Werner Syndrome: An autosomal recessive disorder that causes premature aging in adults, characterized by sclerodermal skin changes, cataracts, subcutaneous calcification, muscular atrophy, a tendency to diabetes mellitus, aged appearance of the face, baldness, and a high incidence of neoplastic disease.RecQ Helicases: A family of structurally-related DNA helicases that play an essential role in the maintenance of genome integrity. RecQ helicases were originally discovered in E COLI and are highly conserved across both prokaryotic and eukaryotic organisms. Genetic mutations that result in loss of RecQ helicase activity gives rise to disorders that are associated with CANCER predisposition and premature aging.Exodeoxyribonucleases: A family of enzymes that catalyze the exonucleolytic cleavage of DNA. It includes members of the class EC 3.1.11 that produce 5'-phosphomonoesters as cleavage products.DNA Helicases: Proteins that catalyze the unwinding of duplex DNA during replication by binding cooperatively to single-stranded regions of DNA or to short regions of duplex DNA that are undergoing transient opening. In addition DNA helicases are DNA-dependent ATPases that harness the free energy of ATP hydrolysis to translocate DNA strands.Syndrome: A characteristic symptom complex.Exonucleases: Enzymes that catalyze the release of mononucleotides by the hydrolysis of the terminal bond of deoxyribonucleotide or ribonucleotide chains.Aging, Premature: Changes in the organism associated with senescence, occurring at an accelerated rate.4-Nitroquinoline-1-oxide: A potent mutagen and carcinogen. This compound and its metabolite 4-HYDROXYAMINOQUINOLINE-1-OXIDE bind to nucleic acids. It inactivates bacteria but not bacteriophage.Progeria: An abnormal congenital condition, associated with defects in the LAMIN TYPE A gene, which is characterized by premature aging in children, where all the changes of cell senescence occur. It is manifested by premature greying; hair loss; hearing loss (DEAFNESS); cataracts (CATARACT); ARTHRITIS; OSTEOPOROSIS; DIABETES MELLITUS; atrophy of subcutaneous fat; skeletal hypoplasia; elevated urinary HYALURONIC ACID; and accelerated ATHEROSCLEROSIS. Many affected individuals develop malignant tumors, especially SARCOMA.Bloom Syndrome: An autosomal recessive disorder characterized by telangiectatic ERYTHEMA of the face, photosensitivity, DWARFISM and other abnormalities, and a predisposition toward developing cancer. The Bloom syndrome gene (BLM) encodes a RecQ-like DNA helicase.Rothmund-Thomson Syndrome: An autosomal recessive syndrome occurring principally in females, characterized by the presence of reticulated, atrophic, hyperpigmented, telangiectatic cutaneous plaques, often accompanied by juvenile cataracts, saddle nose, congenital bone defects, disturbances in the growth of HAIR; NAILS; and TEETH; and HYPOGONADISM.Telomere: A terminal section of a chromosome which has a specialized structure and which is involved in chromosomal replication and stability. Its length is believed to be a few hundred base pairs.DNA Replication: The process by which a DNA molecule is duplicated.DNA Damage: Injuries to DNA that introduce deviations from its normal, intact structure and which may, if left unrepaired, result in a MUTATION or a block of DNA REPLICATION. These deviations may be caused by physical or chemical agents and occur by natural or unnatural, introduced circumstances. They include the introduction of illegitimate bases during replication or by deamination or other modification of bases; the loss of a base from the DNA backbone leaving an abasic site; single-strand breaks; double strand breaks; and intrastrand (PYRIMIDINE DIMERS) or interstrand crosslinking. Damage can often be repaired (DNA REPAIR). If the damage is extensive, it can induce APOPTOSIS.DNA: A deoxyribonucleotide polymer that is the primary genetic material of all cells. Eukaryotic and prokaryotic organisms normally contain DNA in a double-stranded state, yet several important biological processes transiently involve single-stranded regions. DNA, which consists of a polysugar-phosphate backbone possessing projections of purines (adenine and guanine) and pyrimidines (thymine and cytosine), forms a double helix that is held together by hydrogen bonds between these purines and pyrimidines (adenine to thymine and guanine to cytosine).Replication Protein A: A single-stranded DNA-binding protein that is found in EUKARYOTIC CELLS. It is required for DNA REPLICATION; DNA REPAIR; and GENETIC RECOMBINATION.Telomeric Repeat Binding Protein 2: A ubiquitously expressed telomere-binding protein that is present at TELOMERES throughout the cell cycle. It is a suppressor of telomere elongation and may be involved in stabilization of telomere length. It is structurally different from TELOMERIC REPEAT BINDING PROTEIN 1 in that it contains basic N-terminal amino acid residues.Adenosine Triphosphatases: A group of enzymes which catalyze the hydrolysis of ATP. The hydrolysis reaction is usually coupled with another function such as transporting Ca(2+) across a membrane. These enzymes may be dependent on Ca(2+), Mg(2+), anions, H+, or DNA.DNA Repair: The reconstruction of a continuous two-stranded DNA molecule without mismatch from a molecule which contained damaged regions. The major repair mechanisms are excision repair, in which defective regions in one strand are excised and resynthesized using the complementary base pairing information in the intact strand; photoreactivation repair, in which the lethal and mutagenic effects of ultraviolet light are eliminated; and post-replication repair, in which the primary lesions are not repaired, but the gaps in one daughter duplex are filled in by incorporation of portions of the other (undamaged) daughter duplex. Excision repair and post-replication repair are sometimes referred to as "dark repair" because they do not require light.Antigens, Nuclear: Immunologically detectable substances found in the CELL NUCLEUS.Mutation: Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.Fibroblasts: Connective tissue cells which secrete an extracellular matrix rich in collagen and other macromolecules.HeLa Cells: The first continuously cultured human malignant CELL LINE, derived from the cervical carcinoma of Henrietta Lacks. These cells are used for VIRUS CULTIVATION and antitumor drug screening assays.Genomic Instability: An increased tendency of the GENOME to acquire MUTATIONS when various processes involved in maintaining and replicating the genome are dysfunctional.Down Syndrome: A chromosome disorder associated either with an extra chromosome 21 or an effective trisomy for chromosome 21. Clinical manifestations include hypotonia, short stature, brachycephaly, upslanting palpebral fissures, epicanthus, Brushfield spots on the iris, protruding tongue, small ears, short, broad hands, fifth finger clinodactyly, Simian crease, and moderate to severe INTELLECTUAL DISABILITY. Cardiac and gastrointestinal malformations, a marked increase in the incidence of LEUKEMIA, and the early onset of ALZHEIMER DISEASE are also associated with this condition. Pathologic features include the development of NEUROFIBRILLARY TANGLES in neurons and the deposition of AMYLOID BETA-PROTEIN, similar to the pathology of ALZHEIMER DISEASE. (Menkes, Textbook of Child Neurology, 5th ed, p213)Cell Aging: The decrease in the cell's ability to proliferate with the passing of time. Each cell is programmed for a certain number of cell divisions and at the end of that time proliferation halts. The cell enters a quiescent state after which it experiences CELL DEATH via the process of APOPTOSIS.Metabolic Syndrome X: A cluster of metabolic risk factors for CARDIOVASCULAR DISEASES and TYPE 2 DIABETES MELLITUS. The major components of metabolic syndrome X include excess ABDOMINAL FAT; atherogenic DYSLIPIDEMIA; HYPERTENSION; HYPERGLYCEMIA; INSULIN RESISTANCE; a proinflammatory state; and a prothrombotic (THROMBOSIS) state. (from AHA/NHLBI/ADA Conference Proceedings, Circulation 2004; 109:551-556)DNA-Binding Proteins: Proteins which bind to DNA. The family includes proteins which bind to both double- and single-stranded DNA and also includes specific DNA binding proteins in serum which can be used as markers for malignant diseases.DNA, Single-Stranded: A single chain of deoxyribonucleotides that occurs in some bacteria and viruses. It usually exists as a covalently closed circle.Chromosomes, Human, Pair 8: A specific pair of GROUP C CHROMOSOMES of the human chromosome classification.Protein Binding: The process in which substances, either endogenous or exogenous, bind to proteins, peptides, enzymes, protein precursors, or allied compounds. Specific protein-binding measures are often used as assays in diagnostic assessments.Protein Structure, Tertiary: The level of protein structure in which combinations of secondary protein structures (alpha helices, beta sheets, loop regions, and motifs) pack together to form folded shapes called domains. Disulfide bridges between cysteines in two different parts of the polypeptide chain along with other interactions between the chains play a role in the formation and stabilization of tertiary structure. Small proteins usually consist of only one domain but larger proteins may contain a number of domains connected by segments of polypeptide chain which lack regular secondary structure.Lamin Type A: A subclass of developmentally regulated lamins having a neutral isoelectric point. They are found to disassociate from nuclear membranes during mitosis.Optic Nerve: The 2nd cranial nerve which conveys visual information from the RETINA to the brain. The nerve carries the axons of the RETINAL GANGLION CELLS which sort at the OPTIC CHIASM and continue via the OPTIC TRACTS to the brain. The largest projection is to the lateral geniculate nuclei; other targets include the SUPERIOR COLLICULI and the SUPRACHIASMATIC NUCLEI. Though known as the second cranial nerve, it is considered part of the CENTRAL NERVOUS SYSTEM.Medical Oncology: A subspecialty of internal medicine concerned with the study of neoplasms.Iliac Artery: Either of two large arteries originating from the abdominal aorta; they supply blood to the pelvis, abdominal wall and legs.Phosphodiesterase I: A phosphoric diester hydrolase that removes 5'-nucleotides from the 3'-hydroxy termini of 3'-hydroxy-terminated OLIGONUCLEOTIDES. It has low activity towards POLYNUCLEOTIDES and the presence of 3'-phosphate terminus on the substrate may inhibit hydrolysis.Zebrafish: An exotic species of the family CYPRINIDAE, originally from Asia, that has been introduced in North America. They are used in embryological studies and to study the effects of certain chemicals on development.Play Therapy: A treatment technique utilizing play as a medium for expression and communication between patient and therapist.ArchivesBiological Science Disciplines: All of the divisions of the natural sciences dealing with the various aspects of the phenomena of life and vital processes. The concept includes anatomy and physiology, biochemistry and biophysics, and the biology of animals, plants, and microorganisms. It should be differentiated from BIOLOGY, one of its subdivisions, concerned specifically with the origin and life processes of living organisms.Periodicals as Topic: A publication issued at stated, more or less regular, intervals.PubMed: A bibliographic database that includes MEDLINE as its primary subset. It is produced by the National Center for Biotechnology Information (NCBI), part of the NATIONAL LIBRARY OF MEDICINE. PubMed, which is searchable through NLM's Web site, also includes access to additional citations to selected life sciences journals not in MEDLINE, and links to other resources such as the full-text of articles at participating publishers' Web sites, NCBI's molecular biology databases, and PubMed Central.Directories as Topic: Lists of persons or organizations, systematically arranged, usually in alphabetic or classed order, giving address, affiliations, etc., for individuals, and giving address, officers, functions, and similar data for organizations. (ALA Glossary of Library and Information Science, 1983)Heterochromatin: The portion of chromosome material that remains condensed and is transcriptionally inactive during INTERPHASE.Embryonic Stem Cells: Cells derived from the BLASTOCYST INNER CELL MASS which forms before implantation in the uterine wall. They retain the ability to divide, proliferate and provide progenitor cells that can differentiate into specialized cells.Stem Cells: Relatively undifferentiated cells that retain the ability to divide and proliferate throughout postnatal life to provide progenitor cells that can differentiate into specialized cells.Euchromatin: Chromosome regions that are loosely packaged and more accessible to RNA polymerases than HETEROCHROMATIN. These regions also stain differentially in CHROMOSOME BANDING preparations.Insulin-Like Growth Factor I: A well-characterized basic peptide believed to be secreted by the liver and to circulate in the blood. It has growth-regulating, insulin-like, and mitogenic activities. This growth factor has a major, but not absolute, dependence on GROWTH HORMONE. It is believed to be mainly active in adults in contrast to INSULIN-LIKE GROWTH FACTOR II, which is a major fetal growth factor.Insulin-Like Growth Factor II: A well-characterized neutral peptide believed to be secreted by the LIVER and to circulate in the BLOOD. It has growth-regulating, insulin-like and mitogenic activities. The growth factor has a major, but not absolute, dependence on SOMATOTROPIN. It is believed to be a major fetal growth factor in contrast to INSULIN-LIKE GROWTH FACTOR I, which is a major growth factor in adults.Somatomedins: Insulin-like polypeptides made by the liver and some fibroblasts and released into the blood when stimulated by SOMATOTROPIN. They cause sulfate incorporation into collagen, RNA, and DNA synthesis, which are prerequisites to cell division and growth of the organism.Recombinant Proteins: Proteins prepared by recombinant DNA technology.Insulin-Like Growth Factor Binding Proteins: A family of soluble proteins that bind insulin-like growth factors and modulate their biological actions at the cellular level. (Int J Gynaecol Obstet 1992;39(1):3-9)Bone Density: The amount of mineral per square centimeter of BONE. This is the definition used in clinical practice. Actual bone density would be expressed in grams per milliliter. It is most frequently measured by X-RAY ABSORPTIOMETRY or TOMOGRAPHY, X RAY COMPUTED. Bone density is an important predictor for OSTEOPOROSIS.
The Saccharomyces cerevisiae Sgs1 helicase efficiently unwinds G-G paired DNAs. (1/250)
The Saccharomyces cerevisiae Sgs1p helicase localizes to the nucleolus and is required to maintain the integrity of the rDNA repeats. Sgs1p is a member of the RecQ DNA helicase family, which also includes Schizo-saccharomyces pombe Rqh1, and the human BLM and WRN genes. These genes encode proteins which are essential to maintenance of genomic integrity and which share a highly conserved helicase domain. Here we show that recombinant Sgs1p helicase efficiently unwinds guanine-guanine (G-G) paired DNA. Unwinding of G-G paired DNA is ATP- and Mg2+-dependent and requires a short 3' single-stranded tail. Strikingly, Sgs1p unwinds G-G paired substrates more efficiently than duplex DNAs, as measured either in direct assays or by competition experiments. Sgs1p efficiently unwinds G-G paired telomeric sequences, suggesting that one function of Sgs1p may be to prevent telomere-telomere interactions which can lead to chromosome non-disjunction. The rDNA is G-rich and has considerable potential for G-G pairing. Diminished ability to unwind G-G paired regions may also explain the deleterious effect of mutation of Sgs1 on rDNA stability, and the accelerated aging characteristic of yeast strains that lack Sgs1 as well as humans deficient in the related WRN helicase. (+info)Human werner syndrome DNA helicase unwinds tetrahelical structures of the fragile X syndrome repeat sequence d(CGG)n. (2/250)
Formation of hairpin and tetrahelical structures by a d(CGG) trinucleotide repeat sequence is thought to cause expansion of this sequence and to engender fragile X syndrome. Here we show that human Werner syndrome DNA helicase (WRN), a member of the RecQ family of helicases, efficiently unwinds G'2 bimolecular tetraplex structures of d(CGG)7. Unwinding of d(CGG)7 by WRN requires hydrolyzable ATP and Mg2+ and is proportional to the amount of added helicase and to the time of incubation. The efficiencies of unwinding of G'2 d(CGG)7 tetraplex with 7 nucleotide-long single-stranded tails at their 3' or 5' ends are, respectively, 3.5- and 2-fold greater than that of double-stranded DNA. By contrast, WRN is unable to unwind a blunt-ended d(CGG)7 tetraplex, bimolecular tetraplex structures of a telomeric sequence 5'-d(TAGACATG(TTAGGG)2TTA)-3', or tetramolecular quadruplex forms of an IgG switch region sequence 5'-d(TACAGGGGAGCTGGGGTAGA)-3'. The ability of WRN to selectively unwind specific tetrahelices may reflect a specific role of this helicase in DNA metabolism. (+info)Werner syndrome helicase contains a 5'-->3' exonuclease activity that digests DNA and RNA strands in DNA/DNA and RNA/DNA duplexes dependent on unwinding. (3/250)
We show that WRN helicase contains a unique 5'-->3' exonuclease activity in the N-terminal region. Adeletion mutant lacking 231 N-terminal amino acid residues, made in a baculovirus system, did nothave this activity, while it showed ATPase and DNA helicase activities. This exonuclease activity was co-precipitated with the helicase activity using monoclonal antibodies specific to WRN helicase, indicating that it is an integral component with WRN helicase. The exonuclease in WRN helicase does not digest free single-stranded DNA or RNA, but it digests a strand in the duplex DNA or an RNA strand in a RNA/DNA heteroduplex in a 5'-->3' direction dependent on duplex unwinding. The digestion products were identified as 5'-mononucleotides. Our data show that WRN helicase needs a single-stranded 3' overhang region for efficient binding and unwinding of duplex molecules, while blunt-ended or 5' overhang duplex molecules were hardly unwound. These findings suggest that the WRN helicase and integral 5'-->3' exonuclease activities are involved in preventing a hyper-recombination by resolving entangled structures of DNA and RNA/DNA heteroduplexes that may be generated during rep-lication, repair and/or transcription. (+info)p53-mediated apoptosis is attenuated in Werner syndrome cells. (4/250)
The WRN DNA helicase is a member of the DExH-containing DNA helicase superfamily that includes XPB, XPD, and BLM. Mutations in WRN are found in patients with the premature aging and cancer susceptibility syndrome known as Werner syndrome (WS). p53 binds to the WRN protein in vivo and in vitro through its carboxyl terminus. WS fibroblasts have an attenuated p53- mediated apoptotic response, and this deficiency can be rescued by expression of wild-type WRN. These data support the hypothesis that p53 can induce apoptosis through the modulation of specific DExH-containing DNA helicases and may have implications for the cancer predisposition observed in WS patients. (+info)The Werner syndrome protein is involved in RNA polymerase II transcription. (5/250)
Werner syndrome (WS) is a human progeroid syndrome characterized by the early onset of a large number of clinical features associated with the normal aging process. The complex molecular and cellular phenotypes of WS involve characteristic features of genomic instability and accelerated replicative senescence. The gene involved (WRN) was recently cloned, and its gene product (WRNp) was biochemically characterized as a helicase. Helicases play important roles in a variety of DNA transactions, including DNA replication, transcription, repair, and recombination. We have assessed the role of the WRN gene in transcription by analyzing the efficiency of basal transcription in WS lymphoblastoid cell lines that carry homozygous WRN mutations. Transcription was measured in permeabilized cells by [3H]UTP incorporation and in vitro by using a plasmid template containing the RNA polymerase II (RNA pol II)-dependent adenovirus major late promoter. With both of these approaches, we find that the transcription efficiency in different WS cell lines is reduced to 40-60% of the transcription in cells from normal individuals. This defect can be complemented by the addition of normal cell extracts to the chromatin of WS cells. Addition of purified wild-type WRNp but not mutated WRNp to the in vitro transcription assay markedly stimulates RNA pol II-dependent transcription carried out by nuclear extracts. A nonhelicase domain (a direct repeat of 27 amino acids) also appears to have a role in transcription enhancement, as revealed by a yeast hybrid-protein reporter assay. This is further supported by the lack of stimulation of transcription when mutant WRNp lacking this domain was added to the in vitro assay. We have thus used several approaches to show a role for WRNp in RNA pol II transcription, possibly as a transcriptional activator. A deficit in either global or regional transcription in WS cells may be a primary molecular defect responsible for the WS clinical phenotype. (+info)Physical and functional interaction between p53 and the Werner's syndrome protein. (6/250)
Werner's syndrome is a human autosomal recessive disorder leading to premature aging. The mutations responsible for this disorder have recently been localized to a gene (WRN) encoding a protein that possesses DNA helicase and exonuclease activities. Patients carrying WRN gene mutations exhibit an elevated rate of cancer, accompanied by increased genomic instability. The latter features are also characteristic of the loss of function of p53, a tumor suppressor that is very frequently inactivated in human cancer. Moreover, changes in the activity of p53 have been implicated in the onset of cellular replicative senescence. We report here that the WRN protein can form a specific physical interaction with p53. This interaction involves the carboxyl-terminal part of WRN and the extreme carboxyl terminus of p53, a region that plays an important role in regulating the functional state of p53. A small fraction of WRN can be found in complex with endogenous p53 in nontransfected cells. Overexpression of WRN leads to augmented p53-dependent transcriptional activity and induction of p21(Waf1) protein expression. These findings support the existence of a cross-talk between WRN and p53, which may be important for maintaining genomic integrity and for preventing the accumulation of aberrations that can give rise to premature senescence and cancer. (+info)Mut-7 of C. elegans, required for transposon silencing and RNA interference, is a homolog of Werner syndrome helicase and RNaseD. (7/250)
While all known natural isolates of C. elegans contain multiple copies of the Tc1 transposon, which are active in the soma, Tc1 transposition is fully silenced in the germline of many strains. We mutagenized one such silenced strain and isolated mutants in which Tc1 had been activated in the germline ("mutators"). Interestingly, many other transposons of unrelated sequence had also become active. Most of these mutants are resistant to RNA interference (RNAi). We found one of the mutated genes, mut-7, to encode a protein with homology to RNaseD. This provides support for the notion that RNAi works by dsRNA-directed, enzymatic RNA degradation. We propose a model in which MUT-7, guided by transposon-derived dsRNA, represses transposition by degrading transposon-specific messengers, thus preventing transposase production and transposition. (+info)Requirement of yeast SGS1 and SRS2 genes for replication and transcription. (8/250)
The SGS1 gene of the yeast Saccharomyces cerevisiae encodes a DNA helicase with homology to the human Bloom's syndrome gene BLM and the Werner's syndrome gene WRN. The SRS2 gene of yeast also encodes a DNA helicase. Simultaneous deletion of SGS1 and SRS2 is lethal in yeast. Here, using a conditional mutation of SGS1, it is shown that DNA replication and RNA polymerase I transcription are drastically inhibited in the srs2Delta sgs1-ts strain at the restrictive temperature. Thus, SGS1 and SRS2 function in DNA replication and RNA polymerase I transcription. These functions may contribute to the various defects observed in Werner's and Bloom's syndromes. (+info)
Genome-wide DNA methylation analysis in blood cells from patients with Werner syndrome | Clinical Epigenetics | Full Text
Werner Syndrome | Cancer.Net
Metabolism of acetylated low density lipoproteins by monocyte-derived macrophages from patients with Werner's syndrome. |...
Werner's syndrome protein (WRN) migrates Holliday junctions and co‐localizes with RPA upon replication arrest | EMBO Reports
Werner syndrome | pathology | Britannica
Werner syndrome
The Werner Syndrome Helicase-Nuclease--One Protein, Many Mysteries -- Fry 2002 (13): 2 -- <i>Science</i...
CellNEWS: Establishment of Induced Pluripotent Stem Cells from Werner Syndrome Fibroblasts
A Werner syndrome stem cell model unveils heterochromatin alterations as a driver of human aging | Science
Werner Syndrome
ATYPICAL WERNER SYNDROME | MENDELIAN.CO
The expression of proliferation-dependent antigens during the lifespan of normal and progeroid human fibroblasts in culture |...
Gerhard Werner - Wikipedia
Lack of WRN Results in Extensive Deletion at Nonhomologous Joining Ends - PubMed
Progeria: Werner's Syndrome | HubPages
Database of WS-associated WRN mutations
Blood Flow & Glaucoma - Glaucoma Service Foundation to Prevent Blindness
Werner's Syndrome (Progeria of the Adult)
Werner syndrome - ONA
Dr. Marc Werner, MD - Ophthalmologist in Garden City, NY
Dr. Paul Werner, MD - Vascular Surgeon in Milwaukee, WI
komakino fanzine - Werner - what color should be the record we do
Werner Paddles KALLISTE STRAIGHT STD 1 PC Made to Order Kayak Paddles Free Shipping, Free Awesomeness: Werner Paddles Kayak...
File aaa base.changes of Package aaa base.import4464 -
openSUSE Build Service
'werner syndrome' Protocols and Video...
Shimizu, Kenji - OU Author List - OKAYAMA UNIVERSITY SCIENTIFIC ACHIEVEMENT REPOSITORY
Human Knee Hinge Joint Showing Bones and Muscles Photographic Print by Carol & Mike Werner at AllPosters.com
Werner Siemens Foundation fosters synthetic biotechnology | EurekAlert! Science News
Werner receives $75,000 grant from Research to Prevent Blindness
RE: ma-ont RDF latest version from Bailer, Werner on 2010-10-14 ([email protected] from October 2010)
"Virus oncogenes des animaux de laboratoire et recherche de produits an" by Y De ratuld and G H. Werner
Werner K. Doyle | NYU Langone Health
CAMPO SAN VIO, VENICE - JAMES LEE BYARS: THE GOLDEN TOWER - News - Michael Werner Gallery
Paddle Details | Werner Paddles
Companies Related to: Temperature-Sensitive Goods, Food Logistics, Transportation Infrastructure - Inbound Logistics
Lo And Behold, Reveries of the Connected World review (2016) Werner
Herzog - Qwipster's Movie Reviews
Author: Abdool Karim, Salim and Werner, Lise / Academic Unit: Epidemiology / Subject: Virology | Search Results | Academic...
Protocols and Video Articles Authored by Werner J. H. Koopman
Fall Protection | Harnesses | Werner® H332105 LITEFIT Construction Harness, Tongue Buckle Legs, 2XL | B1646142 -...
Werner Kalliste Performance Tour Carbon Blade Sea Kayak Paddle | Kayak Academy
Werner follows Broughton as Liverpool chairman | Football News
Reviews | Dr. Christine Werner, MD | Bellevue, WA | Obstetrician & Gynecologist
Dr. Michael Werner, MD - Kaukauna, WI - Family Medicine | Healthgrades.com
Illustration of the Axon Tip of a Neuron Sending an Electrical Impulse Photographic Print by Carol & Mike Werner at AllPosters...
Werner Herzog's Cave of Forgotten Dreams Review | EW.com
Abscesses and Antibiotics, Here We Go Again! | To the Point: Clinical Reviews | AccessEmergency Medicine | McGraw-Hill Medical
TEAD4, YAP1 and WWTR1 Prevent the Premature Onset of Pluripotency Prior to the 16-cell Stage - PubMed
Carsten Werner gives keynote at Life Science Technology Day 2019 of KTH Royal Institute of Technology, Stockholm | Leibniz...
Browsing by Author "Werner Braun"
Michael A. Werner, MD, FACS | SexHealthMatters.org
British Society for Research on Ageing
Instituto Nacional de Medicina Genómica
DNA polymerase beta
Kostniakomięsak, wolna encyklopedia
پرتو کیهانی - ویکیپدیا، دانشنامهٔ آزاد
Asma bahasa Indonesia, ensiklopedia bebas
Trimetilamina bahasa Indonesia, ensiklopedia bebas
Discrimination based on skin color
Histone acetyltransferase
Diabetes insipidus
Werner syndrome: MedlinePlus GeneticsWerner Syndrome Medical Definition | Merriam-Webster Medical Dictionary
From Special Olympian To High Fashion Model, Chelsea Werner Defies All Down Syndrome Stereotypes
International Registry of Werner Syndrome - NORD (National Organization for Rare Disorders)
Vitamin C alleviates aging defects in a stem cell model for Werner syndrome | SpringerLink
Werner's Syndrome | Annals of Internal Medicine | American College of Physicians
Anti-Werner's syndrome helicase WRN antibody (ab200) | Abcam
'werner syndrome' Protocols and Video...
WRN, the Werner Syndrome Gene, Exhibits Frameshift Mutations in Gastric and Colorectal Cancers. - PubMed - NCBI
Atypical Werner syndrome | definition of Atypical Werner syndrome by Medical dictionary
Interstitial Lung Disease in Werner Syndrome: A Case Report of a 55-Year-Old Male Patient
Inhibition of helicase activity by a small molecule impairs Werner syndrome helicase (WRN) function in the cellular response to...
Homologous Recombination Resolution Defect in Werner Syndrome | Molecular and Cellular Biology
Pharmaceuticals | Free Full-Text | Microwave-Assisted Synthesis of a MK2 Inhibitor by Suzuki-Miyaura Coupling for Study in...
SGS1, a Homologue of the Bloom's and Werner's Syndrome Genes, Is Required for Maintenance of Genome Stability in Saccharomyces...
A Werner syndrome stem cell model unveils heterochromatin alterations as a driver of human aging | Science
A cascade leading to premature aging phenotypes including abnormal tumor profiles in Werner syndrome (Review)
Treating a Patient with the Werner Syndrome and Osteoporosis Using Recombinant Human Insulin-like Growth Factor | Annals of...
Werner syndrome helicase is a selective vulnerability of microsatellite instability-high tumor cells | eLife
Metabolism of acetylated low density lipoproteins by monocyte-derived macrophages from patients with Werner's syndrome. |...
The DNA repair endonuclease XPG interacts directly and functionally with the WRN helicase defective in Werner syndrome | Amrita...
The Werner Syndrome Helicase-Nuclease--One Protein, Many Mysteries -- Fry 2002 (13): 2 -- <i>Science</i...
HelicaseBloomMutationsAutosomal recessive disorderPredisposition syndromesHerlyn-Werner-Wunderlich SyndromeABSTRACTHutchinson-GilfordGeneProteinPremature aging diDefectsTumorRecQCockayneInstabilityOnsetPeople with Werner syndromeHereditarySymptomsClinicalType of progeroid syndromeFibroblastsSegmentalOccursGenesDiseasesPatient with the Werner SyndromeProgeria and Werner syndromeDiagnosis of Werner syndromePatients with Werner syndromeCancersSenescenceLate forties or early fiftiesPhenotypesLymphocytesMetabolismCauses Werner syndromeIndividuals with WernerChromosomalReplicationLipodystrophy
Helicase17
- Werner syndrome ATP-dependent helicase" also known as DNA helicase, RecQ-like type 3 is an enzyme that in humans is encoded by the WRN gene. (wikipedia.org)
- Defects of WRN, which encodes a DNA helicase responsible for maintaining genomic integrity, cause Werner syndrome. (thefreedictionary.com)
- An in vitro helicase activity screen was used to identify molecules that modulate DNA unwinding by Werner syndrome helicase (WRN), mutated in the premature aging disorder Werner syndrome. (pnas.org)
- A small molecule from the National Cancer Institute Diversity Set designated NSC 19630 [1-(propoxymethyl)-maleimide] was identified that inhibited WRN helicase activity but did not affect other DNA helicases [Bloom syndrome (BLM), Fanconi anemia group J (FANCJ), RECQ1, RecQ, UvrD, or DnaB). (pnas.org)
- Mutations in other human RecQ helicase genes have also been identified in patients with two other genetic instability and tumor predisposition syndromes, Bloom syndrome ( 12 ) and Rothmund-Thomson syndrome ( 24 , 26 ). (asm.org)
- This perspective review focused on the Werner syndrome (WS) by addressing the issue of how a single mutation in a WRN gene encoding WRN DNA helicase induces a wide range of premature aging phenotypes accompanied by an abnormal pattern of tumors. (spandidos-publications.com)
- WRN is a member of the RecQ helicase gene family, which includes RECQL1 ( 8 ), Bloom syndrome gene ( BLM ) ( 9 ), WRN ( 4 ), Rothmund-Thomson syndrome gene ( RTS/RECQL4 ) ( 10 ), and RECQL5 ( 11 ). (spandidos-publications.com)
- By leveraging recent functional screening data of cancer cell lines we identify Werner syndrome helicase (WRN) as a novel specific vulnerability of microsatellite instability-high (MSI-H) cancer cells. (elifesciences.org)
- The Werner Syndrome Helicase Coordinates Sequential Strand Displacement and FEN1-Mediated Flap Cleavage during Polymerase δ Elongation. (diseaseinfosearch.org)
- The Werner's Syndrome RecQ helicase/exonuclease at the nexus of cancer and aging. (cdc.gov)
- Dr. Akira Shimamoto and his collaborators analysed patient-derived iPS cells and found that telomeric abnormalities in the fibroblasts of these patients, which were caused by the lack of WRN helicase encoded by the gene responsible for Werner syndrome, were recovered in the iPS cells generated from these patients. (blogspot.se)
- Synthetic peptide within Human Werner's syndrome helicase WRN aa 1400-1500 (C terminal). (abcam.co.jp)
- The WRN gene encodes a 3′-5′ DNA helicase, and is a member of the RecQ family, which also includes the product of the Bloom's syndrome gene ( BLM ). (embopress.org)
- Werner syndrome is caused by a mutation to the RecQ helicase-like gene, known as the WRN gene for short, which generates protein. (scotsman.com)
- The Bloom syndrome gene product is related to the RecQ subset of DExH box-containing DNA helicases and has both DNA-stimulated ATPase and ATP-dependent DNA helicase activities. (genecards.org)
- Mutations causing Bloom syndrome delete or alter helicase motifs and may disable the 3'-5' helicase activity. (genecards.org)
- BLM (Bloom Syndrome RecQ Like Helicase) is a Protein Coding gene. (genecards.org)
Bloom6
- Mutations of BLM , WRN and RTS result in Bloom syndrome (BS), Werner syndrome (WS) and Rothmund-Thomson syndrome (RTS), respectively. (spandidos-publications.com)
- Examples of PS include Werner syndrome (WS), Bloom syndrome (BS), Rothmund-Thomson syndrome (RTS), Cockayne syndrome (CS), xeroderma pigmentosum (XP), trichothiodystrophy (TTD), combined xeroderma pigmentosum - Cockayne syndrome (XP-CS), restrictive dermopathy (RD), and Hutchinson-Gilford progeria syndrome (HGPS). (wikipedia.org)
- There are five genes encoding RecQ in humans (RECQ1-5), and defects in RECQL2/WRN, RECQL3/BLM and RECQL4 lead to Werner syndrome (WS), Bloom syndrome (BS), and Rothmund-Thomson syndrome (RTS), respectively. (wikipedia.org)
- Diseases associated with BLM include Bloom Syndrome and Werner Syndrome . (genecards.org)
- Werner syndrome and Bloom syndrome result from defects in the RecQ helicases Werner (WRN) and Bloom (BLM), respectively, and display premature aging phenotypes. (pnas.org)
- Furthermore, T-SCE-driven premature cellular senescence may be a factor contributing to accelerated aging in Werner and Bloom syndromes, but not XFE progeroid syndrome. (pnas.org)
Mutations17
- Mutations in the WRN gene cause Werner syndrome. (medlineplus.gov)
- Mutations in the WRN gene often lead to the production of an abnormally short, nonfunctional Werner protein. (medlineplus.gov)
- Researchers do not fully understand how WRN mutations cause the signs and symptoms of Werner syndrome. (medlineplus.gov)
- Mutations (alterations) in the WRN gene are known to cause Werner syndrome. (cancer.net)
- Mutations in the WRN gene are found in about 90% of people with Werner syndrome. (cancer.net)
- Werner syndrome is caused by mutations in the WRN gene. (wikipedia.org)
- Many of these mutations result in an abnormally shortened Werner protein. (wikipedia.org)
- Researchers are still determining how these mutations cause the appearance of premature aging seen in Werner syndrome. (wikipedia.org)
- WRN, the Werner Syndrome Gene, Exhibits Frameshift Mutations in Gastric and Colorectal Cancers. (nih.gov)
- Mutations in the Werner syndrome ( WRN ), Bloom's syndrome ( BLM ), and RecQ protein-like 4 ( RECQL4 ) genes are responsible for the human disorders Werner syndrome, Bloom's syndrome, and Rothmund-Thomson syndrome, respectively ( 3 ). (pnas.org)
- Werner patient mutations truncate the WRN open reading frame and promote loss of the altered protein and both of its associated biochemical activities ( 4 , 28 , 42 ). (asm.org)
- Werner syndrome is a rare autosomal recessive disorder, caused by mutations in the WRN gene. (diseaseinfosearch.org)
- One of the main causes of progeroid syndromes is genetic mutations , which lead to defects in the cellular processes which repair DNA . (wikipedia.org)
- Case report: A case of Werner syndrome with compound heterozygous mutations of WRN gene]. (cdc.gov)
- Costello syndrome is a clinically heterogeneous condition caused by sporadic mutations in HRAS , [ 8 ] in the Ras-mitogen-activated protein kinase (MAPK) pathway. (medscape.com)
- Mutations in the BLM gene lead to Bloom's syndrome. (embopress.org)
- The US researchers say genetic mutations which are a factor in Werner syndrome, a dramatic condition where sufferers age rapidly in early adulthood, could have wider implications for the medical profession. (scotsman.com)
Autosomal recessive disorder5
- Werner syndrome, a rare autosomal recessive disorder, is characterized by abnormally short stature in childhood and premature aging beginning in adolescence or early adulthood. (rarediseases.org)
- Werner syndrome is a rare autosomal recessive disorder characterized by clinical signs of premature aging, short stature , scleroderma-like skin changes, endocrine abnormalities, cataracts, and an increased incidence of malignancies. (symptoma.com)
- Werner syndrome (WS) is a rare autosomal recessive disorder. (wikipedia.org)
- Individuals affected by the autosomal recessive disorder Werner's syndrome (WS) develop many of the symptoms characteristic of premature ageing. (embopress.org)
- Werner's syndrome (WS) is a rare autosomal recessive disorder with multisystem manifestations of premature aging from the second decade of life. (who.int)
Predisposition syndromes2
- PGD has been in use for over 2 decades, and it has been used for several hereditary cancer predisposition syndromes. (cancer.net)
- Tumour predisposition syndromes in which cancers arise at an accelerated rate and in different organs - the equivalent of a sensitized background - provide a unique opportunity to examine how gene-environment interactions influence cancer risk when the initiating genetic defect responsible for malignancy is known. (nature.com)
Herlyn-Werner-Wunderlich Syndrome5
- Herlyn-Werner-Wunderlich syndrome is a very rare congenital genitourinary anomaly characterized by uterus didelphys, blind hemivagina and ipsilateral renal agenesis. (biomedcentral.com)
- Authors present a case of Herlyn-Werner-Wunderlich syndrome in a 19-year-old unmarried woman who presented with pelvic pain and pelvic mass. (biomedcentral.com)
- Herlyn-Werner-Wunderlich syndrome would be suspected in patients with unilateral absent kidney and pelvic mass. (biomedcentral.com)
- Schematic drawing of Herlyn-Werner-Wunderlich Syndrome (classification 2.2): duplication of the uterine bodies, endometrial canals, uterine cervices and vaginal canals, communication between two cervices, dilated right hemivagina and blinded ectopic right ureter (the mesonephric remnants). (biomedcentral.com)
- ABSTRACT We describe a Herlyn-Werner-Wunderlich syndrome (HWWS) patient with previous history of infertility who got pregnant without treatment and presented a pyometra in the contralateral uterus throughout the gestational period, despite multiple antibiotic treatments . (bvsalud.org)
ABSTRACT1
- abstract = "A case of Werner's Syndrome in a 47-year-old man, with typical features of pangeria associated with intracranial meningioma is described. (elsevier.com)
Hutchinson-Gilford9
- Kudlow BA, Kennedy BK, Monnat RJ Jr. Werner and Hutchinson-Gilford progeria syndromes: mechanistic basis of human progeroid diseases. (medlineplus.gov)
- It is a less known form of progeria but more common than Hutchinson - Gilford syndrome. (hubpages.com)
- Other premature aging syndromes are on the differential diagnosis of WS including Hutchinson-Gilford progeria syndrome, Cockayne syndrome, ataxia-telangiectasia, Rothmund-Thomson syndrome and mandibuloacral dysplasia. (oncologynurseadvisor.com)
- WS can be distinguished from Hutchinson-Gilford progeria syndrome by its later onset, presence of cataracts, hypogonadism, laryngeal atrophy, and osteosclerosis of the distal extremities. (oncologynurseadvisor.com)
- The term progeroid syndrome does not necessarily imply progeria ( Hutchinson-Gilford progeria syndrome ), which is a specific type of progeroid syndrome. (wikipedia.org)
- The most widely studied of the progeroid syndromes are Werner syndrome and Hutchinson-Gilford progeria, as they are seen to most resemble natural aging. (wikipedia.org)
- Early-passage cells from fetal, young, and old donors and cells from subjects with the Hutchinson-Gilford and Werner syndromes of accelerated aging had similar error frequencies. (nih.gov)
- Early-onset progeria is a rare genetic disease known as Hutchinson-Gilford progeria syndrome. (popularmechanics.com)
- Werner's syndrome is an inherited recessive trait, but Hutchinson-Gilford progeria syndrome is not passed down in families. (popularmechanics.com)
Gene15
- The WRN gene provides instructions for producing the Werner protein, which is thought to perform several tasks related to the maintenance and repair of DNA. (medlineplus.gov)
- The parents of an individual with Werner syndrome each carry one copy of the mutated gene, but they typically do not show signs and symptoms of the condition. (medlineplus.gov)
- Werner syndrome follows an autosomal recessive inheritance pattern, which means that a mutation must be present in both copies of the gene for a person to be affected. (cancer.net)
- Options exist for people interested in having a child when a prospective parent carries a gene mutation that increases the risk for this hereditary cancer syndrome. (cancer.net)
- The advances in pluripotent stem cell and gene editing techniques have opened a new avenue to study the pathogenesis of human premature aging syndromes and aging-related diseases (Fu et al. (springer.com)
- The Saccharomyces cerevisiae SGS1 gene is homologous to Escherichia coli RecQ and the human BLM and WRN proteins that are defective in the cancer-prone disorder Bloom's syndrome and the premature aging disorder Werner's syndrome, respectively. (genetics.org)
- In 1996, the gene responsible for the syndrome was positionally cloned. (sciencemag.org)
- If the WRN gene is changed (mutated), the individual's DNA becomes more prone to damage and leads to the various physical signs of Werner syndrome. (diseaseinfosearch.org)
- The map comprises a series of contigs mostly P1/PAC clones, which span the loci of potential tumor suppressor genes and the Werner's syndrome gene. (oup.com)
- Professor Juan Carlos Izpisua Belmonte, from the institue's Gene Expression Laboratory, explained: "Our findings show that the gene mutation that causes Werner syndrome results in the disorganisation of heterochromatin, and that this disruption of normal DNA packaging is a key driver of ageing. (scotsman.com)
- Stephen D. Ginsberg on Gene expression profiling in Werner syndrome closely resembles that of normal aging. (alzforum.org)
- COMMENT This convincing report provides integrated DNA, RNA, and protein data that is used for disease gene discovery in a rare form of a mitochondrial disorder named Leigh syndrome, an autosomal recessive cytochrome c deficiency. (alzforum.org)
- The Werner's syndrome gene is identified in people, yes. (abc.net.au)
- So what we have is a model system based on Drosophila where we've taken out the Werner gene, and those cells are very interesting because as cells divide, the DNA condenses down into chromosomes and those chromosomes separate to form new daughter nuclei. (abc.net.au)
- Defects in this gene are the cause of LIG4 syndrome. (cancerindex.org)
Protein14
- Evidence also suggests that the altered protein is broken down more quickly in the cell than the normal Werner protein. (medlineplus.gov)
- Cells with an altered Werner protein may divide more slowly or stop dividing earlier than normal, causing growth problems. (medlineplus.gov)
- Lee JW, Harrigan J, Opresko PL, Bohr VA. Pathways and functions of the Werner syndrome protein. (medlineplus.gov)
- Monnat RJ Jr, Saintigny Y. Werner syndrome protein--unwinding function to explain disease. (medlineplus.gov)
- Opresko PL, Calvo JP, von Kobbe C. Role for the Werner syndrome protein in the promotion of tumor cell growth. (medlineplus.gov)
- Further evidence suggests that Werner protein plays a critical role in repairing DNA. (wikipedia.org)
- This shortened protein may also be broken down too quickly, leading to a loss of Werner protein in the cell. (wikipedia.org)
- Without normal Werner protein in the nucleus, cells cannot perform the tasks of DNA replication, repair, and transcription. (wikipedia.org)
- Identification and Biochemical Characterization of a Werner's Syndrome Protein Complex with Ku70/80 and Poly(ADP-ribose) Polymerase-1. (sciencemag.org)
- Werner Syndrome Protein--Unwinding Function to Explain Disease. (sciencemag.org)
- The Werner syndrome protein (WRN) suppresses the loss of telomeres replicated by lagging-strand synthesis by a yet to be defined mechanism. (diseaseinfosearch.org)
- The genes newly found by the exon amplification method together with other known genes, including those of glutathion reductase, a general transcription factor, protein phosphatase 2A β subunit and Werner's syndrome, were precisely mapped within the contigs. (oup.com)
- Telomere ResQue and preservation--roles for the Werner syndrome protein and other RecQ helicases. (cdc.gov)
- When the protein is mutated in Werner syndrome it disrupts the replication and repair of DNA and the expression of genes, which was thought to cause premature ageing. (scotsman.com)
Premature aging di4
- Werner syndrome (WS) is a premature aging disorder that mainly affects tissues derived from mesoderm. (springer.com)
- 2013 ). Werner Syndrome (referred to as WS, also known as adult progeria) is a premature aging disorder with phenotypes such as grey hair, osteoporosis, diabetes, and cancer. (springer.com)
- Werner syndrome is a premature aging disorder that displays many clinical symptoms of aging at an accelerated rate ( 7 ). (pnas.org)
- COMMENT This compelling report provides cDNA microarray and RT-PCR evidence that a premature aging disorder, Werner syndrome (WS), closely resembles the expression profile of normal aging in a cultured cell line. (alzforum.org)
Defects3
- Defects in WRN are a cause of Werner syndrome (WRN) [MIM: (abcam.com)
- Some examples of DNA repair defects causing progeroid syndromes in humans or mice are shown in Table 1. (wikipedia.org)
- Similarly, XFE progeroid syndrome results from defects in the ERCC1-XPF DNA repair endonuclease. (pnas.org)
Tumor1
- A vipoma is a non-beta pancreatic islet cell tumor secreting vasoactive intestinal peptide (VIP), resulting in a syndrome of watery diarrhea, hypokalemia, and achlorhydria (WDHA syndrome). (merckmanuals.com)
RecQ1
- While recQ mutants are deficient in conjugational recombination and DNA repair, Bloom's syndrome cell lines show hyperrecombination. (genetics.org)
Cockayne2
- Cockayne Syndrome is distinguished from WS by its characteristic neurological degeneration (optic atrophy, deafness, nervous system demyelination). (oncologynurseadvisor.com)
- Fig. 3: Xeroderma pigmentosum and Cockayne syndrome as examples of environmental impacts and genetics on DNA damage and repair. (nature.com)
Instability5
- Werner syndrome (WRN) is an uncommon autosomal recessive disease whose phenotype includes features of premature aging, genetic instability, and an elevated risk of cancer. (asm.org)
- Further characterization of the clinical, pathological, and genetic aspects of this syndrome following Otto Werner's initial description has led to the recognition of Werner syndrome as an uncommon autosomal recessive disease whose phenotype includes features of premature aging, genetic instability, and an elevated risk of cancer ( 13 , 18 , 39 ). (asm.org)
- Bloom's and Werner's syndrome cell lines both exhibit chromosomal instability. (genetics.org)
- These findings suggest a correlation between chromosomal instability and the onset of neoplasms in Werner's Syndrome. (elsevier.com)
- Also covered are chromosome instability syndromes, mutagen-induced chromosome damage in lymphocytes and the role of cytogenetics in the assessment of haematological disorders. (booktopia.com.au)
Onset8
- onset in early childhood, and Werner syndrome (adult progeria), which occurs later in life. (britannica.com)
- WRN is a rare autosomal recessive progeroid syndrome characterized by the premature onset of multiple age-related disorders, including atherosclerosis, cancer, non-insulin-dependent diabetes mellitus, ocular cataracts and osteoporosis. (abcam.com)
- Finally, Rothmund-Thomson syndrome patients may display progeroid features but differs from WS in that it is a childhood onset disorder wth distinctive cutaneous features consisting of telangiectasias, poikiloderma, and scaling. (oncologynurseadvisor.com)
- A rare autosomal recessive progeroid syndrome (OMIM:277700) characterised by premature onset of multiple age-related disorders, including atherosclerosis, cancer, type-2 diabetes, ocular cataracts, osteoporosis, and death by age 47, often due to myocardial infarction. (thefreedictionary.com)
- Werner syndrome (WS) is a progeroid or premature aging syndrome characterized by early onset of age-related pathologies and cancer. (hindawi.com)
- Werner syndrome (WS) is an autosomal recessive condition characterized by an early onset of age-related symptoms that include ocular cataracts, premature graying and loss of hair, arteriosclerosis and atherosclerosis, diabetes mellitus, osteoporosis, and a high incidence of some types of cancers. (sciencemag.org)
- Werner's syndrome is sometimes called "adult-onset progeria. (popularmechanics.com)
- Werner syndrome is one type of progeria (premature aging syndromes), often called adult onset progeria because it doesn't show up until adulthood. (healthtap.com)
People with Werner syndrome4
- Many people with Werner syndrome have thin arms and legs and a thick trunk due to abnormal fat deposition. (medlineplus.gov)
- People with Werner syndrome usually live into their late forties or early fifties. (medlineplus.gov)
- One of the most significant health problems faced by people with Werner syndrome is the early development of various types of cancer and atherosclerosis, commonly known as hardening of the arteries, which can lead to a heart attack. (cancer.net)
- Types of cancers reported in people with Werner syndrome include thyroid cancer, melanoma, soft tissue sarcoma, and osteosarcoma (bone cancer). (cancermedicines.in)
Hereditary3
- Werner syndrome, also called progeria, is a hereditary condition associated with premature aging and an increased risk of cancer and other diseases. (cancer.net)
- Werner disease - hereditary disorder characterized by premature aging. (thefreedictionary.com)
- This graph depicts the general finding of a low relative risk associated with common, low-penetrance genetic variants, such as single-nucleotide polymorphisms identified in genome-wide association studies, and a higher relative risk associated with rare, high-penetrance genetic variants, such as pathogenic variants in the BRCA1 / BRCA2 genes associated with hereditary breast and ovarian cancer and the mismatch repair genes associated with Lynch syndrome. (cancer.gov)
Symptoms3
- Because WS patients have a longer lifespan than other progeroid syndromes, it is recommended for them to have a healthy lifestyle to delay its symptoms. (hubpages.com)
- It is a syndrome that occurs when the symptoms of concussion are prolonged. (healthtap.com)
- What are the symptoms of hantavirus pulmonary syndrome (hps)? (healthtap.com)
Clinical7
- The International Registry of Werner Syndrome (IRWS), associated with the Department of Pathology of the University of Washington, is a non-profit research organization dedicated to providing clinical and genetic information on Werner syndrome to healthcare professionals and researchers. (rarediseases.org)
- Finding the right clinical trial for Werner syndrome can be challenging. (diseaseinfosearch.org)
- Werner syndrome: a changing pattern of clinical manifestations in Japan (1917~2008). (cdc.gov)
- It used to be that the majority of islet cell tumors / pancreatic endocrine neoplasms that were discovered clinically were functional, indicating that they elaborate one or more hormonal products into the blood, leading to a recognizable clinical syndrome. (jhu.edu)
- By convention, functional islet cell tumors / endocrine neoplasms are named according to their predominant clinical syndrome and hormonal product. (jhu.edu)
- Patients with islet cell tumors / pancreatic endocrine neoplasms of the pancreas with no recognizable clinical syndrome and normal serum hormone levels are considered to have nonfunctional pancreatic endocrine tumors. (jhu.edu)
- German physician Otto Werner (1879-1936) described the clinical picture of this syndrome in 1904, in four sisters, defining the skin thin, tight, scleroderma-like, that mimics premature aging, with bilateral cataracts associated. (science20.com)
Type of progeroid syndrome1
- Werner syndrome (WS) is a type of progeroid syndrome characterized by the development of premature aging. (oncologynurseadvisor.com)
Fibroblasts3
- These results confirm definitively that Werner's syndrome is a chromosome rearrangement syndrome and that these non-constitutional chromosome changes are not exclusive of cultured fibroblasts but present also in lymphocytes. (elsevier.com)
- Scientists at Hiroshima University established induced pluripotent stem (iPS) cells from the fibroblasts of Werner Syndrome patients. (blogspot.se)
- The accelerated aging of Werner syndrome (WS) fibroblasts can be prevented by treatment with the p38 kinase inhibitor SB203580. (cf.ac.uk)
Segmental2
- Segmental progeria, which is more frequently associated with the term progeroid syndrome , tends to affect multiple or all tissues while causing affected individuals to exhibit only some of the features associated with aging. (wikipedia.org)
- This is in support that Werner's syndrome is a segmental progeroid syndrome. (brad.ac.uk)
Occurs3
- This syndrome occurs more often in Japan, affecting 1 in 20,000 to 1 in 40,000 people. (medlineplus.gov)
- Progeria occurs in two forms: Progeria of childhood, described by Jonathan Hutchinson (1886) and Hastings Gilford (1897), diagnosed in the first or second year of life and Progeria adultorum commonly indicated as Werner Syndrome. (nottingham.ac.uk)
- Flushing similar to that of carcinoid syndrome occurs in 20% of patients during attacks of diarrhea. (merckmanuals.com)
Genes1
- people smoking, not doing enough exercise, whereas in Werner's syndrome is very definitely a genetic defect, and so we can start looking at the genes and the biochemistry involved in ageing. (abc.net.au)
Diseases3
- Markedly elevated levels establish the diagnosis, but mild elevations may occur with short bowel syndrome and inflammatory diseases. (merckmanuals.com)
- The syndrome causes wrinkly skin and greying hair at a young age, along with a significantly greater risk of diseases such as cancer. (scotsman.com)
- Diseases associated with RECQL include Werner Syndrome and Rothmund-Thomson Syndrome . (genecards.org)
Patient with the Werner Syndrome2
- 1 patient with the Werner syndrome, a low serum IGF-1 level, and osteoporosis. (annals.org)
- Treatment with rhIGF-1 increased both bone formation and resorption in a patient with the Werner syndrome, a low baseline serum IGF-1 level, and established osteoporosis. (annals.org)
Progeria and Werner syndrome2
- Speculate on how the Hayflick limit may lead to genetic disorders such as progeria and Werner syndrome. (bartleby.com)
- Are progeria and werner syndrome the same? (healthtap.com)
Diagnosis of Werner syndrome6
- The diagnosis of Werner syndrome is established in a proband with the following cardinal signs: bilateral ocular cataracts, premature graying and/or thinning of scalp hair, characteristic dermatologic pathology, and short stature. (nih.gov)
- Note: Percent frequencies are derived from individuals with a diagnosis of Werner syndrome confirmed by molecular testing. (nih.gov)
- The diagnosis of Werner syndrome is established in a proband who has all four cardinal signs and two additional signs (definite) or the first three cardinal signs and two additional signs (probable). (nih.gov)
- Currently, the diagnosis of Werner syndrome is suspected if someone has several of the features listed below. (cancer.net)
- Guidelines for the diagnosis of Werner syndrome have been proposed but may change over time as more is learned about this condition. (cancer.net)
- Currently, the diagnosis of Werner syndrome is suspected if someone has several of the features that have been reported in people with this condition. (cancermedicines.in)
Patients with Werner syndrome1
- Patients with Werner syndrome (WS) show a wide range of premature aging phenotypes accompanied by rare tumors ( 1 ). (spandidos-publications.com)
Cancers1
- [ 8 ] Specific cancers associated with Costello syndrome in children include rhabdomyosarcoma, neuroblastoma and transitional cell carcinoma of the bladder. (medscape.com)
Senescence1
- Ibrahim B, Sheerin AN, Jennert-Burston K et al (2016) Absence of premature senescence in Werner's syndrome keratinocytes. (brad.ac.uk)
Late forties or early fifties1
- Most people with the syndrome live to their late forties or early fifties. (scotsman.com)
Phenotypes1
Lymphocytes2
- Multiple numerical and structural chromosome abnormalities were found in cultured lymphocytes of four patients with Werner's syndrome. (elsevier.com)
- Furthermore, the possibility of detecting chromosome n. 22 aberrations in peripheral blood lymphocytes of Werner's Syndrome patients could provide a clue to the presence of a meningioma at a preclinical stage. (elsevier.com)
Metabolism4
- Werner's syndrome: a study of adrenocortical and hepatic steroidal metabolism. (pubmedcentralcanada.ca)
- Metabolism of acetylated low density lipoproteins by monocyte-derived macrophages from patients with Werner's syndrome. (ahajournals.org)
- Therefore, for determination of the mechanism of accelerated atherogenesis in Werner's syndrome, studies were carried out on the metabolism of acetylated low density lipoprotein (LDL) by monocyte-derived macrophages from patients with this syndrome. (ahajournals.org)
- Vascular risk does not exist in isolation, and is accompanied by alterations in hormonal metabolism and metabolic syndromes . (fightaging.org)
Causes Werner syndrome1
- What causes Werner syndrome? (cancer.net)
Individuals with Werner4
- Individuals with Werner syndrome develop normally until the end of the first decade. (nih.gov)
- the mean age of death in individuals with Werner syndrome is 54 years. (nih.gov)
- Established in 1986, IRWS works to ascertain and genotype individuals with Werner syndrome from around the world and to establish and cryopreserve cell lines from affected individuals. (rarediseases.org)
- Individuals with Werner syndrome usually notice the first signs of rapid aging during their twenties. (diseaseinfosearch.org)
Chromosomal1
- Thus, elevated cancer incidence associated with Werner syndrome is due to increased chromosomal changes , while the accelerated aging characteristics probably stem from telomere dysfunction leading to accumulation of non-functional senescent cells or excessive apoptotic cell death over time. (fightaging.org)
Replication1
- If WRN function is lost (as exemplified in cells from Werner patients), problems with replication and DNA damage processing arise, probably resulting in an increased number or persistence of strand breaks . (fightaging.org)
Lipodystrophy2
- Lipodystrophy syndromes are rare heterogeneous disorders characterized by deficiency of adipose tissue, usually a decrease in leptin levels and, frequently, severe metabolic abnormalities including diabetes mellitus and dyslipidemia. (springer.com)
- Based on literature and in our own experience, we propose a stepwise approach for diagnosis of the different subtypes of rare lipodystrophy syndromes, describing its more frequent co-morbidities and establishing the therapeutical approach. (springer.com)
