In this study we demonstrated that Alu repetitive elements can function as inducers of A-to-I editing in adjacent sequences, affecting the expressed proteome. Alu repeats are primate specific and vary also in abundance within primates. Our observation therefore points to a human- or primate-specific phenomenon that cannot be explained by the sequence at the site of editing.. It has previously been speculated by Li and co-workers that non-Alu A/I editing sites are dependent on nearby edited Alu sequences in the human transcriptome [20]. Their theory was based on the fact the two classes of editing are often found within close proximity in the same transcripts. We were able to confirm their hypothesis, and show that editing in non-repetitive elements often depends on nearby repetitive Alu elements. Our previous analysis showed that induction of site-selective editing at the I/M site of Gabra-3 by a long intronic hairpin structure is independent of editing, and instead depends on the ...
TY - JOUR. T1 - MIEN1 is tightly regulated by SINE Alu methylation in its promoter. AU - Rajendiran, Smrithi. AU - Gibbs, Lee D.. AU - Van Treuren, Timothy. AU - Klinkebiel, David L.. AU - Vishwanatha, Jamboor K.. PY - 2016/1/1. Y1 - 2016/1/1. N2 - Migration and invasion enhancer 1 (MIEN1) is a novel gene involved in prostate cancer progression by enhancing prostate cancer cell migration and invasion. DNA methylation, an important epigenetic regulation, is one of the most widely altered mechanisms in prostate cancer. This phenomenon frames the basis to study the DNA methylation patterns in the promoter region of MIEN1. Bisulfite pyrosequencing demonstrates the MIEN1 promoter contains a short interspersed nuclear Alu element (SINE Alu) repeat sequence. Validation of methylation inhibition on MIEN1 was performed using nucleoside analogs and non-nucleoside inhibitors and resulted in an increase in both MIEN1 RNA and protein in normal cells. MIEN1 mRNA and protein increases upon inhibition of ...
Repetitive elements constitute 45% of the human genome [1]. With more than 1 million copies (about 10% of the human genome), Alu sequences are the most prevalent repetitive elements [2]. Alus began to spread at the base of the primate lineage about 65 million years ago [3] and inserted at high rates until about 30 million years ago, after which Alu insertion rate was markedly reduced. This translates to 85% of Alus being common to all monkeys [4]. Because they are primate specific, Alus have been proposed to be major players in shaping the primate genome and transcriptome. However, little is known about the impact they have on genome structure and function. Although they are considered genetic junk by some authors [5], others have proposed that they are functionally important [1, 6-8]. In a few instances they have been found to have inserted into coding regions of genes, becoming part of the protein coding message [9, 10]. Similarly, newly inserted Alu elements may trigger genomic responses ...
Gene duplication and exonization of intronic transposed elements are two mechanisms that enhance genomic diversity. We examined whether there is less selection against exonization of transposed elements in duplicated genes than in single-copy genes. Genome-wide analysis of exonization of transposed elements revealed a higher rate of exonization within duplicated genes relative to single-copy genes. The gene for TIF-IA, an RNA polymerase I transcription initiation factor, underwent a humanoid-specific triplication, all three copies of the gene are active transcriptionally, although only one copy retains the ability to generate the TIF-IA protein. Prior to TIF-IA triplication, an Alu element was inserted into the first intron. In one of the non-protein coding copies, this Alu is exonized. We identified a single point mutation leading to exonization in one of the gene duplicates. When this mutation was introduced into the TIF-IA coding copy, exonization was activated and the level of the protein-coding
lncRNAs transactivate STAU1-mediated mRNA decay by duplexing with 3′ UTRs via Alu elements Chenguang Gong & Lynne E. Maquat Nature 470, 284-288 (10 February 2011) doi:10.1038/nature09701Staufen 1 (STAU1)-mediated messenger RNA decay (SMD) involves the degradation of translationally active mRNAs whose 3′-untranslated regions (3′ UTRs) bind to STAU1, a protein that binds to double-stranded RNA1. Earlier…
The newly identified mechanism involves Alu elements, repetitive DNA elements that spread throughout the genome as primates evolved. While scientists have known about the existence of Alu elements for many years, their function, if any, was largely unknown.. Maquat discovered that Alu elements team up with molecules called long noncoding RNAs (lncRNAs) to regulate protein production. They do this by ensuring messenger RNAs (mRNAs), which take genetic instructions from DNA and use it to create proteins, stay on track and create the right number of proteins. If left unchecked, protein production can spiral out of control, leading to the proliferation or multiplication of cells, which is characteristic of diseases such as cancer.. "Previously, no one knew what Alu elements and long noncoding RNAs did, whether they were junk or if they had any purpose. Now, weve shown that they actually have important roles in regulating protein production," said Maquat, the J. Lowell Orbison Chair, professor of ...
Dark Horse Comics told ANN on Monday that it has sold 1.2 million copies of Kentarou Miuras Berserk manga. As of 2015, the series had more than 27 million...
Activision has announced this weekend that Modern Warfare 3 sold 6.5 million copies in its first 24 hours of availability. Making that massive number even more impressive ...
Cuphead is celebrating its second anniversary today. As part of that, the game is seeing a 20 percent discount during the next week.. Studio MDHR has also announced that Cuhead has surpassed five million copies sold. The title debuted on Switch earlier this year and has been a strong seller on the platform.. Source. ...
The passing of Dr. Jerzy Jurka (Jurek to his friends) represents a heartfelt loss to his many friends in the Mobile DNA field. The whole field of Mobile DNA has lost the scientific efforts of a brilliant colleague and for many of us an esteemed friend. The accompanying biography provides an outstanding outline of his life and career, so I will focus primarily on his impact to the field of Mobile DNA.. Jureks first publication related to Mobile DNA was the discovery of an Alu element in an alpha globin gene in the late 1980s while working with Temple Smith. Jurek was one of the pioneers of well-trained bioinformatics experts to focus his expertise on mobile elements, with one of the early and important findings of subfamilies in the Alu elements. Through the years, his ability to handle large genomic datasets led him to a number of important discoveries, including a bioinformatic prediction of the target site for SINEs and LINEs, the discovery of several new families and clades of mobile ...
ID PBP96 preliminary; circular DNA; SYN; 4600 BP. XX AC ATCC77084; XX DT 01-JUL-1993 (Rel. 7, Created) DT 01-JUL-1995 (Rel. 12, Last updated, Version 1) XX DE Saccharomyces/E.coli plasmid vector pBP96 - incomplete. XX KW cloning vector. XX OS Cloning vector OC Artificial sequences; Cloning vehicles. XX RN [1] RC plasmid from pBluescript series & HIS3 gene RC pBP96 from BLUR8 & plasmid RC pBP97 from BLUR8 & plasmid RC pBP90 from HIS3 gene & pL1.1A, LINE RA Pavan W.J., Reeves R.H.; RT "Integrative selection of human chromosome-specific yeast RT artificial chromosomes"; RL Proc. Natl. Acad. Sci. U.S.A. 88:7788-7791(1991). XX RN [2] RC from pBP62 RC from pYAC3 RC from pYAC4 RC from pYAC55 RC from pJS97 RC from pJS98 RC from pYACneo RC from pYAC-RC RC from pCGS966 RC from pBP81 RC from pBP100 series RC pBP90 from human LINE repeats RC pBP96 from human Alu repeats RC pBP97 from human Alu repeats RC pBP47 from human Alu repeats & HIS3 & SV40 promoter & neo RA Reeves R.H., Pavan W.J., Hieter P.; RT ...
The fact that roughly half of the human genome is made up of TEs, with a significant portion of them being L1 and Alu retrotransposons, raises an important question: What do a…ll these jumping genes do, besides jump? Much of what a transposon does depends on where it lands. Landing inside a gene can result in a mutation, as was discovered when insertions of L1 into the factor VIII gene caused hemophilia (Kazazian et al., 1988). Similarly, a few years later, researchers found L1 in the APC genes in colon cancer cells but not in the APC genes in healthy cells in the same individuals. This confirms that L1 transposes in somatic cells in mammals, and that this element might play a causal role in disease development (Miki et al., 1992). (MORE) ...
In response to Death Note/Hikaru no Go artist Takeshi Obatas recent arrest, Shueisha, his publisher, has announced that, until they can verify the details of the incident, they are not considering any actions such as pulling his work from stores.. Of Obatas work, Hikaru no Go (story: Yumi Hotta) has sold approximately 10 million copies over the span of 23 volumes, while Death Note (story: Tsugumi Ohba) has sold approximately 20 million copies over a span of 12 volumes. Publicists for Shueisha commented, "we are currently verifying the factual details of this incident, and are not considering pulling titles from circulation or any such action at this time.". Death Note was adapted into a live-action movie by Nihon TV (NTV), the first part of which was released in Japan in June and became a smash-hit, drawing an audience of over 2 million people. The movie was released in Hong Kong as well, and the sequel, which concludes the story, is slated for a November release. An anime adaptation is also ...
French media outlets help to publish newest issue of satirical magazine, after an attack on its offices killed eight of its staff, four others.
This is a parity predictor and carry checker for the Arithmetic Logic Unit ALU of a data processor. The carry generation within ALU is checked by perfo...
Kendra Baughman York Marahrens Lab UCLA. Finding Sequence Motifs in Alu Transposons that Enhance the Expression of Nearby Genes. Overview. Goal Background Prior Studies Strategy Results Remaining Tasks Future Directions. Goal. Slideshow 322233 by hamilton
Akkadian: (?) alu (elu) a fine breed of sheep [CAD a1 374], [AHw. 39] (rendered as ālu, jālu). // Extensively commented in the discussion section of the article in [CAD] as well as in [Steinkeller 52]. According to Steinkeller, the earliest attestations of UDU.A.LUM are in Sum. lexicals lists from Abū Salābīh̊ and Ebla. Later on, the term is common in economic texts from Ur III, early OB, Mari and Qatna. Both CAD and Steinkeller assume its identity with aslu, a literary term for ram, lamb found mostly in later texts. Since the phonetic development alu > aslu (or vice versa) is difficult, one tends to agree with Steinkeller that A.LUM is "an abbreivated/defective Akkadogram" to be read aslumx. If this assumption is correct, Akk. alu does not exist and does not form part of the present root ("Once UDU A.LUM is reclassified as aslu, then the lemma alu ... simply disappears" [Steinkeller 66]). // As for the forms a-lu, e-lu appearing as "true" Akkadian words (not logograms) in MA sources, ...
Vostermans Companies is parent company of a multinational enterprise, executed by Vostermans Ventilation and Vostermans Alu Foundries.
To detect this sequence using open PCR, the primers must first be constructed. In this case, the reverse primer would be 5 AACTCTTACACTGCATACAT 3, and the forward primer would be 3 TGGTATAAGACATTCCTGT 5. The forward primer is located 200 base pairs to the left of the reverse primer, attaching to the opposite strand. The strand needs to be at least 200 base pairs long so that the DNA may be easier detected if the results are positive. If the sample produces positive results, it means that the r17879961 gene is present, so the primers will bind to this gene, replicating exponentially and producing thousands to millions of copies of DNA. If the sample being tested gives us negative results and does not contain this sequence, there will only be around 30 replicated strands of DNA, rather than millions copies since the primers wont bind to the gene ...
To detect this sequence using open PCR, the primers must first be constructed. In this case, the reverse primer would be 5 AACTCTTACACTGCATACAT 3, and the forward primer would be 3 TGGTATAAGACATTCCTGT 5. The forward primer is located 200 base pairs to the left of the reverse primer, attaching to the opposite strand. The strand needs to be at least 200 base pairs long so that the DNA may be easier detected if the results are positive. If the sample produces positive results, it means that the r17879961 gene is present, so the primers will bind to this gene, replicating exponentially and producing thousands to millions of copies of DNA. If the sample being tested gives us negative results and does not contain this sequence, there will only be around 30 replicated strands of DNA, rather than millions copies since the primers wont bind to the gene ...
Later, when People released a commemorative issue about the singer, few at the magazine thought it would sell. Publishers were shocked when the issue sold one million copies, and then its entire run within a matter of weeks. Editor Betty Cortina called it "unheard of," and it was credited with sparking the start of Spanish-language magazines like People en Español and Latina. The singer also arguably paved the way for future Latino artists, including Jennifer Lopez, who, in the film about Selenas life, became the first Latina to earn $1 million for a film role ...
PJ Lynch on drawing, painting and illustration with particular reference to his own work. PJ Lynch is an award winning illustrator whose books have sold more than two million copies worldwide.
PJ Lynch on drawing, painting and illustration with particular reference to his own work. PJ Lynch is an award winning illustrator whose books have sold more than two million copies worldwide.
Fingerprints of the Gods has been translated into 27 languages and is estimated to have sold more than three million copies around the world.
We all know the classic Manics quote, right? About how they were going to make the greatest debut album ever, sell 18 million copies, then split u...
AluScan combines inter-Alu PCR using multiple Alu-based primers with opposite orientations and next-generation sequencing to capture a huge number of Alu-proximal genomic sequences for investigation. Its requirem... Authors: Jian-Feng Yang, Xiao-Fan Ding, Lei Chen, Wai-Kin Mat, Michelle Zhi Xu, Jin-Fei Chen, Jian-Min Wang, Lin Xu, Wai-Sang Poon, Ava Kwong, Gilberto Ka-Kit Leung, Tze-Ching Tan, Chi-Hung Yu, Yue-Bin Ke, Xin-Yun Xu, Xiao-Yan Ke…. ...
AluScan combines inter-Alu PCR using multiple Alu-based primers with opposite orientations and next-generation sequencing to capture a huge number of Alu-proximal genomic sequences for investigation. Its requirem... Authors: Jian-Feng Yang, Xiao-Fan Ding, Lei Chen, Wai-Kin Mat, Michelle Zhi Xu, Jin-Fei Chen, Jian-Min Wang, Lin Xu, Wai-Sang Poon, Ava Kwong, Gilberto Ka-Kit Leung, Tze-Ching Tan, Chi-Hung Yu, Yue-Bin Ke, Xin-Yun Xu, Xiao-Yan Ke…. ...
It is a high quality, rigid and a very solid round profile made of anodized aluminum designed to be used with LED light sources. Thanks to a suitably designed shape, the profile can be safely used for high power LED strips (36W/m). The shape guara...
As I had a small portion of paneer left over in the fridge, I combined it with some potato and used it up to make this delicious parata. As of any Parata, this is also very soft, wholesome and filling ...
MTB Cross Fahrräder günstig im Mountainbike Shop von bikester.at kaufen. Hier klicken und sich vom Großen Angebot an Cross Mountainbikes überzeugen!
The entire functional NANOG gene (according to our sequencing data) and NANOGP1 are present in both the human and chimpanzee genome assemblies at orthologous chromosomal positions. In the 3 UTR of the NANOG gene, there is an Alu element, which is missing from NANOGP1 in both genomes. Therefore, the NANOGP1 unprocessed pseudogene arose through duplication of the chromosomal region containing NANOG before the human-chimpanzee (H/C) divergence and before insertion of the Alu element into the NANOG gene. Because the same Alu element is present in both the human and chimpanzee NANOG genes, its insertion must also have preceded the H/C divergence. The processed pseudogenes NANOGP2, NANOGP3, NANOGP4, NANOGP5, NANOGP6, NANOGP7, NANOGP9, and NANOGP10 lack this Alu element. They thus likely arose before its insertion and, therefore, also predate the H/C divergence. The presence of the NANOGP11 pseudogene fragment in both the human and chimpanzee genomes likewise shows that its origin preceded H/C ...
Read "Interaction of rice and human SRP19 polypeptides with signal recognition particle RNA, Plant Molecular Biology" on DeepDyve, the largest online rental service for scholarly research with thousands of academic publications available at your fingertips.
Active retrotransposons play important roles during evolution and continue to shape our genomes today, especially in genetic polymorphisms underlying a diverse set of diseases. However, studies of human retrotransposon insertion polymorphisms (RIPs) based on whole-genome deep sequencing at the population level have not been sufficiently undertaken, despite the obvious need for a thorough characterization of RIPs in the general population.|br| Herein, we present a novel and efficient computational tool named Specific Insertions Detector (SID) for the detection of non-reference RIPs. We demonstrate that SID is suitable for high depth whole-genome sequencing (WGS) data using paired-end reads obtained from simulated and real datasets. We construct a comprehensive RIP database using a large population of 90 Han Chinese individuals with a mean 68× depth per individual. In total, we identify 9342 recent RIPs, and 8433 of these RIPs are novel compared with dbRIP, including 5826 Alu, 2169 long interspersed
While at Rodale, Gottlieb was the creator and supervising editor of the mega-selling The Doctors Book of Home Remedies (16 million copies sold), and was the spokesperson in a commercial for the book that was broadcast 50,000 times and generated sales of 2 million copies. He has appeared as an expert on natural remedies on Good Morning America, CNN, and many other national TV and radio shows. His articles on health and healing have appeared in many magazines and periodicals, including Prevention, Readers Digest, Health, Runners World, Mens Health, New Beauty, Natural Health, Self, Alternative Medicine, Bottom Line Personal and Bottom Line Health ...
Translations of select Alu repeats from REPBASE, suitable for masking Alu repeats from query sequences. It is available by anonymous FTP from ncbi.nlm.nih.gov (under the /pub/jmc/alu directory). See "Alu alert" by Claverie and Makalowski, Nature vol. 371, page 752 (1994) . ...
Alu transposons are found only in primate genomes and have accumulated in large numbers since primates diverged from other mammals. Human chromosomes contain more than one million Alu copies, equaling about 10% of the genome by mass. This accumulation was made possible by a transposition mechanism that reverse transcribes Alu mRNAs into mobile DNA copies. Another transposon, the long interspersed element (LINE) L1, supplies a specialized reverse transcriptase enzyme needed for Alu to jump. Hence, Alu and L1 exist in a sort of molecular symbiosis. ...
I suppose this is a good follow-up to the post on Grays Anatomy. (The study of genetics is the new study of anatomy, right?) The image above is a quilt that is designed to show a YAP genomic sequence: "the Y alu polymorphism sequence of an Italian male is encoded in this quilt. The quilt is made of shot silk, which reflects light differently depending on the orientation of the weave and the viewer." The quilt is by Beverly St. Clair, a psychiatrist who is also a quilter, and more explanation of her method and how to read the quilt can be found on her website ...
[vc_column pofo_column_animation_style=none width=1/1 mobile_alignment=xs-text-justify mobile_display=xs-display-inline-block][pofo_section_heading
Buy the BH LYNX RACE ALU 3.0 bike online in the official BH store. Complete information about its features, geometrics,technology and tests in magazines in the BH Bikes Store EN
Patrick Lencioni is founder and president of The Table Group, a firm dedicated to providing organizations with ideas, products and services that improve teamwork, clarity and employee engagement. Pats passion for organizations and teams is reflected in his writing, speaking and executive consulting. He is the author of several best-selling business books with over five million copies sold. Prior to founding his firm, he worked as a corporate executive for Sybase, Oracle and Bain & Company.. ...
Is anesthesia worthy of the House of Gods assessment that its a cushy medical specialty? My answer, after thirty years of anesthesia practice: it depends.
Lets be honest. Lara Bars are expensive. Its only been on the rare occasion that Ive eaten one and everytime I do, I think "I could have just made that!". There are currently 1.3 million copy cat recipes out there for Lara Bars (okay, maybe that number is inaccurate.) I figured I should contribute at least one more ...
Got a thing on the agenda here.. Bending aluminum tube of the 6061 variety, OD 30 mm with a 5 mm wall, 90 degree bend... with a radius of two inches.
There are also various self replicating genetic elements that exist in huge numbers in the human genome alu alone numbers about 500,000 compared to about 30,000 protein coding genes. About 45% of the human genome is composed of these elements. These elements can play many roles in the human including disrupting genes, promoting certain types of mutation and they can be co-opted to play a role in gene expression, although most seem to have no effect on the host ...
Of course, these proteins are ultimately a encoded by some genes, so the DNA code would still be the ultimate arbiter, but now it seems that the key may not be in the gene alone but also in those proteins that control its behavior, which in turn are generated by other "master genes". ...
Claim 2: Reddit user Aceofspades25 [4] has addressed Tomkins claim that the low frequency of telomere motif repeats indicates that the fusion of 2 chimp chromosomes did not occur to product the human chromosome 2. These motifs are "TTAGGG" joined to a series of repeats of the motif "CCCTAA". While the frequency of these repeated motifs may be lower than expected on initial examination, he believes that it is not surprising. He cites, Carl Zimmer, a popular science writer and blogger, who focuses on the study of evolution and parasites. He has written several books on the topic and is a science writer for The New York Times, Discover, and National Geographic. Zimmer states "The ends of chromosomes are very vulnerable places. If they simply dangle loosely, DNA-cutting enzymes can nibble away at them, destroying the genes they encounter. The dangling end of one chromosome can also get attached to the dangling end of another, fusing chromosomes together. We are mostly protected from such changes ...
Hospitals are under pressure to cut costs and to restore patients to good health without readmissions. Predictive analytics can help, but providers need a solid plan for using their data. Continue Reading ...
Variegate porphyria (VP) is an autosomal dominantly inherited hepatic porphyria. The genetic defect in the PPOX gene leads to a partial defect of protoporphyrinogen oxidase, the penultimate enzyme of heme biosynthesis. Affected individuals can develop cutaneous symptoms in sun-exposed areas of the skin and/or neuropsychiatric acute attacks. The identification of the genetic defect in VP families is of crucial importance to detect the carrier status which allows counseling to prevent potentially life threatening neurovisceral attacks, usually triggered by factors such as certain drugs, alcohol or fasting. In a total of 31 Swedish VP families sequence analysis had identified a genetic defect in 26. In the remaining five families an extended genetic investigation was necessary. After the development of a synthetic probe set, MLPA analysis to screen for single exon deletions/duplications was performed. We describe here, for the first time, two partial deletions within the PPOX gene detected by MLPA analysis
Long non-coding RNAs (lncRNA) are a novel class of RNA molecule that are emerging as important regulators of gene transcription and post-transcriptional events. lncRNAs have been shown to reg
Disneys debut of Cinderella on DVD last week generated sales of more than 3 million copies in just the first week of release. Like most of Disneys animated classics debuting on DVD each fall in Platinum editions, the 55-year-old Cinderella got out of the gate quickly with more than 1 million copies sold on the first day.