The VERSANT HCV RNA 1.0 Assay is a real-time kPCR assay for quantitative detection of human HCV RNA in plasma or serum of HCV-infected individuals.
The VERSANT® HCV RNA 1.0 Assay (kPCR)* is a real-time kinetic polymerase chain reaction (kPCR) assay for quantitative detection of human hepatitis C virus (HCV) RNA in plasma or serum of HCV-infected individuals. The assay is intended to be used in conjunction with clinical presentation and other laboratory markers of disease status to aid in the management of HCV-infected individuals undergoing antiviral therapy.. ...
HCV infection is one of the main causes of chronic liver disease worldwide.1 Fortunately, with detection and appropriate therapy, the majority of HCV-infected individuals can be cured. The European Association for the Study of the Liver (EASL) recommends response-guided therapy for HCV, which includes the monitoring of treatment efficacy using a real-time PCR-based assay, with a lower limit of detection of 10-20 IU/mL.2 The VERSANT® HCV RNA 1.0 Assay (kPCR)*, which has a limit of detection of 15 IU/mL, provides excellent precision across the dynamic range and 100 percent specificity. Additionally, the assay features technology that is compatible with all HCV genotypes, providing clinicians the information that they need to manage patient therapy.. 1. Lavanchy D. The global burden of hepatitis C. Liver Int 2009; 29:74-81 ...
The performance of the point-of-care Xpert HIV-1 viral load assay was evaluated against the Abbott RealTime PCR m2000rt system. A total of 96 plasma specimens ranging from 2.5 log10 copies ml-1 to 4.99 log10 copies ml-1 and proficiency testing panel specimens were used. Precision and accuracy were checked using the Pearson correlation co-efficient test and Bland-Altman analysis.. RESULTS ...
PCR detection works by heating the DNA sample to about 110°C in order to split the DNA. Then the PCR cools off to 57°C in order for the primer to attach to the DNA strands. The PCR then heats to 72°C so the DNA strand can be re-written. The r17879961 cancer-associated sequence will produce a DNA signal because the reverse primer used, AACTCTTACACTCGATACAT will only attach if the DNA sample has the same coding with the cancer-associated sequence "ACT". If the DNA sample does not have the cancer-associated sequence the primer will not attach and there will be no DNA signal.,br ...
Investigator Quantiplex Pro Kit, For quantification of human and male DNA with high sensitivity and a straightforward quality assessment
IVDD, CE marked. Product availability varies from country to country and is subject to local regulatory requirements.. VERSANT is a registered trademark of Siemens. All other marks are the property of their respective owners.. The products/features (mentioned herein) are not commercially available in all countries. Due to regulatory reasons their future availability cannot be guaranteed. Please contact your local Siemens organization for further details. ...
The products/features (mentioned herein) are not commercially available in all countries. Due to regulatory reasons their future availability cannot be guaranteed. Please contact your local Siemens organization for further details. ...
Likely a new method, although hard to be certain. This definitely happens when labs go to a new viral load assay. Depending on the technology used, some recalibration will be required, either up or...
Buy The Review E-newsletter design by super_things on ThemeForest. About The Review An elegant and clean layout, ideal for business and commercial use. Special Campaign Monitor version...
Product Description Convenient real-time RNA quantification in one EASY step. Biocredes One-Step TaqTicProbe qRT-PCR iCycler Kit uses a combination of high-qua
In biology, a branched DNA assay is a signal amplification assay (as opposed to a target amplification assay) that is used to detect nucleic acid molecules. A branched DNA assay begins with a dish or some other solid support (e.g., a plastic dipstick). The dish is peppered with small, single stranded DNA molecules (or chains) that stick up into the air. These are known as capture probe DNA molecules. Next, an extender DNA molecule is added. Each extender has two domains; one that hybridizes to the capture DNA molecule and one that "hangs out" in the air. The purpose of the extender is two-fold. First, it creates more available surface area for target DNA molecules to bind, and second, it allows the assay to be easily adapted to detect a variety of target DNA molecules. Once the capture and extender molecules are in place and they have hybridized, the sample can be added. Target molecules in the sample will bind to the extender molecule. This results in a base peppered with capture probes, ...
The VERSANT HIV-1 RNA 1.0 Assay (kPCR) provides efficient and reproducible extraction, amplification, and detection of HIV-1 RNA.
A method for determining a molecule A comprising a sample of molecules capable of participating in formation of triplex structures is useful for sensitive determination. The principle can be used to determine any kind of analytes.
article{BUT115093, author="Karel {Sedlář} and Helena {Škutková} and Martin {Vítek} and Ivo {Provazník}", title="Set of rules for genomic signal downsampling", annote="Comparison and classification of organisms based on molecular data is an important task of computational biology, since at least parts of DNA sequences for many organisms are available. Unfortunately, methods for comparison are computationally very demanding, suitable only for short sequences. In this paper, we focus on the redundancy of genetic information stored in DNA sequences. We proposed rules for downsampling of DNA signals of cumulated phase. According to the length of an original sequence, we are able to significantly reduce the amount of data with only slight loss of original information. Dyadic wavelet transform was chosen for fast downsampling with minimum influence on signal shape carrying the biological information. We proved the usability of such new short signals by measuring percentage deviation of pairs of ...
Results bDNA was quantified in 714 whole blood samples. There was no correlation between bDNA levels and baseline characteristics such as age and gender, nor with static markers of liver function such as MELD. Elevated bDNA levels were associated with development of infection within the first 7 days in patients treated with prednisolone (p = 0.001), and remained independently associated with the subsequent development of infection after multivariate analysis (p = 0.02). Importantly, bDNA levels were not associated with the development of infection in patients treated without prednisolone (p = 0.43).. Elevated bDNA levels were associated with death at 90 days (p = 0.05). Mortality in prednisolone treated patients was increased for patients with high bDNA compared to patients with low bDNA (hazard ratio 2; p = 0.02). Accordingly, patients with elevated bDNA were more likely to die if they were randomly allocated prednisolone therapy (OR 2.9, 95% CI 1.2-6.9, p = 0.02). We estimate that if patients ...
You have made the correct diagnosis. Blipping is usually caused by issues associated with the viral load assay or more specifically with the blood collection tube that the sample is collected in. In...
Title: Alabel-free and enzyme-free signal amplification strategy for a sensitive RNase Hactivity assay Author: Chang Yeol Lee,‡Hyowon Jang,‡ Ki Soo Park* and Hyun Gyu Park* (‡: equal contribution) Journal: Nanoscale 2017, 9, 16149-16153 Abstra
Title: Alabel-free and enzyme-free signal amplification strategy for a sensitive RNase Hactivity assay Author: Chang Yeol Lee,‡Hyowon Jang,‡ Ki Soo Park* and Hyun Gyu Park* (‡: equal contribution) Journal: Nanoscale 2017, 9, 16149-16153 Abstra
Ready and easy-to-use VERSANT Urine Transport Kit (UTK) requires no manual pipetting, centrifugation, or off-line processing steps ...
Tumor-derived exosomes (TEXs) are extracellular vesicles that are continuously released into the blood by tumor cells and carry specific surface markers of the original tumor cells. Substantial evidence has implicated TEXs as attractive diagnostic markers for cancer. However, the detection of TEXs in blood at an early tumor stage is challenging due to their very low concentration. Here, we established a method called PLA-RPA-TMA assay that allows TEXs to be detected with high sensitivity and specificity. Based on two proximity ligation assay (PLA) probes that recognize a biomarker on a TEX, we generated a unique surrogate DNA signal for the specific biomarker, which was synchronously amplified twice by recombinase polymerase amplification (RPA) coupled with transcription-mediated amplification (TMA), and then the products of the RPA-TMA reaction were quantitatively detected using a gold nanoparticle-based colorimetric assay ...
TY - JOUR. T1 - Hepatitis C virus RNA quantification in right and left lobes of the liver in patients with chronic hepatitis C. AU - Idrovo, V.. AU - Dailey, P. J.. AU - Jeffers, Lennox J. AU - Coelho-Little, E.. AU - Bernstein, D.. AU - Bartholomew, M.. AU - Alvarez, L.. AU - Urdea, M. S.. AU - Collins, M. L.. AU - Schiff, Eugene R. PY - 1996/9/1. Y1 - 1996/9/1. N2 - Quantification of hepatitis C virus RNA in liver tissue is likely to be useful in the study of the natural history, pathogenesis, progression and treatment of hepatitis C virus-associated liver disease. Quantitative measurements of hepatitis C virus RNA in liver biopsy samples using the branched DNA (bDNA) signal amplification assay were carried out. The aims of this study were threefold: first, to assess the level of hepatitis C virus RNA in biopsy samples from the right and left lobes of the liver; second, to evaluate the correlation between hepatitis C virus RNA levels in serum and liver; and third, to investigate the ...
Utility of random amplification of polymorphic DNA assay and BOX-A PCR in molecular characterization of Streptococcus pneumoniae isolates recovered from various
16 x PERSONA MONITOR TEST STICKS for the NEW and OLD Persona Monitor These Persona monitor sticks are for use with the NEW and the OLD Persona ovulation
Javais prévu daller vers la Croix de Belledonne, mais lenneigemment est encore énorme en cette fin mai. Et donc pour éviter une longue galère dans de la neige molle je me tourne vers le Grand Colon, plus proche et plus facile daccès ...
Leader LV5700A The LV 5700A is a Multi SDI Monitor for HD/SD-SDI signals with an XGA TFT color LCD in an adjustable tilt front panel. The monitor tests 14 HD-SDI and SD-SDI formats with total digital processing c
San Diego, CA. FDA-cleared TMA tests are available for the detection of Chlamydia trachomatis, Neisseria gonorrhoeae, and Mycobacterium tuberculosis (APTIMA CT, APTIMA GC, and, AMPLIFIED Mycobacterium tuberculosis Direct Test [MTD] assays, respectively) An FDA-approved TMA qualitative assay for hepatitis C virus (HCV) is also available (VERSANT HCV RNA [distributed by Siemens Healthcare Diagnostics, Deerfield, IL]) - Nucleic acid sequence-based amplification (NASBA) ◆ NASBA is an isothermal amplification technique and can be used for the amplification of a DNA or RNA target. Following the first PCR cycle, there is (theoretically) a per-cycle doubling in the number of copies of the PCR product. (Modified from Leonard DGB [ed]: Diagnostic Molecular Pathology. ) - Basic PCR method ◆ During the denaturation stage, sample specimen DNA is rendered single-stranded by heating to 94° to 98°C ◆ In the annealing step, oligonucleotide primers hybridize with the target sequences they have been ...
When a test has more than two possible outcomes, its accuracy can be reported as pairs of sensitivity and specificity corresponding to each degree of abnormality. This approach, the basis for receiver-operating characteristic analysis, maximizes the use of diagnostic information (2). When the diagnostic threshold is set at a lower degree of abnormality, the sensitivity of the test tends to increase but its specificity tends to decrease. The opposite occurs when a higher diagnostic threshold is selected. In the case of HIV viral load assays, if more viral units must be detected to report the test result as abnormal, the specificity will increase. As noted by Rich and colleagues, "the lowest reported plasma viral load during seroconversion is more than 17 times higher than the highest viral load detected in our three patients." Thus, for the diagnosis of acute infection, the threshold should probably be set much higher ...
Dr Ellen Jo Baron, Emeritus Professor of Pathology at the Stanford University Medical Center and associated with Cepheid, gave the example of Cepheids Xpert HIV1 Viral Load assay which is strictly not a point-of-care test. But it can be done in a small laboratory that has necessary resources. It is fully automated, can identify all the sub-types and gives results in 90 minutes. Dr Baron shared that Cepheid has got a grant to create a finger-stick test for viral load testing, which is battery operated, portable, rugged, relatively affordable, can be run on omni instrument at remote sites. It is hoped to give results in less than 60 minutes, with an accuracy of 500 copies/ml ...
Make an appointment for the Holter Monitor Test with Dr. Roya Golshani if you have symptoms, such as irregular palpitations/ heartbeats, chest pain, and shortness of breath.
Have clearly documented HIV infection, determined by the presence of HIV confirmed by one of the following: Western blot, immunofluorescence assay, HIV culture, polymerase chain reaction (PCR) amplification, branched DNA (bDNA) signal amplification or the presence of p24 antigen. These tests may have been performed at any time in the past, but the results must be available for review by Serono prior to entry into the study ...
Have clearly documented HIV infection, determined by the presence of HIV confirmed by one of the following: Western blot, immunofluorescence assay, HIV culture, polymerase chain reaction (PCR) amplification, branched DNA (bDNA) signal amplification or the presence of p24 antigen. These tests may have been performed at any time in the past, but the results must be available for review by Serono prior to entry into the study ...
Maintenance and service is a key contributor to the total cost of train ownership. LORD MicroStrain® wireless sensing systems provide fleet operators with a quick and cost-effective path to embedding health sensing capabilities on both new and existing cr. ...
The farnesoid X receptor (FXR) controls the synthesis and transport of bile acids (BAs). Mice lacking expression of FXR, designated Fxr-null, have elevated levels of serum and hepatic BAs and an increase in BA pool size. Surprisingly, at 12 months of age, male and female Fxr-null mice had a high incidence of degenerative hepatic lesions, altered cell foci and liver tumors including hepatocellular adenoma, carcinoma and hepatocholangiocellular carcinoma, the latter of which is rarely observed in mice. At 3 months, Fxr-null mice had increased expression of the proinflammatory cytokine IL-1beta mRNA and elevated beta-catenin and its target gene c-myc. They also had increased cell proliferation as revealed by increased PCNA mRNA and BrdU incorporation. These studies reveal a potential role for FXR and BAs in hepatocarcinogenesis.
Generally, an immunoaffinity SPR biosensor detects a target analyte in a sample through highly selective adsorption by using the antigen–antibody interaction. For improving the sensitivity, various kinds of particles have been added to the already bound analytes on the SPR biosensor (sandwich assay). In this work, signal amplification was demonstrated by the expression of the IgG-binding Z-domain of protein A on the outer membrane of Escherichia coli via "Autodisplay". The amount of Z-domain of protein A expressed on the outer membrane was calculated to be 280,000 molecules per cell. In addition, the IgGbinding ability of the expressed proteinwas characterized using FACS analysis. The signal amplification of the SPR biosensor was performed in the sandwich assay format using a model of horseradish peroxidase (HRP); the limit of detectionwas determined to be significantly improved from1 g/ml to 1 ng/ml. Finally, myoglobin analysis was demonstrated for the medical diagnosis of cardiac ...
Dr Ellen Jo Baron, Emeritus Professor of Pathology at the Stanford University Medical Center and associated with Cepheid, gave the example of Cepheids Xpert HIV1 Viral Load assay which is strictly not a point-of-care test. But it can be done in a small laboratory that has necessary resources. It is fully automated, can identify all the sub-types and gives results in 90 minutes. Dr Baron shared that Cepheid has got a grant to create a finger-stick test for viral load testing, which is battery operated, portable, rugged, relatively affordable, can be run on omni instrument at remote sites. It is hoped to give results in less than 60 minutes, with an accuracy of 500 copies/ml ...
TestLine Clinical Diagnostics s.r.o. - Development, production and distribution of laboratory diagnostics for human and veterinary use
TY - JOUR. T1 - Evaluation of the COBAS AMPLICOR CMV MONITOR test for detection of viral DNA in specimens taken from patients after liver transplantation. AU - Sia, Irene G.. AU - Wilson, Jennie A.. AU - Espy, Mark J.. AU - Paya, Carlos V.. AU - Smith, Thomas F.. PY - 2000/2/16. Y1 - 2000/2/16. N2 - Detection of cytomegalovirus (CMV) DNA in blood by PCR is a sensitive method for the detection of infection in patients posttransplantation. The test, however, has low specificity for the identification of overt CMV disease. Quantitative CMV PCR has been shown to overcome this shortcoming. The COBAS AMPLICOR CMV MONITOR test was evaluated by using consecutive serum and peripheral blood mononuclear cell (PBMN) samples from liver transplant patients. Twenty-five patients had CMV viremia (by shell vial cell culture assay) and/or tissue-invasive disease (by biopsy); 20 had no active infection. A total of 262 serum and 62 PBMN specimens were tested. Of 159 serum specimens from patients with overt CMV ...
Brambilla, D., Granger, S., Jennings, C., & Bremer, J. (2001). Effect of errors in the sequence of optical densities from the Roche Amplicor HIV-1 Monitor assay on the validity of assay results. Journal of Clinical Microbiology, 39, 1118 - 1120. ...
Disease marker detection plays an important role in clinical practice; however, rapid, low-cost and simultaneous detection of multiple trace disease markers remain a challenge because of low abundance of related strategies. Herein, we report a G-quadruplex DNAzyme and nicking enzyme-assisted multiplex chemil
OBJECTIVES : To use SIVmac-infected Chinese-origin rhesus macaques (Ch Rh) to characterize the immunopathology of the long term non-progressor (LTNP) state. The key questions addressed were whether or not LTNP experience an early and rapid loss of mucosal CD4 T cells during the acute infection and the mechanisms by which they maintain the LTNP state. METHODS : Ch Rh were infected with SIVmac239. Polychromatic flow cytometry was used to analyze T lymphocyte subsets from blood, lymph nodes and gut tissues during SIV infection. Plasma viral loads were monitored by bDNA assay. Two LTNP were treated with anti-CD8 antibody to deplete CD8 cells in vivo. RESULTS : Thirty-one percent (5/16) of SIVmac239-infected ChRh having low viral loads for as long as 6 years were LTNP. Both LTNP and progressors had similar levels of gut memory CD4/CCR5 T cells (target cells) before infection and there was an early and profound depletion of target cells in both groups. LTNP were distinguished by gradual restoration of
African Traditional Medicines (ATMs) serve as a major source of primary healthcare for African people. The reasons for their use range from easy access, affordability, beliefs in traditional systems and long term safety. ATMs have been used to treat individuals infected with HIV and therefore need scientific validation; a view supported by Traditional Health Practitioners (THPs). This study aimed to evaluate the in vitro cytotoxicity, immune modulatory and anti-HIV activities of traditional multiple herbal preparations from local THPs. Ugambu, Ihashi, Product Nene, Product Blue, SPNa and SDKc ATM were supplied by local THPs. Changes in adenosine triphosphate (ATP) & glutathione (GSH) over 24 hours were measured using luminometry. Changes in 12 cytokines were assayed using an ELISA-based absorbance assay. Protective effects against HIV killing of MT-4 cells were tested using the XTT assay and antiviral activity was measured using an HIV-1 viral load assay. Cyclosporine and AZT were used as ...
A viral load test measures how much human immunodeficiency virus (HIV) is in the blood. Viral load is first measured when you are diagnosed with HIV infection.
Siemens proprietary extraction technology uses magnetic particles coated with a nano layer of silica for the efficient isolation of quality nucleic acids. Homogeneous bead size and shape improves reproducibility, recovery, and quality of RNA and DNA extractions to enhance assay performance ...
RNAscope® assay is an innovative and proprietary RNA in situ hybridization (ISH) assay based on ACDs patented technology with signal amplification and simultaneous background noise suppression. RNAscope® assay delivers quantitative, sensitive and specific molecular detection of RNA species on a cell-by-cell basis with morphological context in a single assay. In this webinar, we will focus on how to analyze and review RNAscope® assay data images successfully. We will cover the following topics:. ...
The substantial amount of RNA required for expression analysis is a limiting factor for the cDNA microarray technology in a number of potentially important applications. Two main approaches, signal amplification and global mRNA amplification, have been developed to overcome this obstacle. Signal amplification, such as dendrimer technology [1] and tyramide signal amplification (TSA) [2] aim to increase the fluorescent signal emitted per mRNA molecule. Global mRNA amplification has the purpose of increasing the number of available transcript equivalents for sufficient labeling from a limited starting amount. In current implementations, mRNA amplification techniques require less RNA than those based on signal amplification.. Van Gelder et al. [3] devised a multistep strategy to amplify mRNA from limited quantities of cDNA in studies of gene expression. Their method is commonly referred to in the literature as the Eberwine method. The general steps involve reverse transcription of mRNA with an oligo ...
October 31, 2019 - The new Quantitative Assay Apps from BioTek Instruments, Inc. provide convenience and simplicity for researchers performing four commonly used detection-based applications: absorbance-based BCA, Bradford, Lowry protein assays, and fluorescence-based DNA assays. These easy-to-use Apps are powered through Gen5™ Data Analysis Software and are compatible with BioTek microplate readers equipped with the relevant detection mode, including the popular Cytation™ and Synergy™ multi-mode readers. Weiterlesen ...
RNAscope® assay is an innovative and proprietary RNA in situ hybridization (ISH) assay based on ACDs patented technology with signal amplification and simultaneous background noise suppression.
The cobas b 221 system is a quick and reliable blood gas and electrolyte analyser which measures 18 key critical care parameters.