/TCF. Third, SYS-1 acts as a transcriptional coactivator for POP-1 in a TOPFLASH reporter. Fourth, ceh-22 expression in distal SGP daughters depends on POP-1 binding sites in the ceh-22b promoter and also on SYS-1 and POP-1. Therefore, SYS-1 acts in many ways like a typical β-catenin.. Both SYS-1/β-catenin and POP-1/TCF control the SGP asymmetric cell division (7, 9). In pop-1 mutants, as in sys-1 mutants, the SGP daughters both adopt a proximal fate (Fig. 1B). Importantly, POP-1 is asymmetrically distributed to SGP daughters (10), a phenomenon that has been seen in many asymmetric cell divisions and has been dubbed "POP-1 asymmetry" (11). Although counterintuitive, nuclear POP-1 is reduced in distal ...
gi,17508791,ref,NP_492239.1, C-x8-C-x5-C-x3-H type zinc finger containing protein (76.1 kD) (1I793) [Caenorhabditis elegans] gi,7506947,pir,,T24365 hypothetical protein T02E1.3b - Caenorhabditis elegans gi,3879305,emb,CAB04666.1, Hypothetical protein T02E1.3b [Caenorhabditis elegans ...
Aging in C. elegans involves measurable declines in morphology, reproduction, and behavior. Understanding the cellular and molecular processes leading to senescence in this nematode began in the early 1980s with the targeted identification of mutants that extended life span (an AGE phenotype). These studies identified at least two key regulators of life span, DAF-2, an insulin/IGF receptor ortholog, and DAF-16, a Forkhead-related transcription factor. Since then many more genes and pathways involved in senescence have been identified. Almost all of these genes play important roles in cellular and organismal-level processes other than aging, such as dauer formation, stress response, feeding, and chemosensation ...
Individual neurons in vertebrates are typically highly branched with a complex morphology of their processes (axons and dendrites). In C. elegans almost all neuronal processes are unbranched and extend in a stereotpical fashion. The example in Figure 3 shows a pair of sensory neurons (ASH) with cell bodies located in head ganglia. The two ASH neurons are chemosensory neurons. A single process, the dendrite, extends from the cell body towards the tip of the nose. A second process, the axon, grows first towards the ventral cord through the amphid commissure. It then turns anteriorly and loops in a halfcircle around the pharynx (not visible) within a large axon bundle - the nerve ring (note: the processes in the ventral cord in the figure belong to a second pair of neurons (PVQ) with cell bodies in the tail). The nerve ring is a horseshoe-shaped axon bundle containing neuronal processes of sensory and interneurons which form connections (synapses) as they run next to each other.. The invariant ...
With the aid of a pair of sensory neurons, the nematode worm C. elegans is able to detect the Earths magnetic field and use it to navigate towards food sources.
With the aid of a pair of sensory neurons, the nematode worm C. elegans is able to detect the Earths magnetic field and use it to navigate towards food sources.
The C. elegans grinder is an intricately designed, macromolecular structure located in the terminal bulb of the pharynx. It acts as the teeth of C. elegans, crushing bacteria before they are passed to the intestine. The ...
In the nematode Caenorhabditis elegans, inactivating mutations in the insulin/IGF-1 receptor, DAF-2, result in a 2-fold increase in lifespan mediated by DAF-16, a FOXO-family transcription factor. Downstream protein activities that directly regulate longevity during impaired insulin/IGF-1 signaling (IIS) are poorly characterized. Here, we use global cysteine-reactivity profiling to identify protein activity changes during impaired IIS. Upon confirming that cysteine reactivity is a good predictor of functionality in C. elegans, we profiled cysteine-reactivity changes between daf-2 and daf-16;daf-2 mutants, and identified 40 proteins that display a | 2-fold change. Subsequent RNAi-mediated knockdown studies revealed that lbp-3 and K02D7.1 knockdown caused significant increases in lifespan and dauer formation. The proteins encoded by these two genes, LBP-3 and K02D7.1, are implicated in intracellular fatty acid transport and purine metabolism, respectively. These studies demonstrate that cysteine
J. Pathol. 163:2155-2164. , 2001, Amyloid p protein forms ion channels: implications for Alzheimers disease pathophysiology. FASEB J. 15: 2433-2444. -C, Hall, D. , Mathis, C. , 2001, Visualization of fibrillar amyloid deposits in living, transgenic Caenorhabditis elegans animals using the sensitive amyloid dye, X-34. Neurobiol Aging 22:217-226. , 2004, Single chain variable fragments against B-amyloid (AB) can The Contribution of Microscopy to the Study of Alzheimers Disease 39 inhibit AB aggregation and prevent AB-induced neurotoxicity. Interestingly, a rapidly-formed but transient nanocrystalhne from of a 14-amino acid Ap peptide has been described by Otzen and Oliveberg (2004). Using TEM these workers showed that the nanocrystalline form of this peptide leads to the formation of a tangled aggregate (hours) and amyloid fibres (days). 2 Ap protofilaments Definition of the P-sheet-containing protofilament that can be formed by Ap and several other fibril-forming amyloidogenic peptides is by no ...
A formidable barrier to imaging studies of in vivo C. elegans sperm behavior has been the lack of bright, sperm-specific fluorescent markers. Use of dim sperm markers negatively influences the ability to perform confocal imaging in various ways, including but not limited to loss of signal deep into the gonad, which can be ~40 mm thick (Hubbard and Greenstein 2000); loss of spatial and temporal resolution, due to techniques commonly used to address imaging dim signals, such as signal accumulation; and increased phototoxicity and bleaching, due to increased excitation intensity. For in vivo imaging of the C. elegans hermaphrodite gonad, temporal resolution is limited by the rapidity of sheath contraction (McCarter et al. 1999) and the small physical size of sperm cells, parameters that already push the limits of many imaging systems. Researchers may find themselves trapped in the so-called "pyramid of frustration," which refers to the difficult position of balancing the conflicting demands of high ...
C. elegans biologists show an admirable desire to understand all facets of the worms biology, often wanting to relate their work to the context of C. elegans as a "real organism" that lives out in the wild world. However, some early perceptions about C. elegans biology are now known to be incorrect. Here we highlight four common misconceptions to, hopefully, eliminate the perpetuation of these myths.C. elegans is not a soil nematode: it is found in niches rich in decomposing organic matter. Despite old statements of C. elegans living in soil, no species of Caenorhabditis is found commonly in dirt - although Caenorhabditis are terrestrial when compared to marine nematodes. To understand why, it helps to think like a hungry worm. Like all species in the genus, C. elegans eats bacteria and some other microbes, and consequently C. elegans (and related species) occur in the wild with greatest prevalence in niches rich in decomposing organic matter that have abundant bacterial growth, such as rotting ...
Critical role in assembling adherens junctions; adapter protein involved in polarizing protein trafficking in epithelial cells. Necessary to maintain, not establish, the entire terminal web (organelle-depleted, intermediate filament-rich layer of cytoplasm that underlies the apical microvilli of polarized epithelial cells) or brush border assembly at the apical surface gut cells. Required for correct localization of ifb-2 intermediate filaments in the terminal web.
A mutation in the let-653 gene of Caenorhabditis elegansresults in larval death. The lethal arrest is concurrent with the appearance of a vacuole anterior to the lower pharyngeal bulb. The position...