Werner Syndrome: An autosomal recessive disorder that causes premature aging in adults, characterized by sclerodermal skin changes, cataracts, subcutaneous calcification, muscular atrophy, a tendency to diabetes mellitus, aged appearance of the face, baldness, and a high incidence of neoplastic disease.RecQ Helicases: A family of structurally-related DNA helicases that play an essential role in the maintenance of genome integrity. RecQ helicases were originally discovered in E COLI and are highly conserved across both prokaryotic and eukaryotic organisms. Genetic mutations that result in loss of RecQ helicase activity gives rise to disorders that are associated with CANCER predisposition and premature aging.Exodeoxyribonucleases: A family of enzymes that catalyze the exonucleolytic cleavage of DNA. It includes members of the class EC 3.1.11 that produce 5'-phosphomonoesters as cleavage products.DNA Helicases: Proteins that catalyze the unwinding of duplex DNA during replication by binding cooperatively to single-stranded regions of DNA or to short regions of duplex DNA that are undergoing transient opening. In addition DNA helicases are DNA-dependent ATPases that harness the free energy of ATP hydrolysis to translocate DNA strands.Syndrome: A characteristic symptom complex.Exonucleases: Enzymes that catalyze the release of mononucleotides by the hydrolysis of the terminal bond of deoxyribonucleotide or ribonucleotide chains.Aging, Premature: Changes in the organism associated with senescence, occurring at an accelerated rate.4-Nitroquinoline-1-oxide: A potent mutagen and carcinogen. This compound and its metabolite 4-HYDROXYAMINOQUINOLINE-1-OXIDE bind to nucleic acids. It inactivates bacteria but not bacteriophage.Progeria: An abnormal congenital condition, associated with defects in the LAMIN TYPE A gene, which is characterized by premature aging in children, where all the changes of cell senescence occur. It is manifested by premature greying; hair loss; hearing loss (DEAFNESS); cataracts (CATARACT); ARTHRITIS; OSTEOPOROSIS; DIABETES MELLITUS; atrophy of subcutaneous fat; skeletal hypoplasia; elevated urinary HYALURONIC ACID; and accelerated ATHEROSCLEROSIS. Many affected individuals develop malignant tumors, especially SARCOMA.Bloom Syndrome: An autosomal recessive disorder characterized by telangiectatic ERYTHEMA of the face, photosensitivity, DWARFISM and other abnormalities, and a predisposition toward developing cancer. The Bloom syndrome gene (BLM) encodes a RecQ-like DNA helicase.Rothmund-Thomson Syndrome: An autosomal recessive syndrome occurring principally in females, characterized by the presence of reticulated, atrophic, hyperpigmented, telangiectatic cutaneous plaques, often accompanied by juvenile cataracts, saddle nose, congenital bone defects, disturbances in the growth of HAIR; NAILS; and TEETH; and HYPOGONADISM.Telomere: A terminal section of a chromosome which has a specialized structure and which is involved in chromosomal replication and stability. Its length is believed to be a few hundred base pairs.DNA Replication: The process by which a DNA molecule is duplicated.DNA Damage: Injuries to DNA that introduce deviations from its normal, intact structure and which may, if left unrepaired, result in a MUTATION or a block of DNA REPLICATION. These deviations may be caused by physical or chemical agents and occur by natural or unnatural, introduced circumstances. They include the introduction of illegitimate bases during replication or by deamination or other modification of bases; the loss of a base from the DNA backbone leaving an abasic site; single-strand breaks; double strand breaks; and intrastrand (PYRIMIDINE DIMERS) or interstrand crosslinking. Damage can often be repaired (DNA REPAIR). If the damage is extensive, it can induce APOPTOSIS.DNA: A deoxyribonucleotide polymer that is the primary genetic material of all cells. Eukaryotic and prokaryotic organisms normally contain DNA in a double-stranded state, yet several important biological processes transiently involve single-stranded regions. DNA, which consists of a polysugar-phosphate backbone possessing projections of purines (adenine and guanine) and pyrimidines (thymine and cytosine), forms a double helix that is held together by hydrogen bonds between these purines and pyrimidines (adenine to thymine and guanine to cytosine).Replication Protein A: A single-stranded DNA-binding protein that is found in EUKARYOTIC CELLS. It is required for DNA REPLICATION; DNA REPAIR; and GENETIC RECOMBINATION.Telomeric Repeat Binding Protein 2: A ubiquitously expressed telomere-binding protein that is present at TELOMERES throughout the cell cycle. It is a suppressor of telomere elongation and may be involved in stabilization of telomere length. It is structurally different from TELOMERIC REPEAT BINDING PROTEIN 1 in that it contains basic N-terminal amino acid residues.Adenosine Triphosphatases: A group of enzymes which catalyze the hydrolysis of ATP. The hydrolysis reaction is usually coupled with another function such as transporting Ca(2+) across a membrane. These enzymes may be dependent on Ca(2+), Mg(2+), anions, H+, or DNA.DNA Repair: The reconstruction of a continuous two-stranded DNA molecule without mismatch from a molecule which contained damaged regions. The major repair mechanisms are excision repair, in which defective regions in one strand are excised and resynthesized using the complementary base pairing information in the intact strand; photoreactivation repair, in which the lethal and mutagenic effects of ultraviolet light are eliminated; and post-replication repair, in which the primary lesions are not repaired, but the gaps in one daughter duplex are filled in by incorporation of portions of the other (undamaged) daughter duplex. Excision repair and post-replication repair are sometimes referred to as "dark repair" because they do not require light.Antigens, Nuclear: Immunologically detectable substances found in the CELL NUCLEUS.Mutation: Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.Fibroblasts: Connective tissue cells which secrete an extracellular matrix rich in collagen and other macromolecules.HeLa Cells: The first continuously cultured human malignant CELL LINE, derived from the cervical carcinoma of Henrietta Lacks. These cells are used for VIRUS CULTIVATION and antitumor drug screening assays.Genomic Instability: An increased tendency of the GENOME to acquire MUTATIONS when various processes involved in maintaining and replicating the genome are dysfunctional.Down Syndrome: A chromosome disorder associated either with an extra chromosome 21 or an effective trisomy for chromosome 21. Clinical manifestations include hypotonia, short stature, brachycephaly, upslanting palpebral fissures, epicanthus, Brushfield spots on the iris, protruding tongue, small ears, short, broad hands, fifth finger clinodactyly, Simian crease, and moderate to severe INTELLECTUAL DISABILITY. Cardiac and gastrointestinal malformations, a marked increase in the incidence of LEUKEMIA, and the early onset of ALZHEIMER DISEASE are also associated with this condition. Pathologic features include the development of NEUROFIBRILLARY TANGLES in neurons and the deposition of AMYLOID BETA-PROTEIN, similar to the pathology of ALZHEIMER DISEASE. (Menkes, Textbook of Child Neurology, 5th ed, p213)Cell Aging: The decrease in the cell's ability to proliferate with the passing of time. Each cell is programmed for a certain number of cell divisions and at the end of that time proliferation halts. The cell enters a quiescent state after which it experiences CELL DEATH via the process of APOPTOSIS.Metabolic Syndrome X: A cluster of metabolic risk factors for CARDIOVASCULAR DISEASES and TYPE 2 DIABETES MELLITUS. The major components of metabolic syndrome X include excess ABDOMINAL FAT; atherogenic DYSLIPIDEMIA; HYPERTENSION; HYPERGLYCEMIA; INSULIN RESISTANCE; a proinflammatory state; and a prothrombotic (THROMBOSIS) state. (from AHA/NHLBI/ADA Conference Proceedings, Circulation 2004; 109:551-556)DNA-Binding Proteins: Proteins which bind to DNA. The family includes proteins which bind to both double- and single-stranded DNA and also includes specific DNA binding proteins in serum which can be used as markers for malignant diseases.DNA, Single-Stranded: A single chain of deoxyribonucleotides that occurs in some bacteria and viruses. It usually exists as a covalently closed circle.Chromosomes, Human, Pair 8: A specific pair of GROUP C CHROMOSOMES of the human chromosome classification.Protein Binding: The process in which substances, either endogenous or exogenous, bind to proteins, peptides, enzymes, protein precursors, or allied compounds. Specific protein-binding measures are often used as assays in diagnostic assessments.Protein Structure, Tertiary: The level of protein structure in which combinations of secondary protein structures (alpha helices, beta sheets, loop regions, and motifs) pack together to form folded shapes called domains. Disulfide bridges between cysteines in two different parts of the polypeptide chain along with other interactions between the chains play a role in the formation and stabilization of tertiary structure. Small proteins usually consist of only one domain but larger proteins may contain a number of domains connected by segments of polypeptide chain which lack regular secondary structure.Lamin Type A: A subclass of developmentally regulated lamins having a neutral isoelectric point. They are found to disassociate from nuclear membranes during mitosis.Optic Nerve: The 2nd cranial nerve which conveys visual information from the RETINA to the brain. The nerve carries the axons of the RETINAL GANGLION CELLS which sort at the OPTIC CHIASM and continue via the OPTIC TRACTS to the brain. The largest projection is to the lateral geniculate nuclei; other targets include the SUPERIOR COLLICULI and the SUPRACHIASMATIC NUCLEI. Though known as the second cranial nerve, it is considered part of the CENTRAL NERVOUS SYSTEM.Medical Oncology: A subspecialty of internal medicine concerned with the study of neoplasms.Iliac Artery: Either of two large arteries originating from the abdominal aorta; they supply blood to the pelvis, abdominal wall and legs.Phosphodiesterase I: A phosphoric diester hydrolase that removes 5'-nucleotides from the 3'-hydroxy termini of 3'-hydroxy-terminated OLIGONUCLEOTIDES. It has low activity towards POLYNUCLEOTIDES and the presence of 3'-phosphate terminus on the substrate may inhibit hydrolysis.Zebrafish: An exotic species of the family CYPRINIDAE, originally from Asia, that has been introduced in North America. They are used in embryological studies and to study the effects of certain chemicals on development.Play Therapy: A treatment technique utilizing play as a medium for expression and communication between patient and therapist.ArchivesBiological Science Disciplines: All of the divisions of the natural sciences dealing with the various aspects of the phenomena of life and vital processes. The concept includes anatomy and physiology, biochemistry and biophysics, and the biology of animals, plants, and microorganisms. It should be differentiated from BIOLOGY, one of its subdivisions, concerned specifically with the origin and life processes of living organisms.Periodicals as Topic: A publication issued at stated, more or less regular, intervals.PubMed: A bibliographic database that includes MEDLINE as its primary subset. It is produced by the National Center for Biotechnology Information (NCBI), part of the NATIONAL LIBRARY OF MEDICINE. PubMed, which is searchable through NLM's Web site, also includes access to additional citations to selected life sciences journals not in MEDLINE, and links to other resources such as the full-text of articles at participating publishers' Web sites, NCBI's molecular biology databases, and PubMed Central.Directories as Topic: Lists of persons or organizations, systematically arranged, usually in alphabetic or classed order, giving address, affiliations, etc., for individuals, and giving address, officers, functions, and similar data for organizations. (ALA Glossary of Library and Information Science, 1983)Heterochromatin: The portion of chromosome material that remains condensed and is transcriptionally inactive during INTERPHASE.Embryonic Stem Cells: Cells derived from the BLASTOCYST INNER CELL MASS which forms before implantation in the uterine wall. They retain the ability to divide, proliferate and provide progenitor cells that can differentiate into specialized cells.Stem Cells: Relatively undifferentiated cells that retain the ability to divide and proliferate throughout postnatal life to provide progenitor cells that can differentiate into specialized cells.Euchromatin: Chromosome regions that are loosely packaged and more accessible to RNA polymerases than HETEROCHROMATIN. These regions also stain differentially in CHROMOSOME BANDING preparations.Insulin-Like Growth Factor I: A well-characterized basic peptide believed to be secreted by the liver and to circulate in the blood. It has growth-regulating, insulin-like, and mitogenic activities. This growth factor has a major, but not absolute, dependence on GROWTH HORMONE. It is believed to be mainly active in adults in contrast to INSULIN-LIKE GROWTH FACTOR II, which is a major fetal growth factor.Insulin-Like Growth Factor II: A well-characterized neutral peptide believed to be secreted by the LIVER and to circulate in the BLOOD. It has growth-regulating, insulin-like and mitogenic activities. The growth factor has a major, but not absolute, dependence on SOMATOTROPIN. It is believed to be a major fetal growth factor in contrast to INSULIN-LIKE GROWTH FACTOR I, which is a major growth factor in adults.Somatomedins: Insulin-like polypeptides made by the liver and some fibroblasts and released into the blood when stimulated by SOMATOTROPIN. They cause sulfate incorporation into collagen, RNA, and DNA synthesis, which are prerequisites to cell division and growth of the organism.Recombinant Proteins: Proteins prepared by recombinant DNA technology.Insulin-Like Growth Factor Binding Proteins: A family of soluble proteins that bind insulin-like growth factors and modulate their biological actions at the cellular level. (Int J Gynaecol Obstet 1992;39(1):3-9)Bone Density: The amount of mineral per square centimeter of BONE. This is the definition used in clinical practice. Actual bone density would be expressed in grams per milliliter. It is most frequently measured by X-RAY ABSORPTIOMETRY or TOMOGRAPHY, X RAY COMPUTED. Bone density is an important predictor for OSTEOPOROSIS.

The Saccharomyces cerevisiae Sgs1 helicase efficiently unwinds G-G paired DNAs. (1/250)

The Saccharomyces cerevisiae Sgs1p helicase localizes to the nucleolus and is required to maintain the integrity of the rDNA repeats. Sgs1p is a member of the RecQ DNA helicase family, which also includes Schizo-saccharomyces pombe Rqh1, and the human BLM and WRN genes. These genes encode proteins which are essential to maintenance of genomic integrity and which share a highly conserved helicase domain. Here we show that recombinant Sgs1p helicase efficiently unwinds guanine-guanine (G-G) paired DNA. Unwinding of G-G paired DNA is ATP- and Mg2+-dependent and requires a short 3' single-stranded tail. Strikingly, Sgs1p unwinds G-G paired substrates more efficiently than duplex DNAs, as measured either in direct assays or by competition experiments. Sgs1p efficiently unwinds G-G paired telomeric sequences, suggesting that one function of Sgs1p may be to prevent telomere-telomere interactions which can lead to chromosome non-disjunction. The rDNA is G-rich and has considerable potential for G-G pairing. Diminished ability to unwind G-G paired regions may also explain the deleterious effect of mutation of Sgs1 on rDNA stability, and the accelerated aging characteristic of yeast strains that lack Sgs1 as well as humans deficient in the related WRN helicase.  (+info)

Human werner syndrome DNA helicase unwinds tetrahelical structures of the fragile X syndrome repeat sequence d(CGG)n. (2/250)

Formation of hairpin and tetrahelical structures by a d(CGG) trinucleotide repeat sequence is thought to cause expansion of this sequence and to engender fragile X syndrome. Here we show that human Werner syndrome DNA helicase (WRN), a member of the RecQ family of helicases, efficiently unwinds G'2 bimolecular tetraplex structures of d(CGG)7. Unwinding of d(CGG)7 by WRN requires hydrolyzable ATP and Mg2+ and is proportional to the amount of added helicase and to the time of incubation. The efficiencies of unwinding of G'2 d(CGG)7 tetraplex with 7 nucleotide-long single-stranded tails at their 3' or 5' ends are, respectively, 3.5- and 2-fold greater than that of double-stranded DNA. By contrast, WRN is unable to unwind a blunt-ended d(CGG)7 tetraplex, bimolecular tetraplex structures of a telomeric sequence 5'-d(TAGACATG(TTAGGG)2TTA)-3', or tetramolecular quadruplex forms of an IgG switch region sequence 5'-d(TACAGGGGAGCTGGGGTAGA)-3'. The ability of WRN to selectively unwind specific tetrahelices may reflect a specific role of this helicase in DNA metabolism.  (+info)

Werner syndrome helicase contains a 5'-->3' exonuclease activity that digests DNA and RNA strands in DNA/DNA and RNA/DNA duplexes dependent on unwinding. (3/250)

We show that WRN helicase contains a unique 5'-->3' exonuclease activity in the N-terminal region. Adeletion mutant lacking 231 N-terminal amino acid residues, made in a baculovirus system, did nothave this activity, while it showed ATPase and DNA helicase activities. This exonuclease activity was co-precipitated with the helicase activity using monoclonal antibodies specific to WRN helicase, indicating that it is an integral component with WRN helicase. The exonuclease in WRN helicase does not digest free single-stranded DNA or RNA, but it digests a strand in the duplex DNA or an RNA strand in a RNA/DNA heteroduplex in a 5'-->3' direction dependent on duplex unwinding. The digestion products were identified as 5'-mononucleotides. Our data show that WRN helicase needs a single-stranded 3' overhang region for efficient binding and unwinding of duplex molecules, while blunt-ended or 5' overhang duplex molecules were hardly unwound. These findings suggest that the WRN helicase and integral 5'-->3' exonuclease activities are involved in preventing a hyper-recombination by resolving entangled structures of DNA and RNA/DNA heteroduplexes that may be generated during rep-lication, repair and/or transcription.  (+info)

p53-mediated apoptosis is attenuated in Werner syndrome cells. (4/250)

The WRN DNA helicase is a member of the DExH-containing DNA helicase superfamily that includes XPB, XPD, and BLM. Mutations in WRN are found in patients with the premature aging and cancer susceptibility syndrome known as Werner syndrome (WS). p53 binds to the WRN protein in vivo and in vitro through its carboxyl terminus. WS fibroblasts have an attenuated p53- mediated apoptotic response, and this deficiency can be rescued by expression of wild-type WRN. These data support the hypothesis that p53 can induce apoptosis through the modulation of specific DExH-containing DNA helicases and may have implications for the cancer predisposition observed in WS patients.  (+info)

The Werner syndrome protein is involved in RNA polymerase II transcription. (5/250)

Werner syndrome (WS) is a human progeroid syndrome characterized by the early onset of a large number of clinical features associated with the normal aging process. The complex molecular and cellular phenotypes of WS involve characteristic features of genomic instability and accelerated replicative senescence. The gene involved (WRN) was recently cloned, and its gene product (WRNp) was biochemically characterized as a helicase. Helicases play important roles in a variety of DNA transactions, including DNA replication, transcription, repair, and recombination. We have assessed the role of the WRN gene in transcription by analyzing the efficiency of basal transcription in WS lymphoblastoid cell lines that carry homozygous WRN mutations. Transcription was measured in permeabilized cells by [3H]UTP incorporation and in vitro by using a plasmid template containing the RNA polymerase II (RNA pol II)-dependent adenovirus major late promoter. With both of these approaches, we find that the transcription efficiency in different WS cell lines is reduced to 40-60% of the transcription in cells from normal individuals. This defect can be complemented by the addition of normal cell extracts to the chromatin of WS cells. Addition of purified wild-type WRNp but not mutated WRNp to the in vitro transcription assay markedly stimulates RNA pol II-dependent transcription carried out by nuclear extracts. A nonhelicase domain (a direct repeat of 27 amino acids) also appears to have a role in transcription enhancement, as revealed by a yeast hybrid-protein reporter assay. This is further supported by the lack of stimulation of transcription when mutant WRNp lacking this domain was added to the in vitro assay. We have thus used several approaches to show a role for WRNp in RNA pol II transcription, possibly as a transcriptional activator. A deficit in either global or regional transcription in WS cells may be a primary molecular defect responsible for the WS clinical phenotype.  (+info)

Physical and functional interaction between p53 and the Werner's syndrome protein. (6/250)

Werner's syndrome is a human autosomal recessive disorder leading to premature aging. The mutations responsible for this disorder have recently been localized to a gene (WRN) encoding a protein that possesses DNA helicase and exonuclease activities. Patients carrying WRN gene mutations exhibit an elevated rate of cancer, accompanied by increased genomic instability. The latter features are also characteristic of the loss of function of p53, a tumor suppressor that is very frequently inactivated in human cancer. Moreover, changes in the activity of p53 have been implicated in the onset of cellular replicative senescence. We report here that the WRN protein can form a specific physical interaction with p53. This interaction involves the carboxyl-terminal part of WRN and the extreme carboxyl terminus of p53, a region that plays an important role in regulating the functional state of p53. A small fraction of WRN can be found in complex with endogenous p53 in nontransfected cells. Overexpression of WRN leads to augmented p53-dependent transcriptional activity and induction of p21(Waf1) protein expression. These findings support the existence of a cross-talk between WRN and p53, which may be important for maintaining genomic integrity and for preventing the accumulation of aberrations that can give rise to premature senescence and cancer.  (+info)

Mut-7 of C. elegans, required for transposon silencing and RNA interference, is a homolog of Werner syndrome helicase and RNaseD. (7/250)

While all known natural isolates of C. elegans contain multiple copies of the Tc1 transposon, which are active in the soma, Tc1 transposition is fully silenced in the germline of many strains. We mutagenized one such silenced strain and isolated mutants in which Tc1 had been activated in the germline ("mutators"). Interestingly, many other transposons of unrelated sequence had also become active. Most of these mutants are resistant to RNA interference (RNAi). We found one of the mutated genes, mut-7, to encode a protein with homology to RNaseD. This provides support for the notion that RNAi works by dsRNA-directed, enzymatic RNA degradation. We propose a model in which MUT-7, guided by transposon-derived dsRNA, represses transposition by degrading transposon-specific messengers, thus preventing transposase production and transposition.  (+info)

Requirement of yeast SGS1 and SRS2 genes for replication and transcription. (8/250)

The SGS1 gene of the yeast Saccharomyces cerevisiae encodes a DNA helicase with homology to the human Bloom's syndrome gene BLM and the Werner's syndrome gene WRN. The SRS2 gene of yeast also encodes a DNA helicase. Simultaneous deletion of SGS1 and SRS2 is lethal in yeast. Here, using a conditional mutation of SGS1, it is shown that DNA replication and RNA polymerase I transcription are drastically inhibited in the srs2Delta sgs1-ts strain at the restrictive temperature. Thus, SGS1 and SRS2 function in DNA replication and RNA polymerase I transcription. These functions may contribute to the various defects observed in Werner's and Bloom's syndromes.  (+info)

  • A vipoma is a non-beta pancreatic islet cell tumor secreting vasoactive intestinal peptide (VIP), resulting in a syndrome of watery diarrhea, hypokalemia, and achlorhydria (WDHA syndrome). (merckmanuals.com)
  • Werner syndrome, also called progeria, is a hereditary condition associated with premature aging and an increased risk of cancer and other diseases. (cancer.net)
  • Werner disease - hereditary disorder characterized by premature aging. (thefreedictionary.com)
  • This graph depicts the general finding of a low relative risk associated with common, low-penetrance genetic variants, such as single-nucleotide polymorphisms identified in genome-wide association studies, and a higher relative risk associated with rare, high-penetrance genetic variants, such as pathogenic variants in the BRCA1 / BRCA2 genes associated with hereditary breast and ovarian cancer and the mismatch repair genes associated with Lynch syndrome. (cancer.gov)
  • The International Registry of Werner Syndrome (IRWS), associated with the Department of Pathology of the University of Washington, is a non-profit research organization dedicated to providing clinical and genetic information on Werner syndrome to healthcare professionals and researchers. (rarediseases.org)
  • Finding the right clinical trial for Werner syndrome can be challenging. (diseaseinfosearch.org)
  • Werner syndrome: a changing pattern of clinical manifestations in Japan (1917~2008). (cdc.gov)
  • It used to be that the majority of islet cell tumors / pancreatic endocrine neoplasms that were discovered clinically were functional, indicating that they elaborate one or more hormonal products into the blood, leading to a recognizable clinical syndrome. (jhu.edu)
  • By convention, functional islet cell tumors / endocrine neoplasms are named according to their predominant clinical syndrome and hormonal product. (jhu.edu)
  • Patients with islet cell tumors / pancreatic endocrine neoplasms of the pancreas with no recognizable clinical syndrome and normal serum hormone levels are considered to have nonfunctional pancreatic endocrine tumors. (jhu.edu)
  • German physician Otto Werner (1879-1936) described the clinical picture of this syndrome in 1904, in four sisters, defining the skin thin, tight, scleroderma-like, that mimics premature aging, with bilateral cataracts associated. (science20.com)
  • people smoking, not doing enough exercise, whereas in Werner's syndrome is very definitely a genetic defect, and so we can start looking at the genes and the biochemistry involved in ageing. (abc.net.au)
  • 1 patient with the Werner syndrome, a low serum IGF-1 level, and osteoporosis. (annals.org)
  • Treatment with rhIGF-1 increased both bone formation and resorption in a patient with the Werner syndrome, a low baseline serum IGF-1 level, and established osteoporosis. (annals.org)
  • The diagnosis of Werner syndrome is established in a proband with the following cardinal signs: bilateral ocular cataracts, premature graying and/or thinning of scalp hair, characteristic dermatologic pathology, and short stature. (nih.gov)
  • Note: Percent frequencies are derived from individuals with a diagnosis of Werner syndrome confirmed by molecular testing. (nih.gov)
  • The diagnosis of Werner syndrome is established in a proband who has all four cardinal signs and two additional signs (definite) or the first three cardinal signs and two additional signs (probable). (nih.gov)
  • Currently, the diagnosis of Werner syndrome is suspected if someone has several of the features listed below. (cancer.net)
  • Guidelines for the diagnosis of Werner syndrome have been proposed but may change over time as more is learned about this condition. (cancer.net)
  • Currently, the diagnosis of Werner syndrome is suspected if someone has several of the features that have been reported in people with this condition. (cancermedicines.in)
  • [ 8 ] Specific cancers associated with Costello syndrome in children include rhabdomyosarcoma, neuroblastoma and transitional cell carcinoma of the bladder. (medscape.com)
  • Thus, elevated cancer incidence associated with Werner syndrome is due to increased chromosomal changes , while the accelerated aging characteristics probably stem from telomere dysfunction leading to accumulation of non-functional senescent cells or excessive apoptotic cell death over time. (fightaging.org)
  • Lipodystrophy syndromes are rare heterogeneous disorders characterized by deficiency of adipose tissue, usually a decrease in leptin levels and, frequently, severe metabolic abnormalities including diabetes mellitus and dyslipidemia. (springer.com)
  • Based on literature and in our own experience, we propose a stepwise approach for diagnosis of the different subtypes of rare lipodystrophy syndromes, describing its more frequent co-morbidities and establishing the therapeutical approach. (springer.com)