Werner Syndrome
RecQ Helicases
A family of structurally-related DNA helicases that play an essential role in the maintenance of genome integrity. RecQ helicases were originally discovered in E COLI and are highly conserved across both prokaryotic and eukaryotic organisms. Genetic mutations that result in loss of RecQ helicase activity gives rise to disorders that are associated with CANCER predisposition and premature aging.
Exodeoxyribonucleases
DNA Helicases
Proteins that catalyze the unwinding of duplex DNA during replication by binding cooperatively to single-stranded regions of DNA or to short regions of duplex DNA that are undergoing transient opening. In addition DNA helicases are DNA-dependent ATPases that harness the free energy of ATP hydrolysis to translocate DNA strands.
Exonucleases
Aging, Premature
4-Nitroquinoline-1-oxide
Progeria
An abnormal congenital condition, associated with defects in the LAMIN TYPE A gene, which is characterized by premature aging in children, where all the changes of cell senescence occur. It is manifested by premature greying; hair loss; hearing loss (DEAFNESS); cataracts (CATARACT); ARTHRITIS; OSTEOPOROSIS; DIABETES MELLITUS; atrophy of subcutaneous fat; skeletal hypoplasia; elevated urinary HYALURONIC ACID; and accelerated ATHEROSCLEROSIS. Many affected individuals develop malignant tumors, especially SARCOMA.
Bloom Syndrome
Rothmund-Thomson Syndrome
An autosomal recessive syndrome occurring principally in females, characterized by the presence of reticulated, atrophic, hyperpigmented, telangiectatic cutaneous plaques, often accompanied by juvenile cataracts, saddle nose, congenital bone defects, disturbances in the growth of HAIR; NAILS; and TEETH; and HYPOGONADISM.
Telomere
DNA Damage
Injuries to DNA that introduce deviations from its normal, intact structure and which may, if left unrepaired, result in a MUTATION or a block of DNA REPLICATION. These deviations may be caused by physical or chemical agents and occur by natural or unnatural, introduced circumstances. They include the introduction of illegitimate bases during replication or by deamination or other modification of bases; the loss of a base from the DNA backbone leaving an abasic site; single-strand breaks; double strand breaks; and intrastrand (PYRIMIDINE DIMERS) or interstrand crosslinking. Damage can often be repaired (DNA REPAIR). If the damage is extensive, it can induce APOPTOSIS.
DNA
A deoxyribonucleotide polymer that is the primary genetic material of all cells. Eukaryotic and prokaryotic organisms normally contain DNA in a double-stranded state, yet several important biological processes transiently involve single-stranded regions. DNA, which consists of a polysugar-phosphate backbone possessing projections of purines (adenine and guanine) and pyrimidines (thymine and cytosine), forms a double helix that is held together by hydrogen bonds between these purines and pyrimidines (adenine to thymine and guanine to cytosine).
Replication Protein A
Telomeric Repeat Binding Protein 2
A ubiquitously expressed telomere-binding protein that is present at TELOMERES throughout the cell cycle. It is a suppressor of telomere elongation and may be involved in stabilization of telomere length. It is structurally different from TELOMERIC REPEAT BINDING PROTEIN 1 in that it contains basic N-terminal amino acid residues.
Adenosine Triphosphatases
DNA Repair
The reconstruction of a continuous two-stranded DNA molecule without mismatch from a molecule which contained damaged regions. The major repair mechanisms are excision repair, in which defective regions in one strand are excised and resynthesized using the complementary base pairing information in the intact strand; photoreactivation repair, in which the lethal and mutagenic effects of ultraviolet light are eliminated; and post-replication repair, in which the primary lesions are not repaired, but the gaps in one daughter duplex are filled in by incorporation of portions of the other (undamaged) daughter duplex. Excision repair and post-replication repair are sometimes referred to as "dark repair" because they do not require light.
Mutation
Fibroblasts
HeLa Cells
Genomic Instability
Down Syndrome
A chromosome disorder associated either with an extra chromosome 21 or an effective trisomy for chromosome 21. Clinical manifestations include hypotonia, short stature, brachycephaly, upslanting palpebral fissures, epicanthus, Brushfield spots on the iris, protruding tongue, small ears, short, broad hands, fifth finger clinodactyly, Simian crease, and moderate to severe INTELLECTUAL DISABILITY. Cardiac and gastrointestinal malformations, a marked increase in the incidence of LEUKEMIA, and the early onset of ALZHEIMER DISEASE are also associated with this condition. Pathologic features include the development of NEUROFIBRILLARY TANGLES in neurons and the deposition of AMYLOID BETA-PROTEIN, similar to the pathology of ALZHEIMER DISEASE. (Menkes, Textbook of Child Neurology, 5th ed, p213)
Cell Aging
Metabolic Syndrome X
A cluster of metabolic risk factors for CARDIOVASCULAR DISEASES and TYPE 2 DIABETES MELLITUS. The major components of metabolic syndrome X include excess ABDOMINAL FAT; atherogenic DYSLIPIDEMIA; HYPERTENSION; HYPERGLYCEMIA; INSULIN RESISTANCE; a proinflammatory state; and a prothrombotic (THROMBOSIS) state. (from AHA/NHLBI/ADA Conference Proceedings, Circulation 2004; 109:551-556)
DNA-Binding Proteins
DNA, Single-Stranded
Chromosomes, Human, Pair 8
Protein Binding
Protein Structure, Tertiary
The level of protein structure in which combinations of secondary protein structures (alpha helices, beta sheets, loop regions, and motifs) pack together to form folded shapes called domains. Disulfide bridges between cysteines in two different parts of the polypeptide chain along with other interactions between the chains play a role in the formation and stabilization of tertiary structure. Small proteins usually consist of only one domain but larger proteins may contain a number of domains connected by segments of polypeptide chain which lack regular secondary structure.
Lamin Type A
Optic Nerve
The 2nd cranial nerve which conveys visual information from the RETINA to the brain. The nerve carries the axons of the RETINAL GANGLION CELLS which sort at the OPTIC CHIASM and continue via the OPTIC TRACTS to the brain. The largest projection is to the lateral geniculate nuclei; other targets include the SUPERIOR COLLICULI and the SUPRACHIASMATIC NUCLEI. Though known as the second cranial nerve, it is considered part of the CENTRAL NERVOUS SYSTEM.
Iliac Artery
Phosphodiesterase I
Zebrafish
Play Therapy
Biological Science Disciplines
All of the divisions of the natural sciences dealing with the various aspects of the phenomena of life and vital processes. The concept includes anatomy and physiology, biochemistry and biophysics, and the biology of animals, plants, and microorganisms. It should be differentiated from BIOLOGY, one of its subdivisions, concerned specifically with the origin and life processes of living organisms.
PubMed
A bibliographic database that includes MEDLINE as its primary subset. It is produced by the National Center for Biotechnology Information (NCBI), part of the NATIONAL LIBRARY OF MEDICINE. PubMed, which is searchable through NLM's Web site, also includes access to additional citations to selected life sciences journals not in MEDLINE, and links to other resources such as the full-text of articles at participating publishers' Web sites, NCBI's molecular biology databases, and PubMed Central.
Directories as Topic
Heterochromatin
Embryonic Stem Cells
Stem Cells
The Saccharomyces cerevisiae Sgs1 helicase efficiently unwinds G-G paired DNAs. (1/250)
The Saccharomyces cerevisiae Sgs1p helicase localizes to the nucleolus and is required to maintain the integrity of the rDNA repeats. Sgs1p is a member of the RecQ DNA helicase family, which also includes Schizo-saccharomyces pombe Rqh1, and the human BLM and WRN genes. These genes encode proteins which are essential to maintenance of genomic integrity and which share a highly conserved helicase domain. Here we show that recombinant Sgs1p helicase efficiently unwinds guanine-guanine (G-G) paired DNA. Unwinding of G-G paired DNA is ATP- and Mg2+-dependent and requires a short 3' single-stranded tail. Strikingly, Sgs1p unwinds G-G paired substrates more efficiently than duplex DNAs, as measured either in direct assays or by competition experiments. Sgs1p efficiently unwinds G-G paired telomeric sequences, suggesting that one function of Sgs1p may be to prevent telomere-telomere interactions which can lead to chromosome non-disjunction. The rDNA is G-rich and has considerable potential for G-G pairing. Diminished ability to unwind G-G paired regions may also explain the deleterious effect of mutation of Sgs1 on rDNA stability, and the accelerated aging characteristic of yeast strains that lack Sgs1 as well as humans deficient in the related WRN helicase. (+info)Human werner syndrome DNA helicase unwinds tetrahelical structures of the fragile X syndrome repeat sequence d(CGG)n. (2/250)
Formation of hairpin and tetrahelical structures by a d(CGG) trinucleotide repeat sequence is thought to cause expansion of this sequence and to engender fragile X syndrome. Here we show that human Werner syndrome DNA helicase (WRN), a member of the RecQ family of helicases, efficiently unwinds G'2 bimolecular tetraplex structures of d(CGG)7. Unwinding of d(CGG)7 by WRN requires hydrolyzable ATP and Mg2+ and is proportional to the amount of added helicase and to the time of incubation. The efficiencies of unwinding of G'2 d(CGG)7 tetraplex with 7 nucleotide-long single-stranded tails at their 3' or 5' ends are, respectively, 3.5- and 2-fold greater than that of double-stranded DNA. By contrast, WRN is unable to unwind a blunt-ended d(CGG)7 tetraplex, bimolecular tetraplex structures of a telomeric sequence 5'-d(TAGACATG(TTAGGG)2TTA)-3', or tetramolecular quadruplex forms of an IgG switch region sequence 5'-d(TACAGGGGAGCTGGGGTAGA)-3'. The ability of WRN to selectively unwind specific tetrahelices may reflect a specific role of this helicase in DNA metabolism. (+info)Werner syndrome helicase contains a 5'-->3' exonuclease activity that digests DNA and RNA strands in DNA/DNA and RNA/DNA duplexes dependent on unwinding. (3/250)
We show that WRN helicase contains a unique 5'-->3' exonuclease activity in the N-terminal region. Adeletion mutant lacking 231 N-terminal amino acid residues, made in a baculovirus system, did nothave this activity, while it showed ATPase and DNA helicase activities. This exonuclease activity was co-precipitated with the helicase activity using monoclonal antibodies specific to WRN helicase, indicating that it is an integral component with WRN helicase. The exonuclease in WRN helicase does not digest free single-stranded DNA or RNA, but it digests a strand in the duplex DNA or an RNA strand in a RNA/DNA heteroduplex in a 5'-->3' direction dependent on duplex unwinding. The digestion products were identified as 5'-mononucleotides. Our data show that WRN helicase needs a single-stranded 3' overhang region for efficient binding and unwinding of duplex molecules, while blunt-ended or 5' overhang duplex molecules were hardly unwound. These findings suggest that the WRN helicase and integral 5'-->3' exonuclease activities are involved in preventing a hyper-recombination by resolving entangled structures of DNA and RNA/DNA heteroduplexes that may be generated during rep-lication, repair and/or transcription. (+info)p53-mediated apoptosis is attenuated in Werner syndrome cells. (4/250)
The WRN DNA helicase is a member of the DExH-containing DNA helicase superfamily that includes XPB, XPD, and BLM. Mutations in WRN are found in patients with the premature aging and cancer susceptibility syndrome known as Werner syndrome (WS). p53 binds to the WRN protein in vivo and in vitro through its carboxyl terminus. WS fibroblasts have an attenuated p53- mediated apoptotic response, and this deficiency can be rescued by expression of wild-type WRN. These data support the hypothesis that p53 can induce apoptosis through the modulation of specific DExH-containing DNA helicases and may have implications for the cancer predisposition observed in WS patients. (+info)The Werner syndrome protein is involved in RNA polymerase II transcription. (5/250)
Werner syndrome (WS) is a human progeroid syndrome characterized by the early onset of a large number of clinical features associated with the normal aging process. The complex molecular and cellular phenotypes of WS involve characteristic features of genomic instability and accelerated replicative senescence. The gene involved (WRN) was recently cloned, and its gene product (WRNp) was biochemically characterized as a helicase. Helicases play important roles in a variety of DNA transactions, including DNA replication, transcription, repair, and recombination. We have assessed the role of the WRN gene in transcription by analyzing the efficiency of basal transcription in WS lymphoblastoid cell lines that carry homozygous WRN mutations. Transcription was measured in permeabilized cells by [3H]UTP incorporation and in vitro by using a plasmid template containing the RNA polymerase II (RNA pol II)-dependent adenovirus major late promoter. With both of these approaches, we find that the transcription efficiency in different WS cell lines is reduced to 40-60% of the transcription in cells from normal individuals. This defect can be complemented by the addition of normal cell extracts to the chromatin of WS cells. Addition of purified wild-type WRNp but not mutated WRNp to the in vitro transcription assay markedly stimulates RNA pol II-dependent transcription carried out by nuclear extracts. A nonhelicase domain (a direct repeat of 27 amino acids) also appears to have a role in transcription enhancement, as revealed by a yeast hybrid-protein reporter assay. This is further supported by the lack of stimulation of transcription when mutant WRNp lacking this domain was added to the in vitro assay. We have thus used several approaches to show a role for WRNp in RNA pol II transcription, possibly as a transcriptional activator. A deficit in either global or regional transcription in WS cells may be a primary molecular defect responsible for the WS clinical phenotype. (+info)Physical and functional interaction between p53 and the Werner's syndrome protein. (6/250)
Werner's syndrome is a human autosomal recessive disorder leading to premature aging. The mutations responsible for this disorder have recently been localized to a gene (WRN) encoding a protein that possesses DNA helicase and exonuclease activities. Patients carrying WRN gene mutations exhibit an elevated rate of cancer, accompanied by increased genomic instability. The latter features are also characteristic of the loss of function of p53, a tumor suppressor that is very frequently inactivated in human cancer. Moreover, changes in the activity of p53 have been implicated in the onset of cellular replicative senescence. We report here that the WRN protein can form a specific physical interaction with p53. This interaction involves the carboxyl-terminal part of WRN and the extreme carboxyl terminus of p53, a region that plays an important role in regulating the functional state of p53. A small fraction of WRN can be found in complex with endogenous p53 in nontransfected cells. Overexpression of WRN leads to augmented p53-dependent transcriptional activity and induction of p21(Waf1) protein expression. These findings support the existence of a cross-talk between WRN and p53, which may be important for maintaining genomic integrity and for preventing the accumulation of aberrations that can give rise to premature senescence and cancer. (+info)Mut-7 of C. elegans, required for transposon silencing and RNA interference, is a homolog of Werner syndrome helicase and RNaseD. (7/250)
While all known natural isolates of C. elegans contain multiple copies of the Tc1 transposon, which are active in the soma, Tc1 transposition is fully silenced in the germline of many strains. We mutagenized one such silenced strain and isolated mutants in which Tc1 had been activated in the germline ("mutators"). Interestingly, many other transposons of unrelated sequence had also become active. Most of these mutants are resistant to RNA interference (RNAi). We found one of the mutated genes, mut-7, to encode a protein with homology to RNaseD. This provides support for the notion that RNAi works by dsRNA-directed, enzymatic RNA degradation. We propose a model in which MUT-7, guided by transposon-derived dsRNA, represses transposition by degrading transposon-specific messengers, thus preventing transposase production and transposition. (+info)Requirement of yeast SGS1 and SRS2 genes for replication and transcription. (8/250)
The SGS1 gene of the yeast Saccharomyces cerevisiae encodes a DNA helicase with homology to the human Bloom's syndrome gene BLM and the Werner's syndrome gene WRN. The SRS2 gene of yeast also encodes a DNA helicase. Simultaneous deletion of SGS1 and SRS2 is lethal in yeast. Here, using a conditional mutation of SGS1, it is shown that DNA replication and RNA polymerase I transcription are drastically inhibited in the srs2Delta sgs1-ts strain at the restrictive temperature. Thus, SGS1 and SRS2 function in DNA replication and RNA polymerase I transcription. These functions may contribute to the various defects observed in Werner's and Bloom's syndromes. (+info)
Genome-wide DNA methylation analysis in blood cells from patients with Werner syndrome | Clinical Epigenetics | Full Text
Werner Syndrome | Cancer.Net
Metabolism of acetylated low density lipoproteins by monocyte-derived macrophages from patients with Werners syndrome. |...
Werners syndrome protein (WRN) migrates Holliday junctions and co‐localizes with RPA upon replication arrest | EMBO Reports
Werner syndrome | pathology | Britannica
Werner syndrome
The Werner Syndrome Helicase-Nuclease--One Protein, Many Mysteries -- Fry 2002 (13): 2 -- <i>Science</i...
CellNEWS: Establishment of Induced Pluripotent Stem Cells from Werner Syndrome Fibroblasts
A Werner syndrome stem cell model unveils heterochromatin alterations as a driver of human aging | Science
Werner Syndrome
ATYPICAL WERNER SYNDROME | MENDELIAN.CO
The expression of proliferation-dependent antigens during the lifespan of normal and progeroid human fibroblasts in culture |...
Gerhard Werner - Wikipedia
Lack of WRN Results in Extensive Deletion at Nonhomologous Joining Ends - PubMed
Progeria: Werners Syndrome | HubPages
Database of WS-associated WRN mutations
Blood Flow & Glaucoma - Glaucoma Service Foundation to Prevent Blindness
Werners Syndrome (Progeria of the Adult)
Science
Werner syndrome - ONA
Alfred Werner
Dr. Paul Werner, MD - Vascular Surgeon in Milwaukee, WI
komakino fanzine - Werner - what color should be the record we do
Werner Paddles KALLISTE STRAIGHT STD 1 PC Made to Order Kayak Paddles Free Shipping, Free Awesomeness: Werner Paddles Kayak...
Dr. Marc Werner, MD - Ophthalmologist in Garden City, NY
File aaa base.changes of Package aaa base.import4464 -
openSUSE Build Service
werner syndrome Protocols and Video...
Shimizu, Kenji - OU Author List - OKAYAMA UNIVERSITY SCIENTIFIC ACHIEVEMENT REPOSITORY
Human Knee Hinge Joint Showing Bones and Muscles Photographic Print by Carol & Mike Werner at AllPosters.com
Werner Siemens Foundation fosters synthetic biotechnology | EurekAlert! Science News
Virus oncogenes des animaux de laboratoire et recherche de produits an by Y De ratuld and G H. Werner
RE: ma-ont RDF latest version from Bailer, Werner on 2010-10-14 ([email protected] from October 2010)
Werner receives $75,000 grant from Research to Prevent Blindness
Werner K. Doyle | NYU Langone Health
CAMPO SAN VIO, VENICE - JAMES LEE BYARS: THE GOLDEN TOWER - News - Michael Werner Gallery
Paddle Details | Werner Paddles
Companies Related to: Temperature-Sensitive Goods, Food Logistics, Transportation Infrastructure - Inbound Logistics
Lo And Behold, Reveries of the Connected World review (2016) Werner
Herzog - Qwipsters Movie Reviews
Kerry Werner, Caroline Mani Claim 2018 Go Cross Day 1 - Report, Photos, Results
Author: Abdool Karim, Salim and Werner, Lise / Academic Unit: Epidemiology / Subject: Virology | Search Results | Academic...
Dr. Michael Werner, MD - Kaukauna, WI - Family Medicine | Healthgrades.com
Stamp Out Meningitis - The Becky Werner Meningitis Foundation
Illustration of the Axon Tip of a Neuron Sending an Electrical Impulse Photographic Print by Carol & Mike Werner at AllPosters...
Start Your Day with Werner Herzog Inspirational Posters
Werner follows Broughton as Liverpool chairman | Football News
Werner Kalliste Performance Tour Carbon Blade Sea Kayak Paddle | Kayak Academy
Reviews | Dr. Christine Werner, MD | Bellevue, WA | Obstetrician & Gynecologist
The Human Race - Werner Volkner | Synopsis, Characteristics, Moods, Themes and Related | AllMovie
Werner Paddles | Algonquin 1 Piece Bent Shaft
Fall Protection | Harnesses | Werner® H332105 LITEFIT Construction Harness, Tongue Buckle Legs, 2XL | B1646142 -...
Progeroid syndromes
Some segmental progeroid syndromes, such as Werner syndrome (WS), Bloom syndrome (BS), Rothmund-Thomson syndromes (RTS) and ... Examples of PS include Werner syndrome (WS), Bloom syndrome (BS), Rothmund-Thomson syndrome (RTS), Cockayne syndrome (CS), ... Werner syndrome[edit]. Werner syndrome is inherited in an autosomal recessive manner, which means both parents must contribute ... Main article: Werner syndrome. Werner syndrome (WS) is a rare autosomal recessive disorder.[9][10] It has a global incidence ...
Human nose
Werner syndrome, a condition that causes the appearance of premature aging, causes a "bird-like" appearance due to pinching of ... eds.). Werner Syndrome. GeneReviews®. Seattle, WA: University of Washington. Archived from the original on 2017-01-18. ... Down syndrome commonly presents a small nose with a flattened nasal bridge. This can be due to the absence of one or both nasal ... Empty nose syndrome, a nose crippled by excessive resection of the inferior and/or middle turbinates of the nose Dried nasal ...
Evolution of ageing
Werner syndrome, also known as "adult progeria", is another single-gene genetic disease. it is caused by a mutation in the wrn ... Those who have Werner syndrome are at an increased risk for cataracts, type 2 diabetes, different types of cancers, and ... "Werner syndrome". Genetics Home Reference. Retrieved 2020-04-11. Yamamoto, K.; Imakiire, A.; Miyagawa, N.; Kasahara, T. ( ... There are four common traits of Werner's syndrome: cataracts in both eyes, changes in skin similar to scleroderma, short ...
DNA repair-deficiency disorder
Werner syndrome helicase Homologous recombination,[28][29] Non-homologous end joining,[30]Base excision repair,[31][32] ... "Roles of Werner syndrome protein in protection of genome integrity". DNA Repair (Amst.). 9 (3): 331-44. doi:10.1016/j.dnarep. ... "The human Werner syndrome protein stimulates repair of oxidative DNA base damage by the DNA glycosylase NEIL1". J. Biol. Chem. ... Werner syndrome". Mutat. Res. 577 (1-2): 252-9. doi:10.1016/j.mrfmmm.2005.03.021. PMID 15916783.. ...
Steve Horvath
... and Werner syndrome. Horvath published the first article demonstrating that trisomy 21 (Down syndrome) is associated with ... Maierhofer, A (2017). "Accelerated epigenetic aging in Werner syndrome". Aging. 9 (4): 1143-1152. doi:10.18632/aging.101217. ... physical activity and the risks associated with metabolic syndrome. Horvath and Raj proposed an epigenetic clock theory of ... "Accelerated epigenetic aging in Down syndrome". Aging Cell. 14 (3): 491-5. doi:10.1111/acel.12325. PMC 4406678. PMID 25678027. ...
Epigenetic clock
Adult progeria also known as Werner syndrome is associated with epigenetic age acceleration in blood. Fibroblast samples from ... Maierhofer, A (2017). "Accelerated epigenetic aging in Werner syndrome". Aging. 9 (4): 1143-1152. doi:10.18632/aging.101217. ... Down syndrome entails an increased risk of many chronic diseases that are typically associated with older age. The clinical ... Children with a very rare disorder known as syndrome X maintain the façade of persistent toddler-like features while aging from ...
British Society for Research on Ageing
The cell kinetics of Werner's syndrome). Royal Pharmaceutical Society Conference Science Medal for outstanding scientific ... Research interests: progeroid syndromes, resveratrol analogues ('resveralogues') and the phenotype of senescent cells. Trustee ...
DNA damage theory of aging
... and Cockayne syndrome (mean lifespan 13 years). Werner syndrome is due to an inherited defect in an enzyme (a helicase and ... Werner syndrome (WS), a premature aging condition in humans, is caused by a genetic defect in a RecQ helicase that is employed ... Bloom syndrome and Rothmund-Thomson syndrome. In addition to human inherited syndromes, experimental mouse models with genetic ... Harrigan, JA; Wilson, DM; Prasad, R; Opresko, PL; Beck, G; May, A; Wilson, SH; Bohr, VA (Jan 2006). "The Werner syndrome ...
Ying-Hui Fu
1996). "Positional cloning of the Werner's syndrome gene". Science. 272 (5259): 258-262. Bibcode:1996Sci...272..258Y. doi: ... Werner Syndrome) and early onset Alzheimer's Disease (Presinilin 2). In 1997, Fu returned to academia, taking the position of ... While there, she was part of the team that identified the fragile-X syndrome gene. The gene contains a polymorphic CGG ... This mutational mechanism is now known to cause not only Fragile X syndrome and Myotonic dystrophy, but also Huntington's ...
P53
... "p53 Modulates the exonuclease activity of Werner syndrome protein". The Journal of Biological Chemistry. 276 (37): 35093-102. ... Yu A, Fan HY, Liao D, Bailey AD, Weiner AM (May 2000). "Activation of p53 or loss of the Cockayne syndrome group B repair ... Abramovitch S, Werner H (2003). "Functional and physical interactions between BRCA1 and p53 in transcriptional regulation of ... GeneReviews/NCBI/NIH/UW entry on Li-Fraumeni Syndrome TUMOR PROTEIN p53 @ OMIM p53 restoration of function p53 @ The Atlas of ...
POLD1
MDPL/MDP, AWS and Werner's syndrome all present with progeria. A first example of germline transmission was observed in a ... POLD1 Ser605del and R507C variants have also been identified in a subset of patients with atypical Werner's syndrome (AWS). ... The WRN gene is mutated in Werner syndrome (an autosomal recessive disorder) leading to accelerated aging and increased genetic ... Kamath-Loeb AS, Shen JC, Schmitt MW, Loeb LA (April 2012). "The Werner syndrome exonuclease facilitates DNA degradation and ...
Cruciform DNA
Werner's syndrome is a genetic disorder that causes premature aging. Patients with Werner's syndrome lack a functional WRN ... Compton SA, Tolun G, Kamath-Loeb AS, Loeb LA, Griffith JD (September 2008). "The Werner syndrome protein binds replication fork ... such as cancer and Werner's Disease. The first theoretical description of cruciform-forming DNA structures was hypothesized in ...
Human hair color
Werner syndrome and pernicious anemia can also cause premature graying. A 2005 uncontrolled study demonstrated that people 50- ... Marie Antoinette syndrome is a proposed phenomenon in which sudden whitening is caused by stress. It has been found that some ... Waardenburg syndrome or a vitamin B12 deficiency. At some point in the human life cycle, cells that are located in the base of ...
Atherosclerosis
Werner syndrome (WS) is a premature aging condition in humans. WS is caused by a genetic defect in a RecQ helicase that is ... Didangelos A, Simper D, Monaco C, Mayr M (May 2009). "Proteomics of acute coronary syndromes". Current Atherosclerosis Reports ...
Drosophila melanogaster
Werner syndrome is a condition in humans characterized by accelerated aging. It is caused by mutations in the gene WRN that ... November 2019). "Evidence for premature aging in a Drosophila model of Werner syndrome". Experimental Gerontology. 127: 110733 ...
Instituto Nacional de Medicina Genómica
Researchers at INMEGEN also study Werner syndrome and the pulmonary adenocarcinoma. INMEGEN has many investigations related to ... Another study is on the effect of Omega 3 on metabolic syndrome in the Mexican population, specifically on early biomarkers ...
Non-small-cell lung carcinoma
June 2006). "Epigenetic inactivation of the premature aging Werner syndrome gene in human cancer". Proceedings of the National ... superior vena cava syndrome, trouble swallowing, large amounts of mucus, weakness, fatigue, and hoarseness. Smoking is by far ... numbness of extremities due to Pancoast syndrome, and nausea, vomiting, and constipation brought on by hypercalcemia. Some more ...
WRNIP1
Werner's syndrome is a rare autosomal recessive disorder characterized by premature aging. The protein encoded by this gene ... WRNIP1 has been shown to interact with Werner syndrome ATP-dependent helicase. GRCh38: Ensembl release 89: ENSG00000124535 - ... "A novel protein interacts with the Werner's syndrome gene product physically and functionally". J Biol Chem. 276 (23): 20364-9 ... "Entrez Gene: WRNIP1 Werner helicase interacting protein 1". Maruyama K, Sugano S (1994). "Oligo-capping: a simple method to ...
Synthetic lethality
Futami K, Ishikawa Y, Goto M, Furuichi Y, Sugimoto M (2008). "Role of Werner syndrome gene product helicase in carcinogenesis ... "Epigenetic inactivation of the premature aging Werner syndrome gene in human cancer". Proc. Natl. Acad. Sci. U.S.A. 103 (23): ... "Recapitulation of Werner syndrome sensitivity to camptothecin by limited knockdown of the WRN helicase/exonuclease". ...
George M. Martin
Important highlights include the discovery of the genetic defect causing Werner syndrome and certain familial forms of ... September 1994). "Integrated mapping analysis of the Werner syndrome region of chromosome 8" (PDF). Genomics. 23 (1): 100-13. ...
DNA polymerase beta
May 1994). "Evidence against DNA polymerase beta as a candidate gene for Werner syndrome". Human Genetics. 93 (5): 507-12. doi: ...
Treatment of cancer
"Epigenetic inactivation of the premature aging Werner syndrome gene in human cancer". Proceedings of the National Academy of ... lessons from pediatric cancer susceptibility syndromes". Journal of Clinical Oncology. 24 (23): 3799-808. doi:10.1200/JCO. ...
TOP1
"Epigenetic inactivation of the premature aging Werner syndrome gene in human cancer". Proc. Natl. Acad. Sci. U.S.A. 103 (23): ...
Type I topoisomerase
"Epigenetic inactivation of the premature aging Werner syndrome gene in human cancer". Proc. Natl. Acad. Sci. U.S.A. 103 (23): ... Topo III has been identified to be associated with the BLM (for Bloom Syndrome) helicase during recombination. Type IA ...
Ku80
Li B, Comai L (September 2000). "Functional interaction between Ku and the werner syndrome protein in DNA end processing". J. ... and Werner syndrome ATP-dependent helicase. GRCh38: Ensembl release 89: ENSG00000079246 - Ensembl, May 2017 GRCm38: Ensembl ... "Ku heterodimer binds to both ends of the Werner protein and functional interaction occurs at the Werner N-terminus". Nucleic ... recognized by autoantibodies from patients with scleroderma-polymyositis overlap syndrome". Proc. Natl. Acad. Sci. U.S.A. 87 (5 ...
Ku70
Li B, Comai L (Sep 2000). "Functional interaction between Ku and the werner syndrome protein in DNA end processing". The ... "Ku heterodimer binds to both ends of the Werner protein and functional interaction occurs at the Werner N-terminus". Nucleic ...
Kostniakomięsak, wolna encyklopedia
Excess of rare cancers in Werner syndrome (adult progeria). „Cancer Epidemiol Biomarkers Prev". 5 (4), s. 239-46, Apr 1996. ... Bloom's syndrome. XX. The first 100 cancers. „Cancer Genet Cytogenet". 93 (1), s. 100-6, Jan 1997. PMID: 9062585. ...
Nosebleed
Folz, BJ; Kanne, M; Werner, JA (November 2008). "[Current aspects in epistaxis]". HNO. 56 (11): 1157-65; quiz 1166. doi:10.1007 ... Hemorrhagic telangiectasia (Osler-Weber-Rendu syndrome), a rare disease that runs in families ...
Lassa fever
Werner, Dietrich, editor (2004). Biological Resources and Migration. Springer. p. 363. ISBN 978-3-540-21470-0.. CS1 maint: ... The "Swollen baby syndrome" occurs in newborns, infants and toddlers with pitting edema, abdominal distension and hemorrhage.[6 ...
JC virus
Other strains and novel pathological syndromes[edit]. Although JC virus infection is classically associated with white matter ... Werner; Goelz, Susan E.; Major, Eugene Oliver (18 May 2016). "JC Polyomavirus Abundance and Distribution in Progressive ... This syndrome, called JCV granule cell layer neuronopathy (JCV GCN), is characterized by a productive and lytic infection by a ... recent literature has identified viral variants as etiological agents of other novel syndromes. For example, JCV has been found ...
پرتو کیهانی - ویکیپدیا، دانشنامهٔ آزاد
Bothe, Walther; Werner Kolhörster (November 1929). "Das Wesen der Höhenstrahlung". Zeitschrift für Physik. 56 (11-12): 751-777 ... Werner Kolhörster confirmed Victor Hess's earlier results by measuring the increased ionization enthalpy rate at an altitude of ...
Asma bahasa Indonesia, ensiklopedia bebas
Werner, HA (June 2001). "Status asthmaticus in children: a review". Chest 119 (6): 1596-1607. PMID 11399724. doi:10.1378/chest. ... Asma juga dihubungkan dengan Churg-Strauss syndrome, suatu penyakit autoimun dan vaskulitis. Seseorang dengan tipe urtikaria ...
Andrea Prader
Prader-Gurtner syndrome, with HP Gurtner (1955) Prader-Labhart-Willi syndrome (1956) Prader has been involved in the discovery ... Werner Isler (pediatrician), Fritz Lüthy (neurologist), and Rudolf Siebenmann (pathologist). Siemerling, E; H. G. Creutzfeldt ( ... He co-discovered the Prader-Willi syndrome and created two physiological sex development scales, the Prader scale and the ... They came up with diagnostic criteria, pathology and clinical picture of this heritable syndrome, described first by Siemerling ...
Extrasensory perception
In the 1930s, at Duke University in North Carolina, J. B. Rhine and his wife Louisa E. Rhine conducted investigation into extrasensory perception. While Louisa Rhine concentrated on collecting accounts of spontaneous cases, J. B. Rhine worked largely in the laboratory, carefully defining terms such as ESP and psi and designing experiments to test them. A simple set of cards was developed, originally called Zener cards[8] - now called ESP cards. They bear the symbols circle, square, wavy lines, cross, and star; there are five cards of each in a pack of 25.. In a telepathy experiment, the "sender" looks at a series of cards while the "receiver" guesses the symbols. To try to observe clairvoyance, the pack of cards is hidden from everyone while the receiver guesses. To try to observe precognition, the order of the cards is determined after the guesses are made. Later he used dice to test for psychokinesis.[9][10]. The parapsychology experiments at Duke evoked criticism from academics and others who ...
Medical genetics
Down syndrome, DiGeorge syndrome (22q11.2 Deletion Syndrome), Fragile X syndrome, Marfan syndrome, Neurofibromatosis, Turner ... Lanphier, Edward; Urnov, Fyodor; Haecker, Sarah Ehlen; Werner, Michael; Smolenski, Joanna (26 March 2015). "Don't edit the ... Marfan syndrome, Noonan syndrome, and Rett syndrome. Molecular tests are also used in the diagnosis of syndromes involving ... epigenetic abnormalities, such as Angelman syndrome, Beckwith-Wiedemann syndrome, Prader-willi syndrome, and uniparental disomy ...
Trimetilamina bahasa Indonesia, ensiklopedia bebas
Wallrabenstein I, Kuklan J, Weber L, Zborala S, Werner M, Altmüller J, Becker C, Schmidt A, Hatt H, Hummel T, Gisselmann G ( ... or Fish-Odor Syndrome) and cardiovascular disease through the proatherogenic property of its oxidized liver-derived form.. ...
Globo d'Oro a o Millor Actor Dramatico - Biquipedia, a enciclopedia libre
Oskar Werner ‡. Willie Schumann. Ship of Fools ‡ 24ena edición d'os Globos d'Oro (1966). Paul Scofield †. Sir Thomas More. A ... The China Syndrome‡ Al Pacino ‡. Arthur Kirkland. ...And Justice for All‡ Jon Voight. Billy Flynn. The Champ ...
Pelvis
ISBN 0-7506-8814-9. Platzer, Werner (2004). Color Atlas of Human Anatomy, Vol. 1: Locomotor System (5th ed.). Thieme. ISBN 3-13 ... ISBN 978-1-4511-1945-9. Morris, Craig E. (2005). Low Back Syndromes: Integrated Clinical Management. McGraw-Hill. ISBN 0-07- ... irritable bowel syndrome, and interstitial cystitis. There are many anatomical variations of the pelvis. In the female the ...
Parkinson's disease
Mark Hallett; Werner Poewe (13 October 2008). Therapeutics of Parkinson's Disease and Other Movement Disorders. John Wiley & ... This is now discouraged since it can bring on dangerous side effects such as neuroleptic malignant syndrome.[74] Most people ... Other causes that can secondarily produce parkinsonism are stroke and drugs.[59] Parkinson plus syndromes such as progressive ... The dopamine dysregulation syndrome - with wanting of medication leading to overusage - is a rare complication of levodopa use ...
NMDA receptor
Todd A Hardy, Reddel, Barnett, Palace, Lucchinetti, Weinshenker, Atypical inflammatory demyelinating syndromes of the CNS, The ...
Gorham's disease
MÖLLER, G., Priemel, M., Amling, M. Werner, M., Kuhlmey, A. S., Delling, G. "The Gorham-Stout syndrome (Gorham's massive ... In 1999 Möller and colleagues concluded, "The Gorham-Stout syndrome may be, essentially, a monocentric bone disease with a ... Dupond JL, Bermont L, Runge M, de Billy M. Plasma VEGF determination in disseminated lymphangiomatosis-Gorham-Stout syndrome: a ... There now exists the basis for a new syndrome which is supported by a remarkable similarity of clinical and [x-ray] findings in ...
Forensic pathology
Spitz, Werner U.; Spitz, Daniel J. (eds.) (2006). Spitz and Fisher's Medicolegal Investigation of Death: Guidelines for the ... Perry Mason syndrome. *Pollen calendar. *Skid mark. *Trace evidence. *. Use of DNA in. forensic entomology ...
Causes of cancer pain
Koh, M; Portenoy, RK (2010). "Cancer Pain Syndromes". In Bruera ED & Portenoy RK. Cancer Pain Syndromes. Cambridge University ... ISBN 1-60831-089-2. Kurita GP, Ulrich A, Jensen TS, Werner MU, Sjøgren P. How is neuropathic cancer pain assessed in randomised ... Superior vena cava syndrome The superior vena cava (a large vein carrying circulating, de-oxygenated blood into the heart) may ... Twycross R & Bennett M. Cancer pain syndromes. In: Sykes N, Bennett MI & Yuan C-S. Clinical pain management: Cancer pain. 2nd ...
Light
Max Planck · Albert Einstein · Niels Bohr · Max Born · Werner Heisenberg · Erwin Schrödinger · Pascual Jordan · Wolfgang Pauli ...
Discrimination based on skin color
Troesken, Werner; Walsh, Randall (August 2017). "Collective Action, White Flight, and the Origins of Formal Segregation Laws". ... Hall, R (1995). "The bleaching syndrome: African American's response to cultural domination vis-A-vis skin color". Journal of ...
Histone acetyltransferase
... and Werner syndrome DNA helicase, STAT6, Runx1 (AML1), UBF, Beta2/NeuroD, CREB, c-Jun, C/EBPβ, NF-E2, SREBP, IRF2, Sp3, YY1, ...
Sponge
Caribbean sponges of the genus Aplysina suffer from Aplysina red band syndrome. This causes Aplysina to develop one or more ... Werner E. G. Muller, Elaine Seaver, Ward C. Wheeler, Mark Q. Martindale, Gonzalo Giribet & Casey W. Dunn (December 2009). " ... Olson, J. B., Gochfeld, D. J., and Slattery, M. (2006). "Aplysina red band syndrome: a new threat to Caribbean sponges". ...
Men who have sex with men
Werner W. K. Hoeger, Sharon A. Hoeger (2010). Fitness and Wellness: A Personalized Program. Cengage Learning. p. 455. ISBN 978- ... Acquired immune deficiency syndrome (AIDS) is a disease of the human immune system caused by the human immunodeficiency virus ( ...
Diabetes insipidus
... is also associated with some serious diseases of pregnancy, including pre-eclampsia, HELLP syndrome and ...
Tetracycline
Fanconi syndrome may result from ingesting expired tetracyclines.. Caution should be exercised in long-term use when ... Olson CA, Mitchell KD, Werner PA (October 2000). "Bait ingestion by free-ranging raccoons and nontarget species in an oral ... cases of Stevens-Johnson syndrome, toxic epidermal necrolysis, and erythema multiforme associated with doxycyline use have been ...
Cysteine
Belitz, H.-D; Grosch, Werner; Schieberle, Peter (2009-02-27). Food Chemistry. ISBN 9783540699330. .mw-parser-output cite. ... and individuals with certain metabolic diseases or who suffer from malabsorption syndromes. Cysteine can usually be synthesized ...
Daniel Carleton Gajdusek Bahasa Melayu, ensiklopedia bebas
Gajdusek; Carleton, Daniel; Gibbs, Clarence J.; Alpers, Mâ (1966). "Experimental transmission of a Kuru-like syndrome to ... 1956 André Cournand / Werner Forssmann / Dickinson W. Richards. *1957 Daniel Bovet. *1958 George Beadle / Edward Tatum / Joshua ...
PARP1, a enciclopedia libre
"Genetic cooperation between the Werner syndrome protein and poly(ADP-ribose) polymerase-1 in preventing chromatid breaks, ... é deficiente en persoas con síndrome de Werner, un trastorno humano de envellecemento prematuro. A PARP1 e as proteínas Wrn ...
Diabetic nephropathy
... and result in the nephrotic syndrome. Likewise, the estimated glomerular filtration rate (eGFR) may progressively fall from a ...
Vein
Kahn SR (August 2006). "The post-thrombotic syndrome: progress and pitfalls". British Journal of Haematology. 134 (4): 357-65. ... In 1956, André Frédéric Cournand, Werner Forssmann and Dickinson W. Richards were awarded the Nobel Prize in Medicine "for ... Postphlebitic syndrome is venous insufficiency that develops following deep vein thrombosis.[5] ... Budd Chiari syndrome) or compression from tumours or tuberculosis lesions. When the pressure increases in the portal veins, a ...
Werner syndrome | pathology | Britannica
... and Werner syndrome (adult progeria), which occurs later in life. A third condition, Hallerman-Streiff-François syndrome, is ... Progeria is extremely rare; for example, the global incidence of Hutchinson-Gilford progeria syndrome is… ... Other articles where Werner syndrome is discussed: progeria: …onset in early childhood, ... and Werner syndrome (adult progeria), which occurs later in life. A third condition, Hallerman-Streiff-François syndrome, is ...
Werner syndrome: MedlinePlus Genetics
Werner syndrome is characterized by the dramatic, rapid appearance of features associated with normal aging. Explore symptoms, ... medlineplus.gov/genetics/condition/werner-syndrome/ Werner syndrome. ... Mutations in the WRN gene cause Werner syndrome. The WRN gene provides instructions for producing the Werner protein, which is ... Werner syndrome is estimated to affect 1 in 200,000 individuals in the United States. This syndrome occurs more often in Japan ...
Werner Syndrome - GeneReviews® - NCBI Bookshelf
Individuals with Werner syndrome develop normally until the end of the first decade. The first sign is the lack of a growth ... Myocardial infarction and cancer are the most common causes of death; the mean age of death in individuals with Werner syndrome ... Werner syndrome is characterized by the premature appearance of features associated with normal aging and cancer predisposition ... Werner syndrome ATP-dependent helicase. Werner Syndrome Mutational Database. WRN database. WRN. WRN. ...
Werner Syndrome Medical Definition | Merriam-Webster Medical Dictionary
Medical definition of Werner syndrome: a rare genetic disorder with onset during adolescence or early adulthood that is ... Share Werner syndrome Post the Definition of Werner syndrome to Facebook Share the Definition of Werner syndrome on Twitter ... Comments on Werner syndrome What made you want to look up Werner syndrome? Please tell us where you read or heard it (including ... Dictionary Entries near Werner syndrome. Wenckebach phenomenon Werdnig-Hoffmann disease Werlhofs disease Werner syndrome ...
Werner syndrome helicase - Wikipedia
Werner syndrome is caused by mutations in the WRN gene. More than 20 mutations in the WRN gene are known to cause Werner ... Werner syndrome ATP-dependent helicase, also known as DNA helicase, RecQ-like type 3, is an enzyme that in humans is encoded by ... Werner syndrome ATP-dependent helicase has been shown to interact with: BLM DNA-PKcs, FEN1, Ku70, Ku80, P53, PCNA, TERF2, and ... Lebel M (2001). "Werner syndrome: genetic and molecular basis of a premature aging disorder". Cell. Mol. Life Sci. 58 (7): 857- ...
From Special Olympian To High Fashion Model, Chelsea Werner Defies All Down Syndrome Stereotypes
The model has defied the odds of Down Syndrome - not only becoming a four-time Olympic champion but becoming the poster girl ... Chelsea Werner has defied the odds of Down Syndrome - not only becoming a four-time Olympic champion but becoming an ... From Special Olympian To High Fashion Model, Chelsea Werner Defies All Down Syndrome Stereotypes. ... Chelsea was born with Down Syndrome, unable to walk until she was almost two years old and told she would always have low ...
International Registry of Werner Syndrome - NORD (National Organization for Rare Disorders)
International Registry of Werner Syndrome. Address. University of Washington Department of Pathology. Box 357470. Seattle, WA ... Werner syndrome, a rare autosomal recessive disorder, is characterized by abnormally short stature in childhood and premature ... Home / For Patients and Families / Find a Patient Organization / International Registry of Werner Syndrome ... Established in 1986, IRWS works to ascertain and genotype individuals with Werner syndrome from around the world and to ...
Werner's Syndrome
PubMed Central Canada (PMC Canada) provides free access to a stable and permanent online digital archive of full-text, peer-reviewed health and life sciences research publications. It builds on PubMed Central (PMC), the U.S. National Institutes of Health (NIH) free digital archive of biomedical and life sciences journal literature and is a member of the broader PMC International (PMCI) network of e-repositories.
Vitamin C alleviates aging defects in a stem cell model for Werner syndrome | SpringerLink
Werner syndrome (WS) is a premature aging disorder that mainly affects tissues derived from mesoderm. We have recently ... Werner Syndrome as an example of inflamm-aging: possible therapeutic opportunities for a progeroid syndrome? Rejuvenation Res 9 ... A Werner syndrome stem cell model unveils heterochromatin alterations as a driver of human aging. Science 348:1160-1163CrossRef ... Werner syndrome (WS) is a premature aging disorder that mainly affects tissues derived from mesoderm. We have recently ...
Werner syndrome - ONA
Werner syndrome OMIM #277700. Are You Confident of the Diagnosis?. What you should be alert for in the history. Werner syndrome ... A detailed discussion of the molecular and genetic basis of the progeroid syndromes including Werner syndrome is presented to ... aging syndromes is presented with a detailed discussion of both Hutchinson-Gilford progeria syndrome and Werner syndrome, their ... Management of the Systemic Complications of Werner Syndrome. Complications. Management Strategies. Diabetes. Smoking cessation ...
'werner syndrome' Protocols and Video...
WRNexo - Werner Syndrome-like exonuclease - Drosophila simulans (Fruit fly) - WRNexo gene & protein
Werner Syndrome-like exonucleaseAdd BLAST. 354. Amino acid modifications. Feature key. Position(s). DescriptionActions. ... Werner Syndrome-like exonuclease (EC:3.1.11.-*Search proteins in UniProtKB for this EC number. ... sp,B4QUF6,WRNXO_DROSI Werner Syndrome-like exonuclease OS=Drosophila simulans OX=7240 GN=WRNexo PE=3 SV=1 ...
RCSB PDB - 2E1E: Crystal structure of the HRDC Domain of Human Werner Syndrome Protein, WRN
Werner syndrome ATP-dependent helicase. A. 103. Homo sapiens. Mutation(s): 0 Gene Names: WRN, RECQ3, RECQL2. EC: 3.6.1 (PDB ... Crystal structure of the HRDC domain of human Werner syndrome protein, WRN. Kitano, K., Yoshihara, N., Hakoshima, T.. (2007) J ... Werner syndrome is a human premature aging disorder characterized by chromosomal instability. The disease is caused by the ... Werner syndrome is a human premature aging disorder characterized by chromosomal instability. The disease is caused by the ...
WRN, the Werner Syndrome Gene, Exhibits Frameshift Mutations in Gastric and Colorectal Cancers. - PubMed - NCBI
Atypical Werner syndrome | definition of Atypical Werner syndrome by Medical dictionary
What is Atypical Werner syndrome? Meaning of Atypical Werner syndrome medical term. What does Atypical Werner syndrome mean? ... Looking for online definition of Atypical Werner syndrome in the Medical Dictionary? Atypical Werner syndrome explanation free ... Werner syndrome. (redirected from Atypical Werner syndrome). Also found in: Dictionary. Wer·ner syn·drome. (wĕrnĕr), [MIM* ... Werner syndrome. (vĕr′nər) or Werners syndrome. (-nərz). n.. An autosomal recessive disorder characterized by short stature ...
Werner's Syndrome (Progeria of the Adult)
Werners syndrome (progeria in the adult). Ulster Med J. 1957 May 1;26(1):65-70. [PMC free article] [PubMed] ... Werners syndrome: a study of adrenocortical and hepatic steroidal metabolism. Tex State J Med. 1953 Dec;49(12):882-888. [ ... Werners syndrome. Br Med J. 1955 Jul 23;2(4933):237-239. [PMC free article] [PubMed] ... Werners syndrome; with a report of two cases. Am J Med. 1953 Aug;15(2):266-271. [PubMed] ...
NAD+ augmentation restores mitophagy and limits accelerated aging in Werner syndrome.
... dc.date.accessioned. 2020-06-09T18:26: ... Metabolic dysfunction is a primary feature of Werner syndrome (WS), a human premature aging disease caused by mutations in the ... NAD+ augmentation restores mitophagy and limits accelerated aging in Werner syndrome.. Nature Communications. 2019. ... gene encoding the Werner (WRN) DNA helicase. WS patients exhibit severe metabolic phenotypes, but the underlying mechanisms are ...
Homologous Recombination Resolution Defect in Werner Syndrome | Molecular and Cellular Biology
... and genetic aspects of this syndrome following Otto Werners initial description has led to the recognition of Werner syndrome ... report and clinical and molecular comparisons with Bloom syndrome and Werner syndrome. Am. J. Med. Genet. 90:223-228. ... Werner syndrome, p. 785-797. In C. R. Scriver, A. L. Beaudet, W. S. Sly, and D. Valle (ed.), The metabolic and molecular basis ... Homologous Recombination Resolution Defect in Werner Syndrome. Yannick Saintigny, Kate Makienko, Cristina Swanson, Mary J. ...
Pharmaceuticals | Free Full-Text | Microwave-Assisted Synthesis of a MK2 Inhibitor by Suzuki-Miyaura Coupling for Study in...
... inhibitors to study accelerated aging in Werner syndrome (WS) cells, including the cross-coupling of a 2-chloroquinoline with a ... Microwave-Assisted Synthesis of a MK2 Inhibitor by Suzuki-Miyaura Coupling for Study in Werner Syndrome Cells. Mark C. Bagley 1 ... "Microwave-Assisted Synthesis of a MK2 Inhibitor by Suzuki-Miyaura Coupling for Study in Werner Syndrome Cells." Pharmaceuticals ... Keywords: Suzuki-Miyaura; cross-coupling; MK2 inhibitor; Werner syndrome; cell aging; pyrazoles; heterocycles; microwave- ...
A Werner syndrome stem cell model unveils heterochromatin alterations as a driver of human aging | Science
Analysis of human aging syndromes, such as Werner syndrome (WS), may lead to greater understanding of both premature and normal ... Werner syndrome (WS) is a premature aging disorder caused by WRN protein deficiency. Here, we report on the generation of a ... A Werner syndrome stem cell model unveils heterochromatin alterations as a driver of human aging ... A Werner syndrome stem cell model unveils heterochromatin alterations as a driver of human aging ...
Werner syndrome | Genetic and Rare Diseases Information Center (GARD) - an NCATS Program
... information resources and questions answered by our Genetic and Rare Diseases Information Specialists for Werner syndrome ... ghr.nlm.nih.gov/condition/werner-syndrome. *Werner syndrome. National Organization for Rare Disorders (NORD). Updated 2018; ... rarediseases.org/rare-diseases/werner-syndrome/. *Oshima J, Sidorva JM, Monnat RJ Jr. Werner syndrome: Clinical features, ... Werner syndrome. is a condition that causes premature aging. People with this syndrome will develop and grow normally until ...
A cascade leading to premature aging phenotypes including abnormal tumor profiles in Werner syndrome (Review)
WRN and RTS result in Bloom syndrome (BS), Werner syndrome (WS) and Rothmund-Thomson syndrome (RTS), respectively. These three ... and genetic aspects of the Werner syndrome in Japan. Werners Syndrome and Human Aging. Advances in Experimental Medicine and ... Fry M and Loeb LA: Human werner syndrome DNA helicase unwinds tetrahelical structures of the fragile X syndrome repeat sequence ... Goto M: Syndrome-causing mutations in Werner syndrome. Biosci Trends. 2:147-150. 2008. ...
Werner syndrome helicase is a selective vulnerability of microsatellite instability-high tumor cells | eLife
Targeting Werner syndrome helicase might constitute a novel opportunity for the treatment of a clinically defined subset of ... Werner Syndrome RecQ Like Helicase (WRN). N/A. Entrez Gene: 7486. Genetic reagent (Homo sapiens). NTC siRNA. Dharmacon. D- ... Werner syndrome helicase has a critical role in DNA damage responses in the absence of a functional fanconi anemia pathway * M ... Werner syndrome helicase (WRN) is a member of the RecQ DNA helicase subfamily (Croteau et al., 2014; Yu et al., 1996). RecQ ...
Metabolism of acetylated low density lipoproteins by monocyte-derived macrophages from patients with Werner's syndrome. |...
Metabolism of acetylated low density lipoproteins by monocyte-derived macrophages from patients with Werners syndrome.. S Mori ... Therefore, for determination of the mechanism of accelerated atherogenesis in Werners syndrome, studies were carried out on ... These results indicate that in monocyte-derived macrophages of patients with Werners syndrome, the uptake, lysosomal ... Metabolism of acetylated low density lipoproteins by monocyte-derived macrophages from patients with Werners syndrome. ...
The DNA repair endonuclease XPG interacts directly and functionally with the WRN helicase defective in Werner syndrome | Amrita...
Werner syndrome, Werner syndrome protein, xeroderma pigmentosum Abstract:. XPG is a structure-specific endonuclease required ... We show that XPG interacts directly with WRN protein, which is defective in the premature aging disorder Werner syndrome, and ... The DNA repair endonuclease XPG interacts directly and functionally with the WRN helicase defective in Werner syndrome ... "The DNA repair endonuclease XPG interacts directly and functionally with the WRN helicase defective in Werner syndrome", Cell ...
Ep 98 - Marfan Syndrome: "I Have a Client Who . . ." Pathology Conversations with Ruth Werner | Associated Bodywork & Massage...
A client has Marfan syndrome-what does it mean for him? And what does it mean for massage? Listen in as we review what ... Ep 98 - Marfan Syndrome: "I Have a Client Who . . ." Pathology Conversations with Ruth Werner. 04/16/2021 ... In fact, Marfan syndrome and the signs and symptoms of Ehlers-Danlos Syndrome often overlap and it can be difficult to ... Werner is also a long-time Massage & Bodywork columnist, most notably of the Pathology Perspectives column. Werner is also ...
The Werner Syndrome Helicase-Nuclease--One Protein, Many Mysteries -- Fry 2002 (13): 2 -- <i>Science</i...
Key Words: Werner helicase exonuclease progeroid progeria DNA replication DNA repair. Abstract: Werner syndrome (WS) is an ... The Werner Syndrome Helicase-Nuclease--One Protein, Many Mysteries Michael Fry The author is in the Department of Biochemistry ... Werner Syndrome Protein--Unwinding Function to Explain Disease.. R. J. Monnat Jr. and Y. Saintigny (2004). Sci. Aging Knowl. ... Identification and Biochemical Characterization of a Werners Syndrome Protein Complex with Ku70/80 and Poly(ADP-ribose) ...
Herlyn-Werner-Wunderlich Syndrome /OHVIRA Syndrome; A Rare Urogenital
Anomaly with Unusual Presentation in Two Cases with...
OHVIRA Syndrome; A Rare Urogenital Anomaly with Unusual Presentation in Two Cases with Review of Literature Abstract. ... Herlyn-Werner-Wunderlich Syndrome /OHVIRA Syndrome; A Rare Urogenital Anomaly with Unusual Presentation in Two Cases with ... Citation: Singh K, Thakur S, Soni A, Verma A (2016) Herlyn-Werner-Wunderlich Syndrome /OHVIRA Syndrome; A Rare Urogenital ... The OHVIRA syndrome classically occurs in the setting of uterine didelphys or more rarely, a septate uterus with incidence in ...
PO-0911 Herlyn-werner-wunderlich Syndrome And Distal Vaginal Atresia. Two Particular Cases | Archives of Disease in Childhood
John Libbey Eurotext - European Journal of Dermatology - A novel <i>WRN</i> mutation identified in a patient with Werner...
Home , Journals , European Journal of Dermatology , A novel WRN mutation identified in a patient with Werner syndrome and acute ... WS: Werner syndrome; PV: psoriasis vulgaris; AGEP: acute generalized exanthematous pustulosis. F) Sequence analysis showing ... Werner syndrome (WS; OMIM 277700) is a group of hereditary progeria conditions with an autosomal recessive inheritance pattern ... A novel WRN mutation identified in a patient with Werner syndrome and acute generalized exanthematous pustulosis Volume 28, ...
HelicaseHutchinson-GilfordBloomMutationsAutosomal recessive disorderProteinDefectsTumorPredisposition syndromesWerner's SyndromeProgeroid syndromesHerlyn-Werner-Wunderlich SyndromeFibroblastsPeople with Werner syndromeClinicalInstabilityOMIMPremature aging diCockayneCongenitalDiseasesSenescenceMetabolismType of progeroid syndromeSymptomsCataractsDisorderPhenotypesSegmentalHereditaryPathologyWatery diarrheaOccursOnsetProgeria and Werner syndromeDiagnosis of Werner syndromeCancersMetabolicLate forties or early fiftiesCauses Werner syndromeIndividuals with WernerCancer predispositionCells
Helicase16
- Werner syndrome ATP-dependent helicase, also known as DNA helicase, RecQ-like type 3, is an enzyme that in humans is encoded by the WRN gene. (wikipedia.org)
- Defects of WRN, which encodes a DNA helicase responsible for maintaining genomic integrity, cause Werner syndrome. (thefreedictionary.com)
- Metabolic dysfunction is a primary feature of Werner syndrome (WS), a human premature aging disease caused by mutations in the gene encoding the Werner (WRN) DNA helicase. (uio.no)
- Mutations in other human RecQ helicase genes have also been identified in patients with two other genetic instability and tumor predisposition syndromes, Bloom syndrome ( 12 ) and Rothmund-Thomson syndrome ( 24 , 26 ). (asm.org)
- This perspective review focused on the Werner syndrome (WS) by addressing the issue of how a single mutation in a WRN gene encoding WRN DNA helicase induces a wide range of premature aging phenotypes accompanied by an abnormal pattern of tumors. (spandidos-publications.com)
- WRN is a member of the RecQ helicase gene family, which includes RECQL1 ( 8 ), Bloom syndrome gene ( BLM ) ( 9 ), WRN ( 4 ), Rothmund-Thomson syndrome gene ( RTS/RECQL4 ) ( 10 ), and RECQL5 ( 11 ). (spandidos-publications.com)
- By leveraging recent functional screening data of cancer cell lines we identify Werner syndrome helicase (WRN) as a novel specific vulnerability of microsatellite instability-high (MSI-H) cancer cells. (elifesciences.org)
- The Werner Syndrome Helicase Coordinates Sequential Strand Displacement and FEN1-Mediated Flap Cleavage during Polymerase δ Elongation. (diseaseinfosearch.org)
- Dr. Shimamoto and his collaborators analyzed patient-derived iPS cells and found that telomeric abnormalities in the fibroblasts of these patients, which were caused by the lack of WRN helicase encoded by the gene responsible for Werner syndrome, were recovered in the iPS cells generated from these patients. (stemcellclinic.net)
- Synthetic peptide within Human Werner's syndrome helicase WRN aa 1400-1500 (C terminal). (abcam.co.jp)
- The WRN gene encodes a 3′-5′ DNA helicase, and is a member of the RecQ family, which also includes the product of the Bloom's syndrome gene ( BLM ). (embopress.org)
- In particular, Werner syndrome helicase and related genes are differentially expressed between the YRI and CEU cohorts. (clarkfrancis.com)
- Werner syndrome is caused by a mutation to the RecQ helicase-like gene, known as the WRN gene for short, which generates protein. (scotsman.com)
- The Bloom syndrome gene product is related to the RecQ subset of DExH box-containing DNA helicases and has both DNA-stimulated ATPase and ATP-dependent DNA helicase activities. (genecards.org)
- Mutations causing Bloom syndrome delete or alter helicase motifs and may disable the 3'-5' helicase activity. (genecards.org)
- BLM (Bloom Syndrome RecQ Like Helicase) is a Protein Coding gene. (genecards.org)
Hutchinson-Gilford17
- Kudlow BA, Kennedy BK, Monnat RJ Jr. Werner and Hutchinson-Gilford progeria syndromes: mechanistic basis of human progeroid diseases. (medlineplus.gov)
- Other premature aging syndromes are on the differential diagnosis of WS including Hutchinson-Gilford progeria syndrome, Cockayne syndrome, ataxia-telangiectasia, Rothmund-Thomson syndrome and mandibuloacral dysplasia. (oncologynurseadvisor.com)
- WS can be distinguished from Hutchinson-Gilford progeria syndrome by its later onset, presence of cataracts, hypogonadism, laryngeal atrophy, and osteosclerosis of the distal extremities. (oncologynurseadvisor.com)
- [1] [2] The term progeroid syndrome does not necessarily imply progeria ( Hutchinson-Gilford progeria syndrome ), which is a specific type of progeroid syndrome. (wikipedia.org)
- Examples of PS include Werner syndrome (WS), Bloom syndrome (BS), Rothmund-Thomson syndrome (RTS), Cockayne syndrome (CS), xeroderma pigmentosum (XP), trichothiodystrophy (TTD), combined xeroderma pigmentosum - Cockayne syndrome (XP-CS), restrictive dermopathy (RD), and Hutchinson-Gilford progeria syndrome (HGPS). (wikipedia.org)
- The most widely studied of the progeroid syndromes are Werner syndrome and Hutchinson-Gilford progeria, as they are seen to most resemble natural aging. (wikipedia.org)
- Model of human aging: recent findings on Werner's and Hutchinson-Gilford progeria syndromes. (medscape.com)
- Mechanisms of premature vascular aging in children with Hutchinson-Gilford progeria syndrome. (medscape.com)
- Impact of farnesylation inhibitors on survival in Hutchinson-Gilford progeria syndrome. (medscape.com)
- Phenotype and course of Hutchinson-Gilford progeria syndrome. (medscape.com)
- Hutchinson-Gilford progeria syndrome: review of the phenotype. (medscape.com)
- Disease progression in Hutchinson-Gilford progeria syndrome: impact on growth and development. (medscape.com)
- Hutchinson-Gilford progeria syndrome: oral and craniofacial phenotypes. (medscape.com)
- Otologic and audiologic manifestations of Hutchinson-Gilford progeria syndrome. (medscape.com)
- LMNA is mutated in Hutchinson-Gilford progeria (MIM 176670) but not in Wiedemann-Rautenstrauch progeroid syndrome (MIM 264090). (medscape.com)
- Early-passage cells from fetal, young, and old donors and cells from subjects with the Hutchinson-Gilford and Werner syndromes of accelerated aging had similar error frequencies. (nih.gov)
- PRG Science & Technology Co., Ltd. (PRG S&T) is developing Progerinin (SLC-D011) for the treatment of the rare aging diseases Hutchinson-Gilford Progeria Syndrome (HGPS) and Werner Syndrome (WS). (clinicaltrials.gov)
Bloom5
- Mutations of BLM , WRN and RTS result in Bloom syndrome (BS), Werner syndrome (WS) and Rothmund-Thomson syndrome (RTS), respectively. (spandidos-publications.com)
- There are five genes encoding RecQ in humans (RECQ1-5), and defects in RECQL2/WRN, RECQL3/BLM and RECQL4 lead to Werner syndrome (WS), Bloom syndrome (BS), and Rothmund-Thomson syndrome (RTS), respectively. (wikipedia.org)
- Diseases associated with BLM include Bloom Syndrome and Werner Syndrome . (genecards.org)
- Werner syndrome and Bloom syndrome result from defects in the RecQ helicases Werner (WRN) and Bloom (BLM), respectively, and display premature aging phenotypes. (pnas.org)
- Furthermore, T-SCE-driven premature cellular senescence may be a factor contributing to accelerated aging in Werner and Bloom syndromes, but not XFE progeroid syndrome. (pnas.org)
Mutations17
- Mutations in the WRN gene cause Werner syndrome. (medlineplus.gov)
- Mutations in the WRN gene often lead to the production of an abnormally short, nonfunctional Werner protein. (medlineplus.gov)
- Researchers do not fully understand how WRN mutations cause the signs and symptoms of Werner syndrome. (medlineplus.gov)
- Werner syndrome is caused by mutations in the WRN gene. (wikipedia.org)
- More than 20 mutations in the WRN gene are known to cause Werner syndrome. (wikipedia.org)
- Many of these mutations result in an abnormally shortened Werner protein. (wikipedia.org)
- Researchers are still determining how these mutations cause the appearance of premature aging seen in Werner syndrome. (wikipedia.org)
- WRN, the Werner Syndrome Gene, Exhibits Frameshift Mutations in Gastric and Colorectal Cancers. (nih.gov)
- Werner patient mutations truncate the WRN open reading frame and promote loss of the altered protein and both of its associated biochemical activities ( 4 , 28 , 42 ). (asm.org)
- Werner syndrome is caused by mutations in the WRN gene and is inherited in an autosomal recessive manner. (nih.gov)
- Werner syndrome is a rare autosomal recessive disorder, caused by mutations in the WRN gene. (diseaseinfosearch.org)
- Mutations in the WRN gene are found in about 90% of people with Werner syndrome. (cancermedicines.in)
- One of the main causes of progeroid syndromes is genetic mutations , which lead to defects in the cellular processes which repair DNA . (wikipedia.org)
- Case report: A case of Werner syndrome with compound heterozygous mutations of WRN gene]. (cdc.gov)
- Costello syndrome is a clinically heterogeneous condition caused by sporadic mutations in HRAS , [ 8 ] in the Ras-mitogen-activated protein kinase (MAPK) pathway. (medscape.com)
- Mutations in the BLM gene lead to Bloom's syndrome. (embopress.org)
- The US researchers say genetic mutations which are a factor in Werner syndrome, a dramatic condition where sufferers age rapidly in early adulthood, could have wider implications for the medical profession. (scotsman.com)
Autosomal recessive disorder5
- Werner syndrome, a rare autosomal recessive disorder, is characterized by abnormally short stature in childhood and premature aging beginning in adolescence or early adulthood. (rarediseases.org)
- Werner syndrome is a rare autosomal recessive disorder characterized by clinical signs of premature aging, short stature , scleroderma-like skin changes, endocrine abnormalities, cataracts, and an increased incidence of malignancies. (symptoma.com)
- Werner syndrome (WS) is a rare autosomal recessive disorder. (wikipedia.org)
- Individuals affected by the autosomal recessive disorder Werner's syndrome (WS) develop many of the symptoms characteristic of premature ageing. (embopress.org)
- Werner's syndrome (WS) is a rare autosomal recessive disorder with multisystem manifestations of premature aging from the second decade of life. (who.int)
Protein16
- The WRN gene provides instructions for producing the Werner protein, which is thought to perform several tasks related to the maintenance and repair of DNA. (medlineplus.gov)
- Evidence also suggests that the altered protein is broken down more quickly in the cell than the normal Werner protein. (medlineplus.gov)
- Cells with an altered Werner protein may divide more slowly or stop dividing earlier than normal, causing growth problems. (medlineplus.gov)
- Lee JW, Harrigan J, Opresko PL, Bohr VA. Pathways and functions of the Werner syndrome protein. (medlineplus.gov)
- Monnat RJ Jr, Saintigny Y. Werner syndrome protein--unwinding function to explain disease. (medlineplus.gov)
- Opresko PL, Calvo JP, von Kobbe C. Role for the Werner syndrome protein in the promotion of tumor cell growth. (medlineplus.gov)
- Further evidence suggests that Werner protein plays a critical role in repairing DNA. (wikipedia.org)
- This shortened protein may also be broken down too quickly, leading to a loss of Werner protein in the cell. (wikipedia.org)
- Without normal Werner protein in the nucleus, cells cannot perform the tasks of DNA replication, repair, and transcription. (wikipedia.org)
- Identification and Biochemical Characterization of a Werner's Syndrome Protein Complex with Ku70/80 and Poly(ADP-ribose) Polymerase-1. (sciencemag.org)
- Werner Syndrome Protein--Unwinding Function to Explain Disease. (sciencemag.org)
- The Werner syndrome protein (WRN) suppresses the loss of telomeres replicated by lagging-strand synthesis by a yet to be defined mechanism. (diseaseinfosearch.org)
- The genes newly found by the exon amplification method together with other known genes, including those of glutathion reductase, a general transcription factor, protein phosphatase 2A β subunit and Werner's syndrome, were precisely mapped within the contigs. (oup.com)
- Telomere ResQue and preservation--roles for the Werner syndrome protein and other RecQ helicases. (cdc.gov)
- When the protein is mutated in Werner syndrome it disrupts the replication and repair of DNA and the expression of genes, which was thought to cause premature ageing. (scotsman.com)
- COMMENT This convincing report provides integrated DNA, RNA, and protein data that is used for disease gene discovery in a rare form of a mitochondrial disorder named Leigh syndrome, an autosomal recessive cytochrome c deficiency. (alzforum.org)
Defects5
- Defects in WRN are a cause of Werner syndrome (WRN) [MIM:277700]. (abcam.cn)
- Some examples of DNA repair defects causing progeroid syndromes in humans or mice are shown in Table 1. (wikipedia.org)
- A large body of evidence supports the theory that genomic instability acts as a causative factor in the aging process, which is evident from the fact that most mouse models of premature aging as well as human progeria syndromes are related to defects in mechanisms of genomic maintenance [ 2 ]. (hindawi.com)
- Defects in this gene are the cause of LIG4 syndrome. (cancerindex.org)
- Similarly, XFE progeroid syndrome results from defects in the ERCC1-XPF DNA repair endonuclease. (pnas.org)
Tumor2
- The map comprises a series of contigs mostly P1/PAC clones, which span the loci of potential tumor suppressor genes and the Werner's syndrome gene. (oup.com)
- A vipoma is a non-beta pancreatic islet cell tumor secreting vasoactive intestinal peptide (VIP), resulting in a syndrome of watery diarrhea, hypokalemia, and achlorhydria (WDHA syndrome). (merckmanuals.com)
Predisposition syndromes1
- Tumour predisposition syndromes in which cancers arise at an accelerated rate and in different organs - the equivalent of a sensitized background - provide a unique opportunity to examine how gene-environment interactions influence cancer risk when the initiating genetic defect responsible for malignancy is known. (nature.com)
Werner's Syndrome22
- Werner's syndrome: a study of adrenocortical and hepatic steroidal metabolism. (pubmedcentralcanada.ca)
- Metabolism of acetylated low density lipoproteins by monocyte-derived macrophages from patients with Werner's syndrome. (ahajournals.org)
- Therefore, for determination of the mechanism of accelerated atherogenesis in Werner's syndrome, studies were carried out on the metabolism of acetylated low density lipoprotein (LDL) by monocyte-derived macrophages from patients with this syndrome. (ahajournals.org)
- These results indicate that in monocyte-derived macrophages of patients with Werner's syndrome, the uptake, lysosomal hydrolysis, and re-esterification of free cholesterol are enhanced with no change in the receptor binding of acetylated LDL. (ahajournals.org)
- This abnormal enhancement of cholesteryl ester accumulation may cause an accelerated conversion of macrophages to foam cells in Werner's syndrome. (ahajournals.org)
- Multiple numerical and structural chromosome abnormalities were found in cultured lymphocytes of four patients with Werner's syndrome. (elsevier.com)
- These results confirm definitively that Werner's syndrome is a chromosome rearrangement syndrome and that these non-constitutional chromosome changes are not exclusive of cultured fibroblasts but present also in lymphocytes. (elsevier.com)
- Werner's syndrome (WS) is an autosomal recessive genetic disorder caused by loss of function mutation in wrn and is a useful model of premature in vivo ageing. (brad.ac.uk)
- This is in support that Werner's syndrome is a segmental progeroid syndrome. (brad.ac.uk)
- Ibrahim B, Sheerin AN, Jennert-Burston K et al (2016) Absence of premature senescence in Werner's syndrome keratinocytes. (brad.ac.uk)
- A case of Werner's Syndrome in a 47-year-old man, with typical features of pangeria associated with intracranial meningioma is described. (elsevier.com)
- A review of the literature showed that meningioma is the most frequent benign neoplasm in Werner's Syndrome. (elsevier.com)
- These findings suggest a correlation between chromosomal instability and the onset of neoplasms in Werner's Syndrome. (elsevier.com)
- Furthermore, the possibility of detecting chromosome n. 22 aberrations in peripheral blood lymphocytes of Werner's Syndrome patients could provide a clue to the presence of a meningioma at a preclinical stage. (elsevier.com)
- IMSEAR at SEARO: Endothelial cell study in a case of Werner's syndrome undergoing phacoemulsification and Yettrium-Aluminum-Garnet laser capsulotomy. (who.int)
- Kemmanu Vasudha, Nagappa Somshekar, Hegde Kaushik, Yadav Naresh K, Shetty Bhujang K. Endothelial cell study in a case of Werner's syndrome undergoing phacoemulsification and Yettrium-Aluminum-Garnet laser capsulotomy. (who.int)
- People with Werner's syndrome age quickly in their early 20s and at this age can look as though they are 70 years old. (abc.net.au)
- There is a premature ageing syndrome called Werner's syndrome where people look fairly normal until puberty and then age very suddenly, so by the time they are in their late 20s they're looking like they're about 70 years old. (abc.net.au)
- And essentially, at the molecular level right through to the whole person level, Werner's syndrome looks like normal ageing. (abc.net.au)
- people smoking, not doing enough exercise, whereas in Werner's syndrome is very definitely a genetic defect, and so we can start looking at the genes and the biochemistry involved in ageing. (abc.net.au)
- The Werner's syndrome gene is identified in people, yes. (abc.net.au)
- Werner's syndrome (Pangeria) or acrogeria) are rare and characterized by accelerated or premature aging. (quidel.com)
Progeroid syndromes3
- Progeroid syndromes ( PS ) are a group of rare genetic disorders which mimic physiological aging , making affected individuals appear to be older than they are. (wikipedia.org)
- They affect only one tissue and can be classified as unimodal progeroid syndromes. (wikipedia.org)
- [3] Progeroid syndromes have been widely studied in the fields of aging, regeneration , stem cells , and cancer . (wikipedia.org)
Herlyn-Werner-Wunderlich Syndrome2
- PO-0911 Herlyn-werner-wunderlich Syndrome And Distal Vaginal Atresia. (bmj.com)
- Herlyn-Werner-Wunderlich syndrome (HWWS) is a very rare congenital anomaly of the urogenital tract involving Mullerian ducts and Wolffian ducts , and is characterized by the triad of uterine didelphys, unilateral obstructed hemivagina and ipsilateral renal agenesis. (bvsalud.org)
Fibroblasts2
People with Werner syndrome5
- Many people with Werner syndrome have thin arms and legs and a thick trunk due to abnormal fat deposition. (medlineplus.gov)
- People with Werner syndrome usually live into their late forties or early fifties. (medlineplus.gov)
- In addition, people with Werner syndrome have an increased risk of developing cancer , especially thyroid and skin cancers. (nih.gov)
- One of the most significant health problems faced by people with Werner syndrome is the early development of atherosclerosis, commonly known as hardening of the arteries, which can lead to a heart attack. (cancermedicines.in)
- Types of cancers reported in people with Werner syndrome include thyroid cancer, melanoma, soft tissue sarcoma, and osteosarcoma (bone cancer). (cancermedicines.in)
Clinical6
- The International Registry of Werner Syndrome (IRWS), associated with the Department of Pathology of the University of Washington, is a non-profit research organization dedicated to providing clinical and genetic information on Werner syndrome to healthcare professionals and researchers. (rarediseases.org)
- Further characterization of the clinical, pathological, and genetic aspects of this syndrome following Otto Werner's initial description has led to the recognition of Werner syndrome as an uncommon autosomal recessive disease whose phenotype includes features of premature aging, genetic instability, and an elevated risk of cancer ( 13 , 18 , 39 ). (asm.org)
- Finding the right clinical trial for Werner syndrome can be challenging. (diseaseinfosearch.org)
- Werner syndrome: a changing pattern of clinical manifestations in Japan (1917~2008). (cdc.gov)
- German physician Otto Werner (1879-1936) described the clinical picture of this syndrome in 1904, in four sisters, defining the skin thin, tight, scleroderma-like, that mimics premature aging, with bilateral cataracts associated. (science20.com)
- Considerable evidence supports the association between insulin resistance and vascular disease, and this has led to wide acceptance of the clustering of hyperlipidemia, glucose intolerance, hypertension, and obesity as a clinical entity, the metabolic syndrome. (jci.org)
Instability3
- Werner syndrome is a human premature aging disorder characterized by chromosomal instability. (rcsb.org)
- Werner syndrome (WRN) is an uncommon autosomal recessive disease whose phenotype includes features of premature aging, genetic instability, and an elevated risk of cancer. (asm.org)
- Also covered are chromosome instability syndromes, mutagen-induced chromosome damage in lymphocytes and the role of cytogenetics in the assessment of haematological disorders. (booktopia.com.au)
OMIM1
- A rare autosomal recessive progeroid syndrome (OMIM:277700) characterised by premature onset of multiple age-related disorders, including atherosclerosis, cancer, type-2 diabetes, ocular cataracts, osteoporosis, and death by age 47, often due to myocardial infarction. (thefreedictionary.com)
Premature aging di3
- Werner syndrome (WS) is a premature aging disorder that mainly affects tissues derived from mesoderm. (springer.com)
- 2013 ). Werner Syndrome (referred to as WS, also known as adult progeria) is a premature aging disorder with phenotypes such as grey hair, osteoporosis, diabetes, and cancer. (springer.com)
- COMMENT This compelling report provides cDNA microarray and RT-PCR evidence that a premature aging disorder, Werner syndrome (WS), closely resembles the expression profile of normal aging in a cultured cell line. (alzforum.org)
Cockayne2
- Cockayne Syndrome is distinguished from WS by its characteristic neurological degeneration (optic atrophy, deafness, nervous system demyelination). (oncologynurseadvisor.com)
- Fig. 3: Xeroderma pigmentosum and Cockayne syndrome as examples of environmental impacts and genetics on DNA damage and repair. (nature.com)
Congenital2
- Herlyn-Werner-Wunderlich (HWW) syndrome is a rare congenital malformation syndrome that is characterized by a triad of uterine didelphys, blind hemivagina, and ipsilateral renal agenesis. (bvsalud.org)
- Generalized lipoatrophy, also known as Lawrence-Seip syndrome, is a rare group of syndromes, either acquired or congenital, characterized by a near-complete absence of fat. (medscape.com)
Diseases5
- The advances in pluripotent stem cell and gene editing techniques have opened a new avenue to study the pathogenesis of human premature aging syndromes and aging-related diseases (Fu et al. (springer.com)
- Werner syndrome (also called progeria) is a hereditary condition associated with premature aging and an increased risk of cancer and other diseases. (cancermedicines.in)
- Markedly elevated levels establish the diagnosis, but mild elevations may occur with short bowel syndrome and inflammatory diseases. (merckmanuals.com)
- The syndrome causes wrinkly skin and greying hair at a young age, along with a significantly greater risk of diseases such as cancer. (scotsman.com)
- Diseases associated with RECQL include Werner Syndrome and Rothmund-Thomson Syndrome . (genecards.org)
Senescence1
- These results were published in PLOS ONE in an article entitled "Reprogramming Suppresses Premature Senescence Phenotypes of Werner Syndrome Cells and Maintains Chromosomal Stability over Long-Term Culture. (stemcellclinic.net)
Metabolism1
- Vascular risk does not exist in isolation, and is accompanied by alterations in hormonal metabolism and metabolic syndromes . (fightaging.org)
Type of progeroid syndrome1
- Werner syndrome (WS) is a type of progeroid syndrome characterized by the development of premature aging. (oncologynurseadvisor.com)
Symptoms6
- The parents of an individual with Werner syndrome each carry one copy of the mutated gene, but they typically do not show signs and symptoms of the condition. (medlineplus.gov)
- The signs and symptoms of Werner syndrome do not usually appear until the teens. (nih.gov)
- Not everyone with Werner syndrome will have all of these symptoms. (nih.gov)
- Werner syndrome (WS) is an autosomal recessive condition characterized by an early onset of age-related symptoms that include ocular cataracts, premature graying and loss of hair, arteriosclerosis and atherosclerosis, diabetes mellitus, osteoporosis, and a high incidence of some types of cancers. (sciencemag.org)
- It is a syndrome that occurs when the symptoms of concussion are prolonged. (healthtap.com)
- What are the symptoms of hantavirus pulmonary syndrome (hps)? (healthtap.com)
Cataracts2
- The diagnosis of Werner syndrome is established in a proband with the following cardinal signs: bilateral ocular cataracts, premature graying and/or thinning of scalp hair, characteristic dermatologic pathology, and short stature. (nih.gov)
- WRN is a rare autosomal recessive progeroid syndrome characterized by the premature onset of multiple age-related disorders, including atherosclerosis, cancer, non-insulin-dependent diabetes mellitus, ocular cataracts and osteoporosis. (abcam.cn)
Disorder4
- Finally, Rothmund-Thomson syndrome patients may display progeroid features but differs from WS in that it is a childhood onset disorder wth distinctive cutaneous features consisting of telangiectasias, poikiloderma, and scaling. (oncologynurseadvisor.com)
- Werner disease - hereditary disorder characterized by premature aging. (thefreedictionary.com)
- Werner Syndrome is a rare genetic disorder associated with premature aging . (symptoma.com)
- Polycystic ovary syndrome (PCOS) is the leading cause of infertility among women in the US and the most common endocrine disorder among women. (cwu.edu)
Phenotypes2
- Patients with Werner syndrome (WS) show a wide range of premature aging phenotypes accompanied by rare tumors ( 1 ). (spandidos-publications.com)
- Major phenotypes of Werner syndrome. (spandidos-publications.com)
Segmental1
- Segmental progeria, which is more frequently associated with the term progeroid syndrome , tends to affect multiple or all tissues while causing affected individuals to exhibit only some of the features associated with aging. (wikipedia.org)
Hereditary1
- This graph depicts the general finding of a low relative risk associated with common, low-penetrance genetic variants, such as single-nucleotide polymorphisms identified in genome-wide association studies, and a higher relative risk associated with rare, high-penetrance genetic variants, such as pathogenic variants in the BRCA1 / BRCA2 genes associated with hereditary breast and ovarian cancer and the mismatch repair genes associated with Lynch syndrome. (cancer.gov)
Pathology3
- Werner is also a long-time Massage & Bodywork columnist, most notably of the Pathology Perspectives column. (abmp.com)
- Werner is also ABMP's partner on Pocket Pathology, a web-based app and quick reference program that puts key information for nearly 200 common pathologies at your fingertips. (abmp.com)
- 0:01:13.6 Ruth Werner: Hi, and welcome to I Have A Client Who, pathology conversations with Ruth Werner. (abmp.com)
Watery diarrhea1
- Hypermotility, watery diarrhea syndromes with hypokalemia and hypochloremia or hyperchloremia, dehydration. (mhmedical.com)
Occurs3
- onset in early childhood, and Werner syndrome (adult progeria), which occurs later in life. (britannica.com)
- This syndrome occurs more often in Japan, affecting 1 in 20,000 to 1 in 40,000 people. (medlineplus.gov)
- Flushing similar to that of carcinoid syndrome occurs in 20% of patients during attacks of diarrhea. (merckmanuals.com)
Onset1
- Werner syndrome is one type of progeria (premature aging syndromes), often called adult onset progeria because it doesn't show up until adulthood. (healthtap.com)
Progeria and Werner syndrome2
- Speculate on how the Hayflick limit may lead to genetic disorders such as progeria and Werner syndrome. (bartleby.com)
- Are progeria and werner syndrome the same? (healthtap.com)
Diagnosis of Werner syndrome4
- Note: Percent frequencies are derived from individuals with a diagnosis of Werner syndrome confirmed by molecular testing. (nih.gov)
- The diagnosis of Werner syndrome is established in a proband who has all four cardinal signs and two additional signs (definite) or the first three cardinal signs and two additional signs (probable). (nih.gov)
- Currently, the diagnosis of Werner syndrome is suspected if someone has several of the features that have been reported in people with this condition. (cancermedicines.in)
- Guidelines for the diagnosis of Werner syndrome have been proposed but may change over time as more is learned about this condition. (cancermedicines.in)
Cancers1
- [ 8 ] Specific cancers associated with Costello syndrome in children include rhabdomyosarcoma, neuroblastoma and transitional cell carcinoma of the bladder. (medscape.com)
Metabolic2
Late forties or early fifties1
- Most people with the syndrome live to their late forties or early fifties. (scotsman.com)
Causes Werner syndrome2
- What causes Werner syndrome? (cancermedicines.in)
- Professor Juan Carlos Izpisua Belmonte, from the institue's Gene Expression Laboratory, explained: "Our findings show that the gene mutation that causes Werner syndrome results in the disorganisation of heterochromatin, and that this disruption of normal DNA packaging is a key driver of ageing. (scotsman.com)
Individuals with Werner4
- Individuals with Werner syndrome develop normally until the end of the first decade. (nih.gov)
- the mean age of death in individuals with Werner syndrome is 54 years. (nih.gov)
- Established in 1986, IRWS works to ascertain and genotype individuals with Werner syndrome from around the world and to establish and cryopreserve cell lines from affected individuals. (rarediseases.org)
- Individuals with Werner syndrome usually notice the first signs of rapid aging during their twenties. (diseaseinfosearch.org)
Cancer predisposition1
- Werner syndrome is characterized by the premature appearance of features associated with normal aging and cancer predisposition. (nih.gov)
Cells4
- Microwave-assisted Suzuki-Miyaura cross-coupling reactions have been employed towards the synthesis of three different MAPKAPK2 (MK2) inhibitors to study accelerated aging in Werner syndrome (WS) cells, including the cross-coupling of a 2-chloroquinoline with a 3-pyridinylboronic acid, the coupling of an aryl bromide with an indolylboronic acid and the reaction of a 3-amino-4-bromopyrazole with 4-carbamoylphenylboronic acid. (mdpi.com)
- Bagley MC, Baashen M, Chuckowree I, Dwyer JE, Kipling D, Davis T. Microwave-Assisted Synthesis of a MK2 Inhibitor by Suzuki-Miyaura Coupling for Study in Werner Syndrome Cells. (mdpi.com)
- The iPS cells that we have established will provide an opportunity for drug discovery for the treatment of Werner syndrome and also help with better understanding of the mechanism of this disease. (stemcellclinic.net)
- So what we have is a model system based on Drosophila where we've taken out the Werner gene, and those cells are very interesting because as cells divide, the DNA condenses down into chromosomes and those chromosomes separate to form new daughter nuclei. (abc.net.au)