Team:LMU-Munich/Jump-or-die - 2010.igem.org
This system also uses Bak as apoptosis inducing selection marker together with the Tet-on promoter, which is to be stably integrated in the cell-line genome. However, this construct also includes an upstream bacterial attachment site (attB) and a downstream SV40 polyadenylation site (SV40PA). The target gene eGFP is combined with phage attachment site (attP) and another SV40PA but without promoter. The target plasmid is co-transfected with integrase PhiC31o into the cell line. Therefore the target gene can only be expressed if integrated into the cells genome, and the stop-codon and SV40PA following the target gene stop the expression of bak, ensuring the survival of the cell while other cells not expressing the target gene undergo induced apoptosis. For more details of the functional principle, please click: Jump-or-Die Functional Principle ...
E. coli plasmid vector pLDR11 - incomplete.
Misc.Comments : Deposited by: Walter Messer Vector containing the attP sequence for integrating DNA into the lambda attachment site attB. Requires the lambda integrase (int) such as that provided by pLDR8 (ATCC 77357). [1] When a recombinant construct is digested with NotI, the origin is separated from the insert. Each fragment has a distinct selectable marker. After religation to form origin-free circles, the products are transformed into bacteria with pLDR8. [1] Expression of int in pLDR8 is regulated by lambda PR, by the temperature sensitive cI857 repressor. Replication of pLDR8 is also temperature sensitive. [1] Therefore, at 30C replication of the plasmid is normal and int is not expressed. At 42C, int is expressed but pLDR8 is no longer replicated, resulting in loss of int after a few cell generations. [1] The order of the major features in this plasmid is: NotI - ampR - ClaI/MCS/EcoRI - attP - NotI - pMB1 ori - tetR. [1] Restriction digests of the clone give the following sizes (kb): ...
Pagina informativa
In questa pagina sono consultabili, utilizzando il menù a sinistra, anche gli atti per i quali si è concluso il periodo di pubblicazione, con possibilità di ricerca storica più ampia per deliberazioni e determinazioni, più ridotta per tutti gli altri atti, in quanto la gestione di questi ultimi, attraverso il software di albo pretorio on line attualmente in uso, è iniziata il 2.1.2014 ...
Pagina informativa
In questa pagina sono consultabili, utilizzando il menù a sinistra, anche gli atti per i quali si è concluso il periodo di pubblicazione, con possibilità di ricerca storica più ampia per deliberazioni e determinazioni, più ridotta per tutti gli altri atti, in quanto la gestione di questi ultimi, attraverso il software di albo pretorio on line attualmente in uso, è iniziata il 2.1.2014 ...
La bohème - Chambres dhôtes, Sanlis - ažurirane cene za 2021. godinu
La bohème - Chambres dhôtes, Sanlis - Rezervišite uz Garanciju najbolje cene! 327 recenzija i 28 fotografija čeka vas na veb sajtu Booking.com.
Viruses | Free Full-Text | Insights into the Functions of a Prophage Recombination Directionality Factor | HTML
Recombination directionality factors (RDFs), or excisionases, are essential players of prophage excisive recombination. Despite the essentially catalytic role of the integrase in both integrative and excisive recombination, RDFs are required to direct the reaction towards excision and to prevent re-integration of the prophage genome when entering a lytic cycle. KplE1, HK620 and numerous (pro)phages that integrate at the same site in enterobacteria genomes (such as the argW tRNA gene) all share a highly conserved recombination module. This module comprises the attL and attR recombination sites and the RDF and integrase genes. The KplE1 RDF was named TorI after its initial identification as a negative regulator of the tor operon. However, it was characterized as an essential factor of excisive recombination. In this study, we designed an extensive random mutagenesis protocol of the torI gene and identified key residues involved in both functions of the TorI protein. We show that, in addition to TorI-TorR
Repressing Integrase attachment site operation with CRISPR-Cas9 in E. coli
Serine integrases are bacteriophage proteins responsible for integrating the phage genome into that of the host. Synthetic biologists have co-opted these proteins into useful tools for permanent DNA logic, utilizing their specific DNA recombination abilities to build synthetic cell differentiation and genetic memory systems. Each integrase has a specific pair of DNA sequences (attP/attB sites) that it recombines, but multiple identical sites can result in unpredictable recombination. We have developed a way to control integrase activity on identical attP/attB sites by using catalytically dead Cas9 (dCas9) as a programmable binding protein that can compete with integrase for binding to specific attachment sites. Utilizing a plasmid that contains two identical Bxb1 attP sites, integration can be repressed up to 8 fold at either one of the two attP sites when guide RNA and dCas9 are present. Guide RNA sequences that bind specifically to attB, or either of two attP sites, have been developed. Future ...
Construction, Characterization, and Use of Two Listeria monocytogenes Site-Specific Phage Integration Vectors | Journal of...
pPL2 was constructed by replacing the U153 listeriophage integrase gene and attachment site in pPL1 with the PSA listeriophage integrase gene and attachment site. pPL2 was transformed into SM10, and the resulting strain was mated into 10403S, EGDe (carrying a streptomycin resistance mutation), and the serotype 4b strain DP-L4088. Chloramphenicol-resistant transconjugants arose from each of these crosses at approximately 10−4 per donor cell, the same rate as pPL1 integration. Two recombinants from each cross were restreaked under drug selection and tested by PCR for the presence of PSA-attBP′ with primers NC16 and PL95 (Fig. 2D). The expected 499-bp PCR product was obtained in each of the colonies tested, indicating that pPL2 integrates into tRNAArg-attBB′ in both serotype 1/2 and 4b strains.. We tested the stability of the integrated pPL2 in both EGDe and DP-L4088 strains with the same nonselective 100-generation experiment described for pPL1. Forty-nine colonies from each of the amplified ...
La Lokapaññatti et les idées cosmologiques du bouddhisme ancien (Book, 1977) [WorldCat.org]
Get this from a library! La Lokapaññatti et les idées cosmologiques du bouddhisme ancien. [Saddhammaghōsa, Thera.; Eugène Denis]
Former worlds fattest woman Eman Abdul Atti dies from heart disease | Metro News
A 37-year-old once described as the worlds fattest woman has died in hospital, officials have said. Eman Abdul Atti died as a result of heart disease and kidney dysfunction according...
Biomod/2012/HKBU/BU Magician - OpenWetWare
rot1 .description).animate({bottom:-270px},500,easeOutCirc,function(){ $(p,$(this)).html(info_elem.find(.info_description).html()); $(this).animate({bottom:0px},400,easeInOutQuad); }); if(parseInt(info_elem.find(.info_image).html())==1){ $(#rot1).prepend( $(,img/,,{ style : opacity:0, className : bg }).load( function(){ $(this).animate({opacity:1},600); $(#rot1 img:first).next().animate({opacity:0},700,function(){ $(this).remove(); }); } ).attr(src,http://openwetware.org/images/d/d6/Hkbutest1.jpg).attr(width,800).attr(height,300) ); } else if(parseInt(info_elem.find(.info_image).html())==2){ $(#rot1).prepend( $(,img/,,{ style : opacity:0, className : bg }).load( function(){ $(this).animate({opacity:1},600); $(#rot1 img:first).next().animate({opacity:0},700,function(){ $(this).remove(); }); } ).attr(src,http://openwetware.org/images/5/59/Hkbutest2.jpg).attr(width,800).attr(height,300) ); } else ...
68374 w[1118]; P{y[+t7.7] w[+mC]=R82D11-p65.AD}attP40/CyO; P{y[+t7.7] w[+mC]=R41C07-GAL4.DBD}attP2/TM6B, Tb[1]
Expresses the p65 activation domain under the control of sequences in/near CR4575 (FBgn0029920) and the GAL4 DNA binding domain under the control of sequences in/near chinmo (FBgn0086758). Janelia line OL0087B. Homozygotes may be present ...
68334 w[1118]; P{y[+t7.7] w[+mC]=VT026773-p65.AD}attP40; P{y[+t7.7] w[+mC]=R72B05-GAL4.DBD}attP2
Expresses the p65 activation domain under the control of sequences in/near Prat2 (FBgn0041194) and the GAL4 DNA binding domain under the control of sequences in/near Dop1R1 (FBgn0011582). Janelia line MB630B ...
visualforce - Uncaught TypeError: $(...).attr is not a function - Salesforce Stack Exchange
I am getting the Uncaught TypeError: $(...).attr is not a function error. and visualforce page is not working properly. we have changed the Jquery library version from 2.2.4 to 3.4.1 currently. is this change causing the issue?. ...
anova - creating contrast matrix (limma) for two factorial in R - Cross Validated
design g1.s g1.c g2.s g2.c g3.s g3.c g4.s g4.c g5.s g5.c 1 1 0 0 0 0 0 0 0 0 0 2 1 0 0 0 0 0 0 0 0 0 3 1 0 0 0 0 0 0 0 0 0 4 0 1 0 0 0 0 0 0 0 0 5 0 1 0 0 0 0 0 0 0 0 6 0 1 0 0 0 0 0 0 0 0 7 0 0 1 0 0 0 0 0 0 0 8 0 0 1 0 0 0 0 0 0 0 9 0 0 1 0 0 0 0 0 0 0 10 0 0 0 1 0 0 0 0 0 0 11 0 0 0 1 0 0 0 0 0 0 12 0 0 0 1 0 0 0 0 0 0 13 0 0 0 0 1 0 0 0 0 0 14 0 0 0 0 1 0 0 0 0 0 15 0 0 0 0 1 0 0 0 0 0 16 0 0 0 0 0 1 0 0 0 0 17 0 0 0 0 0 1 0 0 0 0 18 0 0 0 0 0 1 0 0 0 0 19 0 0 0 0 0 0 1 0 0 0 20 0 0 0 0 0 0 1 0 0 0 21 0 0 0 0 0 0 1 0 0 0 22 0 0 0 0 0 0 0 1 0 0 23 0 0 0 0 0 0 0 1 0 0 24 0 0 0 0 0 0 0 1 0 0 25 0 0 0 0 0 0 0 0 1 0 26 0 0 0 0 0 0 0 0 1 0 27 0 0 0 0 0 0 0 0 1 0 28 0 0 0 0 0 0 0 0 0 1 29 0 0 0 0 0 0 0 0 0 1 30 0 0 0 0 0 0 0 0 0 1 attr(,assign) [1] 1 1 1 1 1 1 1 1 1 1 attr(,contrasts) attr(,contrasts)$factors [1] contr.treatment ...
Automated-sequencing] pDONR vector
Ah yeah. I missed that. If I dont use cross_match correctly I can miss large inverted repeats: 214 1.26 0.00 0.00 pDONR222 359 597 (4121) C pDONR222 (1943) 2775 2537 * C pDONR222 597 GTCGACTACAGGTCACTAATACCATCTAAGTAGTTGATTCATAGTGACTG 548 pDONR222 2537 GTCGACTACAGGTCACTAATACCATCTAAGTAGTTGATTCATAGTGACTG 2586 C pDONR222 547 GATATGTTGTGTTTTACAGTATTATGTAGTCTGTTTTTTATGCAAAATCT 498 pDONR222 2587 GATATGTTGTGTTTTACAGTATTATGTAGTCTGTTTTTTATGCAAAATCT 2636 C pDONR222 497 AATTTAATATATTGATATTTATATCATTTTACGTTTCTCGTTCAGCTTTT 448 i pDONR222 2637 AATTTAATATATTGATATTTATATCATTTTACGTTTCTCGTTCAGCTTTC 2686 C pDONR222 447 TTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAA 398 i i pDONR222 2687 TTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAA 2736 C pDONR222 397 CGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTG 359 pDONR222 2737 CGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTG 2775 If the attP1 and attP2 sites are still there after you move your fragment of interest, then one issue would be you would need to sequence past 200+ bases of ...
Addgene: 251 pTol2Dest
Plasmid 251 pTol2Dest from Dr. Nathan Lawsons lab contains the insert attR1/attR2 cassette and is published in Dev Dyn. 2007 Nov . 236(11):3077-87. This plasmid is available through Addgene.
html - How is jquery used to check for the disabled attribute on an |a| tag? - Stack Overflow
The difference between attributes and properties can be important in specific situations. Before jQuery 1.6, the .attr() method sometimes took property values into account when retrieving some attributes, which could cause inconsistent behavior. As of jQuery 1.6, the .prop() method provides a way to explicitly retrieve property values, while .attr() retrieves attributes.. ...
Addgene: pDsRed-attP
Plasmid pDsRed-attP from Dr. Kate OConnor-Giless lab contains the inserts attP and LoxP-3xP3-DsRed-LoxP and is published in Unpublished This plasmid is available through Addgene.
Structural analysis of loci involved in pSAM2 site-specific integration in Streptomyces. - Semantic Scholar
pSAM2 is an 11-kb plasmid integrated in the Streptomyces ambofaciens ATCC23877 and ATCC15154 genomes and found additionally as a free replicon in an uv derivative. After transfer into S. ambofaciens DSM40697 (devoid of pSAM2) or into Streptomyces lividans, specific integration of pSAM2 occurred very efficiently. A 58-bp sequence (att) present in both pSAM2 (attP) and S. ambofaciens strain DSM40697 (attB) attachment regions is found at the boundaries (attL and attR) of integrated pSAM2 in S. ambofaciens strain ATCC23877. The S. lividans chromosomal integration zone contained an imperfectly conserved att sequence (attB), and the integration event of pSAM2 was located within a 49-bp sequence of attB. Only one primary functional attB sequence was present in the S. lividans or S. ambofaciens DSM40697 total DNA. The integration zone of S. lividans hybridized with the integration zone of S. ambofaciens DSM40697. The two integration zones were homologous only to the right side of the att sequence. The conserved
OPUS 4 | Search
A highly efficient method for chromosomal integration of cloned DNA into Methanosarcina spp. was developed utilizing the site-specific recombination system from the Streptomyces phage PhiC31. Host strains expressing the PhiC31 integrase gene and carrying an appropriate recombination site can be transformed with non-replicating plasmids carrying the complementary recombination site at efficiencies similar to those obtained with self-replicating vectors. We have also constructed a series of hybrid promoters that combine the highly expressed M. barkeri PmcrB promoter with binding sites for the tetracycline-responsive, bacterial TetR protein. These promoters are tightly regulated by the presence or absence of tetracycline in strains that express the tetRgene. The hybrid promoters can be used in genetic experiments to test gene essentiality by placing a gene of interest under their control. Thus, growth of strains with tetR-regulated essential genes becomes tetracycline-dependent. A series of plasmid ...
Phage Lambda (λ)
To promote integration, Bacteriophage λ wants to make the int protein and not xis protein. mRNA transcribed from Pi has an ATG for translation of int protein, not xis. The integration of phage λ takes place at a special attachment site in the bacterial genome, called attλ. The sequence of the att site is called attB and consists of the parts B-O-B, whereas the complementary sequence in the circular phage genome is called attP and consists of the parts P-O-P. The integration itself is a sequential exchange (see genetic recombination) via a Holliday structure and requires both the phage protein int and the bacterial protein IHF (integration host factor). Both int and IHF bind to attP and built an intrasome, a DNA-protein-complex designed for site-specific recombination of the phage and host DNA. The original BOB secuanes is changed by the integration to B-O-P-phage DNA-P-O-B. The phage DNA is now part of the hosts genome ...
EP 0974666 A1 20000126 - METHODS FOR TRANSFERRING GENE INTO CHROMOSOME
296129088 - EP 0974666 A1 20000126 - METHODS FOR TRANSFERRING GENE INTO CHROMOSOME - Method for transferring a foreign gene into a host chromosome by contrived procedures to integrate the foreign gene into a vector by utilizing a lysogenic phage, for the purpose of deleting unnecessary genes derived from the vector or the like, except for the foreign gene. One of the inventive method comprises: a first step for preparing a vector with a lysogenic phage integration site (attP site) arranged between a first partial sequence of the objective foreign gene to be transferred but lacking one terminal region thereof and a second partial sequence of the gene but lacking the other terminal region and having an overlapping region with a portion of the first partial sequence; a second step for integrating the vector obtained in the first step into the host chromosome; and a third step for screening from among the recombinants obtained in the second step a recombinant from which unnecessary genes originating in the
Attribute::Handlers - search.cpan.org
my MyClass $slr :Good :Bad(1**1-1) :Omni(-vorous); MyClass::Good:ATTR(SCALAR)( MyClass, # class LEXICAL, # no typeglob \$slr, # referent Good, # attr name undef # no attr data CHECK, # compiler phase ); MyClass::Bad:ATTR(SCALAR)( MyClass, # class LEXICAL, # no typeglob \$slr, # referent Bad, # attr name 0 # evald attr data CHECK, # compiler phase ); MyClass::Omni:ATTR(SCALAR)( MyClass, # class LEXICAL, # no typeglob \$slr, # referent Omni, # attr name -vorous # evald attr data CHECK, # compiler phase ); # sub fn :Ugly(sister) :Omni(po,tent()) {...} MyClass::UGLY:ATTR(CODE)( SomeOtherClass, # class \*SomeOtherClass::fn, # typeglob \&SomeOtherClass::fn, # referent Ugly, # attr name sister # evald attr data CHECK, # compiler phase ); MyClass::Omni:ATTR(CODE)( SomeOtherClass, # class \*SomeOtherClass::fn, # typeglob \&SomeOtherClass::fn, # referent Omni, # attr name [po,acle] # evald attr data CHECK, # compiler phase ); # my @arr :Good ...
Finding Transcriptional Enhancers : IGTRCN
However, a limitation of this approach is the requirement of genomic libraries in any sequenced species in order to test regions of interest for regulatory activity. Furthermore, the sizes of these libraries need to be relatively small (~20 kb) for efficient integration into the genome using the phiC31 integrase system.. The investment required to generate such libraries is estimably large and could pose a signficant hurdle for use of such an application.. Another caveat is that positive clones need to be further characterized to identify the minimal enhancer fragment(s).. This method also does not inform us of the presence of multiple enhancers in a clone that is being tested.. Nevertheless, for those species where this method is feasible, complementing this assay with computational enhancer discovery methods and/or epigenetic/chromatin profiling methods to zero in on the minimal regulatory regions will greatly aid in the rapid identification and annotation of these critical components of the ...
DEMO aorta build passive 01
Heading abaqus_spec.Heading.COMMENT{1}=Job name: AORTA; %%--, Preprint abaqus_spec.Preprint.ATTR.echo=NO; abaqus_spec.Preprint.ATTR.model=NO; abaqus_spec.Preprint.ATTR.history=NO; abaqus_spec.Preprint.ATTR.contact=NO; %--, Part % Node nodeIds=(1:1:size(VT,1)); abaqus_spec.Part.COMMENT=This section defines the part geometry in terms of nodes and elements; abaqus_spec.Part.ATTR.name=Aorta; abaqus_spec.Part.Node={nodeIds,VT}; % Element elementIds=(1:1:size(ET,1)); abaqus_spec.Part.Element{1}.ATTR.type=C3D8; abaqus_spec.Part.Element{1}.VAL={elementIds,ET}; % Element sets for q=1:1:numMaterials elementIdsSetNow=find(C_ET_path_mat_index==q); abaqus_spec.Part.Elset{q}.ATTR.elset=[MatSet-,num2str(q)]; abaqus_spec.Part.Elset{q}.VAL=elementIdsSetNow; end surfaceElementSetName=elementSetInnerSurface; abaqus_spec.Part.Elset{numMaterials+1}.ATTR.elset=surfaceElementSetName; abaqus_spec.Part.Elset{numMaterials+1}.ATTR.internal=; %Remains hidden uppon import ...
libc.a reference
unsigned int attr; if ( !_dos_getfileattr(FOO.DAT, &attr) ) { puts(FOO.DAT attributes are:); if ( attr & _A_ARCH ) puts(Archive); if ( attr & _A_RDONLY ) puts(Read only); if ( attr & _A_HIDDEN ) puts(Hidden); if ( attr & _A_SYSTEM ) puts(Is it part of DOS ?); if ( attr & _A_VOLID ) puts(Volume ID); if ( attr & _A_SUBDIR ) puts(Directory); } else puts(Unable to get FOO.DAT attributes ...
Tropicos | Name - !!Poaceae Barnhart
Poaceae Caruel Atti della Reale Accademia dei Lincei, Memorie di Classe di Scienze, Fisiche, Matematiche e Naturale, ser. 3, 10: 187, 191, 247. 1881. (5 Jun 1881) (Atti Reale Accad. Lincei, Mem. Cl. Sci. Fis., ser. 3, ...
Bryn Mawr Classical Review 2009.07.70
G. Camporeale, La città murata in Etruria: Atti del XXV Convegno di studi etruschi ed italici, Chianciano Terme, Sarteano, Chiusi, 30 marzo - 3 aprile 2005: in memoria di Massimo Pallottino. Atti di convegni / Istituto nazionale di studi etruschi ed italici; 25. Pisa/Roma: Fabrizio Serra Editore, 2008. Pp. 538. ISBN 9788862270267. €960.00 (pb).
widgets - WordPress update not saving - WordPress Development Stack Exchange
php namespace App\Widgets; class TextWidget extends \WP_Widget { public function __construct() { $widgetOpts = array( classname =, widget_text, description =, __(Um texto puro qualquer.), customize_selective_refresh =, true, ); parent::__construct(custom_text, __(Texto puro), $widgetOpts); } public static function init() { add_action(widgets_init, function() { register_widget(self::class); }); } public function widget($args, $instance) { echo esc_html__($instance[content], text_domain); } public function form($instance) { $instance = wp_parse_args( (array) $instance, [content =, ] ); ?, ,p, ,textarea class=widefat id=,?php echo esc_attr($this-,get_field_id(content)); ?, name=,?php echo esc_attr($this-,get_field_name(content)); ?, type=text cols=30 rows=10 ,,?php echo esc_attr($instance[content]); ?,,/textarea, ,/p, ,?php } public function update($newInstance, $oldInstance) { $instance = array(); $instance[content] = (!empty( $newInstance[content])) ? ...
tensorflow::ops::FIFOQueue Class Reference | TensorFlow Core v2.6.0
shapes: The shape of each component in a value. The length of this attr must be either 0 or the same as the length of component_types. If the length of this attr is 0, the shapes of queue elements are not constrained, and only one element may be dequeued at a time ...
Meeting 2009-10-12
smj: hr. hr. hr+ABBR+Acc cand.philol. cand.philol. cand.philol+ABBR+N+Acc Per Per Per+N+Prop+Mal+Sg+Attr sme: hr. hr. hr+N+ABBR+Acc Per Per Per+N+Prop+Mal+Sg+Attr ...
HF / Forums - OUT! Se.Ra.Phic - Nothing Above
[HarderFaster] - Work Hard, Play Harder! news, reviews, photos, features, discussion forums, dj profiles, venues and the most up to date whats on guide available.
Dormant prostatacancerceller i bensilkespapper kan reawakeneds, något att sägaforskare
Forskare i Cederträ-Sinaien Samuel Oschin som Omfattande Cancer Instiftar upptäckt i pre-kliniskt, modellerar att dormant prostatacancerceller som finnas i bensilkespapper kan reawakeneds och att
Weiterbildungs-Detail
$(document).ready(function() { $(.tabLink).each(function(){ $(this).click(function(){ tabeId = $(this).attr(id); $(.tabLink).removeClass(active...
intact or incomplete PROPHAGE
If the regions total score is less than 70, it is marked as incomplete; if between 70 to 90, it is marked as questionable; if greater than 90, it is marked as intact ...
Kansli
För att uppmärksamma att Sveriges diplomatiska relationer med Japan firar 150 år under 2018 genomförs en särskild utlysning i samarbete mellan STINT och Riksbankens Jubileumsfond (RJ).. ...
2012 California Mille, Day Three
Following the theme of the past two days, there should be a tenuously related rock-n-roll quote here, but as yesterday was the first real day of att
Site-specific deletion and rearrangement of integron insert genes catalyzed by the integron DNA integrase. | Journal of...
Deletion of individual antibiotic resistance genes found within the variable region of integrons is demonstrated. Evidence for gene duplications and rearrangements resulting from the insertion of gene units at new locations is also presented. Deletion, duplication, and rearrangement occur only in the presence of the integron-encoded DNA integrase. These events are precise and involve loss or gain of one or more complete insert units or gene cassettes. This confirms the recent definition of gene cassettes as consisting of the gene coding sequences, all except the last 7 bases of the 59-base element found at the 3 end of the gene, and the core site located 5 to the gene (Hall et al., Mol. Microbiol. 5:1941-1959, 1991) and demonstrates that individual gene cassettes are functional units which can be independently mobilized. Both deletions and duplications can be generated by integrase-mediated cointegrate formation followed by integrase-mediated resolution involving a different pair of sites. ...
ASMscience | Resolution of Multimeric Forms of Circular Plasmids and Chromosomes
One of the disadvantages of circular plasmids and chromosomes is their high sensitivity to rearrangements caused by homologous recombination. Odd numbers of crossing-over occurring during or after replication of a circular replicon result in the formation of a dimeric molecule in which the two copies of the replicon are fused. If they are not converted back to monomers, the dimers of replicons may fail to correctly segregate at the time of cell division. Resolution of multimeric forms of circular plasmids and chromosomes is mediated by site-specific recombination, and the enzymes that catalyze this type of reaction fall into two families of proteins: the serine and tyrosine recombinase families. Here we give an overview of the variety of site-specific resolution systems found on circular plasmids and chromosomes.
Leicester Research Archive: Nucleotide sequence of conjugative prophage Φ1207.3 (formerly Tn1207.3) carrying the mef(A)/msr(D)...
Genetic element Φ1207.3 (formerly Tn1207.3) is a prophage of Streptococcus pyogenes which carries the macrolide efflux resistance genes mef(A)/msr(D) and is capable of conjugal transfer among streptococci. Complete nucleotide sequence showed that Φ1207.3 is 52,491 bp in length and contained 58 open reading frames (ORFs). A manual homology-based annotation with functional prediction of the hypothetical gene product was possible only for 34 out of 58 ORFs. Φ1207.3 codes for two different C-methylation systems, several phage structural genes, a lysis cassette (composed by a holin and a peptidoglycan hydrolase), and three site-specific resolvases of the serine recombinase family ...
DCE 1.1: Authentication and Security Services - sec rgy attr test and update
The sec_rgy_attr_test_and_update() routine updates an attribute only if the set of control attributes specified in the test_attrs match attributes that already exist for the object. This update is an atomic operation: if any of the control attributes do not match existing attributes, none of the updates are performed, and if an update should be performed, but the write cannot occur for whatever reason to any member of the update_attrs array, all updates are aborted. The attribute causing the update to fail is identified in failure_index. If the failure cannot be attributed to a given attribute, failure_index contains -1. If an attribute instance already exists which is identical in both attr_id and attr_value to an attribute specified in in_attrs, the existing attribute information is overwritten by the new information. For multi-valued attributes, every instance with the same attr_id is overwritten with the supplied values. If an attribute instance does not exist, it is created. If you specify ...
مرکز منطقه ای اطلاع رساني علوم و فناوري - Assignment of O-Glycan Attachment Sites to the Hinge-like Regions of Human Lysosomal...
subject:1450510 title:Assignment of O-Glycan Attachment Sites to the Hinge-like Regions of Human Lysosomal Membrane Glycoproteins Lamp-1 and Lamp-2 author:Carlsson، نويسنده , , S.R. and Lycksell، نويسنده , , P.O. and Fukuda، نويسنده , , M.، نويسنده ,
Difference between revisions of A 5-circle incidence theorem - JSXGraph Wiki
var board = JXG.JSXGraph.initBoard(jxgbox,{boundingbox:[-5,5,5,-5]}); var A = [], s = [], B = [], c = [], r = [], k; var attA = {name:,strokeColor: #7355ff, fillColor: #7355ff}; A[0] = board.create(point, [2.5, -3], attA); A[1] = board.create(point, [2, 4], attA); A[2] = board.create(point, [-2.5, 3], attA); A[3] = board.create(point, [-4, -2], attA); A[4] = board.create(point, [0, -4], attA); for (k = 0; k , 5; k++) { s[k] = board.create(segment,[A[k], A[(k + 2) % 5]],{strokeColor:blue,strokeWidth:1}); } var attB = {name: , strokeColor: #EA0000, fillColor: #EA0000}; for (k = 0; k , 5; k++) { B[k] = board.create(intersection, [s[k], s[(k-1+5)%5], 0], attB); } var attC = {strokeColor: #aaaaaa, strokeWidth: 1}; for (k = 0; k , 5; k++) { c[k] = board.create(circle, [A[k], B[k], A[(k+1)%5]], attC); } var attR = {strokeColor: #ff0000, strokeWidth: 2}; for (k = 0; k , 5; k++) { r[k] = board.create(radicalaxis, [c[k], c[(k-1+5)%5]], attR); } ...
Difference between revisions of A 5-circle incidence theorem - JSXGraph Wiki
var board = JXG.JSXGraph.initBoard(jxgbox,{boundingbox:[-5,5,5,-5]}); var A = [], s = [], B = [], c = [], r = [], k; var attA = {name:,strokeColor: #7355ff, fillColor: #7355ff}; A[0] = board.create(point, [2.5, -3], attA); A[1] = board.create(point, [2, 4], attA); A[2] = board.create(point, [-2.5, 3], attA); A[3] = board.create(point, [-4, -2], attA); A[4] = board.create(point, [0, -4], attA); for (k = 0; k , 5; k++) { s[k] = board.create(segment,[A[k], A[(k + 2) % 5]],{strokeColor:blue,strokeWidth:1}); } var attB = {name: , strokeColor: #EA0000, fillColor: #EA0000}; for (k = 0; k , 5; k++) { B[k] = board.create(intersection, [s[k], s[(k-1+5)%5], 0], attB); } var attC = {strokeColor: #aaaaaa, strokeWidth: 1}; for (k = 0; k , 5; k++) { c[k] = board.create(circle, [A[k], B[k], A[(k+1)%5]], attC); } var attR = {strokeColor: #ff0000, strokeWidth: 2}; for (k = 0; k , 5; k++) { r[k] = board.create(radicalaxis, [c[k], c[(k-1+5)%5]], attR); } ...
DCE 1.1: Authentication and Security Services - sec rgy attr sch update entry
The sec_rgy_attr_sch_update_entry() routine modifies schema entries. Only those schema entry fields set to be modified in the sec_attr_schema_entry_parts_t data type can be modified. Some schema entry components can never be modified. Instead to make any changes to these components, the schema entry must be deleted (which deletes all attribute instances of that type) and recreated. The schema entry components that can never be modified are listed below: ...
Re: [O] What happened to ATTR ORG?
It used to be possible use ATTR_ORG on images to make them display at a different size, which was very useful when the images were large. It worked like this: #+ATTR_ORG: :width 300 [[file:very-large-image.jpg]] I havent needed it for a while, but today I went to use it and its gone! I grepped the source code, ORG-NEWS and the git log, but didnt see any mention of it. What happened? Did it go in version 9? Am I overlooking something? I feel like Ive stepped into some parallel universe where everything is the same except this one Org command. Bill -- William Denton :: Toronto, Canada --- Listening to Art: https://listeningtoart.org/ https://www.miskatonic.org/ --- GHG.EARTH: https://ghg.earth/ Caveat lector. --- STAPLR: http://staplr.org/ ...
ProCure Proton Terapiyası - Həssas Hədəfləndirmə. Daha az yan təsirlər.
2019 ProCure Proton Terapiya Mərkəzi. Bütün hüquqlar qorunur. Məzmunu və proqramları da daxil olmaqla ProCure üçün veb sayt yalnız məlumat və maarifləndirmə məqsədi ilə təmin edilmişdir. Bu tibbi məsləhət kimi nəzərdə tutulmur və hər hansı bir həkim-xəstə və ya klinik əlaqələr yaratmaq üçün nəzərdə tutulmur. Bu məlumat səhiyyə təminatçınızla məsləhətləşmənin əvəzi deyil. Bu veb saytdakı fikir və rəylər mütləq ProCure-ni əks etdirmir. ProCure, ən geniş auditoriya üçün əlçatan bir veb sayt təqdim etməyə sadiqdir. Bu işdə kömək etmək üçün bir dil tərcüməçisi vasitəsi mövcuddur. ProCure İngilis dilindən səhv və yanlış hesab edilə bilən tərcümələrə görə məsuliyyət daşımır. Zəhmət olmasa bir tərcüməçini təyin etmək üçün birbaşa və ya həkiminizlə əlaqə saxlayın. Bu veb saytdan istifadə etməklə İstifadə şərtlərini qəbul edirsiniz. Zəhmət olmasa Gizlilik ...
Camera Product Specifications | Horn Photo, Fresno CA
var warranties = ; if(warranties < 200) { $(#warrantyText).text(3 Year ADH Protection Under $200 Warranty); $(#warrantyLinkBox).attr(href, ../promaster-3-year-adh-protection-under-200-6025/92bdf7f0-fb35-0132-eef4-00163e9110c0); } else if(warranties < 250) { $(#warrantyText).text(3 Year ADH Protection Under $250 Warranty); $(#warrantyLinkBox).attr(href, ../promaster-3-year-adh-protection-under-250-6027/93c530c0-fb38-0132-ef00-00163e9110c0); } else if(warranties < 300) { $(#warrantyText).text(3 Year ADH Protection Under $300 Warranty); $(#warrantyLinkBox).attr(href, ../promaster-3-year-adh-protection-under-300-6029/94a91ec0-fb38-0132-ef01-00163e9110c0); } else if(warranties < 400) { $(#warrantyText).text(3 Year ADH Protection Under $400 Warranty); $(#warrantyLinkBox).attr(href, ../promaster-3-year-adh-protection-under-400-6031/95f57c50-fb38-0132-ef03-00163e9110c0); } else if(warranties < 500) { $(#warrantyText).text(3 Year ADH ...
Camera Product Specifications | Horn Photo, Fresno CA
var warranties = ; if(warranties < 200) { $(#warrantyText).text(3 Year ADH Protection Under $200 Warranty); $(#warrantyLinkBox).attr(href, ../promaster-3-year-adh-protection-under-200-6025/92bdf7f0-fb35-0132-eef4-00163e9110c0); } else if(warranties < 250) { $(#warrantyText).text(3 Year ADH Protection Under $250 Warranty); $(#warrantyLinkBox).attr(href, ../promaster-3-year-adh-protection-under-250-6027/93c530c0-fb38-0132-ef00-00163e9110c0); } else if(warranties < 300) { $(#warrantyText).text(3 Year ADH Protection Under $300 Warranty); $(#warrantyLinkBox).attr(href, ../promaster-3-year-adh-protection-under-300-6029/94a91ec0-fb38-0132-ef01-00163e9110c0); } else if(warranties < 400) { $(#warrantyText).text(3 Year ADH Protection Under $400 Warranty); $(#warrantyLinkBox).attr(href, ../promaster-3-year-adh-protection-under-400-6031/95f57c50-fb38-0132-ef03-00163e9110c0); } else if(warranties < 500) { $(#warrantyText).text(3 Year ADH ...
KBT vid samtidig somatisk sjukdom : KBT-terapeuters erfarenheter av att i psykiatrin möta patienter som lever med allvarlig och...
Studiens syfte var att undersöka erfarenheter hos psykoterapeuter inom psykiatrin av att bedriva KBT med patienter som samtidigt lever med kronisk och/eller allvarlig somatisk sjukdom. Detta utifrån frågeställningar om hur KBT-terapeuter beskriver hur samtidig allvarlig och/eller kronisk somatisk sjukdom påverkar det terapeutiska arbetet och hur terapeuterna förhåller sig till denna påverkan i relation till att genomföra terapin? Semistrukturerade intervjuer genomfördes med sex psykoterapeuter som alla hade KBT-inriktning och arbetade inom psykiatrin. En tematisk analys gjordes sedan av intervjuerna och där framkom huvudteman som följsamhet, helhetssyn och organisatorisk påverkan. Följsamhet till patienternas behov av anpassning gällde allt från längden på sessionerna till möjligheten att pausa terapin under vissa perioder. Att ha en helhetssyn kunde innebära att psykoterapeuten klev utanför sitt expertområde för att samarbeta med den somatiska vården kring en patient, ...
Bibliografia
Note: Ai sensi e per gli effetti dellArt. 76 D.P.R. 445/2000 consapevole della responsabilità e delle conseguenze civili e penali previste in caso di dichiarazioni mendaci e/o formazione od uso di atti falsi, nonché in caso di esibizione atti contenenti dati non più corrispondenti a verità e consapevole altresì che qualora emerga la non veridicità del contenuto della presente decadranno i benefici per i quali la stessa è rilasciata confermo di essere un OPERATORE SANITARIO.. I contenuti presenti in questo sito contengono informazioni rivolte agli operatori sanitari, in quanto si riferiscono a prodotti rientranti nella categoria dei dispositivi medici che richiedono limpiego o lintervento da parte di professionisti del settore medico-sanitario.. ...
No. Akreditasi Lab PT. Ganesha Inti Persada | Calibration Services PT Ganesha Inti Persada
Kabar Gembira!!!. Sekarang Lab PT Ganesha Inti Persada sudah ter-Akreditrasi oleh KAN dengan No. Akreditasi LK-302-IDN .. Yang berminat untuk mengkalibrasi Massa dan Suhu silahkan menghubungi kami.. Contact Person.. Email : [email protected]. Telephone : 021-2283 0080. WhatsApp/SMS : 0811 996 1224. ...
Att arbeta med ensamkommande flyktingbarn : En kvalitativ studie ur ett personalperspektiv på HVB-hem
Syftet med denna studie är att undersöka vilket stöd ensamkommande barn behöver vid ankomsten till Sverige utifrån personalens erfarenhet. Metoden är en kvalitativ studie som baseras utifrån intervjuer och litteraturkunskap för att få mer ingående och friare svar från intervjupersonerna. Huvudteman som framkom under intervjuerna är grundläggande behov, stödet som erbjuds, trygghet, föräldragestalter, utbildning, fritid och hinder i arbetet. Samtliga intervjupersoner beskriver ungdomarnas behov mycket olika då det skiljer sig från person till person. Det stöd barnen får är den viktigaste faktor som de ensamkommande barnen behöver för att kunna utvecklas och få ett bättre och tryggare liv. Resultatet visar att personalen har vetskap om all den kunskap som behövs för att kunna vara en bra förebild och en stödjande vuxen i barnens vardag. Det framkom tydligt hur relationen och tryggheten för de ensamkommande barnen är avgörande och ...
Att leva med bipolär sjukdom.
Bakgrund: Bipolär sjukdom innebär perioder av mani och depressioner vilket kan medföra svårigheter för personer som drabbats. För att kunna förstå och hjälpa dessa personer behöver sjukvårdspersonal kunskap om hur sjukdomen upplevs och hanteras. Syfte: att belysa hur personer med bipolär sjukdom upplever och hanterar sin sjukdom. Metod: En allmän litteraturstudie genomfördes med kvalitativa artiklar. Resultat: Personernas inställning till diagnosen och behandling varierade och relationen till sjukvårdspersonalen var betydelsefull. Svårigheterna att hantera och bemöta sjukdomen orsakade känslor av osäkerhet, okontrollerbarhet och instabilitet. Sjukdomen påverkade självförtroendet och självkänslan och orsakade upplevd stigmatisering och problem i relationer. För att kunna hantera bipolär sjukdom krävdes egen acceptans, kunskap och insikt, struktur i vardagen samt stöd från närstående. Diskussion: Resultaten diskuteras utifrån Antonovskys teori om känsla av ...
Forex trend wave system
Most diaphanopterodeans trend forex system wave the message sinks in, atti Finland , forex investment paypal, recursive algorithm convert decimal to binary code
New drugs approved by drugs con
a3 Item Manager a3 Item Manager är en komplett och flexibel produkt för att hantera artiklar och artikelinformation. Produkten ger möjlighet att skapa och underhålla gemensam artikeldata både internt och externt hos kunder och leverantörer. Accure har som mål att kunna effektivisera och förenkla hanteringen runt artiklar. Nyttan med detta är att kunna göra smidigare och mer löns ...
「オウルバロン!」の永続的アドレス
ここはラグナロクオンラインのフェンリル鯖にて活動しているINT商人しろっくまの日常と中の人の平穏を日々綴っているブログです。
INT商人考察あります。
INT11抗体|Abcam中国|Anti-INT11抗体(ab75276)
INT11兔多克隆抗体(ab75276)可与小鼠, 人样本反应并经WB, IP, IHC实验严格验证,被2篇文献引用。所有产品均提供质保服务,中国75%以上现货。
Svenska avhandlingar - SSVS
Här presenteras avhandlingar inom svensk kärlkirurgi.. Listan är endast påbörjad, och en ständig komplettering kommer att pågå.. Sänd bidrag till webmaster!. ...
Starbucks •
Kaffejätten Starbucks öppnar på Centralstationen i december.Det blir startskottet för en supersatsning där man planerar att öppna runt 50 nya ställen nästa ...
fumalls perjuraràs alteró emmatxuqueu
Heraclià Bruniquer sintagma cofassis cabrafigant desatendés serrat autocompadís prevenia entaulelli encorbàreu mioles disserten alicatats calivoses miraries caplletràveu revel·lisquen menejats parifiquéssem regolfessin desesperancessis encoratjats encebàs [email protected] ...
Do some people have protection against the coronavirus? | WOGT-FM
But many questions remain - including whether this recognition to parts of SARS-CoV-2 by T cells helps or hurts.. Would these memory T cells be helpful for protecting you against Covid-19 disease, thats the huge question, said Crotty. We dont know if [the T cells] are helpful or not, but we think its reasonable to speculate that they may be helpful. Its not that we think they would completely protect against any infection at all, but if you already have some cells around, they can fight the virus faster and so its plausible that instead of ending up in the ICU, you dont. And instead of ending up in the hospital, you just end up with a bad cold.. Other researchers are also intrigued by the possibilities put forth by this discovery.. Dr. Arturo Casadevall told CNN his first thought was Not surprising, important, good to know. Casadevall chairs the department of molecular microbiology and immunology at the Johns Hopkins School of Public Health.. Because these coronaviruses are all ...