Werner Syndrome
RecQ Helicases
Exodeoxyribonucleases
DNA Helicases
Exonucleases
Aging, Premature
4-Nitroquinoline-1-oxide
Progeria
Bloom Syndrome
Rothmund-Thomson Syndrome
Telomere
DNA Damage
DNA
Replication Protein A
Telomeric Repeat Binding Protein 2
Adenosine Triphosphatases
DNA Repair
Mutation
Fibroblasts
HeLa Cells
Genomic Instability
Down Syndrome
Cell Aging
Metabolic Syndrome X
DNA-Binding Proteins
DNA, Single-Stranded
Chromosomes, Human, Pair 8
Protein Binding
Protein Structure, Tertiary
The Saccharomyces cerevisiae Sgs1 helicase efficiently unwinds G-G paired DNAs. (1/250)
The Saccharomyces cerevisiae Sgs1p helicase localizes to the nucleolus and is required to maintain the integrity of the rDNA repeats. Sgs1p is a member of the RecQ DNA helicase family, which also includes Schizo-saccharomyces pombe Rqh1, and the human BLM and WRN genes. These genes encode proteins which are essential to maintenance of genomic integrity and which share a highly conserved helicase domain. Here we show that recombinant Sgs1p helicase efficiently unwinds guanine-guanine (G-G) paired DNA. Unwinding of G-G paired DNA is ATP- and Mg2+-dependent and requires a short 3' single-stranded tail. Strikingly, Sgs1p unwinds G-G paired substrates more efficiently than duplex DNAs, as measured either in direct assays or by competition experiments. Sgs1p efficiently unwinds G-G paired telomeric sequences, suggesting that one function of Sgs1p may be to prevent telomere-telomere interactions which can lead to chromosome non-disjunction. The rDNA is G-rich and has considerable potential for G-G pairing. Diminished ability to unwind G-G paired regions may also explain the deleterious effect of mutation of Sgs1 on rDNA stability, and the accelerated aging characteristic of yeast strains that lack Sgs1 as well as humans deficient in the related WRN helicase. (+info)Human werner syndrome DNA helicase unwinds tetrahelical structures of the fragile X syndrome repeat sequence d(CGG)n. (2/250)
Formation of hairpin and tetrahelical structures by a d(CGG) trinucleotide repeat sequence is thought to cause expansion of this sequence and to engender fragile X syndrome. Here we show that human Werner syndrome DNA helicase (WRN), a member of the RecQ family of helicases, efficiently unwinds G'2 bimolecular tetraplex structures of d(CGG)7. Unwinding of d(CGG)7 by WRN requires hydrolyzable ATP and Mg2+ and is proportional to the amount of added helicase and to the time of incubation. The efficiencies of unwinding of G'2 d(CGG)7 tetraplex with 7 nucleotide-long single-stranded tails at their 3' or 5' ends are, respectively, 3.5- and 2-fold greater than that of double-stranded DNA. By contrast, WRN is unable to unwind a blunt-ended d(CGG)7 tetraplex, bimolecular tetraplex structures of a telomeric sequence 5'-d(TAGACATG(TTAGGG)2TTA)-3', or tetramolecular quadruplex forms of an IgG switch region sequence 5'-d(TACAGGGGAGCTGGGGTAGA)-3'. The ability of WRN to selectively unwind specific tetrahelices may reflect a specific role of this helicase in DNA metabolism. (+info)Werner syndrome helicase contains a 5'-->3' exonuclease activity that digests DNA and RNA strands in DNA/DNA and RNA/DNA duplexes dependent on unwinding. (3/250)
We show that WRN helicase contains a unique 5'-->3' exonuclease activity in the N-terminal region. Adeletion mutant lacking 231 N-terminal amino acid residues, made in a baculovirus system, did nothave this activity, while it showed ATPase and DNA helicase activities. This exonuclease activity was co-precipitated with the helicase activity using monoclonal antibodies specific to WRN helicase, indicating that it is an integral component with WRN helicase. The exonuclease in WRN helicase does not digest free single-stranded DNA or RNA, but it digests a strand in the duplex DNA or an RNA strand in a RNA/DNA heteroduplex in a 5'-->3' direction dependent on duplex unwinding. The digestion products were identified as 5'-mononucleotides. Our data show that WRN helicase needs a single-stranded 3' overhang region for efficient binding and unwinding of duplex molecules, while blunt-ended or 5' overhang duplex molecules were hardly unwound. These findings suggest that the WRN helicase and integral 5'-->3' exonuclease activities are involved in preventing a hyper-recombination by resolving entangled structures of DNA and RNA/DNA heteroduplexes that may be generated during rep-lication, repair and/or transcription. (+info)p53-mediated apoptosis is attenuated in Werner syndrome cells. (4/250)
The WRN DNA helicase is a member of the DExH-containing DNA helicase superfamily that includes XPB, XPD, and BLM. Mutations in WRN are found in patients with the premature aging and cancer susceptibility syndrome known as Werner syndrome (WS). p53 binds to the WRN protein in vivo and in vitro through its carboxyl terminus. WS fibroblasts have an attenuated p53- mediated apoptotic response, and this deficiency can be rescued by expression of wild-type WRN. These data support the hypothesis that p53 can induce apoptosis through the modulation of specific DExH-containing DNA helicases and may have implications for the cancer predisposition observed in WS patients. (+info)The Werner syndrome protein is involved in RNA polymerase II transcription. (5/250)
Werner syndrome (WS) is a human progeroid syndrome characterized by the early onset of a large number of clinical features associated with the normal aging process. The complex molecular and cellular phenotypes of WS involve characteristic features of genomic instability and accelerated replicative senescence. The gene involved (WRN) was recently cloned, and its gene product (WRNp) was biochemically characterized as a helicase. Helicases play important roles in a variety of DNA transactions, including DNA replication, transcription, repair, and recombination. We have assessed the role of the WRN gene in transcription by analyzing the efficiency of basal transcription in WS lymphoblastoid cell lines that carry homozygous WRN mutations. Transcription was measured in permeabilized cells by [3H]UTP incorporation and in vitro by using a plasmid template containing the RNA polymerase II (RNA pol II)-dependent adenovirus major late promoter. With both of these approaches, we find that the transcription efficiency in different WS cell lines is reduced to 40-60% of the transcription in cells from normal individuals. This defect can be complemented by the addition of normal cell extracts to the chromatin of WS cells. Addition of purified wild-type WRNp but not mutated WRNp to the in vitro transcription assay markedly stimulates RNA pol II-dependent transcription carried out by nuclear extracts. A nonhelicase domain (a direct repeat of 27 amino acids) also appears to have a role in transcription enhancement, as revealed by a yeast hybrid-protein reporter assay. This is further supported by the lack of stimulation of transcription when mutant WRNp lacking this domain was added to the in vitro assay. We have thus used several approaches to show a role for WRNp in RNA pol II transcription, possibly as a transcriptional activator. A deficit in either global or regional transcription in WS cells may be a primary molecular defect responsible for the WS clinical phenotype. (+info)Physical and functional interaction between p53 and the Werner's syndrome protein. (6/250)
Werner's syndrome is a human autosomal recessive disorder leading to premature aging. The mutations responsible for this disorder have recently been localized to a gene (WRN) encoding a protein that possesses DNA helicase and exonuclease activities. Patients carrying WRN gene mutations exhibit an elevated rate of cancer, accompanied by increased genomic instability. The latter features are also characteristic of the loss of function of p53, a tumor suppressor that is very frequently inactivated in human cancer. Moreover, changes in the activity of p53 have been implicated in the onset of cellular replicative senescence. We report here that the WRN protein can form a specific physical interaction with p53. This interaction involves the carboxyl-terminal part of WRN and the extreme carboxyl terminus of p53, a region that plays an important role in regulating the functional state of p53. A small fraction of WRN can be found in complex with endogenous p53 in nontransfected cells. Overexpression of WRN leads to augmented p53-dependent transcriptional activity and induction of p21(Waf1) protein expression. These findings support the existence of a cross-talk between WRN and p53, which may be important for maintaining genomic integrity and for preventing the accumulation of aberrations that can give rise to premature senescence and cancer. (+info)Mut-7 of C. elegans, required for transposon silencing and RNA interference, is a homolog of Werner syndrome helicase and RNaseD. (7/250)
While all known natural isolates of C. elegans contain multiple copies of the Tc1 transposon, which are active in the soma, Tc1 transposition is fully silenced in the germline of many strains. We mutagenized one such silenced strain and isolated mutants in which Tc1 had been activated in the germline ("mutators"). Interestingly, many other transposons of unrelated sequence had also become active. Most of these mutants are resistant to RNA interference (RNAi). We found one of the mutated genes, mut-7, to encode a protein with homology to RNaseD. This provides support for the notion that RNAi works by dsRNA-directed, enzymatic RNA degradation. We propose a model in which MUT-7, guided by transposon-derived dsRNA, represses transposition by degrading transposon-specific messengers, thus preventing transposase production and transposition. (+info)Requirement of yeast SGS1 and SRS2 genes for replication and transcription. (8/250)
The SGS1 gene of the yeast Saccharomyces cerevisiae encodes a DNA helicase with homology to the human Bloom's syndrome gene BLM and the Werner's syndrome gene WRN. The SRS2 gene of yeast also encodes a DNA helicase. Simultaneous deletion of SGS1 and SRS2 is lethal in yeast. Here, using a conditional mutation of SGS1, it is shown that DNA replication and RNA polymerase I transcription are drastically inhibited in the srs2Delta sgs1-ts strain at the restrictive temperature. Thus, SGS1 and SRS2 function in DNA replication and RNA polymerase I transcription. These functions may contribute to the various defects observed in Werner's and Bloom's syndromes. (+info)People with Werner Syndrome typically have a normal intelligence and development during early childhood, but they experience a decline in physical and cognitive abilities as they age. They may also have an increased risk of developing certain cancers, such as lung and ovarian cancer. There is currently no cure for Werner Syndrome, and treatment is focused on managing the symptoms and preventing complications.
The primary diagnostic criteria for Werner Syndrome include:
1. Clinical manifestations of premature aging, such as wrinkled skin, graying hair, and short stature.
2. Normal intelligence and development during early childhood, followed by a decline in physical and cognitive abilities with age.
3. Presence of at least two of the following clinical features:
* Telangiectasias (spider veins)
* Ectropion (outward turning of the eyelids)
* Keratoconjunctivitis sicca (dry eyes)
* Poikilodermatous skin changes (skin thickening and pigmentation)
* Mucosal dryness and atrophy (thinning and drying of the mucous membranes)
4. Presence of a WRN gene mutation, confirmed by genetic testing.
The age of onset and severity of Werner Syndrome can vary widely among affected individuals, but most people experience symptoms within the first few years of life. The disorder is usually diagnosed in childhood or adolescence, based on clinical evaluation and genetic testing.
There is currently no cure for Werner Syndrome, and treatment is focused on managing the symptoms and preventing complications. This may include medication to manage dry eyes and skin, physical therapy to maintain joint mobility, and regular monitoring of the eyes and skin for early detection of any changes or problems. In some cases, surgery may be necessary to correct eye or skin problems.
Werner Syndrome is a rare disorder, and there is ongoing research into its causes and potential treatments. With proper management, many people with Werner Syndrome can lead active and fulfilling lives, despite the challenges posed by the disorder.
Examples of syndromes include:
1. Down syndrome: A genetic disorder caused by an extra copy of chromosome 21 that affects intellectual and physical development.
2. Turner syndrome: A genetic disorder caused by a missing or partially deleted X chromosome that affects physical growth and development in females.
3. Marfan syndrome: A genetic disorder affecting the body's connective tissue, causing tall stature, long limbs, and cardiovascular problems.
4. Alzheimer's disease: A neurodegenerative disorder characterized by memory loss, confusion, and changes in personality and behavior.
5. Parkinson's disease: A neurological disorder characterized by tremors, rigidity, and difficulty with movement.
6. Klinefelter syndrome: A genetic disorder caused by an extra X chromosome in males, leading to infertility and other physical characteristics.
7. Williams syndrome: A rare genetic disorder caused by a deletion of genetic material on chromosome 7, characterized by cardiovascular problems, developmental delays, and a distinctive facial appearance.
8. Fragile X syndrome: The most common form of inherited intellectual disability, caused by an expansion of a specific gene on the X chromosome.
9. Prader-Willi syndrome: A genetic disorder caused by a defect in the hypothalamus, leading to problems with appetite regulation and obesity.
10. Sjogren's syndrome: An autoimmune disorder that affects the glands that produce tears and saliva, causing dry eyes and mouth.
Syndromes can be diagnosed through a combination of physical examination, medical history, laboratory tests, and imaging studies. Treatment for a syndrome depends on the underlying cause and the specific symptoms and signs presented by the patient.
There are several types of premature aging, including:
1. Progeria: This is a rare genetic condition that causes accelerated aging in children, resulting in a shortened life span.
2. Hutchinson-Gilford progeria syndrome: This is the most common form of progeria, which affects approximately 1 in 4 million children worldwide. Children with this condition typically die before reaching their teenage years due to complications such as heart attack or stroke.
3. Wiedemann-Steiner syndrome: This is a rare genetic disorder that causes premature aging, including wrinkled skin, thinning hair, and joint stiffness.
4. Werner syndrome: This is a rare genetic disorder that affects approximately 1 in 250,000 individuals worldwide. It is characterized by premature aging, including grey hair, wrinkled skin, and a high risk of developing cancer and other age-related diseases.
5. Telomere shortening: Telomeres are the protective caps at the end of chromosomes that shorten with each cell division. Premature telomere shortening can lead to accelerated aging and an increased risk of age-related diseases.
6. Chronic stress: Prolonged exposure to chronic stress can lead to premature aging, including changes in the brain, skin, and immune system.
7. Poor nutrition: A diet lacking essential nutrients can lead to premature aging, including vitamin D deficiency, which is associated with an increased risk of osteoporosis and other age-related diseases.
8. Lack of exercise: Physical inactivity can contribute to premature aging, including decreased muscle mass, bone density, and cognitive function.
9. Smoking: Cigarette smoking is a significant risk factor for premature aging, including wrinkles, age spots, and an increased risk of cancer and cardiovascular disease.
10. Alcohol consumption: Excessive alcohol consumption can lead to premature aging, including liver damage, heart disease, and certain types of cancer.
While many of these factors are beyond our control, there are steps we can take to reduce their impact and promote healthy aging. These include maintaining a balanced diet, exercising regularly, getting enough sleep, managing stress, not smoking, and limiting alcohol consumption. Additionally, staying up-to-date on preventative healthcare measures, such as regular check-ups and screenings, can help identify and address any potential health issues before they become more serious.
The main symptoms of progeria include:
1. Rapid growth and development during the first two years of life, followed by slowed growth and loss of fat and muscle mass.
2. A distinctive facial appearance, including a small face, thin nose, and narrow eyes.
3. Wasting of the skin, hair, and joints.
4. Cardiovascular disease, such as hardening of the arteries and heart problems.
5. Osteoporosis and joint degeneration.
6. Respiratory problems, including frequent colds and difficulty breathing.
7. Eye problems, including cataracts and glaucoma.
8. Increased risk of stroke and other cardiovascular complications.
Progeria is a fatal condition, with most children dying from heart disease or stroke before the age of 21. However, some individuals with progeria have been known to live into their 30s or 40s due to advances in medical care and technology. There is currently no cure for progeria, but researchers are working to develop new treatments to slow down the progression of the disease and improve the quality of life for those affected.
Bloom syndrome is a rare genetic disorder that affects approximately 1 in 100,000 individuals worldwide. It is caused by a mutation in the BLM gene, which codes for the Bloom syndrome protein (BLM). This protein plays a crucial role in the repair of DNA double-strand breaks and other types of genetic damage.
Characteristics:
Individuals with Bloom syndrome typically have short stature, small head size, and delicate features. They may also experience a range of health problems, including:
1. Increased risk of cancer: People with Bloom syndrome have an increased risk of developing various types of cancer, such as ovarian, breast, skin, and colon cancer.
2. Immune system problems: Individuals with Bloom syndrome may experience immune deficiency and autoimmune disorders, such as allergies and lupus.
3. Infertility: Many people with Bloom syndrome experience infertility or have difficulty conceiving.
4. Developmental delays: Children with Bloom syndrome may experience delayed development, including speech and language difficulties.
5. Skin changes: Individuals with Bloom syndrome may develop skin changes, such as thinning of the skin, easy bruising, and an increased risk of skin cancer.
6. Eye problems: Bloom syndrome can cause a range of eye problems, including cataracts, glaucoma, and detached retinas.
7. Increased risk of infections: People with Bloom syndrome may be more susceptible to infections due to their weakened immune system.
8. Other health problems: Individuals with Bloom syndrome may experience other health issues, such as hearing loss, kidney disease, and gastrointestinal problems.
Diagnosis:
Bloom syndrome can be diagnosed through a combination of clinical evaluation, family history, and genetic testing. Genetic testing can identify the presence of the BLM mutation that causes the disorder. Prenatal testing is also available for pregnant women who have a family history of Bloom syndrome.
Treatment:
There is no cure for Bloom syndrome, but treatment can help manage the symptoms and prevent complications. Treatment options may include:
1. Skin cancer screening and prevention: Regular skin exams can help detect skin cancer at an early stage, and preventive measures such as avoiding excessive sun exposure and using protective clothing and sunscreen can reduce the risk of skin cancer.
2. Eye care: Regular eye exams can help detect eye problems early, and prompt treatment can prevent vision loss.
3. Immune system support: Individuals with Bloom syndrome may be at increased risk of infections, so it's important to take steps to support the immune system, such as getting vaccinated against common illnesses and practicing good hygiene.
4. Developmental support: Children with Bloom syndrome may require extra support in school and at home to help them reach their full potential.
5. Managing other health problems: Depending on the specific health issues experienced by an individual with Bloom syndrome, treatment may involve medication, lifestyle changes, or other interventions to manage these conditions.
Prognosis:
The prognosis for individuals with Bloom syndrome varies depending on the specific health problems they experience. Some individuals may have a relatively mild course of the condition, while others may experience more severe health issues. With appropriate medical care and support, many individuals with Bloom syndrome can lead fulfilling lives. However, the condition can be associated with a shorter life expectancy compared to the general population.
Lifestyle Changes:
There are several lifestyle changes that can help manage the symptoms of Bloom syndrome and improve overall health. These may include:
1. Protecting the skin from the sun: Avoid excessive sun exposure, especially during peak hours, and use protective clothing and sunscreen to prevent skin damage.
2. Eating a healthy diet: A balanced diet that includes plenty of fruits, vegetables, whole grains, and lean protein can help support overall health.
3. Staying hydrated: Drinking plenty of water can help prevent dehydration, which can be a common issue for individuals with Bloom syndrome.
4. Avoiding smoking and excessive alcohol consumption: Both smoking and excessive alcohol consumption can worsen the symptoms of Bloom syndrome and increase the risk of certain health problems.
5. Getting regular exercise: Regular physical activity can help improve overall health and reduce the risk of certain health problems.
6. Managing stress: Stress can exacerbate the symptoms of Bloom syndrome, so it's important to find healthy ways to manage stress, such as through relaxation techniques or therapy.
7. Getting enough sleep: Adequate sleep is essential for overall health and well-being, and can help reduce the risk of certain health problems.
8. Avoiding exposure to toxins: Individuals with Bloom syndrome may be more susceptible to the effects of toxins, so it's important to avoid exposure to chemicals and other toxins whenever possible.
9. Keeping up-to-date on medical care: Regular check-ups with a healthcare provider can help identify any health issues early on and prevent complications.
Support Groups:
There are several support groups and organizations that provide information, resources, and support for individuals with Bloom syndrome and their families. These include:
1. The National Organization for Rare Disorders (NORD) - Provides information and resources on rare diseases, including Bloom syndrome.
2. The Bloom Syndrome Foundation - A non-profit organization dedicated to supporting research and providing information and resources for individuals with Bloom syndrome and their families.
3. The Rare Disease United Foundation - Provides information and resources on rare diseases, including Bloom syndrome, as well as support for individuals and families affected by these conditions.
Online Resources:
There are several online resources available to help individuals with Bloom syndrome and their families learn more about the condition, connect with others, and find support. These include:
1. The National Organization for Rare Disorders (NORD) - Provides information and resources on rare diseases, including Bloom syndrome, as well as a directory of healthcare providers and researchers.
2. The Bloom Syndrome Foundation - Offers information and resources on Bloom syndrome, as well as a registry for individuals with the condition to connect with others and receive updates on research and treatments.
3. Rare Disease United - Provides information and resources on rare diseases, including Bloom syndrome, as well as a directory of support groups and advocacy organizations.
4. The Global Bloom Syndrome Registry - A registry for individuals with Bloom syndrome to connect with others and receive updates on research and treatments.
5. The Bloom Syndrome Community - A Facebook group for individuals with Bloom syndrome and their families to connect, share information, and support one another.
These online resources can provide valuable information and support for individuals with Bloom syndrome and their families. It is important to note that while these resources can be helpful, they should not replace the advice of a qualified healthcare professional.
The main clinical features of Rothmund-Thomson Syndrome include:
1. Congenital anomalies: Individuals with RTS are born with a variety of physical abnormalities such as short stature, microcephaly (small head), and facial dysmorphism (abnormal facial features).
2. Skin abnormalities: The skin is thin, delicate, and susceptible to infections, blistering, and scarring. Individuals with RTS may develop poikiloderma (a condition characterized by irregularly pigmented patches on the skin).
3. Skeletal abnormalities: RTS can cause a range of skeletal defects such as short or missing limbs, joint deformities, and spinal abnormalities.
4. Craniofacial abnormalities: The syndrome can also result in craniofacial abnormalities such as micrognathia (small jaw), protruding eyes, and hearing loss.
5. Developmental delays: Individuals with RTS often experience developmental delays and intellectual disability. They may have difficulty with speech, language, and social interactions.
6. Increased risk of cancer: People with Rothmund-Thomson Syndrome have an increased risk of developing certain types of cancer, particularly osteosarcoma (bone cancer) and rhabdomyosarcoma (soft tissue cancer).
7. Autoimmune disorders: RTS can also lead to autoimmune disorders such as thyroiditis (inflammation of the thyroid gland) and vitiligo (loss of skin pigmentation).
8. Poor immune function: The syndrome can cause poor immune function, making individuals more susceptible to infections and less able to fight them off effectively.
9. Neurological problems: RTS can result in neurological issues such as seizures, tremors, and loss of coordination.
10. Short stature: Adults with Rothmund-Thomson Syndrome often have short stature and may experience delayed or arrested growth.
It's important to note that not all individuals with RTS will experience all of these symptoms, and the severity of the syndrome can vary widely from person to person. Treatment for Rothmund-Thomson Syndrome typically involves a multidisciplinary approach, including medical management, surgical interventions, and supportive care to address the various physical and developmental challenges associated with the condition.
There are several types of genomic instability, including:
1. Chromosomal instability (CIN): This refers to changes in the number or structure of chromosomes, such as aneuploidy (having an abnormal number of chromosomes) or translocations (the movement of genetic material between chromosomes).
2. Point mutations: These are changes in a single base pair in the DNA sequence.
3. Insertions and deletions: These are changes in the number of base pairs in the DNA sequence, resulting in the insertion or deletion of one or more base pairs.
4. Genomic rearrangements: These are changes in the structure of the genome, such as chromosomal breaks and reunions, or the movement of genetic material between chromosomes.
Genomic instability can arise from a variety of sources, including environmental factors, errors during DNA replication and repair, and genetic mutations. It is often associated with cancer, as cancer cells have high levels of genomic instability, which can lead to the development of resistance to chemotherapy and radiation therapy.
Research into genomic instability has led to a greater understanding of the mechanisms underlying cancer and other diseases, and has also spurred the development of new therapeutic strategies, such as targeted therapies and immunotherapies.
In summary, genomic instability is a key feature of cancer cells and is associated with various diseases, including cancer, neurodegenerative disorders, and aging. It can arise from a variety of sources and is the subject of ongoing research in the field of molecular biology.
Down syndrome can be diagnosed before birth through prenatal testing, such as chorionic villus sampling or amniocentesis, or after birth through a blood test. The symptoms of Down syndrome can vary from person to person, but common physical features include:
* A flat face with a short neck and small ears
* A short stature
* A wide, short hands with short fingers
* A small head
* Almond-shaped eyes that are slanted upward
* A single crease in the palm of the hand
People with Down syndrome may also have cognitive delays and intellectual disability, as well as increased risk of certain medical conditions such as heart defects, gastrointestinal problems, and hearing and vision loss.
There is no cure for Down syndrome, but early intervention and proper medical care can greatly improve the quality of life for individuals with the condition. Treatment may include speech and language therapy, occupational therapy, physical therapy, and special education programs. With appropriate support and resources, people with Down syndrome can lead fulfilling and productive lives.
1. Abdominal obesity (excess fat around the waistline)
2. High blood pressure (hypertension)
3. Elevated fasting glucose (high blood sugar)
4. High serum triglycerides (elevated levels of triglycerides in the blood)
5. Low HDL cholesterol (low levels of "good" cholesterol)
Having three or more of these conditions is considered a diagnosis of metabolic syndrome X. It is estimated that approximately 34% of adults in the United States have this syndrome, and it is more common in women than men. Risk factors for developing metabolic syndrome include obesity, lack of physical activity, poor diet, and a family history of type 2 diabetes or CVD.
The term "metabolic syndrome" was first introduced in the medical literature in the late 1980s, and since then, it has been the subject of extensive research. The exact causes of metabolic syndrome are not yet fully understood, but it is believed to be related to insulin resistance, inflammation, and changes in body fat distribution.
Treatment for metabolic syndrome typically involves lifestyle modifications such as weight loss, regular physical activity, and a healthy diet. Medications such as blood pressure-lowering drugs, cholesterol-lowering drugs, and anti-diabetic medications may also be prescribed if necessary. It is important to note that not everyone with metabolic syndrome will develop type 2 diabetes or CVD, but the risk is increased. Therefore, early detection and treatment are crucial in preventing these complications.
Werner syndrome
Werner syndrome helicase
Progeroid syndromes
Cancer syndrome
Human nose
Steve Horvath
Epigenetic clock
British Society for Research on Ageing
Laminopathy
Bloom syndrome protein
DNA damage theory of aging
DNA repair-deficiency disorder
Ying-Hui Fu
P53
POLD1
Cruciform DNA
Human hair color
Atherosclerosis
Otto Werner
Jan Karlseder
Drosophila melanogaster
Gerard Schellenberg
Instituto Nacional de Medicina Genómica
WRNIP1
Synthetic lethality
Renal agenesis
George M. Martin
DNA polymerase beta
Treatment of cancer
TOP1
HGSNAT
Adolf Hitler
Lassa fever
Conservation biology
Cardiac catheterization
Deaths in November 2019
Osborne's ligament
Beck Depression Inventory
Liver support system
Florence
Peter Valent
Telomerase
Nicolas Cage
La Llorona
Telomeric repeat-binding factor 2
Scarlet fever
Tyson Ross
List of German inventors and discoverers
Enclomifene
Triassic-Jurassic extinction event
August 1963
PPP3CA
FIP1L1
Metformin
Hippocampus
PTK2
Isotretinoin
Laron syndrome
Werner syndrome: MedlinePlus Genetics
Myelodysplastic Syndrome in a Patient with Werner's Syndrome | Acta Haematologica | Karger Publishers
Werner Syndrome - another model for aging - AGINGSCIENCES™ - Anti-Aging Firewalls™
Calcinosis Cutis: Background, Pathophysiology, Etiology
Toxic Anterior Segment Syndrome After Cataract Surgery --- Maine, 2006
DeCS 2009 - February 20, 2009 version
Uncovering an allosteric mode of action for a selective inhibitor of human Bloom syndrome protein | eLife
v
Virginia A. Zakian - Publications
WHO EMRO | Patterns of meningococcal infection in Sudan with emergence of Neisseria meningitidis serogroup W135 | Volume 19,...
Reticulate dermatoses Adya KA, Inamadar AC, Palit A - Indian J Dermatol
Jack (1996)
Progeria in Babies | American Pregnancy Association
July Is Sarcoma Awareness Month 2016
Find Research outputs
- Universidad Nacional Mayor de San Marcos
Bibliografia 2015 - Pagina 113 - Endometriosi.it
Hemolytic Uremic Syndrome Incidence in New York - Volume 10, Number 5-May 2004 - Emerging Infectious Diseases journal - CDC
Journal issue - WANFANG MED ONLINE
Soft tissue sarcomas - CheckOrphan
February 2009 - Biosingularity
Measles, Mumps, and Rubella -- Vaccine Use and Strategies for Elimination of Measles, Rubella, and Congenital Rubella Syndrome...
DeCS
July is Bone & Sarcoma Awareness Month
Cosmetic Facelift - The Resident Review Podcast
Catalysis of homologous DNA pairing by yeast Rad51 and Rad54 proteins. DNA helicase Srs2 disrupts the Rad51 presynaptic filament
関連論文 - Genostaff
People | University of Pennsylvania | Pathology and Laboratory Medicine
Acanthosis Nigricans: Background, Pathophysiology, Etiology
Pesquisa | Portal Regional da BVS
Progeria10
- Kudlow BA, Kennedy BK, Monnat RJ Jr. Werner and Hutchinson-Gilford progeria syndromes: mechanistic basis of human progeroid diseases. (medlineplus.gov)
- My last major post traced developments related to a form of progeria (premature aging) known as Hutchinson-Gilford progeria syndrome , or HGPS , for short. (anti-agingfirewalls.com)
- There is also a different rare form of progeria known as Werner Syndrome (WS) that is worth looking at for what it might tell us about normal aging. (anti-agingfirewalls.com)
- 4. Diabetes mellitus coexisted with progeria: a case report of atypical Werner syndrome with novel LMNA mutations and literature review. (nih.gov)
- 5. Nailfold scleroderma-like capillary abnormalities in Werner syndrome (adult progeria). (nih.gov)
- Werners syndrom ble opprinnelig beskrevet av den tyske medisinstudenten Otto Werner (1) og omtales ofte som voksen-progeria. (frambu.no)
- Robin Williams plays the role of Jack Powell, a boy who ages four times faster than normal as a result of Werner syndrome, a form of progeria. (listal.com)
- Hutchinson-Gilford Progeria Syndrome is commonly referred to as Progeria or HGPS . (americanpregnancy.org)
- The most common type is known as Hutchinson-Gilford Progeria Syndrome. (americanpregnancy.org)
- Other progeroid syndromes include Werner's syndrome, also known as "adult Progeria" which does not have an onset until the late teen years, with a life span into the 40s and 50s, and mandibulofacial dysplasia. (americanpregnancy.org)
Progeroid4
- Correction of proliferation and drug sensitivity defects in the progeroid Werner's Syndrome by Holliday junction resolution. (ox.ac.uk)
- The progeroid Werner's syndrome (WS) represents the best current model of human aging. (ox.ac.uk)
- 15. [Atypical Werner syndrome: Atypical progeroid syndrome: A case report]. (nih.gov)
- Progeroid syndromes a. (nih.gov)
Hutchinson-Gilford2
- Hutchinson-Gilford syndrome is an even rarer condition, affecting 1 in 8 million babies . (healthline.com)
- The average life expectancy for children living with Hutchinson-Gilford syndrome is 13 years . (healthline.com)
Werner's Syndrome8
- Werner's syndrome is a relatively rare autosomal recessive disorder characterized by several features generally associated with aging. (karger.com)
- Herein we report a case of Werner's syndrome with myelodysplastic syndrome, a clonal preleukemic disorder of hemopoietic stem cells. (karger.com)
- 2. Werner's syndrome: a quite rare disease for differential diagnosis of scleroderma. (nih.gov)
- 10. Werner's syndrome may be lost in the shadow of the scleroderma. (nih.gov)
- 11. Werner's syndrome: from clinics to genetics. (nih.gov)
- 13. Genetic analyses of two cases of Werner's syndrome. (nih.gov)
- 14. [A female patient with Werner's syndrome]. (nih.gov)
- Werner's Syndrome and Human Aging, Vol. 190, Advances in Experimental Medicine and Biology. (frambu.no)
Genetic syndromes1
- The net metabolic outcome in patients of diabetes with a syndrome or a condition (e.g., a with secondary diabetes thus depends on the direct or number of genetic syndromes). (nih.gov)
Autosomal recessive2
- Introduction: Werner syndrome (WS) is an autosomal recessive disease characterized by premature aging, skin changes, gray hair, alopecia, muscle atrophy, osteoporosis, and cataracts and has a high frequency of association with rare neoplasms. (endocrine-abstracts.org)
- Werner syndrome (WS) is a rare autosomal recessive genetic instability/cancer predisposition disorder that displays many symptoms of premature aging. (nih.gov)
Premature5
- Werner syndrome is characterized by the premature appearance of features associated with normal aging and cancer predisposition. (nih.gov)
- The diagnosis of Werner syndrome is established in a proband with the following cardinal signs: bilateral ocular cataracts, premature graying and/or thinning of scalp hair, characteristic dermatologic pathology, and short stature. (nih.gov)
- The DNA Helicase Section was the first to discover a small molecule inhibitor of the WRN helicase, defective in the premature aging disease Werner syndrome. (nih.gov)
- Mutations in WRN lead to premature aging, known as Werner syndrome (WS). (nih.gov)
- and defects in RECQ4 are associated with Rothmund-Thompson syndrome, which displays growth retardation, skeletal abnormalities and premature ageing. (elifesciences.org)
Mutations4
- Mutations in the WRN gene cause Werner syndrome. (medlineplus.gov)
- Mutations in the WRN gene often lead to the production of an abnormally short, nonfunctional Werner protein. (medlineplus.gov)
- Researchers do not fully understand how WRN mutations cause the signs and symptoms of Werner syndrome. (medlineplus.gov)
- 17. Werner syndrome and mutations of the WRN and LMNA genes in France. (nih.gov)
Predisposition1
- These issues include the genetic risks for Ewing's sarcoma and liposarcoma , the genetic variants that predict response to sarcoma treatments, and the genetics of sarcoma predisposition syndromes . (sarcomahelp.org)
Oshima1
- Maierhofer A, Flunkert J, Oshima J, Martin GM, Poot M, Nanda I, Dittrich M, Muller T, Haaf T. Epigenetic signatures of Werner syndrome occur early in life and are distinct from normal epigenetic aging processes. (medlineplus.gov)
Helicase2
- Aggarwal M, Sommers JA, Shoemaker RH, Brosh RM Jr., Inhibition of helicase activity by a small molecule impairs Werner syndrome helicase (WRN) function in the cellular response to DNA damage or replication stress. (nih.gov)
- BLM (Bloom syndrome protein) is a RECQ-family helicase involved in the dissolution of complex DNA structures and repair intermediates. (elifesciences.org)
Mitochondrial1
- Mitochondrial tRNA gene mutation syndromes f. (nih.gov)
Instability1
- This syndrome is classified in the group of chromosome instability syndromes and there is an increased incidence of neoplasia. (karger.com)
Dysplasia1
- Glucocorticoid excess (Cushing's syndrome) dysplasia, dystrophic nails) c. (nih.gov)
Chromosome1
- Jan Karlseder of the Salk Institute in La Jolla, California, another NIH-funded scientist, has found that people with Werner syndrome sometimes have missing telomeres or parts of one chromosome stuck to another. (livescience.com)
Neoplasia1
- Lauper JM, Krause A, Vaughan TL, Monnat RJ Jr. Spectrum and risk of neoplasia in Werner syndrome: a systematic review. (medlineplus.gov)
Fibroblasts2
- Some researchers highlight the roles of cell senescence and telomeres in WS: "Telomerase prevents the accelerated cell ageing of Werner syndrome fibroblasts( ref ). (anti-agingfirewalls.com)
- This work is the first to demonstrate that Holliday junction accumulation in primary Werner syndrome fibroblasts results in their poor proliferative capacity, and to rescue WS hypersensitivity to camptothecin and 4NQO by Holliday junction resolution. (ox.ac.uk)
Metabolic2
Protein5
- The WRN gene provides instructions for producing the Werner protein, which is thought to perform several tasks related to the maintenance and repair of DNA. (medlineplus.gov)
- Evidence also suggests that the altered protein is broken down more quickly in the cell than the normal Werner protein. (medlineplus.gov)
- Cells with an altered Werner protein may divide more slowly or stop dividing earlier than normal, causing growth problems. (medlineplus.gov)
- Lee JW, Harrigan J, Opresko PL, Bohr VA. Pathways and functions of the Werner syndrome protein. (medlineplus.gov)
- His graduate thesis focused on the nuclear protein Werner (WRN) and autophagy. (nih.gov)
Malignancies1
- Hematologic malignancies associated with this syndrome are, however, unusual. (karger.com)
Mutation4
- Furthermore, the same mutation can also cause different laminopathy syndromes even within the same family. (medscape.com)
- 19. Uncommon cause of cirrhosis-A case of Werner syndrome with a novel WRN mutation. (nih.gov)
- Li-Fraumeni syndrome (TP53 mutation). (kaiserpermanente.org)
- Gardner syndrome (APC mutation). (kaiserpermanente.org)
Underlies1
- Our discovery of the dysregulated neurodevelopmental pathway that underlies LINKED syndrome was only possible through the teamwork of geneticists, developmental biologists, and biochemists from NIH," said Achim Werner, PhD, an NIDCR intramural investigator and lead author. (nih.gov)
Signs and symptoms1
- The parents of an individual with Werner syndrome each carry one copy of the mutated gene, but they typically do not show signs and symptoms of the condition. (medlineplus.gov)
Defects1
- Named linkage-specific-deubiquitylation-deficiency-induced embryonic defects syndrome (LINKED), it is caused by a mutated version of the OTUD5 gene, which interferes with key molecular steps in embryo development. (nih.gov)
Clinical Features1
- Werner Syndrome: Clinical Features, Pathogenesis and Potential Therapeutic Interventions. (frambu.no)
Deficiency1
- For example, regarding study of a mouse model of WS the authors write "Recent studies of the telomerase-Werner double null mouse link telomere dysfunction to accelerated aging and tumorigenesis in the setting of Werner deficiency. (anti-agingfirewalls.com)
Telomerase1
- When Karlseder gave extra telomerase to cells from a person with Werner syndrome, they suffered less DNA damage than cells without extra telomerase. (livescience.com)
Cells1
- The syndrome typically develops within 24 hours after surgery and is characterized by corneal edema and accumulation of white cells in the anterior chamber of the eye. (cdc.gov)
Severe1
- Severe to extreme insulin resistance syndromes b. (nih.gov)
Patient1
- 9. General anesthesia for old Werner syndrome patient: a case report. (nih.gov)
Aging3
- Werner syndrome is characterized by the dramatic, rapid appearance of features associated with normal aging. (medlineplus.gov)
- For example, in Werner syndrome, people start aging during their 20s. (livescience.com)
- Werner Syndrome, aging and cancer. (nih.gov)
Acute1
- Diarrhea-associated hemolytic uremic syndrome (HUS) is a major cause of acute renal failure in children ( 1 ). (cdc.gov)
Patients2
- La culture de type classique a permis d'identifier Neissera meningitidis chez 37 (18,9 %) des 196 patients ayant des symptômes et des signes cliniques de méningite, ce qui a ensuite été confirmé par réaction en chaîne par polymérase. (who.int)
- Escherichia coli O157:H7 was found in 63% of samples cultured from hemolytic uremic syndrome patients, and samples were more likely to be positive when collected early in illness. (cdc.gov)
Diabetes1
- 12. Werner syndrome presenting as early-onset diabetes: A case report. (nih.gov)
Scleroderma2
Rare1
- Achim Werner, NIDCR principal investigator, and David Beck, clinical fellow, NHGRI, discuss how their collaborative research led to discovery of a rare developmental disease that affects the brain and craniofacial skeleton. (nih.gov)
Develop1
- Individuals with Werner syndrome develop normally until the end of the first decade. (nih.gov)
Years1
- the mean age of death in individuals with Werner syndrome is 54 years. (nih.gov)
Group1
- Children with this syndrome don't grow as quickly as others in their age group. (healthline.com)
Individuals1
- Werner syndrome is estimated to affect 1 in 200,000 individuals in the United States. (medlineplus.gov)
People4
- Many people with Werner syndrome have thin arms and legs and a thick trunk due to abnormal fat deposition. (medlineplus.gov)
- People with Werner syndrome usually live into their late forties or early fifties. (medlineplus.gov)
- This syndrome occurs more often in Japan, affecting 1 in 20,000 to 1 in 40,000 people. (medlineplus.gov)
- Werner syndrome affects 1 in 1 million people . (healthline.com)
Early1
- [3] Persistent cutis marmorata, or the one which recurs until early childhood, is associated with cretinism and forms a part of various inherited syndromes [Table 1] . (e-ijd.org)
