Shop Glutamate/aspartate import solute-binding protein ELISA Kit, Recombinant Protein and Glutamate/aspartate import solute-binding protein Antibody at MyBioSource. Custom ELISA Kit, Recombinant Protein and Antibody are available.
K12340 tolC; outer membrane protein K12530 rtxB; ATP-binding cassette, subfamily B, bacterial RtxB K12530 rtxB; ATP-binding cassette, subfamily B, bacterial RtxB K12531 rtxE; ATP-binding cassette, subfamily B, bacterial RtxE K12532 rtxD; membrane fusion protein, RTX toxin transport system K12532 rtxD; membrane fusion protein, RTX toxin transport system K12536 hasD; ATP-binding cassette, subfamily C, bacterial exporter for protease/lipase K12537 hasE; membrane fusion protein, protease secretion system K13408 raxA; membrane fusion protein K13409 raxB; ATP-binding cassette, subfamily B, bacterial RaxB K02452 gspC; general secretion pathway protein C K02453 gspD; general secretion pathway protein D K02454 gspE; general secretion pathway protein E [EC:7.4.2.8] K02455 gspF; general secretion pathway protein F K02456 gspG; general secretion pathway protein G K02457 gspH; general secretion pathway protein H K02458 gspI; general secretion pathway protein I K02459 gspJ; general secretion pathway protein J ...
K12340 tolC; outer membrane protein K12530 rtxB; ATP-binding cassette, subfamily B, bacterial RtxB K12530 rtxB; ATP-binding cassette, subfamily B, bacterial RtxB K12531 rtxE; ATP-binding cassette, subfamily B, bacterial RtxE K12532 rtxD; membrane fusion protein, RTX toxin transport system K12532 rtxD; membrane fusion protein, RTX toxin transport system K12536 hasD; ATP-binding cassette, subfamily C, bacterial exporter for protease/lipase K12537 hasE; membrane fusion protein, protease secretion system K13408 raxA; membrane fusion protein K13409 raxB; ATP-binding cassette, subfamily B, bacterial RaxB K02452 gspC; general secretion pathway protein C K02453 gspD; general secretion pathway protein D K02454 gspE; general secretion pathway protein E [EC:7.4.2.8] K02455 gspF; general secretion pathway protein F K02456 gspG; general secretion pathway protein G K02457 gspH; general secretion pathway protein H K02458 gspI; general secretion pathway protein I K02459 gspJ; general secretion pathway protein J ...
We have identified and analysed a putative response regulator two-component gene (CaSSK1) from Candida albicans and its encoding protein (CaSsk1p). CaSSK1 has an open reading frame of 2022 bp. In the promotor region of CaSSK1 a short sequence is found that matches the consensus sequence of the stres …
The molecular determinants necessary and sufficient for recognition of its specific DNA target are contained in the C-domain (H-NSctd) of nucleoid-associated protein H-NS. H-NSctd protects from DNaseI cleavage a few short DNA segments of the H-NS-sensitive hns promoter whose sequences closely match the recently identified H-NS consensus motif (tCGt/aTa/tAATT) and, ... read more alone or fused to the protein oligomerization domain of phage λ CI repressor, inhibits transcription from the hns promoter in vitro and in vivo. The importance of H-NS oligomerization is indicated by the fact that with an extended hns promoter construct (400 bp), which allows protein oligomerization, DNA binding and transcriptional repression are highly and almost equally efficient with native H-NS and H-NSctd::λCI and much less effective with the monomeric H-NSctd. With a shorter (110 bp) construct, which does not sustain extensive protein oligomerization, transcriptional repression is less effective, but native H-NS, ...
This study revealed that AlgO binds specifically to the algO-algS intergenic region in the alginate genetic cluster and alginate-degraded products function as an effector for the dissociation of AlgO from the algO-algS intergenic region. Primary structure analysis of AlgO and gel mobility shift assays suggest that the C-terminal domain of AlgO contains the structural fold common to periplasmic solute-binding proteins. The strain A1 alginate-binding proteins (AlgQ1 and AlgQ2) are typical periplasmic solute-binding proteins (9). To investigate the binding mode of AlgO to alginate oligosaccharides, the tertiary structure of the C-terminal domain of AlgO was built by homology modeling with a SWISS-MODEL program (Fig. 1C, bottom). The structural architecture shows that the C-terminal domain comprises two domains with an α/β fold. The two domains are connected by a long linker and separated by a cleft. These structural features are also observed in AlgQ1 and AlgQ2 (39, 40). X-ray crystallography of ...
InterPro provides functional analysis of proteins by classifying them into families and predicting domains and important sites. We combine protein signatures from a number of member databases into a single searchable resource, capitalising on their individual strengths to produce a powerful integrated database and diagnostic tool.
Link to Pubmed [PMID] - 26374675. Sci Rep 2015 Sep;5:14223. Many Gram-negative bacteria use Type I secretion systems, T1SS, to secrete virulence factors that contain calcium-binding Repeat-in-ToXin (RTX) motifs. Here, we present structural models of an RTX protein, RD, in both its intrinsically disordered calcium-free Apo-state and its folded calcium-bound Holo-state. Apo-RD behaves as a disordered polymer chain comprising several statistical elements that exhibit local rigidity with residual secondary structure. Holo-RD is a folded multi-domain protein with an anisometric shape. RTX motifs thus appear remarkably adapted to the structural and mechanistic constraints of the secretion process. In the low calcium environment of the bacterial cytosol, Apo-RD is an elongated disordered coil appropriately sized for transport through the narrow secretion machinery. The progressive folding of Holo-RD in the extracellular calcium-rich environment as it emerges form the T1SS may then favor its ...
Genome-wide transcriptional analysis using DNA macroarrays.According to the results of the initial adhesion tests, the factor(s) involved in increased adherence was expressed in the exponential growth phase. In order to assess differences in the transcription profiles of exponentially growing planktonic cells (M63 medium, 37°C) of wild-type strain 536 and the isogenic rfaH mutant, E. coli K-12 strain MG1655-specific DNA arrays (Panorama E. coli gene arrays; Sigma-Genosys, Cambridge, United Kingdom) were used in combination with the so called E. coli pathoarray carrying an assortment of probes specific for many of the known pathogenicity island- or virulence-associated genes of uropathogenic E. coli strain 536, as well as other extraintestinal pathogenic and intestinal pathogenic E. coli strains (26). For each strain, four different RNA preparations from independent cultures were used for cDNA synthesis as follows. DNA-free total RNA was reverse transcribed and radioactively labeled. In short, ...
complex with c-di-GMP. C-di-GMP binds to the protein as an intercalated dimer, displacing the C-terminal 310 helix found in the apo form. The N-terminal part of ...
A search for factors that are necessary for the pathogenicity of Gram-negative microbes has identified many gene clusters that are closely related among different bacterial species (1). Several of these genetic loci encode type III secretion machines for the translocation of polypeptides across the bacterial double membrane envelope (1). Some mammalian pathogens such as Yersinia, Salmonella, Escherichia coli, Pseudomonas, and Shigella use type III machines for the injection of virulence factors into the cytosol of eukaryotic cells (2-7). A similar strategy is thought to be used by several plant pathogens; however, a direct demonstration of their protein injection has not yet been achieved (7). Salmonella typhimurium and perhaps other Gram-negative bacteria harbor two gene clusters that each specifies a type III machine (2). Mutants that abolish the function of individual type III machines arrest pathogenicity at distinct steps during Salmonella infection, indicating that protein secretion is ...
Our main project is on Type III Secretion Apparatus which is one of the most amazing biological devices. This apparatus which looks like a syringe can pass a whole protein molecule from a bacterial cell to a target eukaryotic cell. However, this apparatus is an organelle of pathogenic gram-negative bacterium such as Salmonella and Yersinia. So we are aiming at making this device safely available using E. coli. ...
nbsp;  Our main project is on Type III Secretion Apparatus which is one of the most amazing biological devices. This apparatus which looks like a syringe can pass a whole protein molecule from a bacterial cell to a target eukaryotic cell. However, this apparatus is an organelle of pathogenic gram-negative bacterium such as Salmonella and Yersinia. So we are aiming at making this device safely available using E. coli ...
Sara V. Pais. PhD Student. Project: Characterization of novel type III secretion effectors of Chlamydia trachomatis. Phone: +351 21 294 8530 ...
Approximately 20% of bacterial proteins have functions outside the cytoplasm ( 1 ). Consequently, all bacteria possess protein export pathways that transport proteins made in the cytoplasm beyond the cytoplasmic membrane. These exported proteins may remain in the bacterial cell envelope or be further secreted to the extracellular environment. Many exported proteins function in essential physiological processes. Additionally, in bacterial pathogens, many exported proteins have functions in virulence. Consequently, the pathways that export proteins are commonly essential and/or are important for pathogenesis. Across bacteria, including mycobacteria, there are conserved protein export pathways: the general secretion (Sec) and the twin-arginine translocation (Tat) pathways. Both Sec and Tat pathways are essential to the viability of Mycobacterium tuberculosis and both also contribute to virulence (L. Rank and M. Braunstein, unpublished; 2 - 4 ). In addition to these conserved pathways, bacterial pathogens
The PDB archive contains information about experimentally-determined structures of proteins, nucleic acids, and complex assemblies. As a member of the wwPDB, the RCSB PDB curates and annotates PDB data according to agreed upon standards. The RCSB PDB also provides a variety of tools and resources. Users can perform simple and advanced searches based on annotations relating to sequence, structure and function. These molecules are visualized, downloaded, and analyzed by users who range from students to specialized scientists.
An adaptive response to environmental stimuli is essential for life. The most widespread response mechanism involves the transfer of a phosphoryl group amongst the proteins in a signalling process. Two-component signal transduction systems are the chief signalling devices in bacteria and archaea. Actually, they are found in all life domains, although not in animals. A single bacteria can contain tens to hundreds of two-component systems controlling vital processes such as metabolism, development, motility, response to stress or virulence. These systems offer enormous possibilities for the development of new antimicrobials because they play a paramount role in bacterial physiology and in virulence processes, allowing adaptation of a parasite to its human host, or even triggering resistance to known antibiotics.. Although there are numerous variations in the details, two components systems obey the same basic pattern. The prototype consists of two proteins. One of them is a homodimeric membrane ...
Protecting Yourself in Hostile Environments | SHIELD offers a self-protection course that learns you to operate under extreme conditions in conflict areas.
The type III secretion system (TTSS) is a key mechanism for host cell interaction used by a variety of bacterial pathogens and symbionts of plants and animals including humans. The TTSS represents a molecular syringe with which the bacteria deliver effector proteins directly into the host cell cytosol. Despite the importance of the TTSS for bacterial pathogenesis, recognition and targeting of type III secreted proteins has up until now been poorly understood. Several hypotheses are discussed, including an mRNA-based signal, a chaperon-mediated process, or an N-terminal signal peptide. In this study, we systematically analyzed the amino acid composition and secondary structure of N-termini of 100 experimentally verified effector proteins. Based on this, we developed a machine-learning approach for the prediction of TTSS effector proteins, taking into account N-terminal sequence features such as frequencies of amino acids, short peptides, or residues with certain physico-chemical properties. The ...
The type III secretion system (TTSS) is a key mechanism for host cell interaction used by a variety of bacterial pathogens and symbionts of plants and animals including humans. The TTSS represents a molecular syringe with which the bacteria deliver effector proteins directly into the host cell cytosol. Despite the importance of the TTSS for bacterial pathogenesis, recognition and targeting of type III secreted proteins has up until now been poorly understood. Several hypotheses are discussed, including an mRNA-based signal, a chaperon-mediated process, or an N-terminal signal peptide. In this study, we systematically analyzed the amino acid composition and secondary structure of N-termini of 100 experimentally verified effector proteins. Based on this, we developed a machine-learning approach for the prediction of TTSS effector proteins, taking into account N-terminal sequence features such as frequencies of amino acids, short peptides, or residues with certain physico-chemical properties. The ...
The proposed mathematical model was found to be reasonable in characterizing bacterial growth and predicting the fitness cost of resistance. This simple method appears robust in the assessment of fitness cost associated with drug resistance and warrants further investigations.
Bacterial protein structures can expedite the development of novel antibiotics. Here is the latest research on bacterial proteins and the resolution of their structures. ...
As a member of the wwPDB, the RCSB PDB curates and annotates PDB data according to agreed upon standards. The RCSB PDB also provides a variety of tools and resources. Users can perform simple and advanced searches based on annotations relating to sequence, structure and function. These molecules are visualized, downloaded, and analyzed by users who range from students to specialized scientists.
As a member of the wwPDB, the RCSB PDB curates and annotates PDB data according to agreed upon standards. The RCSB PDB also provides a variety of tools and resources. Users can perform simple and advanced searches based on annotations relating to sequence, structure and function. These molecules are visualized, downloaded, and analyzed by users who range from students to specialized scientists.
As a member of the wwPDB, the RCSB PDB curates and annotates PDB data according to agreed upon standards. The RCSB PDB also provides a variety of tools and resources. Users can perform simple and advanced searches based on annotations relating to sequence, structure and function. These molecules are visualized, downloaded, and analyzed by users who range from students to specialized scientists.
During infection, senses and responds to stress; such responses may be modulated by MisRS (NGO0177 and NGO0176), a two-component system that is a homolog of CpxRA. In , CpxRA senses and responds to envelope stress; CpxA is a sensor kinase/phosphatase for CpxR, a response regulator. When a mutant is grown in medium containing glucose, CpxR is phosphorylated by acetyl phosphate but cannot be dephosphorylated, resulting in constitutive activation. Kandler and coworkers (J. L. Kandler, C. L. Holley, J. L. Reimche, V. Dhulipala, J. T. Balthazar, A. Muszynski, R. W. Carlson, and W. M. Shafer, Antimicrob Agents Chemother 60:4690-4700, 2016, https://doi.org/10.1128/AAC.00823-16) showed that MisR (CpxR) is required for the maintenance of membrane integrity and resistance to antimicrobial peptides, suggesting a role in gonococcal survival Here, we evaluated the contributions of MisR and MisS (CpxA) to gonococcal infection in a murine model of cervicovaginal colonization and identified MisR-regulated genes ...
Our aims in this competitive renewal application are shaped by our observations during the previous funding period that confirmed the critical role of cyclooxyg...
Bacterial proteins exported to the cell surface play key cellular functions. However, despite the interest to study the localisation of surface proteins such
MIT researchers have discovered why an unusually short bacterial protein can have many more interactions than would normally be expected of something its size.
Open full size. Functional types of settlements. The map Functional types of settlements is created using conventional symbols. It shows the distribution of settlements within the Baikal basin and their economic significance. The main content of the map is the network of urban and rural settlements with their population. The size of population is shown by the symbols of different sizes in accordance with the selected scale of nine gradations of the population size. The color of symbols shows the functional type of settlements determined based on the structure of employment of the local population in various sectors of economy.. A dominant role in the settlement network formed in the Baikal basin is played by large multi-functional industrial-transport, administrative-cultural, and scientific centers of the state (Ulaanbaatar) and regional (Irkutsk, Ulan-Ude, and Chita) significance.. Various specialized industrial and transport centers are almost exclusively confined to the railway lines. ...
Virulence, Disease and DefenseResistance to antibiotics and toxic compoundsCobalt-zinc-cadmium resistance Transcriptional regulator, MerR family ...
Gentaur molecular products has all kinds of products like :search , GenWay \ Hypothetical protein STARD7 - \ 10-288-22258F for more molecular products just contact us
Debby Brown, National Handi Quilter Educator, demonstrates how to use the TruStitch™ Stitch Regulation System on the HQ Sweet Sixteen sit-down machine. Clip is from Debbys video Sit-Down .... ...
hypothetical protein [hypothetical protein] GTGAGCGCGCCGCCGGCCGCCCTGTCGCCCACCGAGCGGGGCACGGAGTGCGACGCGCTG ATCGACGACTGGCTCGGGACCGACCTCGACGCGTGGACACGGAAGGTGGTGGCGCGGCAC TTCCACCCGGAGACCGGCAGTCCGTACTGGCTGCGGCGCGCCGCTGGACTGGGCTTCGAC GCGCGGGACATCACCCGCTATGACCAGCTCACGGCGTTCGGACCGTTCCCGGTGGACATC CTGCGCTCCCAGGACCCGGCGGATCTGGTGCCGCTCGACGTGCCGCGCCCGCTGACCGGC CGCGTCTGGGACACCGGCGGCACGACCGGCGCGCCCTGTCGGCTGTTCTACACACCCGCC ATGCTGCTGCACCGGGGCGCGTGGCGCCGCTGGTCCTTCGTCACCGAGGGGTTCACCCAG GGGCGGACCTGGCTCCAGGCGACCCCCACGGGACCGCATCTGATCGGCAACGGCATGTGG GAGGTGTCGGACCTGTACGCCGGTCAGGTGTACGGCGTCGACATGGACCCGCGCTGGGTC AAGCGGCTCATCCGGGCCGGCCGGCTGGCGGACGCGACCGAGTACACCACCCATCTGCTG GAGCAGGTCACCGACGTGCTCATCCACGGCCGGATCGACTACCTCAACACCACTCCCGCG CTCTTCCTGGCGCTGGTGCGCCGCCATCCCGAACTGGTCGCACCGCTGCGGGGGGTGCGG CTGAGCGGCACGCAGCTGAGCCCGGACATGTACCGGGACTTCATGGCCGCGATGGACGAC GGAATCTGCGGCCGCAGCTACGGCAACACCTTCGGCAACGCGGCGGGGCTGCCCGTCGAG CAGAACGCCGAACTCATGCCCTATGTTCCGAATTATCCACAGGTGACAATGAACGTCGTA ...
1.Grow cells to mid-log (~1x107 cells/ml; A600 = 0.7 or klett 80) and collect 1.5 ml cells in 1.5 ml microfuge tube (1 minute, 14000xg). It is important not to grow the cells to a high density as this method will not work well ...
hypothetical protein] GTGACCCATCACCGCCGCCGCGCCGCCCGGCGCCGCGACCGCACTCGCCGGATCACACCC CGCACCCATTGGCTGCTGCTCAGCGTGTTCGCGGTCACCTTGTCCACGGCCCTGCTGCTC CAGGGCTACACCCACCACATGTTCGGCATCACCTCGGACGCCGTGACCGGCGTCCGGGGC AGGAGCGACATGGTGCCCGCCCGGGTGGCCCACGGCGGCCCCGTGATCGCGGGCGCCGCC ACCTCTCCCCACACCGCCCGGGTGCGGCCCCGCACCATCGCGCTGACCTTCGACGACGGC CCGGACCCCACCTGGACGCCACGCATCCTGGAGGTGCTGCGCCGCAACCACGTGCACGCG ACCTTCTTCGTCGTCGGGACCCAGGTCGTCGCCCACCCCGAGCTGGTCCGCCGTATCGTC GCCGACGGCCACCAGATCGGCATCCACACCTTCACCCATCCCGACCTGGCCCGTCTCGCC CCGTGGCAACGCTCGCTGGAGTTGCGTGAGACGCAGTTGGCGGTGGCCGGCGCCGCGGGG GTCACCACCGCACTGCTCAGGCCGCCGTACTCCTCGGAGAACGGCGCGCTGGACGACGCC GACTGGTCCGTCCTGAAGCAGGCCGACGCGGCGGGTTACGTCACGGTGCTGTCCACCCAG GACGCCGAGGACTGGCAGCGCCCCGGTGCGCGCCGCATCCTCGCGAACGCGACACCACAC GGGCACGGCGGGCAGGTCCTGCTCATGCACGACGCCGGCGGCGACCGCTCCCAGACCGTC GCCGCGCTGGCTGCCCTGGTCCCACGCCTCAAGGCGCAGGGCTTCAGGTTCGCGACGGTC TCCGACGCGGTCGGCATGGCCGCACCCGTACAGCCCGCCGGCCTGGGCGATCACCTGCAA GGACTGGCCCTCGTCAGGGCCCTCCAGGGCGGTGACCGGGTCGTCCGGCTGCTGGGCTGG ...
The type 2 secretion system (often referred to as the type II secretion system or the T2SS) is protein secretion machinery found in various species of Gram-negative bacteria, including various human pathogens such as Pseudomonas aeruginosa and Vibrio cholerae. The type II secretion system is one of six protein secretory systems that are commonly found in gram negative bacteria along with the type I secretion system, the type III secretion system, The type IV secretion system, the chaperone/usher pathway, the autotransporter pathway/type V secretion system and the type VI secretion system (some bacteria also utilize the type VII secretion system). Like these other systems, the type II secretion system enables the transport of cytoplasmic proteins across the lipid bilayers that make up the cell membranes in gram negative bacteria. The type II secretion system is a membrane bound protein complex found in Gram-negative bacteria that is used to secrete proteins found in the cytoplasm of the bacteria ...
Type III secretion systems enable plant and animal bacterial pathogens to deliver virulence proteins into the cytosol of eukaryotic host cells, causing a broad spectrum of diseases including bacteremia, septicemia, typhoid fever, and bubonic plague in mammals, and localized lesions, systemic wilting, and blights in plants. In addition, type III secretion systems are also required for biogenesis of the bacterial flagellum. The HrcQ(B) protein, a component of the secretion apparatus of Pseudomonas syringae with homologues in all type III systems, has a variable N-terminal and a conserved C-terminal domain (HrcQ(B)-C). Here, we report the crystal structure of HrcQ(B)-C and show that this domain retains the ability of the full-length protein to interact with other type III components. A 3D analysis of sequence conservation patterns reveals two clusters of residues potentially involved in protein-protein interactions. Based on the analogies between HrcQ(B) and its flagellum homologues, we propose ...
Many Gram-negative bacterial pathogens utilize type III secretion systems (TTSSs) for subverting the normal cellular functions of their target eukaryotic cells. The type III secretion apparatus (TTSA) functions like a syringe to inject proteins through an external needle and into a target cells membrane and cytosol. The TTSA basal body spans the bacterial inner and outer membranes, and the external needle is topped with a tip complex that controls the secretion and delivery of translocator and effector proteins. The needle is formed by the polymerization of ~120 copies of a small acidic protein that is conserved among diverse pathogens. At the tip of the needle, a tip complex is assembled by tip proteins into a ring-like structure which serves as a platform for the assembly of the translocon by translocator proteins. We use NMR spectroscopy to understand how the needle is assembled and how the tip complex is assembled on top of the needle. We determined the solution structures of the BsaL ...
Since their discovery in the 20th century, antibiotics have been prescribed for patients with bacterial infections. The first commercially available antibiotic was penicillin, which was discovered in 1928 by Alexander Fleming in St. Marys Hospital, UK. Penicillin was effective to inhibit the growth of disease-causing microorganisms. However, in 1947, four years after the mass-production of penicillin, the first penicillin resistance case was identified. Since then, scientists have been looking for new targets to inhibit the bacterial growth. Among them, the bacterial cell division protein, filament temperature-sensitive Z (FtsZ), is a promising target for the development of new antibiotics. FtsZ protein is an essential protein in bacterial cytoplasmic division. A GTPase active site is formed when two FtsZ monomers are joined together in head-to-tail manner. The presence of GTP induces the polymerization of FtsZ in the middle of the cell. FtsZ polymers act as a platform to recruit other cell ...
FtsZ plays an important role in bacterial cell division by polymerizing to form the Z ring at the site of cytokinesis. Phytochemicals are known to disrupt bacterial cell division through inhibition of FtsZ assembly. In the present study phytochemicals like eugenol, trans-cinnamic acid, 4-formyl cinnamic acid, naringenin and caffeic acid were were tested for their potential to inhibit cell division. Effect of these antimicrobial compounds on the growth of E. coli was determined and the inhibition of FtsZ assembly in vitro was investigated. The present study revealed trans-cinnamic acid as the most potent inhibitor of FtsZ assembly ...
Protein secretion in Pseudomonas aeruginosa involves different mechanisms. The type II and type III secretory pathways control the extracellular release of a wide range of substrates. The type I secretion process, or ABC transporter, was believed to be exclusively involved in alkaline protease secretion. Recently, it was discovered that a P. aeruginosa heme binding protein, HasAp, is also secreted by a type I process. We present here the identification of a third putative type I-dependent protein of P. aeruginosa, AprX. The function of this protein has not yet been elucidated but very interestingly it appears to be linked to the apr cluster, and organized in one single operon together with the aprD, -E and -F genes.
We have characterized the self-association of FtsZ in its GDP-bound state (GDP-FtsZ) and the heteroassociation of FtsZ and a soluble recombinant ZipA (sZipA) lacking the N-terminal transmembrane domain by means of composition gradient−static light scattering (CG−SLS) and by measurement of sedimentation equilibrium. CG−SLS experiments at high ionic strengths and in the presence of 5 mM Mg2+ show that, while FtsZ self-associates in a noncooperative fashion, sZipA acts as a monomer. CG−SLS data obtained from mixtures of FtsZ (A) and sZipA (B) in the presence of Mg2+ are quantitatively described by an equilibrium model that takes into account significant scattering contributions from B, A1, A2, A3, A4, A5, A6, A1B, A2B, A3B, and A4B. However, in the absence of Mg2+ (with EDTA), the data are best explained by an equilibrium model in which only B, A1, A2, A3, A1B, and A2B contribute significantly to scattering. The best-fit molecular weights of monomeric A and B are in good agreement with ...
A wide variety of drug-resistant microorganisms are continuously emerging, restricting the therapeutic options for common bacterial infections. Antimicrobial agents that were originally potent are now...
Bacteria propel themselves through liquid environments using rotation of a propeller like organelle, the flagellum. Flagella are energized by the membrane ion gradient and enable bacteria to swim towards nutrients and away from harmful substances. This unique nanomachine shares structural and functional similarities to the needle-like injectisome complex that pathogenic bacteria employ to inject virulence factors into eukaryotic host cells. Bacterial flagella and injectisomes contain a specialized protein export system, termed type III secretion, that functions to deliver structural subunits and effector proteins to the outside of the cytoplasmic membrane. Type III secretion systems are made of multiple proteins, however, the function of individual subunits and the molecular mechanism of protein translocation is poorly understood.,br /,The first part of this thesis reports that the flagellar type III secretion system functions as a proton-driven protein exporter and demonstrates that many ...
1. PugsleyAP. 1993 The complete general secretory pathway in gram-negative bacteria. Microbiol Rev 57 50 108. 2. SandkvistM. 2001 Biology of type II secretion. Mol Microbiol 40 271 283. 3. TauschekM. GorrellRJ. StrugnellRA. Robins-BrowneRM. 2002 Identification of a protein secretory pathway for the secretion of heat-labile enterotoxin by an enterotoxigenic strain of Escherichia coli. Proc Natl Acad Sci U S A 99 7066 7071. 4. OverbyeLJ. SandkvistM. BagdasarianM. 1993 Genes required for extracellular secretion of enterotoxin are clustered in Vibrio cholerae. Gene 132 101 106. 5. SandkvistM. MoralesV. BagdasarianM. 1993 A protein required for secretion of cholera toxin through the outer membrane of Vibrio cholerae. Gene 123 81 86. 6. HueckCJ. 1998 Type III protein secretion systems in bacterial pathogens of animals and plants. Microbiol Mol Biol Rev 62 379 433. 7. KuboriT. MatsushimaY. NakamuraD. UralilJ. Lara-TejeroM. 1998 Supramolecular structure of the Salmonella typhimurium type III protein ...
Pss may be transmitted from one generation of its host to the next via seeds. Hence, inoculation of bean seeds with relatively small numbers of bacteria at the time of planting was selected as a way to naturally initiate the plant-bacterial interaction in the field. The apparently normal growth of the type III secretion mutants on preemergent bean plants was unexpected given the in planta growth defects of hrp mutants observed in laboratory experiments (16, 23). After plant emergence, however, leaf population sizes of the hrcC and hrpJ mutants were significantly lower than B728a. Numbers of the mutants tended to remain constant or decline, even under conditions of intense rains, when population sizes of B728a and the hrpZ mutant increased significantly. The hrcC and hrpJ mutants behaved similarly, although the specific genes mutated and the nature of the mutations differed in the two constructs. Thus, mutations in hrp genes that affected the Hrp secretion system substantially reduced growth and, ...
Web server == https://rostlab.org/services/pEffect/ == Introduction == The type III secretion system is one of the causes of a wide range of bacterial infections in human, animals and plants. This system comprises a hollow needle-like structure localized on the surface of bacterial cells that injects specific bacterial proteins, the so-called effectors, directly into the cytoplasm of a host cell. During infection, effectors convert host resources to their advantage and promote pathogenicity. We - Tatyana Goldberg, Burkhard Rost and Yana Bromberg - at [http://bromberglab.org BrombergLab] and [http://rostlab.org/cms/ RostLab] developed a novel method, pEffect that predicts bacterial type III effector proteins. In our method, we combine sequence-based homology searches and advanced machine learning to accurately predict effector proteins. We use information encoded in the entire protein sequence for our predictions. == Method design == pEffect is a method that combines sequence ...
1. OlsenSJMacKinnonLCGouldingJSBeanNHSlutskerL 2000 Surveillance for foodborne-disease outbreaks-United States, 1993-1997. MMWR CDC Surveill Summ 49 1 62. 2. SchmidtHHenselM 2004 Pathogenicity islands in bacterial pathogenesis. Clin Microbiol Rev 17 14 56. 3. GalanJEWolf-WatzH 2006 Protein delivery into eukaryotic cells by type III secretion machines. Nature 444 567 573. 4. AbrahamsGLHenselM 2006 Manipulating cellular transport and immune responses: dynamic interactions between intracellular Salmonella enterica and its host cells. Cell Microbiol 8 728 737. 5. GalanJE 2001 Salmonella interactions with host cells: type III secretion at work. Annu Rev Cell Dev Biol 17 53 86. 6. WatermanSRHoldenDW 2003 Functions and effectors of the Salmonella pathogenicity island 2 type III secretion system. Cell Microbiol 5 501 511. 7. HueckCJ 1998 Type III protein secretion systems in bacterial pathogens of animals and plants. Microbiol Mol Biol Rev 62 379 433. 8. EllermeierJRSlauchJM 2007 Adaptation to the host ...
The LysR-family regulator MexT modulates the expression of the MexEF-OprN efflux system in the human pathogen Pseudomonas aeruginosa. Recently, we demonstrated that MexT regulates certain virulence phenotypes, including the type-three secretion system and early attachment independent of its role in regulating MexEF-OprN. In this study, transcriptome profiling was utilized to investigate the global nature of MexT regulation in P. aeruginosa PAO1 and an isogenic mexEF mutant. Twelve genes of unknown function were highly induced by overexpressing MexT independent of MexEF-OprN. A well-conserved DNA motif was identified in the upstream regulatory region of nine of these genes and upstream of mexE. Reporter fusion analysis demonstrated that the expression of the genes was significantly induced by MexT in P. aeruginosa and a heterogenous Escherichia coli strain and that the conserved sequence was required for this induction. The conserved DNA motif was further characterized as the MexT binding site by ...
HilA activates the expression of Salmonella enterica serovar Typhimurium invasion genes. To learn more about regulation of hilA, we isolated Tn5 mutants exhibiting reduced hilA and/or invasion gene expression. In addition to expected mutations, we identified Tn5 insertions in pstS, fadD, flhD, flhC, and fliA. Analysis of the pstS mutant indicates that hilA and invasion genes are repressed by the response regulator PhoB in the absence of the Pst high-affinity inorganic phosphate uptake system. This system is required for negative control of the PhoR-PhoB two-component regulatory system, suggesting that hilA expression may be repressed by PhoRPhoB under low extracellular inorganic phosphate conditions. FadD is required for uptake and degradation of long-chain fatty acids, and our analysis of the fadD mutant indicates that hilA is regulated by a FadDdependent, FadR-independent mechanism. Thus, fatty acid derivatives may act as intracellular signals to regulate hilA expression. flhDC and fliA encode
Sensor kinases play a key role in sensing and responding to environmental and physiological signals in bacteria. In this study we characterized a previously unknown orphan hybrid sensor kinase from Pseudomonas putida, which is conserved in several Pseudomonads. Inactivation of the gene coding for this sensor kinase, which we have named HskA, modified the expression of at least 85 genes in cells growing in a complete medium. HskA showed a strong influence on the composition of the electron transport chain. In cells growing exponentially in a complete medium, the absence of HskA led to a significant reduction in the expression of the genes coding for the bc1 complex and for the CIO and Cbb3-1 terminal oxidases. In stationary phase cells, however, lack of HskA caused a higher expression of the Cyo terminal oxidase and a lower expression of the Aa3 terminal oxidase. The HskA polypeptide shows two PAS (signal-sensing) domains, a transmitter domain containing the invariant phosphorylatable histidine ...
Summary The gram-positive bacterium Bacillus subtilis is well-known for its contributions to agricultural, medical, and food biotechnology and for the production of recombinant proteins. At present, about 60% of the commercially available technical enzymes are produced by Bacillus species. Furthermore, a large body of information concerning transcription, translation, protein folding and secretion mechanisms, genetic manipulation, and large-scale fermentation has been acquired. But so far, efficient and inexpensive expression vectors for B. subtilis are still missing. To fill this gap, a glycine-inducible expression system and a lysine-autoinducible one were explored and IPTG-inducible expression plasmids that allow overexpression and purification of proteins were constructed and analyzed. Furthermore, a technique with a useful promoter-probe plasmid to analyze strong promoters in B. subtilis was established, which allowed to study promoter and mRNA stabilizing elements to enhance the transcript ...
DnaA protein (a trans-acting element) and its binding sequence, DnaA-box: (a cis-acting element) are two elements essential for the initiation of chromosomal replication in Escherichia coli and other enteric bacteria. Recently these two elements have been found to be conserved in three Gram-positive bacteria (Bacillus subtilis, Micrococcus luteus and Mycoplasma capricolum) as well as in Gram-negative pseudomonads. DnaA protein was also found to be essential in the initiation of the replication of the B. subtilis chromosome, and regions containing multiple repeats of DnaA-box (DnaA-box region) are found to be active as autonomously replicating elements both in B. subtilis and pseudomonads. In this MicroReview we compare first the structures of these DnaA-box regions and their locations on the chromosome and then functional aspects of DnaA protein and DnaA-box regions in the initiation and regulation of chromosomal replication. From these observations we propose evolutionary relationships between ...
Our research seeks to elucidate the molecular basis for the temporal and spatial control of cell division. From bacteria to yeast to humans, cell division is initiated by the formation of a ring of a cytoskeletal protein at the nascent division site. This ring establishes the location of the division septum and serves as a framework for assembly of the division apparatus. In bacteria this ring is composed of the essential tubulin-like GTPase FtsZ. In response to an unidentified cell cycle signal, FtsZ polymerizes into a ring structure that serves as a framework on which the division machinery is assembled. As division proceeds, the FtsZ ring constricts, like a drawstring, at the leading edge of the invaginating septum. We focus our research on the regulatory networks that govern FtsZ ring formation in three model organisms, the soil bacterium Bacillus subtilis, E. coli, and the pathogen Staphylococcus aureus. To date, the signals that couple FtsZ ring formation and constriction to the cell cycle ...
The chromosome of Y. enterocolitica encodes a heat-stable enterotoxin, Yst, being related to STI. The capacity to produce Yst generally disappears during storage of the strains. In these strains, the yst gene is intact but remains silent. The pYV plasmid encodes the eleven secreted antihost proteins called Yops as well as the outer membrane protein YadA. The Yops are secreted by a novel, pYV-encoded secretion mechanism. This mechanism which does not involve the removal of an N-terminal signal sequence, is encoded by the pYV virA and virC loci. The virC locus contains 13 genes called yscA-M. The virA locus encodes the LcrD membrane protein. The yop, yadA and ysc genes form the yop regulon controlled by transcriptional activator VirF. Transcription of the yop, yadA, ysc and virF genes is controlled by temperature. A chromosome-encoded histone-like protein, called YmoA, is involved in the thermoregulation of the yop regulon, which suggests that this thermoregulation could result from ...
TY - JOUR. T1 - Heterogeneity in ess transcriptional organization and variable contribution of the Ess/Type VII protein secretion system to virulence across closely related Staphylocccus aureus strains. AU - Kneuper, Holger. AU - Cao, Zhen Ping. AU - Twomey, Kate B.. AU - Zoltner, Martin. AU - Jäger, Franziska. AU - Cargill, James S.. AU - Chalmers, James. AU - van der Kooi-Pol, Magdalena M.. AU - van Dijl, Jan Maarten. AU - Ryan, Robert P.. AU - Hunter, William N.. AU - Palmer, Tracy. N1 - © 2014 The Authors. Molecular Microbiology published by John Wiley & Sons Ltd.. PY - 2014/7/30. Y1 - 2014/7/30. N2 - The Type VII protein secretion system, found in Gram-positive bacteria, secretes small proteins, containing a conserved W-x-G amino acid sequence motif, to the growth medium. Staphylococcus aureus has a conserved Type VII secretion system, termed Ess, which is dispensable for laboratory growth but required for virulence. In this study we show that there are unexpected differences in the ...
Protein acylation is critical for many cellular functions across all domains of life. In bacteria, lipoproteins have important roles in virulence and are targets for the development of antimicrobials and vaccines. Bacterial lipoproteins are secreted from the cytosol via the Sec pathway and acylated on an N-terminal cysteine residue through the action of three enzymes. In Gram-negative bacteria, the Lol pathway transports lipoproteins to the outer membrane. Here, we demonstrate that the Aat secretion system is a composite system sharing similarity with elements of a type I secretion systems and the Lol pathway. During secretion, the AatD subunit acylates the substrate CexE on a highly conserved N-terminal glycine residue. Mutations disrupting glycine acylation interfere with membrane incorporation and trafficking. Our data reveal CexE as the first member of a new class of glycine-acylated lipoprotein, while Aat represents a new secretion system that displays the substrate lipoprotein on the cell ...
article{5e431ccf-32ec-477e-bd56-bf5f8eca2415, abstract = {Many strains of the important human pathogen Streptococcus pyogenes form aggregates when grown in vitro in liquid medium. The present studies demonstrate that this property is crucial for the adherence, the resistance to phagocytosis and the virulence of S. pyogenes. A conserved sequence of 19 amino acid residues (designated AHP) was identified in surface proteins of common S. pyogenes serotypes. This sequence was found to promote bacterial aggregation through homophilic protein-protein interactions between AHP-containing surface proteins of neighbouring bacteria. A synthetic AHP peptide inhibited S. pyogenes aggregation, reduced the survival of S. pyogenes in human blood and attenuated its virulence in mice. In contrast, mutant bacteria devoid of surface proteins containing AHP-related sequences did not aggregate or adhere to epithelial cells. These bacteria are also rapidly killed in human blood and show reduced virulence in mice, ...
The CRP-family transcription factor NtcA, universally found in cyanobacteria, was initially discovered as a regulator operating N control. It responds to the N regime signaled by the internal 2-oxoglutarate levels, an indicator of the C to N balance of the cells. Canonical NtcA-activated promoters bear an NtcA-consensus binding site (GTAN8TAC) centered at about 41.5 nucleotides upstream from the transcription start point. In strains of the Anabaena/Nostoc genera NtcA is pivotal for the differentiation of heterocysts in response to N stress. In this study, we have used chromatin immunoprecipitation followed by high-throughput sequencing to identify the whole catalog of NtcA-binding sites in cells of the filamentous, heterocyst-forming cyanobacterium Anabaena sp. PCC 7120 three hours after the withdrawal of combined N. NtcA has been found to bind to 2,424 DNA regions in the genome of Anabaena, which have been ascribed to 2,153 genes. Interestingly, only a small proportion of those genes are involved in N
The σE-dependent extracytoplasmic stress response.σE is held at the membrane by the antisigma factor RseA. RseB binds to the periplasmic domain of RseA and pr
Shop Tryptophan-rich sensory protein ELISA Kit, Recombinant Protein and Tryptophan-rich sensory protein Antibody at MyBioSource. Custom ELISA Kit, Recombinant Protein and Antibody are available.
The RTX toxin superfamily is a group of cytolysins and cytotoxins produced by bacteria. There are over 1000 known members with a variety of functions. The RTX family is defined by two common features: characteristic repeats in the toxin protein sequences, and extracellular secretion by the type I secretion systems (T1SS). The name RTX (repeats in toxin) refers to the glycine and aspartate-rich repeats located at the C-terminus of the toxin proteins, which facilitate export by a dedicated T1SS encoded within the rtx operon. RTX proteins range from 40 to over 600 kDa in size and all contain C-terminally located glycine and aspartate-rich repeat sequences of nine amino acids. The repeats contain the common sequence structure [GGXGXDX[L/I/V/W/Y/F]X], (where X represents any amino acid), but the number of repeats varies within RTX protein family members. These consensus regions function as sites for Ca2+ binding, which facilitate folding of the RTX protein following export via an ATP-mediated type 1 ...
The earliest stage in bacterial cell division is the formation of a ring, composed of the tubulin-like protein FtsZ, at the division site. Tight spatial and temporal regulation of Z-ring formation is required to ensure that division occurs precisely at midcell between two replicated chromosomes. However, the mechanism of Z-ring formation and its regulation in vivo remain unresolved. Here we identify the defect of an interesting temperature-sensitive ftsZ mutant (ts1) of Bacillus subtilis. At the nonpermissive temperature, the mutant protein, FtsZ(Ts1), assembles into spiral-like structures between chromosomes. When shifted back down to the permissive temperature, functional Z rings form and division resumes. Our observations support a model in which Z-ring formation at the division site arises from reorganization of a long cytoskeletal spiral form of FtsZ and suggest that the FtsZ(Ts1) protein is captured as a shorter spiral-forming intermediate that is unable to complete this reorganization ...
Type III secretion systems (T3SS) in phytopathogenic bacteria were first described in the 80s. However, whereas numerous characterization studies have revealed the basic processes of assembly, structure and function in animal/human pathogenic systems, our knowledge about these processes in plant type III biosystems is considerably small in comparison. Nonetheless, in recent years we have witnessed important breakthroughs in our understanding on how phytopathogens employ, build and regulate their T3SS: new master transcriptional regulators have been discovered, the activity of already described regulators of the system have been thoroughly investigated, quorum sensing regulators and population dynamics have been found to determine the fine activation of the system, new plant-derived signals have been found to upregulate the phytopathogenic T3SS, and more. Moreover, a considerable weaponry of effectors targeting and tuning the plant responses have been identified and protein components of the core
An overview was made to understand the regulation system of a bacterial cell such as Escherichia coli in response to nutrient limitation such as carbon, nitrogen, phosphate, sulfur, ion sources, and environmental stresses such as oxidative stress, acid shock, heat shock, and solvent stresses. It is quite important to understand how the cell detects environmental signals, integrate such information, and how the cell system is regulated. As for catabolite regulation, F1,6B P (FDP), PEP, and PYR play important roles in enzyme level regulation together with transcriptional regulation by such transcription factors as Cra, Fis, CsrA, and cAMP-Crp. αKG plays an important role in the coordinated control between carbon (C)- and nitrogen (N)-limitations, where αKG inhibits enzyme I (EI) of phosphotransferase system (PTS), thus regulating the glucose uptake rate in accordance with N level. As such, multiple regulation systems are co-ordinated for the cell synthesis and energy generation against nutrient
An overview was made to understand the regulation system of a bacterial cell such as Escherichia coli in response to nutrient limitation such as carbon, nitrogen, phosphate, sulfur, ion sources, and environmental stresses such as oxidative stress, acid shock, heat shock, and solvent stresses. It is quite important to understand how the cell detects environmental signals, integrate such information, and how the cell system is regulated. As for catabolite regulation, F1,6B P (FDP), PEP, and PYR play important roles in enzyme level regulation together with transcriptional regulation by such transcription factors as Cra, Fis, CsrA, and cAMP-Crp. αKG plays an important role in the coordinated control between carbon (C)- and nitrogen (N)-limitations, where αKG inhibits enzyme I (EI) of phosphotransferase system (PTS), thus regulating the glucose uptake rate in accordance with N level. As such, multiple regulation systems are co-ordinated for the cell synthesis and energy generation against nutrient
Typically comprised of ~12 different scaffold components, prokaryotic type IV secretion systems (T4SSs) translocate a variety of substrates across the cell envelope. Due to the ability to translocate large DNA segments (i.e., mobile genetic elements), some T4SSs contribute to the spread of antimicrobial resistance and virulence genes. Other T4SSs translocate smaller DNA segments and/or proteins into eukaryotic cells (e.g., arthropod, plant and human) in order to benefit bacterial survival. At least eight major groups of T4SSs are described and each group consists of minor variations on a common structural theme. Within a given bacterial genome, combinations of different T4SS groups can be encoded, and sometimes multiple copies of the same T4SS group can be present. As an example, two functionally divergent T4SSs (vir and trw) are found in many species of Bartonella, bacteria that are transmitted by arthropods such as ticks and fleas and cause a range of diseases including endocarditis. In species of
Klein JA, Dave BM, Raphenya AR, McArthur AG, Knodler LA.. Mol Microbiol. 2017 Mar;103(6):973-991.. Type III Secretion Systems (T3SSs) are structurally conserved nanomachines that span the inner and outer bacterial membranes, and via a protruding needle complex contact host cell membranes and deliver type III effector proteins. T3SS are phylogenetically divided into several families based on structural basal body components. Here we have studied the evolutionary and functional conservation of four T3SS proteins from the Inv/Mxi-Spa family: a cytosolic chaperone, two hydrophobic translocators that form a plasma membrane-integral pore, and the hydrophilic tip complex translocator that connects the T3SS needle to the translocon pore. Salmonella enterica serovar Typhimurium (S. Typhimurium), a common cause of food-borne gastroenteritis, possesses two T3SSs, one belonging to the Inv/Mxi-Spa family. We used invasion-deficient S. Typhimurium mutants as surrogates for expression of translocator ...
bacterial surface protein extraction - posted in Protein Expression and Purification: Hi, I want to prepare a lysis buffer for bacterial surface protein extraction. How can i prepare 8 M (Tris-buffered) urea containing 5 mM EDTA or is there anyone who have another idea for protein extraction?
Mutations showing specificity for normal growth or Mn(II)-dependent post-exponential phase cell division in Deinococcus radiodurans
We investigated the mechanism by which type-A ARRs regulate cytokinin signaling. Two distinct, but not mutually exclusive, models for this mechanism are proposed: one invokes phosphocompetition between the type-A and type-B ARRs, and the other involves phospho-dependent interactions of the type-A ARRs with target proteins (Figure 1A). To test these models, we generated two site-directed mutants targeting the Asp-87 residue of ARR5, ARR5D87A, and ARR5D87E. This Asp residue is conserved among response regulator family proteins and has been shown to be the target of bacterial two-component phosphorelay (Bourret et al., 1990; Stock et al., 2000; West and Stock, 2001). Substitutions at this conserved Asp have also been shown to abolish receiver domain phosphorylation in other ARRs (Kim et al., 2006; Lee et al., 2007a). In bacterial response regulators, this invariant Asp resides in the conserved active site of the receiver domain that actively catalyzes phosphotransfer from histidine kinases, Hpts, ...
Bacillus subtilis uses two-component signal transduction systems to sense intra- and extracellular stimuli to adapt to fluctuating environmental situations. Regulator aspartate phosphatases (Raps) have important roles in these processes, as they can dephosphorylate certain response-regulators, and are themselves subject to cell-density-controlled inhibition by secreted Phr (phosphate regulator) peptides. Eleven chromosomal genes encode this family of phosphatases, but in addition, certain strains contain endogenous plasmids with genes for homologous Rap-Phr systems. Plasmid pTA1060 encodes Rap60 and its antagonistic signalling molecule Phr60. Strikingly, expression of Rap60 in B. subtilis 168 strongly repressed the production of proteolytic enzymes. In fact, the transcription of the aprE gene, encoding a major extracellular protease, was shown to be decreased upon Rap60 expression, whereas this effect could be antagonized by the extracellular addition of synthetic Phr60 pentapeptide. Finally,
TY - JOUR. T1 - How Bacteria Subvert Animal Cell Structure and Function. AU - Jimenez, Alyssa. AU - Chen, Didi. AU - Alto, Neal M.. PY - 2016/10/6. Y1 - 2016/10/6. N2 - Bacterial pathogens encode a wide variety of effectors and toxins that hijack host cell structure and function. Of particular importance are virulence factors that target actin cytoskeleton dynamics critical for cell shape, stability, motility, phagocytosis, and division. In addition, many bacteria target organelles of the general secretory pathway (e.g., the endoplasmic reticulum and the Golgi complex) and recycling pathways (e.g., the endolysosomal system) to establish and maintain an intracellular replicative niche. Recent research on the biochemistry and structural biology of bacterial effector proteins and toxins has begun to shed light on the molecular underpinnings of these host-pathogen interactions. This exciting work is revealing how pathogens gain control of the complex and dynamic host cellular environments, which ...
Cell division in bacteria is a highly controlled and regulated process. FtsZ, a bacterial cytoskeletal protein, forms a ring-like structure known as the Z-ring and recruits more than a dozen other cell division proteins. The Min system oscillates between the poles and inhibits the Z-ring formation at the poles by perturbing FtsZ assembly. This leads to an increase in the FtsZ concentration at the mid-cell and helps in Z-ring positioning. MinC, the effector protein, interferes with Z-ring formation through two different mechanisms mediated by its two domains with the help of MinD. However, the mechanism by which MinD triggers MinC activity is not yet known. We showed that MinD directly interacts with FtsZ with an affinity stronger than the reported MinC-FtsZ interaction. We determined the MinD-binding site of FtsZ using computational, mutational and biochemical analyses. Our study showed that MinD binds to the H10 helix of FtsZ. Single-point mutations at the charged residues in the H10 helix ...