A computer architecture, implementable in either hardware or software, modeled after biological neural networks. Like the biological system in which the processing capability is a result of the interconnection strengths between arrays of nonlinear processing nodes, computerized neural networks, often called perceptrons or multilayer connectionist models, consist of neuron-like units. A homogeneous group of units makes up a layer. These networks are good at pattern recognition. They are adaptive, performing tasks by example, and thus are better for decision-making than are linear learning machines or cluster analysis. They do not require explicit programming.
Viruses whose hosts are bacterial cells.
Viral proteins that are components of the mature assembled VIRUS PARTICLES. They may include nucleocapsid core proteins (gag proteins), enzymes packaged within the virus particle (pol proteins), and membrane components (env proteins). These do not include the proteins encoded in the VIRAL GENOME that are produced in infected cells but which are not packaged in the mature virus particle,i.e. the so called non-structural proteins (VIRAL NONSTRUCTURAL PROTEINS).
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
A field of biology concerned with the development of techniques for the collection and manipulation of biological data, and the use of such data to make biological discoveries or predictions. This field encompasses all computational methods and theories for solving biological problems including manipulation of models and datasets.
A procedure consisting of a sequence of algebraic formulas and/or logical steps to calculate or determine a given task.
The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.
A genus of PARVOVIRIDAE, subfamily DENSOVIRINAE, comprising helper-independent viruses containing only two species. Junonia coenia densovirus is the type species.
Insects of the suborder Heterocera of the order LEPIDOPTERA.
Processes that stimulate the GENETIC TRANSCRIPTION of a gene or set of genes.
Proteins encoded by a VIRAL GENOME that are produced in the organisms they infect, but not packaged into the VIRUS PARTICLES. Some of these proteins may play roles within the infected cell during VIRUS REPLICATION or act in regulation of virus replication or VIRUS ASSEMBLY.
A large order of insects comprising the butterflies and moths.
A subfamily of DNA arthropod viruses, in the family PARVOVIRIDAE. The host range includes members of Dictyoptera; DIPTERA; LEPIDOPTERA; Odonata; and ORTHOPTERA. There are three genera: DENSOVIRUS, Iteravirus, and Brevidensovirus. Densovirus-like viruses also infect and multiply in crabs and shrimp.
Wormlike or grublike stage, following the egg in the life cycle of insects, worms, and other metamorphosing animals.
Viruses whose host is Staphylococcus.
Potentially pathogenic bacteria found in nasal membranes, skin, hair follicles, and perineum of warm-blooded animals. They may cause a wide range of infections and intoxications.
The phenomenon by which a temperate phage incorporates itself into the DNA of a bacterial host, establishing a kind of symbiotic relation between PROPHAGE and bacterium which results in the perpetuation of the prophage in all the descendants of the bacterium. Upon induction (VIRUS ACTIVATION) by various agents, such as ultraviolet radiation, the phage is released, which then becomes virulent and lyses the bacterium.
Rupture of bacterial cells due to mechanical force, chemical action, or the lytic growth of BACTERIOPHAGES.
An autolytic enzyme bound to the surface of bacterial cell walls. It catalyzes the hydrolysis of the link between N-acetylmuramoyl residues and L-amino acid residues in certain cell wall glycopeptides, particularly peptidoglycan. EC 3.5.1.28.

EBV structural antigens, gp350 and gp85, as targets for ex vivo virus-specific CTL during acute infectious mononucleosis: potential use of gp350/gp85 CTL epitopes for vaccine design. (1/2581)

For many years, EBV vaccine development efforts have concentrated on the use of structural Ag, gp350, and have been directed toward Ab-mediated blocking virus attachment to the target cell. There is increasing evidence to suggest that the development of neutralizing Abs in vaccinated animals does not always correlate with protection; nevertheless, it has been postulated that gp350-specific T cell-mediated immune responses may have an effector role in protection. This hypothesis has largely remained untested. In the present study, we demonstrate that CTL from acute infectious mononucleosis patients display strong ex vivo reactivity against the EBV structural Ags, gp85 and gp350. Moreover, long-term follow up studies on infectious mononucleosis-recovered individuals showed that these individuals maintain gp350- and gp85-specific memory CTL, albeit at low levels, in the peripheral blood. These results strongly suggest that CTL specific for EBV structural proteins may play an important role in the control of EBV infection during acute infection. More importantly, we also show that prior immunization of HLA A2/Kb transgenic mice with gp350 and gp85 CTL epitopes induced a strong epitope-specific CTL response and afforded protection against gp85- or gp350-expressing vaccinia virus challenge. These results have important implications for future EBV vaccine design and provides evidence, for the first time, that CTL epitopes from EBV structural proteins may be used for establishing strong antiviral immunity against EBV infection.  (+info)

Adaptation of very virulent infectious bursal disease virus to chicken embryonic fibroblasts by site-directed mutagenesis of residues 279 and 284 of viral coat protein VP2. (2/2581)

The full-length RNA genomes of a chicken embryonic fibroblast (CEF)-nonpermissive, very virulent infectious bursal disease virus (IBDV) (strain HK46) were amplified into cDNAs by reverse transcription-PCR. The full-length cDNAs were sequenced and subcloned into a eukaryotic expression vector, from which point mutations were introduced into the VP2 region by site-directed mutagenesis. The wild-type and mutated plasmids were transfected directly into CEFs to examine their ability to generate CEF-permissive recombinant viruses. Substitution of amino acid residues 279 (Asp-->Asn) and 284 (Ala-->Thr) of the VP2 protein yielded a recombinant virus which was able to be passaged in CEFs, whereas the wild-type cDNAs and an amino acid substitution at residue 330 (Ser-->Arg) of the VP2 protein alone did not yield viable virus. The results indicated that mutation of other viral proteins, including VP1, VP3, VP4, and VP5, was not required for CEF adaptation of the virus. The same approach may be used to produce CEF-adapted strains from newly evolved IBDVs or to manipulate the antigenicity of the virus.  (+info)

Activation of baculovirus very late promoters by interaction with very late factor 1. (3/2581)

Very late factor 1 (VLF-1) of Autographa californica multicapsid nuclear polyhedrosis virus (AcMNPV) activates the transcription of two genes, polyhedrin (polh) and p10, during the final, occlusion-specific phase of infection. Using transient expression assays responsive to VLF-1, we identified linker scan mutations in the polh and p10 promoters which abolished or weakened the ability of the promoters to respond to stimulation by VLF-1. These mutations were located between the transcriptional and translational initiation sites, a region previously shown to be essential for the burst of expression during the very late phase. Addition of partially purified, epitope-tagged VLF-1 to DNA encompassing this "burst sequence" resulted in a shift in the gel electrophoretic mobility of the DNA, indicating that VLF-1 forms a complex with DNA. Addition of an antibody specific for the epitope tag of VLF-1 decreased the mobility of the DNA further, confirming the presence of VLF-1 in the complex. DNase I footprint assays revealed that VLF-1 partially purified from either insect cells or bacterial cells interacted with the burst sequences of both the polh and p10 very-late promoters. Linker scan mutations within the burst sequences severely impaired interaction between VLF-1 and the promoters. We propose that VLF-1 transactivates the polh and p10 promoters by interacting with the burst sequences.  (+info)

Critical relationship between glycosylation of recombinant lutropin receptor ectodomain and its secretion from baculovirus-infected insect cells. (4/2581)

The lutropin receptor ectodomain overexpressed under the control of the powerful polyhedrin promoter in baculovirus-infected Sf9 insect cells, is mainly found in an inactive, intracellularly-aggregated form. It is secreted in an active form under the control of the P10 promoter, a somewhat weaker and earlier promoter, at the price of a lower production. The apparent molecular masses of the two species encoded by the same cDNA are 48 kDa and 60-68 kDa, respectively. The relationship between the extent and type of glycosylation and the extracellular targeting for the recombinant lutropin receptor ectodomains was investigated precisely with endoglycosidases, lectins of various specificities, and a glycosylation inhibitor, and tested with monoclonal and polyclonal antibodies. The results indicate that the strong polyhedrin promoter probably overwhelms the processing capacity of the ER in Sf9 cells, so that only a high-mannose precursor is expressed in large amounts. Only a minute amount of protein is secreted, which has been processed by Sf9 exoglycosidases/glycosyltransferases and bears complex/hybrid oligosaccharides. The weaker P10 promoter allows secretion of a mature and active receptor ectodomain, bearing complex glycosylation. An important O-linked glycosylation is also added post-translationally on this species. In particular, beta-galactose and sialic acid residues were specifically detected in the secreted species, evidence of the induction of the corresponding glycosyltransferases or of their genes. These results suggest that Sf9 cells should eventually be engineered with chaperones and glycosyltransferases in order to improve the production of demanding glycoproteins such as the porcine lutropin ectodomain, so as to open the way to resolution of the three-dimensional structures of these receptors.  (+info)

Live-cell analysis of a green fluorescent protein-tagged herpes simplex virus infection. (5/2581)

Many stages of the herpes simplex virus maturation pathway have not yet been defined. In particular, little is known about the assembly of the virion tegument compartment and its subsequent incorporation into maturing virus particles. Here we describe the construction of a herpes simplex virus type 1 (HSV-1) recombinant in which we have replaced the gene encoding a major tegument protein, VP22, with a gene expressing a green fluorescent protein (GFP)-VP22 fusion protein (GFP-22). We show that this virus has growth properties identical to those of the parental virus and that newly synthesized GFP-22 is detectable in live cells as early as 3 h postinfection. Moreover, we show that GFP-22 is incorporated into the HSV-1 virion as efficiently as VP22, resulting in particles which are visible by fluorescence microscopy. Consequently, we have used time lapse confocal microscopy to monitor GFP-22 in live-cell infection, and we present time lapse animations of GFP-22 localization throughout the virus life cycle. These animations demonstrate that GFP-22 is present in a diffuse cytoplasmic location when it is initially expressed but evolves into particulate material which travels through an exclusively cytoplasmic pathway to the cell periphery. In this way, we have for the first time visualized the trafficking of a herpesvirus structural component within live, infected cells.  (+info)

Immunization with potato plants expressing VP60 protein protects against rabbit hemorrhagic disease virus. (6/2581)

The major structural protein VP60 of rabbit hemorrhagic disease virus (RHDV) has been produced in transgenic potato plants under the control of a cauliflower mosaic virus 35S promoter or a modified 35S promoter that included two copies of a strong transcriptional enhancer. Both types of promoters allowed the production of specific mRNAs and detectable levels of recombinant VP60, which were higher for the constructs carrying the modified 35S promoter. Rabbits immunized with leaf extracts from plants carrying this modified 35S promoter showed high anti-VP60 antibody titers and were fully protected against the hemorrhagic disease.  (+info)

Packaging cell lines for simian foamy virus type 1 vectors. (7/2581)

Foamy viruses are nonpathogenic retroviruses that offer several unique opportunities for gene transfer in various cell types from different species. We have previously demonstrated the utility of simian foamy virus type 1 (SFV-1) as a vector system by transient expression assay (M. Wu et al., J. Virol. 72:3451-3454, 1998). In this report, we describe the first stable packaging cell lines for foamy virus vectors based on SFV-1. We developed two packaging cell lines in which the helper DNA is placed under the control of either a constitutive cytomegalovirus (CMV) immediate-early gene or inducible tetracycline promoter for expression. Although the constitutive packaging expressing cell line had a higher copy number of packaging DNA, the inducible packaging cell line produced four times more vector particles. This result suggested that the structural gene products in the constitutively expressing packaging cell line were expressed at a level that is not toxic to the cells, and thus vector production was reduced. The SFV-1 vector in the presence of vesicular stomatitis virus envelope protein G (VSV-G) produced an insignificant level of transduction, indicating that foamy viruses could not be pseudotyped with VSV-G to generate high-titer vectors. The availability of stable packaging cell lines represents a step toward the use of an SFV-1 vector delivery system that will allow scaled-up production of vector stocks for gene therapy.  (+info)

Stable alphavirus packaging cell lines for Sindbis virus and Semliki Forest virus-derived vectors. (8/2581)

Alphavirus vectors are being developed for possible human vaccine and gene therapy applications. We have sought to advance this field by devising DNA-based vectors and approaches for the production of recombinant vector particles. In this work, we generated a panel of alphavirus vector packaging cell lines (PCLs). These cell lines were stably transformed with expression cassettes that constitutively produced RNA transcripts encoding the Sindbis virus structural proteins under the regulation of their native subgenomic RNA promoter. As such, translation of the structural proteins was highly inducible and was detected only after synthesis of an authentic subgenomic mRNA by the vector-encoded replicase proteins. Efficient production of biologically active vector particles occurred after introduction of Sindbis virus vectors into the PCLs. In one configuration, the capsid and envelope glycoproteins were separated into distinct cassettes, resulting in vector packaging levels of 10(7) infectious units/ml, but reducing the generation of contaminating replication-competent virus below the limit of detection. Vector particle seed stocks could be amplified after low multiplicity of infection of PCLs, again without generating replication-competent virus, suggesting utility for production of large-scale vector preparations. Furthermore, both Sindbis virus-based and Semliki Forest virus-based vectors could be packaged with similar efficiency, indicating the possibility of developing a single PCL for use with multiple alphavirus-derived vectors.  (+info)

Maringer, Kevin, Julianna Stylianou, and Gillian Elliott. A Network of Protein Interactions around the Herpes Simplex Virus Tegument Protein VP22. Journal of Virology 86.23 (2012): 12971-12982. Web. 06 April. 2020. ...
Herpesvirus maturation requires two different budding steps. First, capsids that were formed in the nucleus bud at the inner leaflet of the nuclear membrane, thereby acquiring a primary envelope which is subsequently lost by fusion with the outer leaflet. In this process, a complex of the UL31 primary tegument and UL34 primary envelope protein, which are conserved throughout the herpesviruses, plays an important role (1, 5, 8, 17, 28, 30, 32). Final maturation of virions then occurs in the cytoplasm by budding of intracytoplasmic capsids into Golgi-derived vesicles (10, 12; reviewed in reference 27). During this maturation process, more than 20 different tegument and envelope proteins are assembled into the mature virion. Recent data indicate that formation of mature virions follows an intricate network of protein-protein interactions with a surprising functional redundancy (reviewed in reference 27). Although the participating tegument and envelope proteins are largely known, knowledge of their ...
Diefenbach, Russel J; Fraefel, Cornel; Cunningham, Anthony L (2014). The interaction of HSV-1 tegument proteins pUL36 and pUL37: a novel target for antivirals that inhibit viral assembly. Future Virology:787-789. ...
4K70: Crystal Structure of the Herpesvirus Inner Tegument Protein UL37 Supports Its Essential Role in Control of Viral Trafficking.
Rabies Virus P Protein Interacts with STAT1 and Inhibits Interferon Signal Transduction Pathways: Rabies virus P protein is a cofactor of RNA polymerase. We inv
Author Summary Bacteriophages are extremely abundant and diverse biological entities. All phage particles are comprised of nucleic acids and structural proteins, with few other packaged proteins. Despite their simplicity and abundance, more than 70% of phage sequences in the viral Reference Sequence database encode proteins with unknown function based on FASTA annotations. As a result, the use of sequence similarity is often insufficient for detecting virus structural proteins among unknown viral sequences. Viral structural protein function is challenging to detect from sequence data because structural proteins possess few known conserved catalytic motifs and sequence domains. To address these issues we investigated the use of Artificial Neural Networks as an alternative means of predicting function. Here, we trained thousands of networks using the amino acid frequency of structural protein sequences and identified the optimal architectures with the highest accuracies. Some hypothetical protein
One amino acid change within a viral structural protein makes the difference between mild cases of brain damage and severe microcephaly in mice.. 0 Comments. ...
One amino acid change within a viral structural protein makes the difference between mild cases of brain damage and severe microcephaly in mice.. 0 Comments. ...
This enabled the expression of a foreign gene in addition to the virus polyhedrin. , 1988). Each foreign sequence was placed under the control of the native or duplicated polyhedrin gene promoter. Similar expression vectors were derived by using a combination of the polyhedrin and p10 gene promoters (Weyer and Possee, 1991). A copy of the p10 gene promoter was inserted upstream of the polyhedrin gene promoter. The influenza virus haernagglutinin o r neuraminidase gene was placed under the control of each promoter and co-synthesis achieved in recombinant virus-infected cells. The influenza virus haernagglutinin o r neuraminidase gene was placed under the control of each promoter and co-synthesis achieved in recombinant virus-infected cells. Baculovirus expression vectors are not limited to the production of two foreign proteins in insect cells. , 1990). Five bluetongue virus structural proteins have been co-expressed within the same cell by coinfection of two dual recombinants and one single ...
Laimbacher, A S; Fraefel, C (2014). HSV-1 Amplicon Vectors as Genetic Vaccines. In: Diefenbach, R J; Fraefel, C. Herpes Simplex Virus. New York: Springer, 99-115.. Melendez, M E; Fraefel, C; Epstein, A L (2014). Herpes Simplex Virus Type 1 (HSV-1)-Derived Amplicon Vectors. In: Diefenbach, R J; Fraefel, C. Herpes Simplex Virus. New York: Springer, 81-89.. Kelly, B J; Diefenbach, E; Fraefel, C; Diefenbach, R J (2012). Identification of host cell proteins which interact with herpes simplex virus type 1 tegument protein pUL37. Biochemical and Biophysical Research Communications (BBRC), 417(3):961-965.. Kelly, B J; Mijatov, Branka; Fraefel, C; Cunningham, A L; Diefenbach, R J (2011). Identification of a single amino acid residue which is critical for the interaction between HSV-1 inner tegument proteins pUL36 and pUL37. Virology:1-9.. Kelly, B J; Fraefel, C; Cunningham, A L; Diefenbach, R J (2009). Functional roles of the tegument proteins of herpes simplex virus type 1. Virus Research, ...
Genome map of SSV1. Open reading frames are shown as block arrows and labeled as in Palm et al. (1991). Virus structural protein genes (Reiter et al., 1987a) an
Biochemical properties and processing of the three major structural proteins of PRRS virus expressed by recombinant adenoviruses. Structural, functional and community aspects
Metrick, C.M., Koenigsberg, A.L., Heldwein, E.E. (2020) Conserved outer-tegument component UL11 from herpes simplex virus type 1 is an intrinsically disordered, RNA-binding protein. mBio. https://mbio.asm.org/content/11/3/e00810-20.. ​. Koenigsberg, A.L., Pitts, J.D. and Heldwein, E.E. (2020). Identification of buffer conditions for optimal thermostability and solubility of herpesviral protein UL37 using the Thermofluor assay. Bio-protocol. 10: e3662. doi: 10.21769/BioProtoc.3662. ​. ​​​​. 2019. ​. Hilterbrand, A.T. and Heldwein, E.E. (2019) Go go gadget glycoprotein!: HSV-1 draws on its sizeable glycoprotein tool kit to customize its diverse entry routes. PLoS Pathog. 15(5), e1007660. PMC6508585.. ​. ​. 2018. ​. Koenigsberg, A.L., and Heldwein, E.E. (2018) The dynamic nature of the conserved tegument protein UL37 of herpesviruses. J. Biol Chem. 293(41), 15827-15839. PMC6187633.. ​. Cooper R.S, Georgieva E.R., Borbat P.P., Freed J.H., Heldwein E.E. (2018) Structural basis ...
p>The checksum is a form of redundancy check that is calculated from the sequence. It is useful for tracking sequence updates.,/p> ,p>It should be noted that while, in theory, two different sequences could have the same checksum value, the likelihood that this would happen is extremely low.,/p> ,p>However UniProtKB may contain entries with identical sequences in case of multiple genes (paralogs).,/p> ,p>The checksum is computed as the sequence 64-bit Cyclic Redundancy Check value (CRC64) using the generator polynomial: x,sup>64,/sup> + x,sup>4,/sup> + x,sup>3,/sup> + x + 1. The algorithm is described in the ISO 3309 standard. ,/p> ,p class=publication>Press W.H., Flannery B.P., Teukolsky S.A. and Vetterling W.T.,br /> ,strong>Cyclic redundancy and other checksums,/strong>,br /> ,a href=http://www.nrbook.com/b/bookcpdf.php>Numerical recipes in C 2nd ed., pp896-902, Cambridge University Press (1993),/a>),/p> Checksum:i ...
VP12 sequence 7614 bps atatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacat gaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcgg ttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattg acgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgcccc attgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctggtttagtgaaccgt cagatccgctagagatccgcggccgctaatacgactcactatagggagagccgccaccatggataaaaag tattctattggtttagacatcggcactaattccgttggatgggctgtcataaccgatgaatacaaagtac cttcaaagaaatttaaggtgttggggaacacagaccgtcattcgattaaaaagaatcttatcggtgccct cctattcgatagtggcgaaacggcagaggcgactcgcctgaaacgaaccgctcggagaaggtatacacgt cgcaagaaccgaatatgttacttacaagaaatttttagcaatgagatggccaaagttgacgattctttct ttcaccgtttggaagagtccttccttgtcgaagaggacaagaaacatgaacggcaccccatctttggaaa catagtagatgaggtggcatatcatgaaaagtacccaacgatttatcacctcagaaaaaagctagttgac tcaactgataaagcggacctgaggttaatctacttggctcttgcccatatgataaagttccgtgggcact ...
Rabbit haemorrhagic disease virus (RHDV) belongs to the family Caliciviridae and is the etiological agent of the haemorrhagic disease, also known as rabbit plague. Its genome is a linear single-stranded (ss) RNA of 7437 nucleotides and the capsid is built from a single structural protein VP60. In connection with the discovery of new RHDV strains, there is a constant need to investigate the genetic variation of this virus and perform phylogenetic analyses which may show the evolutionary relationships among the RHDV strains. Studies on the divergence of RHDV have shown that it is genetically quite stable, although recent observations indicate that some new RHDV strains, significantly different from the original RHDV subtype and the new RHDVa subtype, are appearing. These latest findings suggest that a new group of RHDV strains has evolved. The present review summarizes the current knowledge on the genetic variation and the latest achievements in phylogenetic analyses of RHDV strains isolated in ...
Read Complete genome sequence of two rabbit hemorrhagic disease virus variant b isolates detected on the Iberian Peninsula, Archives of Virology on DeepDyve, the largest online rental service for scholarly research with thousands of academic publications available at your fingertips.
A veterinary laboratory confirmed the presence of Rabbit Hemorrhagic Disease virus type 2 in a wild black-tailed jackrabbit that was among 10 jackrabbits found dead on a property near Palm Springs, according to Californias Fish and Wildlife Department.
3C-like protease processes the polyprotein: 3CLpro-RdRp (p72) is first released by autocleavage, then all other proteins are cleaved.
Genome replication is a critical step in virus life cycles. Here, we analyzed the role of the infectious bursal disease virus (IBDV) VP3, a major component of ...
22] It is, as the appellant agreed at oral proceedings, common general knowledge that structural proteins of a virus, i.e. the proteins involved in formation of the viral capsid, or in the case of enveloped viruses, additionally those situated in the viral envelope, are potential candidates for the inclusion in subunit vaccines. This is so because structural proteins are present at the outside of the virion and are thus exposed to the immune system. Therefore, it is expected that upon infection with ISAV, antibodies are preferably elicited against these structural proteins and that these antibodies may achieve neutralization of the virus. Therefore, vaccine preparations containing, instead of for example the whole inactivated virus, only one (or more) of the structural proteins, i.e. so-called subunit vaccines, would also be expected to have the same effect, i.e. to elicit neutralizing antibodies ...
购买SV40 VP1兔多克隆抗体(ab53977),SV40 VP1抗体经WB,IP验证,11篇文献引用,2个独立用户反馈。产品出库一年都在质保范围内。中国现货速达。
TY - JOUR. T1 - Molecular epidemiology of rabbit haemorrhagic disease virus in Australia. T2 - When one became many. AU - Kovaliski, John. AU - Sinclair, Ron. AU - Mutze, Greg. AU - Peacock, David. AU - Strive, Tanja. AU - Abrantes, Joana. AU - Esteves, Pedro. AU - Holmes, Edward. PY - 2014/2. Y1 - 2014/2. N2 - Rabbit Haemorrhagic Disease Virus (RHDV) was introduced into Australia in 1995 as a biological control agent against the wild European rabbit (Oryctolagus cuniculus). We evaluated its evolution over a 16-year period (1995-2011) by examining 50 isolates collected throughout Australia, as well as the original inoculum strains. Phylogenetic analysis of capsid protein VP60 sequences of the Australian isolates, compared with those sampled globally, revealed that they form a monophyletic group with the inoculum strains (CAPM V-351 and RHDV351INOC). Strikingly, despite more than 3000 rereleases of RHDV351INOC since 1995, only a single viral lineage has sustained its transmission in the ...
During the past 50 years two readily distinguishable rabbit-specific diseases caused by Myxoma virus (MYXV) and Rabbit haemorrhagic disease virus (RHDV) respectively, have decimated wild rabbit populations worldwide. Combined with the use of these viruses as biocontrol agents, the consequences for farming, commercial rabbit breeding and rare habitat conservation dependent on rabbit grazing, have been both positive and negative. Moreover, rare predators that rely on rabbits as a food resource, and even hunters, have suffered the consequences of rabbit populations being affected by one or other of these viruses. Rabbit haemorrhagic disease virus was first identified after thousands of domestic rabbits died suddenly in China in 1984. Similar epidemics subsequently occurred in other regions of Asia, the Middle East, Europe and North America, suggesting that the virus had dispersed widely following its emergence in China. However, the discovery that RHDV had circulated apparently harmlessly for many ...
TY - JOUR. T1 - Comparative quantitative monitoring of rabbit haemorrhagic disease viruses in rabbit kittens. AU - Matthaei, Markus. AU - Kerr, Peter AU - READ, Andrew. AU - Hick, Paul. AU - Haboury, Stephanie. AU - Wright, John. AU - STRIVE, Tanja. PY - 2014. Y1 - 2014. N2 - Background: Only one strain (the Czech CAPM-v351) of rabbit haemorrhagic disease virus (RHDV) has been released in Australia and New Zealand to control pest populations of the European rabbit O. cuniculus. Antigenic variants of RHDV known as RHDVa strains are reportedly replacing RHDV strains in other parts of the world, and Australia is currently investigating the usefulness of RHDVa to complement rabbit biocontrol efforts in Australia and New Zealand. RHDV efficiently kills adult rabbits but not rabbit kittens, which are more resistant to RHD the younger they are and which may carry the virus without signs of disease for prolonged periods. These different infection patterns in young rabbits may significantly influence ...
Public, hunters and hikers asked to take precautions to avoid spreading deadly illness. East County News Service. Photo: Creative Commons-S.A. via Bing. May 13, 2020 (Palm Springs) - After 10 dead jackrabbits were found dead on a private property near Palm Springs, a carcass has tested positive for Rabbit Hemorrhagic Disease virus type 2 (RHDV2) which is highly contagious and often lethal to both wild and domestic rabbits, as well as hares and pikas. The virus has been confirmed in state and federal lab tests. ...
Infectious bursal disease virus (IBDV) is a birnavirus that infects the B-cells in the bursa of Fabricius of young chickens, causing Gumboro disease. The IBDV 114 kDa polyprotein (NH2-pVP2-VP4-VP3-COOH) is thought to be processed at 512Ala-Ala513 and 755Ala-Ala756 through the proteolytic activity of VP4, a serine protease which uses a Ser/Lys catalytic dyad, to release pVP2, VP4 and VP3. Precursor VP2 (pVP2) is further processed at its C-terminus to generate VP2 and structural peptides through the cleavage of the 441Ala-Phe442, 487Ala-Ala488, 494Ala-Ala495 and 501Ala-Ala502 peptide bonds to release VP2 and four structural peptides, pep46, pep7a, pep7b and pep11. While the processing at the 441Ala-Phe442 site was shown to be mediated by the endopeptidase activity of VP2, the processing at the other two sites is not well understood. The products resulting from the processing of the IBDV polyprotein were previously identified by anti-VP2 and anti-VP3 antibodies. The present study used anti-VP4 ...
Infectious bursal disease virus (IBDV) is a chicken pathogen that infects the bursa of Fabricius, an organ involved in the development of the immune system in chickens. Infection by the virus leads to destruction of the bursa and immunosuppression. Infection by virulent strains may result in mortality. Current methods to combat the virus involve the use of vaccines. These are usually a mixture of live attenuated and oil inactivated virus. Variant strains of the virus are able to escape the vaccine-generated antibodies. In addition, the vaccines result in damage to the bursa. Identification of a receptor for IBDV could result in the development of either treatment for the virus or superior vaccines by interfering with the attachment of the virus to host cells. Several methods for identifying IBDV binding proteins from the membranes of cells from the bursa of Fabricius were examined. Affinity chromatography of IBDV binding proteins with a matrix consisting of IBDV cross-linked to Sepharose 4B ...
Testing by the egg and poultry industries, Biosecurity New Zealand and a specialist overseas laboratory confirmed the presence of the chicken virus infectious bursal disease virus type 1 (IBDV-1) in layer hens at a South Island egg farm in September 2019.. The likely presence of the disease was first picked up by Mainland Poultry at its Waikouaiti farm in Otago through its regular, voluntary testing routine. No birds at the farm have shown any signs of sickness due to IBDV-1 infection. Results of testing from Mainland Poultrys Hillgrove site returned positive at this location. No other properties appear to be affected.. IBDV-1 was previously discovered in New Zealand in 1993. An industry-led programme has allowed New Zealand to claim absence from the disease. The virus is present in many other countries and they successfully manage it. ...
Read Efficient rescue of infectious bursal disease virus using a simplified RNA polymerase II-based reverse genetics strategy, Archives of Virology on DeepDyve, the largest online rental service for scholarly research with thousands of academic publications available at your fingertips.
The DNA polymerase genes of human cytomegalovirus (HCMV) and varicella-zoster virus (VZV) were inserted separately into the polyhedrin gene of Autographa californica nuclear polyhedrosis virus (AcNPV) by cotransfection of Spodoptera frugiperda (SF9) cells with baculovirus transfer vectors carrying the genes and AcNPV infectious DNA. Infection of SF9 cells with the recombinant viruses resulted in expression from the polyhedrin promoter of proteins of the expected Mrs. These proteins possessed DNA polymerase activities similar to that of the enzymes induced by the respective herpesvirus in infected cells, and were identified as HCMV and VZV DNA polymerase using inhibitors and specific antisera reactive with each enzyme.
But, with this Rabbit assignment, Ive really struggled. Even with my Pollyanna personality, I fear the light here is very faint, and Im not sure theres an end to the tunnel.
Antivector immunity continues to be recognized as a potential caveat of using virus-based vaccines. ability to stimulate humoral, cellular, and mucosal immune responses. Alphaviruses belong to the family and contain a positive-sense, single-stranded RNA genome of approximately 12 kb encoding four nonstructural proteins in the 5 two-thirds of the genome, followed by a strong subgenomic promoter that directs expression of the viral structural proteins in the 3 one-third of the genome. Upon contamination of a cell, the alphavirus nonstructural proteins are translated to create a polymerase complicated instantly, which initiates replication from the viral genome and high-level transcription through the subgenomic promoter and translation from the downstream structural proteins gene products, that leads to set up of progeny viral contaminants. Vaccine delivery vectors predicated on alphaviruses have already been created from Semliki Forest pathogen (SFV) (27), Sindbis (SIN) pathogen (7, 53), ...
Enveloped viruses enter cells by using their fusion proteins to merge the virus lipid envelope and the cell membrane. While crystal structures of the water-soluble ectodomains of many viral fusion proteins have been determined, the structure and assembly of the C-terminal transmembrane domain (TMD) remains poorly understood. Here we use solid-state NMR to determine the backbone conformation and oligomeric structure of the TMD of the parainfluenza virus 5 (PIV5) fusion protein. 13C chemical shifts indicate that the central leucine-rich segment of the TMD is α-helical in POPC/cholesterol membranes and POPE membranes, while the Ile- and Val-rich termini shift to the β-strand conformation in the POPE membrane ...
ABSTRACT Brachylaima mazzantii (Travassos, 1927) is known only from its original description. Until now, no attempt has been made… Expand ...
If you are a society or association member and require assistance with obtaining online access instructions please contact our Journal Customer Services team ...
We speculate that during the late stages of the viral life cycle when mostly structural proteins such as Gag are expressed, SDF-1 induced CXCR4 downregulation is attenuated resulting in the accumulation of densensitized CXCR4 within intracellular compartments ...
The structural protein that DNA wraps around - something very important if you are a 10 micrometer cheek cell and you need to package over a meter of DN...
Receptors, located on both the cell surface and within the cell, are the molecular targets through which drugs produce their beneficial effects in various disease states
TY - JOUR. T1 - Modulation of macrophages by infectious bursal disease virus. AU - Khatri, M.. AU - Sharma, J. M.. PY - 2007/7/1. Y1 - 2007/7/1. N2 - Infectious bursal disease is one of the most important naturally occurring viral diseases of chickens worldwide. The causative agent, infectious bursal disease virus (IBDV), belongs to the family Birnaviridae. This viruscauses an acute, highly contagious and immunosuppressive disease in chickens. The virus infects and destroys actively dividing IgM-bearing B cells. Although B cells are the principal targets for IBDV, recent data show that the virus also infects macrophages. IBDV-infected macrophages produce various cytokines and chemokines which may play an important role in the protection and/or pathogenesis of IBDV. In this review, the modulatory effects of IBDV on macrophages will be discussed.. AB - Infectious bursal disease is one of the most important naturally occurring viral diseases of chickens worldwide. The causative agent, infectious ...
The nucleotide sequence of genome segment A cDNA of the STC strain of infectious bursal disease virus (IBDV) was determined and compared with sequences of the homologous genome segment of the 002-73 strain of IBDV and the Jasper strain of infectious pancreatic necrosis virus (IPNV). The STC-IBDV genome segment A was determined to be 3262 base pairs (bp), which is close to the estimated total length of 3300 bp for genome segment A in IBDV, although there is no proof that it is the real length of this genome segment. The STC-IBDV genome segment A contains two major overlapping open reading frames (ORFs). The large ORF of 3036 bp predicts a polyprotein of M r 109358, whereas the small ORF is 435 bp and predicts a protein of M r 16550 in STC-IBDV. STC-IBDV and 002-73-IBDV polyproteins are closely related (97.4% amino acid homology). Most of the amino acid mismatches are in VP2 sequences, mainly within the area of the conformation-dependent epitope. Comparison with the Jasper-IPNV polyprotein reveals levels
Infectious bursal disease (IBD) is a highly contagious disease of young chickens between 3 and 6 weeks of age. It is caused by infectious bursal disease virus(IBDV) which occursworldwide affecting livelihoods of resource - compromised poor communities. In Zambia, there is scantily documented information on the epidemiology of IBD. In-depth knowledge on the epidemiology of IBD is needed for effective control measures. This study aimed at molecular detection of circulating IBDV strains, andknowledge assessment of farmers about the disease in Ndola, Kitwe, Kalulushi, Luanshya and Mufulira districts of the Copperbelt province. A cross-sectional purposive study was carried out in the Copperbelt province from February to March, 2015 to determine the occurrence of IBD. The identification of IBDV was done by reverse transcription polymerase chain reaction (RT-PCR) targeting the hypervariable domain (VP2-HVR). A semi-structured questionnaire was administered to 77 respondents who presented poultry ...
詹明才。1992。農桿菌轉殖水稻系統的建立。國立台灣大學農藝學研究所博士論文。 Alvarez, M.L., Pinyerd, H.L., Topal, E. and Cardineau, G.A. 2008. P19-dependent and P19-independent reversion of F1-V gene silencing in tomato.Plant Molecular Biology 68:61-79. Angel, C.A., Hsieh, Y.C., Schoelz, J.E. 2011. Comparative analysis of the capacity of tombusvirus P22 and P19 proteins to function as avirulence determinants in Nicotiana species. Molecular Plant-Microbe Interactions 24:91-99. Arnold, M., Durairaj, V., Mundt, E., Schulze, K., Breunig, K.D., Behrens, S.E.2012. Protective vaccination against infectious bursal disease virus with whole recombinant Kluyveromyces lactis yeast expressing the viral VP2 subunit. PLoS ONE 7:e42870. Azad, A. A. Mckern, N. M., Macreadie, I. G., Failla, P., Heine, H. G., Chapman, A., Ward, C. W., Fahey, K. J. 1991. Physicochemical and immunological characterization of recombinant host-protective antigen (VP2) of infectious bursal disease ...
The study aimed to identify putative virulence determinants for the exotic poultry pathogen infectious bursal disease virus. Results suggest that three specific amino acids in viral protein 2 influence viral pathogenicity, and as a consequence these were exploited for the development of two new molecular diagnostic assays that are currently undergoing evaluation ...
Yousif AA, Mohammad WA, Khodeir MH, Zeid AZ, el-Sanousi AA, Saber MS, Reda IM. 2006, Egypt J Immunol. 13(2):85-94.Department of Virology, Faculty of Veterinary Medicine, Cairo University, Giza, Egypt.Infectious bursal disease (IBD) is one of the most
The present invention relates to a non pathogenic vaccine comprising a recombinant Infectious Bursal Disease virus that includes a recombinant Segment A, designated as rD78GLSNSΔ, that includes sequences from D78 and GLS strains and wherein the NS protein is not expressed.
Aspartyl-Prolyl bonds in proteins could be selectively hydrolyzed with 75% formic aeid. The in situ aeidie cleavage procedure based on acid lability of Asp-Pro bonds is very important in sequence analysis of proteins and comparative studies of related or similar proteins, Limited cleavage of polyhedrin and virion 31k polypeptide which have the same molecalar weights in SDS-PAGE of Buzura suppresaria nuclear polyhedrosis virus by above method produced 4 and 8 bands, respectively. The results suggest that the...
Discussion. The level of MDA is high for chicks derived from immune hens at an early age, but it decreases rapidly after day 21. It is noteworthy that antibodies were present in the blood of the chicks until the end of the experiment, that is, day 28. Similar observations were reported by Zaheer, Naeem and Malik (2003). Wisniewska and Stosik (1999) demonstrated traces of MDA in the blood of chicks until days 11-19 and later at day 23 after hatching. Other researchers claimed that the antibodies persist up to day 28 (Hitchner 1971), day 29 (Wyeth & Cullen 1979), day 30 (Iordanides, Koumpate & Artopois 1991) and day 20 after hatching (Al Mayah & Al Mayah 2013; Chansiripornchai & Sasipreeyajan 2009). These substantial differences could be ascribed to the amount of antibodies transferred from hen to chick through the egg (Hamal et al. 2006; Rai et al. 2005). Rao et al. (1987) concluded that the MDA depends on the quantity of egg yolk.. Lukert and Saif (1997) noticed that the half-life of MDA to IBDV ...
The invention relates to a modified baculovirus wherein one of the two strong late promoters of the wild baculovirus is inactive, as well as to a method for obtaining such a modified baculovirus and to its application for obtaining vectors for the expression of exogenous genes. Said modified baculovirus is particularly deprived of the polyhedrin gene promoter and contains the protein P10 gene promoter.
PubMed comprises more than 30 million citations for biomedical literature from MEDLINE, life science journals, and online books. Citations may include links to full-text content from PubMed Central and publisher web sites.
PubMed comprises more than 30 million citations for biomedical literature from MEDLINE, life science journals, and online books. Citations may include links to full-text content from PubMed Central and publisher web sites.
Rabbit Hemorrhagic Disease virus type 2 is believed to have spread to the U.S. from Europe, and was first reported to have killed wild rabbits in New Mexico back in March.
Elastin is an important component in our skin, providing it with elasticity. It is a structural protein found throughout our bodies, even in our organs.
면역혈소판감소자색반병으로 진단되면 생명에 위험을 줄 수 있는 출혈이 있을 때 응급으로 혈소판 수혈을 하며 만성면역혈소판감소자색반병에서 혈소판 수가 20,000/uL 이하이거나 출혈이 있으면서 혈소판 수가 50,000/uL 이하인 경우 스테로이드 투여, 비장절제, 면역글로불린 투여, 면역억제제투여 등의 치료를 한다. 20년 전 혈소판감소증으로 내원하여 말초혈액도말 검사, 거대세포바이러스, 엡스타인-바바이러스, 인간 면역결핍 바이러스, 간염 혈청 검사, 항핵항체 검사에서 모두 음성으로 확인되었으며 골수 검사에서 거대핵세포 수가 약간 증가된 것을 포함하여 특이 소견이 없었고 수차례 확인하였으나 가족력도 없어 면역혈소판감소자색반병으로 진단하였고 출혈 소견이 있으며 혈소판 수가 20,000/uL미만이었기 때문에 스테로이드, 면역글로불린, 다나졸을 ...
The genome encodes viral structural proteins. Lipids are not reported. By itself, the genomic nucleic acid is infectious. No ... The 5'-end of the genome has a viral protein genome-linked (VPg). The 3'-terminus has a poly (A) tract. ...
Viral structural protein: Capsid protein has a molar mass of 59000-71000 Da; is the coat protein. Capsid protein has a ... The viral genome encodes viral structural protein. Virions consist of 1 structural protein(s) (major species located in the ... They are sharing some epitopes in the structural proteins. Luque, D.; González, J. M.; Gómez-Blanco, J.; Marabini, R.; Chichón ... Viral replication is cytoplasmic. Entry into the host cell is achieved by attachment to host receptors, which mediates ...
The viral genome encodes viral structural protein. Virions consist of 1 viral structural protein (major species), or 2 Viral ... Viral structural protein: Capsid protein has a molar mass of 58000-60000 Da; is the coat protein. Capsid protein has a ... and capsid protein precursor and small structural protein genes, complete cds, complete genome". Retrieved 29 October 2016. " ... structural proteins (detected in Norwalk virus, amyelosis chronic stunt virus and porcine enteric calicivirus located in the ...
Proteins constitute around 94% of the virus by weight. The viral genome encodes structural proteins and non-structural proteins ...
There are 4 genes that encode the viral structural proteins. They are "gag" encoding the structural internal virion proteins ... The viral proteins are synthesized initially as large precursors and are later processed into the mature proteins by ... In vitro assays have found that enJSRV does this by blocking various stages of the viral replication cycle. An example of this ... An additional open reading frame (ORF) was observed in the viral genome and has been called orfX and its function is undefined ...
The first is non-structural and encodes proteins (nsP1-nsP4) necessary for transcription and replication of viral RNA. The ... The four non-structural protein genes are encoded in the 5′ two-thirds of the genome, while the three structural proteins are ... This serves as template for the synthesis of viral structural proteins. Most alphaviruses have conserved domains involved in ... second encodes three structural proteins: the core nucleocapsid protein C, and the envelope proteins P62 and E1, which ...
They usually encode two open reading frames (ORF). The first ORF named gag is related to viral structural proteins. The second ... It is transcribed by RNA polymerase II to give an mRNA that codes for two proteins: ORF1 and ORF2, which are necessary for ... This process ends when the displaced strand is joined by its ends by the same replication protein. The second class of IR ... In addition it has also been shown that mosaic proteins are composed of mobile domains which have spread to different genes ...
E2 is a viral structural protein found in the hepatitis C virus. It is present on the viral envelope and functions as a host ... E1 and E2 protein regions that specifically bind to HepG2 cells". Journal of Hepatology. 36 (2): 254-62. doi:10.1016/S0168-8278 ... "Infectious hepatitis C virus pseudo-particles containing functional E1-E2 envelope protein complexes". The Journal of ... receptor binding protein, mediating entry into host cells. It is a key target for the design of entry inhibitors and vaccine ...
When all of the structural proteins have been produced, viral assembly takes place. The newly formed virus particles can be ... The DNA is encased in the viral core. Two lateral bodies are found outside the viral core, and are believed to hold the enzymes ... The most common medication used to treat Camelpox is Cidofovir, a broad spectrum anti-viral that acts by inhibiting the viral ... The viral genetic material is contained in double stranded linear DNA consisting of 202,182 tightly packed base pairs. ...
This viral genome codes for seven structural proteins and one non-structural protein. The gene order is 3′ - leader - NP - VP35 ... the mRNA is translated into individual viral proteins. These viral proteins are processed: a glycoprotein precursor (GP0) is ... Viral proteins VP40 and VP24 are located between the envelope and the nucleocapsid (see following), in the matrix space. At the ... As viral protein levels rise, a switch occurs from translation to replication. Using the negative-sense genomic RNA as a ...
"The non-structural protein μNS of piscine orthoreovirus (PRV) forms viral factory-like structures". Veterinary Research. 47 (1 ... S1-σ3 - Outer Clamp Protein (Capsid protein) & p13 - Cytotoxic Nonstructural Protein S2-σ2 - Core Clamp Protein S3-σNS - ... Outer Clamp Protein). Additionally, the outer layer has fiber proteins (σ1) that mediate viral attachment and entry into the ... Shell Protein (Inner capsid protein) L2-λ2 - Turret protein, guanyltransferase and methyltranferase, genome extrusion. L3-λ1 - ...
... (NP) is a structural protein which encapsidates the negative strand viral RNA. NP is one of the ...
ORF1 encodes the non-structural protein (NS1) and ORF2 encodes the viral capsid proteins (VP1/VP2). Inverted terminal repeats ... The NS1 protein possesses both helicase and ATPase domains. It has ~652 amino acids residues and a molecular weight of 70-75 ... Jones MS, Kapoor A, Lukashov VV, Simmonds P, Hecht F, et al (2005) New DNA viruses identified in patients with acute viral ... The function of this protein is not known. These viruses have been isolated from blood, liver, spleen, lymph node and bone ...
DIPs are composed of viral structural proteins and sets of DNA or RNA which are incomplete. These DIPs will interfere in ... Pseudotyping is combining a virus or a part of a virus (vector) with a foreign viral envelope protein. Doing this alters their ... Alice Huang, 1.[full citation needed] Huang, Alice S.; Baltimore, David (April 1970). "Defective Viral Particles and Viral ... At the time, biologists knew the central dogma to be DNA to RNA to protein, with DNA replication as the way to replicate ones ...
Some viral genes contain the code to make the structural proteins that form the virus particle. Other genes make non-structural ... virus particles is the stage where a cell uses viral messenger RNA in its protein synthesis systems to produce viral proteins. ... It does this by making the cell copy the virus's DNA or RNA, making viral proteins, which all assemble to form new virus ... Assembly takes place in the cell when the newly created viral proteins and nucleic acid combine to form hundreds of new virus ...
... mostly encoding structural proteins. Host translation shutoff performed by the viral 100K protein. Assembly of new virions in ... The genome codes for 40 proteins. Viral replication is nuclear. Entry into the host cell is achieved by attachment of the viral ... Import of the viral genome into host nucleus mediated by core protein VII. Transcription of early genes (E genes) by host RNA ... Microtubular transport toward nucleus of the viral genome still protected by the core protein VII and a partial capsid mainly ...
However, Rev is needed to export incompletely spliced mRNAs in order to produce the viral structural proteins.[citation needed ... structural proteins are Rev-dependent. The Rev protein is expressed as an early gene from completely spliced transcripts, so ... HIV-1 regulatory proteins (including Rev) are translated from completely processed mRNA transcripts, while structural proteins ... protein of human immunodeficiency virus type 1 affects viral mRNA and protein expression via a cis-acting sequence in the env ...
... the TBEV genome codes for ten viral proteins, three structural, and seven nonstructural (NS). The structural proteins are C ( ... Structural and nonstructural proteins are not required for the genome to be infectious. All viral proteins are expressed as a ... where it is processed on the cytosolic side by host peptidases and in the lumen by viral enzyme action. The viral proteins C, ... Newly replicated viral RNA genomes are then packaged by the C proteins while on the cytosolic side of the ER membrane, forming ...
Non structural protein VP5 is found in RNA segment A.[citation needed] The function of this small viral protein is unknown. It ... Analyses of viral proteins showed that VP2 is the major structural and immunogenic polypeptide of the virus. All neutralizing ... that is processed into the major structural proteins of the virion: VP2, VP3 (a minor structural component of the virus), and ... The protein can not be found in the virion. Viral replication is cytoplasmic. Entry into the host cell is achieved by cell ...
Late genes are expressed during the remainder of infection up to viral egress and typically code for structural proteins. While ... A variety of amino acid changes in the UL97 protein kinase and the viral DNA polymerase have been reported to cause drug ... Specific mutations in pUL97 can cause reduced phosphorylation activity of this viral protein kinase. Thus, fewer ... Synthesis of the viral double-stranded DNA genome occurs at the host cell nucleus within specialized viral replication ...
The viral proteins are translated as a single, long polypeptide, which is cleaved into the structural and nonstructural viral ... Structural proteins are encoded in the 5' region of the genome and non structural at the 3' end. This is the same for all ... Human rhinoviruses are composed of a capsid that contains four viral proteins, VP1, VP2, VP3 and VP4. VP1, VP2, and VP3 form ... A similar result was obtained with the VP1 protein. Like VP4, VP1 also occasionally "pokes" out of the viral particle, making ...
Hickman AB, Ronning DR, Kotin RM, Dyda F (2002). "Structural unity among viral origin binding proteins: crystal structure of ... Datta S, Larkin C, Schildbach JF (2003). "Structural insights into single-stranded DNA binding and cleavage by F factor TraI". ...
... producing all viral structural proteins. Assembly of progeny virions begins in cytoplasmic viral factories, producing a ... Viral replication is cytoplasmic. Entry into the host cell is achieved by attachment of the viral proteins to host ... Fusion of the viral envelope with the plasma membrane releases the viral core into the host cytoplasm. Expression of early- ... The viral core is completely uncoated as early expression ends, releasing the viral genome into the cytoplasm. At this point, ...
"The structural protein ODV-EC27 of Autographa californica nucleopolyhedrovirus is a multifunctional viral cyclin". Proceedings ... "Trafficking of ODV-E66 is mediated via a sorting motif and other viral proteins: Facilitated trafficking to the inner nuclear ... He was an editorial board member of Virology and the executive editor of Protein Expression and Purification. 1989 - Member of ... Braunagel, S. C.; Russell, W. K.; Rosas-Acosta, G.; Russell, D. H.; Summers, M. D. (2003). "Determination of the protein ...
They usually encode two open reading frames (ORF). The first ORF named gag is related to viral structural proteins. The second ... It is transcribed by RNA polymerase II to give an mRNA that codes for two proteins: ORF1 and ORF2, which are necessary for ... Helitron encoded proteins are composed of a rolling-circle (RC) replication initiator (Rep) and a DNA helicase (Hel) domain. ... Kolkman, J. A. & Stemmer, W. P. (2001). "Directed evolution of proteins by exon shuffling". Nat Biotechnol. 19 (5): 423-428. ...
There are 6 structural polypeptide proteins in the viral structure, three larger polypeptides named polypeptide III, ... Gene gp10 which encodes for the protein Lysin A, gene gp11 which encodes for the holin protein, and gene gp12 which encodes for ... The DNA is packaged and stored in the protein head of the phage in a linear fashion. But after infecting cells the linear ... Not all of these genes are protein coding, but the right arm likely encodes for DNA Polymerase, Haloperoxidase, potentially DNA ...
... producing all structural proteins. Assembly of progeny virions starts in cytoplasmic viral factories, producing an spherical ... Viral replication is cytoplasmic. Entry into the host cell is achieved by attachment of the viral proteins to host ... Early phase: early genes are transcribed in the cytoplasm by viral RNA polymerase. Early expression begins at 30 minutes post- ... "Viral Zone". ExPASy. Retrieved 15 June 2015. ICTV. "Virus Taxonomy: 2014 Release". Retrieved 15 June 2015. Viralzone: ...
... producing all structural proteins. Assembly of progeny virions starts in cytoplasmic viral factories, producing an spherical ... Viral replication is cytoplasmic. Entry into the host cell is achieved by attachment of the viral proteins to host ... "Viral Zone". ExPASy. Retrieved 15 June 2015. Viralzone: Parapoxvirus ICTV Virus Pathogen Database and Analysis Resource (ViPR ... Early phase: early genes are transcribed in the cytoplasm by viral RNA polymerase. Early expression begins at 30 minutes post- ...
... producing all structural proteins. Assembly of progeny virions starts in cytoplasmic viral factories, producing an spherical ... Viral replication is cytoplasmic. Entry into the host cell is achieved by attachment of the viral proteins to host ... The virus exits the host cell by microtubular outwards viral transport, and existing in occlusion bodies after cell death and ... Early phase: early genes are transcribed in the cytoplasm by viral RNA polymerase. Early expression begins at 30 minutes post- ...
As a result, structural proteins, resulting from polypeptide products of gag and gag-pol genes, that are necessary for the HIV ... Viral resistance[edit]. Many people were skeptical of being too hopeful with indinavir due to previous events that occurred ... Viral resistance to the drug leads to the drug becoming useless since the virus evolves to have cells that are able to resist ... This fear of viral resistance caused a lot of users to be wary of the drug.[5] ...
... which are then translated into structural and nonstructural proteins. The most abundant protein produced is the nucleoprotein, ... meningitis and other viral haemorrhagic fevers may resemble EVD.[1] Blood samples are tested for viral RNA, viral antibodies or ... which code for proteins with antiviral properties.[51] EBOV's V24 protein blocks the production of these antiviral proteins by ... The VP24 and VP35 structural proteins of EBOV play a key role in this interference. When a cell is infected with EBOV, ...
... protein itself is not lost).[16] Lentils have the second-highest ratio of protein per calorie of any legume, after soybeans. ... Kawaljit Singh Sandhu, Seung-Taik Lim Digestibility of legume starches as influenced by their physical and structural ... Viral diseases[edit]. Viral diseases. Bean (pea) leaf roll virus Beet western yellows virus ... Raw lentils are 8% water, 63% carbohydrates including 11% dietary fiber, 25% protein, and 1% fat (table). Lentils are a rich ...
"Dopamine-dependent neurodegeneration in rats induced by viral vector-mediated overexpression of the parkin target protein, ... Yagi M، Edelhoff S، Disteche CM، Roth GJ (July 1994). "Structural characterization and chromosomal location of the gene ... protein ligase and promotes the degradation of the synaptic vesicle-associated protein, CDCrel-1". Proceedings of the National ... Caltagarone J، Rhodes J، Honer WG، Bowser R (August 1998). "Localization of a novel septin protein, hCDCrel-1, in neurons of ...
Host proteases cut this polyprotein into three structural (C, prM, E) and seven nonstructural proteins (NS1, NS2A, NS2B, NS3, ... The sfRNAs are a result of incomplete degradation of the viral genome by the exonuclease and are important for viral ... and forms a complex with protein E. The immature particles are processed in the Golgi apparatus by the host protein furin, ... Other viral hemorrhagic fevers, such as Ebola virus, Lassa virus, Marburg virus, and Junin virus, must be excluded as the cause ...
The rest of the genome encodes structural proteins at the 5' end and non-structural proteins at the 3' end in a single ... VPg may also play an important role in specific recognition of viral genome by movement protein (MP). Movement proteins are non ... It has both icosahedral virus particles, viral RNA-dependent RNA polymerase and protease and viral replication proteins. But ... Picornaviruses have a viral protein (VPg) covalently linked to 5' end of their genomes instead of 7-methylguanosine cap like ...
This proposal is also supported by other work investigating protein structural relationships[75] and studies that suggest that ... the impact of viral infection is higher on archaea than on bacteria and virus-induced lysis of archaea accounts for up to one- ... Proteins related to the cytoskeleton components of other organisms exist in archaea,[89] and filaments form within their cells, ... January 2002). "Introns in protein-coding genes in Archaea". FEBS Lett. 510 (1-2): 27-30. doi:10.1016/S0014-5793(01)03219-7. ...
The TATA-binding protein (TBP) could also be targeted by viruses as a means of viral transcription.[6] ... Figure 1. TATA box structural elements. The TATA box consensus sequence is TATAWAW, where W is either A or T. ... and viral genes.[8][2] The TATA box was found in protein coding genes transcribed by RNA polymerase II.[2] ... TATA-binding protein (TBP) can be recruited in two ways, by SAGA, a cofactor for RNA polymerase II, or by TFIID.[11] When ...
A.D. Hershey and Martha Chase, "Independent Functions of Viral Protein and Nucleic Acid in Growth of Bacteriophage," J. General ... Leemor Joshua-Tor, structural biologist, Howard Hughes Medical Institute investigator, Member of the National Academy of ... the adenovirus E1A proteins bind to the retinoblastoma gene product". Nature. 334 (6178): 124-9. Bibcode:1988Natur.334..124W. ... a highly conserved protein complex that recognizes and binds to specific DNA sequences, marking starting points for replication ...
The NSm protein is a non-structural protein (not present in mature virion) and is critical to cell-to-cell movement within ... The N protein contributes to viral replication, and coats the genomic RNA within the virion. Presently the soybean thrips ( ... The NSs protein is also a non-structural protein and contributes to suppression of RNA silencing during plant infection. ... This virus codes proteins from the M and S segments in an ambisense manner, meaning that proteins are translated from both ...
"Nature Structural & Molecular Biology. 23 (6): 566-73. doi:10.1038/nsmb.3227. PMC 4899171. PMID 27159559.. ... Wilson J (December 2005). "Milk Intolerance: Lactose Intolerance and Cow's Milk Protein Allergy". Newborn and Infant Nursing ... Lactose intolerance is distinct from milk allergy, an immune response to cow's milk proteins. They may be distinguished in ... protein supplements (powders and bars), and even beers in the milk stout style. Some barbecue sauces and liquid cheeses used in ...
positive regulation of non-membrane spanning protein tyrosine kinase activity. • transmembrane receptor protein tyrosine kinase ... Overview of all the structural information available in the PDB for UniProt: P23560 (Brain-derived neurotrophic factor) at the ... of BDNF into the lateral ventricles doubled the population of newborn neurons in the adult rat olfactory bulb and viral ... Binding proteins: IGFBP (1, 2, 3, 4, 5, 6, 7). *Cleavage products/derivatives with unknown target: Glypromate (GPE, (1-3)IGF-1) ...
GO:0022415 viral process. • signal transduction. • immune system process. • viral entry into host cell. • negative regulation ... GO:0001948 protein binding. Cellular component. • integral component of membrane. • integral component of plasma membrane. • ... Section F, Structural Biology and Crystallization Communications. 66 (Pt 1): 29-31. doi:10.1107/S1744309109047915. PMC 2805530 ... Viral pathology[edit]. The most known ligand for CLEC5A is dengue virus (DV). Activated CLEC5A by binding to the dengue virion ...
R. L. Wysong (1976). "5: Origin of Proteins". The Creation-evolution Controversy (implications, Methodology and Survey of ... Norman Pirie FRS (1907-1997): British biochemist and virologist co-discoverer in 1936 of viral crystallization, an important ... "for their discoveries concerning the structural and functional organization of the cell"). In addition to peroxisome and ... for their studies of the structures of hemoglobin and globular proteins.[269] ...
structural periodicity, which permits modular assembly into enlarged genomes;. *lack of protein-coding ability, consistent with ... Through the process of viral infection into hosts the three domains of life evolved.[83][84] Another interesting proposal is ... and proteins hold no major structural role and are of peripheral functional importance. This was confirmed with the deciphering ... DNA and proteins seemed the dominant macromolecules in the living cell, with RNA only aiding in creating proteins from the DNA ...
Tokuriki N, Tawfik DS (October 2009). "Stability effects of mutations and protein evolvability". Current Opinion in Structural ... "Viral quasispecies evolution". Microbiology and Molecular Biology Reviews. 76 (2): 159-216. doi:10.1128/mmbr.05023-11. PMC ... Similarly, at the protein level, proteins that function as dimers may form a heterodimer composed of one protein from each ... This occurs when the amino acids within a protein interact. Due to the complexity of protein folding and activity, additive ...
WIPI2, a PtdIns(3)P binding protein of the WIPI (WD-repeat protein interacting with phosphoinositides) protein family, was ... these findings have not been examined in non-viral systems. ... with age and precedes cartilage cell death and structural ... Without efficient autophagy, neurons gather ubiquitinated protein aggregates and degrade. Ubiquitinated proteins are proteins ... This allows unneeded proteins to be degraded and the amino acids recycled for the synthesis of proteins that are essential for ...
Immunoglobulin-binding protein - Proteins such as protein A, protein G, and protein L that are capable of binding to antibodies ... Viral antigens[edit]. For virus-associated tumors, such as cervical cancer and a subset of head and neck cancers, epitopes ... The term antigen originally described a structural molecule that binds specifically to an antibody only in the form of native ... An autoantigen is usually a normal protein or protein complex (and sometimes DNA or RNA) that is recognized by the immune ...
Binding proteins: IGFBP (1, 2, 3, 4, 5, 6, 7). *Cleavage products/derivatives with unknown target: Glypromate (GPE, (1-3)IGF-1) ... A non-viral PDGF "bio patch" can regenerate missing or damaged bone by delivering DNA in a nano-sized particle directly into ... "Structural and functional studies on platelet-derived growth factor". EMBO J. 11 (12): 4251-4259. doi:10.1002/j.1460-2075.1992 ... a b Proto-Oncogene+Proteins+c-sis at the US National Library of Medicine Medical Subject Headings (MeSH) ...
Jeng WY, Wang NC, Lin MH, Lin CT, Liaw YC, Chang WJ, Liu CI, Liang PH, Wang AH (January 2011). "Structural and functional ... proteins. Beta-glucosidase catalyzes the hydrolysis of the glycosidic bonds to terminal non-reducing residues in beta-D- ... Journal of Structural Biology. 173 (1): 46-56. doi:10.1016/j.jsb.2010.07.008. PMID 20682343.. .mw-parser-output cite.citation{ ...
The structure of a virus is given by its coat of proteins, which surround the viral genome. Assembly of viral particles takes ... Genetic and Structural Analyses of Pea Embryo Invasion by Pea Seed-Borne Mosaic Virus". The Plant Cell. 6: 777-787. doi:10.2307 ... 2 viral proteins are expressed in this lipid envelope. It has been proposed that the viruses bind via these proteins and are ... Protein subunits can be placed around the circumference of a circle to form a disc. In the presence of the viral genome, the ...
CCR5 protein pripada familiji beta hemokinskih receptora, integralnih membranskih proteina.[2][3] On je G protein spregnuti ... 1998). „Structural interactions between chemokine receptors, gp120 Env and CD4". Semin. Immunol. 10 (3): 249-57. PMID 9653051. ... and internalization in viral-cell fusion and as targets for entry inhibitors". Biochim. Biophys. Acta. 1614 (1): 51-61. PMID ... CCR5 (C-C hemokinski receptor tip 5, CD195) je protein na površini belih krvnih zrnca. On je komponenta imunskog sistema koja ...
Integration occurs following production of the double-stranded viral DNA by the viral RNA/DNA-dependent DNA polymerase reverse ... All retroviral IN proteins contain three canonical domains, connected by flexible linkers: an N-terminal HH-CC zinc-binding ... Biochemical data and structural data suggest that retroviral IN functions as a tetramer (dimer-of-dimers). All three domains ... ends of the viral DNA to expose the invariant CA dinucleotides at both 3'-ends of the viral DNA. the strand transfer reaction, ...
A variant in the gene for tau protein called the H1 haplotype, located on chromosome 17, has been linked to PSP.[4] Nearly all ... a normal part of a brain cell's internal structural skeleton. These tangles are often different from those seen in Alzheimer's ... The cause of the condition is uncertain but involves accumulation of tau protein within the brain. Medications such as levodopa ... The neurons display neurofibrillary tangles (NFTs), which are clumps of tau protein, ...
... matrix 1 protein), M2, NS1 (non-structural protein 1), NS2 (other name is NEP, nuclear export protein), PA, PB1 (polymerase ... The central core contains the viral RNA genome and other viral proteins that package and protect this RNA. RNA tends to be ... which causes the core to disassemble and release the viral RNA and core proteins.[63] The viral RNA (vRNA) molecules, accessory ... or transported back into the nucleus to bind vRNA and form new viral genome particles (step 5a). Other viral proteins have ...
Glycans serve a variety of structural and functional roles in membrane and secreted proteins.[1] The majority of proteins ... glycosylation is often used by viruses to shield the underlying viral protein from immune recognition. A significant example is ... In addition to their function in protein folding and cellular attachment, the N-linked glycans of a protein can modulate a ... disorders of protein N-glycosylation, disorders of protein O-glycosylation, disorders of lipid glycosylation and disorders of ...
positive regulation of non-membrane spanning protein tyrosine kinase activity. • transmembrane receptor protein tyrosine kinase ... Xu X, Ye L, Ruan Q (March 2009). "Environmental enrichment induces synaptic structural modification after transient focal ... of BDNF into the lateral ventricles doubled the population of newborn neurons in the adult rat olfactory bulb and viral ... Binding proteins: IGFBP (1, 2, 3, 4, 5, 6, 7). *Cleavage products/derivatives with unknown target: Glypromate (GPE, (1-3)IGF-1) ...
The virus consists of four nonstructural proteins and three structural proteins.[12] The structural proteins are the capsid and ... viral coat protein, a variant called E1-A226V. This mutation potentially allows the virus to multiply more easily in mosquito ... viral antigen and viral RNA were found in macrophages in the synovial joint of a person experiencing a relapse of ... monocyte chemoattractant protein 1 (MCP-1), monokine induced by gamma interferon (MIG), and interferon gamma-induced protein 10 ...
... in viral infections. The fact that all known cell fusion molecules are viral in origin suggests that they have been vitally ... Felix Rey, of the Pasteur Institute in Paris has constructed the 3D structure of the EFF1 protein[39] and shown it does the ... Jamin, M, H Raveh-Barak, B Podbilewicz, FA Rey (2014) "Structural basis of eukaryotic cell-cell fusion" (Cell, Volume 157, ... Two viral components have been identified. The first is syncytin, which came from a virus. The second identified in 2007 is ...
... the core capsid protein, the viral polymerase, surface antigens-preS1, preS2, and S, the X protein and HBeAg. The X protein is ... thought to be non-structural. Its function and significance are poorly understood but it is suspected to be associated with ... Envelope Proteins[edit]. The hepatitis envelope proteins are composed of subunits made from the viral preS1, preS2, and S genes ... The "adhesion" step of the dynamic phase-in which an exterior viral protein stably interacts with a host cell protein- ...
Structural proteins in marine viral communities. Jennifer R. Brum, J. Cesar Ignacio-Espinoza, Eun-Hae Kim, Gareth Trubl, Robert ... Structural proteins in marine viral communities. Jennifer R. Brum, J. Cesar Ignacio-Espinoza, Eun-Hae Kim, Gareth Trubl, Robert ... Illuminating structural proteins in viral "dark matter" with metaproteomics Message Subject (Your Name) has sent you a message ... Illuminating structural proteins in viral "dark matter" with metaproteomics. Jennifer R. Brum, J. Cesar Ignacio-Espinoza, Eun- ...
A viral structural protein is a viral protein that is a structural component of the mature virus. Examples include the SARS ... March 2005). "Severe acute respiratory syndrome coronavirus 3a protein is a viral structural protein". J. Virol. 79 (5): 3182-6 ... "Severe acute respiratory syndrome coronavirus 7a accessory protein is a viral structural protein". J. Virol. 80 (15): 7287-94. ... Viral+Structural+Proteins at the US National Library of Medicine Medical Subject Headings (MeSH) Ito N, Mossel EC, Narayanan K ...
Viral structural protein function is challenging to detect from sequence data because structural proteins possess few known ... As a result, the use of sequence similarity is often insufficient for detecting virus structural proteins among unknown viral ... Here, we trained thousands of networks using the amino acid frequency of structural protein sequences and identified the ... with few other packaged proteins. Despite their simplicity and abundance, more than 70% of phage sequences in the viral ...
... Brady, Samantha Elizabeth ... These two conformations have been suggested to play a role in minus sense synthesis and viral protein translation, respectively ... ACCESS RESTRICTED TO THE UNIVERSITY OF MISSOURI AT REQUEST OF AUTHOR.] Understanding viral RNA structure and how it functions ... We determined that the 3X is in structural equilibrium between two states: an open conformation and a closed conformation. ...
In the unpackaged procapsid, the protein is situated in close proximity to the viral directed RNA polymerase, P2. Cryo-electron ... protein P8) has undergone partial disassembly exposing the proteins antigenic sites. ... We propose that monoclonal antibodies (Mabs) can be selected that serve as probe- reagents for viral assembly and structure. A ... microscopy difference maps from the species ϕ6 procapsid have demonstrated that P7 and P2 likely interact prior to viral RNA ...
SCoV 7a protein is a SCoV structural protein.To test whether SCoV 7a protein was a viral structural protein, SCoV that was ... Our data also indicated that the major viral structural proteins, i.e., S protein, M protein, N protein, and E protein, were ... Release of SCoV 7a protein in the presence of other viral structural proteins. 7a protein was coexpressed with S protein, M ... SCoV 3a protein was the first SCoV accessory protein identified as a viral structural protein (15, 37). Here, we further ...
Structural alteration of DNA induced by viral protein R of HIV-1 triggers the DNA damage response.. Authors:. ... Background: Viral protein R (Vpr) is an accessory protein of HIV-1, which is potentially involved in the infection of ... The human immunodeficiency virus type 1 (HIV-1) protein Vpr (viral protein R) arrests cells in the G2 phase of the cell cycle, ... encodes a virion-associated nuclear protein that plays an important role in the primary viral infection of resting macrophages ...
Summary The paper is to discuss the role of the non structural protein 1 also known as NSP1 which is found among the rotavirus ... The genome rotaviruses encode six structural proteins known as VPs and six non-structural proteins known as NSPs. Two sets of ... Biology Essay on The role of viral non-structural protein in avoiding the host innate immune response. ... This shows the role of viral non-structural protein in avoiding the host innate immune response (Geiss, 2002). The cells and ...
Structural-functional interactions of NS1-BP protein with the splicing and mRNA export machineries for viral and host gene ... These proteins have key functions in viral trafficking and budding. To uncover the NS1-BP structural and functional activities ... The viral M1 mRNA encodes the M1 matrix protein and is alternatively spliced into the M2 mRNA, which is translated into the M2 ... virulence factor NS1 protein interacts with the cellular NS1-BP protein to promote splicing and nuclear export of the viral M ...
To establish the function of SARS NSP1 protein in translation regulation we attempted the identification of NSP1 protein ... Translational control during viral infection, investigating the role of severe acute respiratory syndrome non-structural ... where we investigated the role of Severe Acute Respiratory Syndrome non-structural protein 1 and Enterovirus 71 Internal ... investigating the role of severe acute respiratory syndrome non-structural protein 1 and enterovirus 71 internal ribosome entry ...
Flexible Viruses: Structural Disorder in Viral Proteins Vladimir Uversky, Sonia Longhi. E-Book Information about E-books:. *E- ...
Viral Replicate/Non-Structural Proteins/Enzymes. August 2020. *Articles to be added shortly ... NEW Structural basis for translational shutdown and immune evasion by the Nsp1 protein of SARS-CoV-2. ... Phylogenetic Analysis and Structural Modeling of SARS-CoV-2 Spike Protein Reveals an Evolutionary Distinct and Proteolytically- ... Evidence for structural protein damage and membrane lipid remodeling in red blood cells from COVID-19 patients. ...
A yeast two-hybrid screen did not reveal interactions between EAV nsp1 and other viral non-structural proteins or the ... The interaction of nsp1 with one of these proteins, p100, a transcription co-activator that also interacts with regulatory ... nucleocapsid protein, although both nsp1 and the nucleocapsid protein were found to form homomers. Subsequently, a yeast two- ... is essential for viral subgenomic mRNA synthesis, but fully dispensable for genome replication. However, at the molecular level ...
Herein, we report the identification of putative promoters for the non-structural proteins (NS) and capsid structural proteins ... Herein, we report the identification of putative promoters for the non-structural proteins (NS) and capsid structural proteins ... Herein, we report the identification of putative promoters for the non-structural proteins (NS) and capsid structural proteins ... Herein, we report the identification of putative promoters for the non-structural proteins (NS) and capsid structural proteins ...
Viral Structural Proteins. Enveloped viruses comprise a protein-nucleic acid core covered by a membrane bilayer with integral ... It is known that antiviral agents against human rhinovirus (HRV) inhibit uncoating of the viral capsid, a process to release ... NMR studies by the research group of Post to define the structure and dynamics of flavivirus capsid protein, and the ... 2004) Solution structure of dengue virus capsid protein reveals another fold. Proc Natl Acad Sci U S A 101: 3414-3419. doi: ...
STRUCTURAL DYNAMICS OF VIRAL PROTEINS: COMPUTATIONAL INVESTIGATION OF CAPSIDS, LYTIC PEPTIDES AND NUCLEOPROTEINS UNDER VARYING ... This proposal is concerned with understanding the mechanisms of recognition of viral RNA by the Lassa nucleoprotein and the ... Significant findings from these studies will include detailed structural and energetic information regarding these infection ... related processes, which will be valuable in the development of anti-viral therapies against non-enveloped viruses. The second ...
Structural analysis of viral proteins that have been captured and repurposed by the host.. Supervisor. Richard L Kingston ... Structural analysis of viral proteins that have been captured and repurposed by the host. ... The project is suitable for someone with a good background in protein science, and a strong interest in structural analysis of ... In this project, we aim to study the structural details of proteins involved in the biosynthesis of two novel antibiotics. We ...
Immunotherapeutic strategies that overcome tolerance and boost these suboptimal responses may lead to viral clearance in ... Immunogenicity and tolerogenicity of hepatitis B virus structural and nonstructural proteins: Implications for immunotherapy of ... Interestingly, the mice were tolerant to the ENV but not to the POL proteins at the CTL level. Furthermore, the POL-specific ... The present study was performed to compare the relative immunogenicities and tolerogenicities of HBV structural (envelope [ENV ...
Structural basis for chemokine recognition and activation of a viral G protein-coupled receptor Mar. 5, 2015. ... Viral entry route determines how human plasmacytoid dendritic cells produce type I interferons Mar. 2, 2015. ...
Here, we show that 2A binds directly to the frameshift-stimulatory element in the viral RNA with nanomolar affinity and ... in cardioviruses is activated by the 2A protein: a multi-functional virulence factor that also inhibits cap-dependent ... Structural and molecular basis for Cardiovirus 2A protein as a viral gene expression switch. Published:. 02-03-2021, Version 2 ...
Color denotes structural compartment of the virion for each protein; grey denotes non-structural viral proteins. (B) Schematic ... We identified interactions among viral capsid and tegument proteins, detecting phosphorylation of the capsid protein VP26 at ... DNA methyltransferase DNMT3A associates with viral proteins and impacts HSV-1 infection.. Rowles DL1, Tsai YC1, Greco TM1, Lin ... Interestingly, we found a nuclear association between viral capsid proteins and the de novo DNA methyltransferase DNA (cytosine ...
Viral Structural Proteins * beta lysin, human * enterotoxin A, Staphylococcal * Sphingomyelin Phosphodiesterase * hlb protein, ...
Protein Chaperones and Protection from Neurodegenerative Diseases - Author: Uversky, Vladimir - Price: 146,75€ ... Flexible Viruses: Structural Disorder in Viral Proteins. Longhi, Sonia. 160,80€. Protein Misfolding Diseases: Current and ... Protein Aggregation in Bacteria: Functional and Structural Properties of Inclusion Bodies in Bacterial Cells. Doglia, Silvia ... Examining how different protein chaperones ameliorate the toxicity of proteins that are known to cause neurodegenerative damage ...
1995) Structural characterization of viral fusion proteins. Curr Biol 5:265-274.. ... 2004) Class I, class II viral fusion protein structures reveal similar principles in membrane fusion. Mol Membr Biol 21:361-371 ... The protein was purified from SFM II (Invitrogen) with protein A-Sepharose beads, eluted with 3 M MgCl2, dialyzed in PBS, and ... The GP2 subunit is a transmembrane protein that mediates fusion of the viral and cellular membranes after internalization of ...
... selfish replicators acquiring structural proteins from cells, enabling them to form virions. ... selfish replicons gave rise to viruses by recruiting host proteins for virion formation. We also propose that new groups of ... viruses have repeatedly emerged at all stages of the evolution of life, often through the displacement of ancestral structural ... for viral genome replication and virion morphogenesis. Here, we outline a chimeric scenario under which different types of ...
The viral structural protein, shown in green, accumulates in button-shaped structures at the contact sites. ... The viral structural protein, shown in green, accumulates in button-shaped structures at the contact sites.. by. Brittany ...
... is essential for viral replication. The C-terminal residues (amino acids 1220-1242) of pUL54 have been reporte … ... DNA polymerase pUL54 is a 1242-amino-acid protein, whose function, stimulated by the processivity factor, phosphoprotein UL44 ( ... Recombinant Fusion Proteins / metabolism * Viral Structural Proteins / genetics * Viral Structural Proteins / metabolism* ... The catalytic subunit of human cytomegalovirus (HCMV) DNA polymerase pUL54 is a 1242-amino-acid protein, whose function, ...
The ability of μNS to recruit other PRV proteins into globular inclusions indicates that it is the main viral protein involved ... The PRV genome comprises ten double-stranded RNA segments encoding at least eight structural and two non-structural proteins. ... the putative site of viral replication. For the mammalian reovirus (MRV), the non-structural protein μNS is the primary ... The analogous PRV protein was the focus of the present study. The subcellular location of PRV μNS and its co-localization with ...
Severe acute respiratory syndrome coronavirus 7a accessory protein is a viral structural protein. / Huang, Cheng; Ito, Naoto; ... Severe acute respiratory syndrome coronavirus 7a accessory protein is a viral structural protein. Journal of Virology. 2006 Aug ... Severe acute respiratory syndrome coronavirus 7a accessory protein is a viral structural protein. In: Journal of Virology. 2006 ... title = "Severe acute respiratory syndrome coronavirus 7a accessory protein is a viral structural protein", ...
Disciplines: Structural Biology - NMR - Biochemistry - Viral proteins. Team: Protein Solid-State NMR, PI: Anja Böckmann. ... We focus on viral proteins, since they are exciting molecules which often group a variety of functions in a single protein, ... Research Associate in NMR Spectroscopy and Protein Chemistry. *Research Associate in NMR studies of viral-cellular protein ... Research Associate in NMR Spectroscopy and Protein Chemistry. *Research Associate in NMR studies of viral-cellular protein ...
  • Deletion of open reading frames 3a, 3b, 6, and 7a, either alone or in combination, does not affect the virus replication significantly in cell culture ( 45 ), demonstrating that these SCoV accessory proteins are not essential for virus replication in cell culture. (asm.org)
  • The NSPs function together in the dsRNA replication to translate and transcribe the viral mRNA and maturation of the viral particles. (write-right.net)
  • Non-structural protein 1 (nsp1), the N-terminal subunit of the replicase polyprotein of the arterivirus Equine arteritis virus (EAV), is essential for viral subgenomic mRNA synthesis, but fully dispensable for genome replication. (microbiologyresearch.org)
  • This proposal is concerned with understanding the mechanisms of recognition of viral RNA by the Lassa nucleoprotein and the formation of the ribonucleoprotein complex, which is essential for viral replication and transcription. (midasnetwork.us)
  • Furthermore, the POL-specific CTLs had no impact on HBV replication or liver function in vivo, even though they were readily induced and reached the liver after DNA immunization, reflecting their relatively low avidity and the low level at which the POL protein is expressed by the hepatocyte. (scripps.edu)
  • These changes can act to promote viral replication or host defense. (nih.gov)
  • These classical scenarios give different timelines for the origin(s) of viruses and do not explain the provenance of the two key functional modules that are responsible, respectively, for viral genome replication and virion morphogenesis. (nature.com)
  • We also propose that new groups of viruses have repeatedly emerged at all stages of the evolution of life, often through the displacement of ancestral structural and genome replication genes. (nature.com)
  • Fig. 2: Evolution of viral and cellular replication modules from the ancestral RNA recognition motif. (nature.com)
  • The catalytic subunit of human cytomegalovirus (HCMV) DNA polymerase pUL54 is a 1242-amino-acid protein, whose function, stimulated by the processivity factor, phosphoprotein UL44 (ppUL44), is essential for viral replication. (nih.gov)
  • the putative site of viral replication. (biomedcentral.com)
  • The factory scaffold facilitates spatial coordination of viral genome replication and assembly with the use of cell resources [ 18 ]. (biomedcentral.com)
  • According to their practical correlations, the practical groups were summarized into five major cellular pathways that were controlled by nsp11: histone-related proteins, cell cycle and DNA replication pathways, MAPK signaling pathways, ubiquitin-proteasome pathways, and complementary pathways (Table 1). (lecollege.org)
  • In particular, we welcome papers that focus on the molecular, cellular or structural biology of virus-host interactions, virus replication/gene expression, bacterial, archaeal, fungal and animal model studies of virus infections, viral populations and evolution, epidemiology, drug/vaccine development against animal viruses. (frontiersin.org)
  • The polyprotein is processed by host cell and viral proteases into three major structural proteins and several non structural proteins necessary for viral replication. (abcam.com)
  • NS5A plays an important role in viral replication and particle formation. (ibs.fr)
  • Despite decades of research on the influenza virus, much remains unknown about the formation of filamentous influenza viruses and their role in the viral replication cycle. (springer.com)
  • Haemagglutinin (HA), neuraminidase (NA), nucleoprotein (NP) and matrix proteins one and two (M1 and M2) are primarily structural proteins with additional functional roles, whilst the polymerase subunits (PB1, PB2 and PA) and the non-structural proteins (NS1 and NS2) serve mainly function roles during virus replication. (springer.com)
  • The early protein VP5 plays a crucial role in IBDV infection by inhibiting apoptosis in the early stage of viral infection ( 9 ) and accumulates within the host plasma membrane, thus contributing to cell lysis in the late stage of viral replication ( 10 ). (mcponline.org)
  • During the replication of flaviviruses, proteolytic cleavages of the polyprotein by viral protease and a number of cellular enzymes occur in distinct subcellular compartments ( 27 , 32 ). (asm.org)
  • Recently, in addition of subgenomic replication system, hepatitis C virus full-length RNA replication has been possible, and a few cell culture systems producing viral particles have been produced. (nii.ac.jp)
  • Other possible agents for reducing viral replication such as cyclophyllin inhibitors, inhibitors of sphingomyelin synthesis, HMG-CoA reductase inhibitors, or RNA-dependent RNA polymerase inhibitors have been also investigated. (nii.ac.jp)
  • Some of these proteins may play roles within the infected cell during VIRUS REPLICATION or act in regulation of virus replication or VIRUS ASSEMBLY. (harvard.edu)
  • Non-structural proteins are involved in the transcription and replication of the virus. (medsci.org)
  • Maintaining an appropriate balance in the amounts of each of these structural proteins produced during viral infection appears to be critical for normal phage T4 morphogenesis. (wikipedia.org)
  • Viral protein R (Vpr) is an accessory protein of HIV-1, which is potentially involved in the infection of macrophages and the induction of the ataxia-telangiectasia and Rad3-related protein (ATR)-mediated DNA damage response (DDR). (pubfacts.com)
  • The findings of this study indicate that Vpr-induced structural alteration of DNA is a primary event that triggers both DDR and DSB, which ultimately contributes to HIV-1 infection. (pubfacts.com)
  • The main reason for understanding the pathogenic mechanism in the infection of the rotavirus is to identify the strategies used by novels in developing new vaccines and antiviral reagents especially the subverting of the rotavirus and evasion of host anti viral responses (Estes , 2006). (write-right.net)
  • The host cells will respond to the viral infection through the production of IFNs, which will further trigger other various genes to express themselves through involving themselves in responding to Activator of Transcription (JAK/STAT) and Janus Kinase/Signal Transducer pathway (Bergmann, et al, 2000). (write-right.net)
  • Translational control during viral infection, investigating the role of severe acute respiratory syndrome non-structural protein 1 and enterovirus 71 internal ribosome entry site. (surrey.ac.uk)
  • This thesis focused on translational control during viral infection, where we investigated the role of Severe Acute Respiratory Syndrome non-structural protein 1 and Enterovirus 71 Internal Ribosome Entry Site in this process. (surrey.ac.uk)
  • It is known that antiviral agents against human rhinovirus (HRV) inhibit uncoating of the viral capsid, a process to release genomic RNA during infection. (purdue.edu)
  • Significant findings from these studies will include detailed structural and energetic information regarding these infection related processes, which will be valuable in the development of anti-viral therapies against non-enveloped viruses. (midasnetwork.us)
  • Persistent hepatitis B virus (HBV) infection is characterized by a weak and narrowly focused CD8+ T-cell response to HBV that is thought to reflect the induction of central and/or peripheral tolerance to HBV proteins in neonatal and adult onset infections, respectively. (scripps.edu)
  • The present study was performed to compare the relative immunogenicities and tolerogenicities of HBV structural (envelope [ENV]) and nonstructural (polymerase [POL]) proteins at the CD8+ cytotoxic T lymphocyte (CTL) level in transgenic mice that replicate HBV in the liver and secrete infectious virus into the blood, thus representing an excellent model of persistent HBV infection. (scripps.edu)
  • DNA methyltransferase DNMT3A associates with viral proteins and impacts HSV-1 infection. (nih.gov)
  • Here, we used fluorescently-labeled viruses in conjunction with immunoaffinity purification and MS to study virus-virus and virus-host protein interactions during HSV-1 infection in primary human fibroblasts. (nih.gov)
  • Altogether, our results highlight a functional association of viral proteins with the mammalian DNA methyltransferase machinery, pointing to DNMT3A as a host factor required for effective HSV-1 infection. (nih.gov)
  • The viral factory inclusions seen during MRV infection consist of viral dsRNA, viral proteins, partially and fully assembled viral particles, microtubules and thinner filaments suggested to be intermediate structures [ 20 ]. (biomedcentral.com)
  • Flaviviruses do not shut down the translation of host mRNA during infection, so work to understand the mechanisms that flaviviruses manipulate to compete with host mRNA for access to the translational apparatus will provide important insight into the function of the viral RNA. (mdpi.com)
  • HCV is a chronic viral infection, and targeting host factors might result in drugs with severe adverse effects. (mcponline.org)
  • Viral adaptation through mutation will continue as new treatment options are employed and current treatment options are expanded into areas of endemic infection. (cdc.gov)
  • Chemokines are small chemoattractant proteins that bind to chemokine receptors, which are members of the family of G protein-coupled receptors (GPCRs), to stimulate the directed migration of immune cells to sites of infection or inflammation. (sciencemag.org)
  • We discuss these results and speculate on the consequences of viral morphology during influenza virus infection of the human respiratory tract. (springer.com)
  • Health officials have linked viral infection during pregnancy to congenital brain abnormalities, including microcephaly, during fetal development. (the-scientist.com)
  • Single-stranded PPP-RNAs, which lack 2'-O-methylation of the 5' cap and bear a 5'-triphosphate group instead, are specific from viruses, providing a molecular signature to distinguish between self and non-self mRNAs by the host during viral infection. (genecards.org)
  • Although a viral infection activates the immune system's response that eradicates the pathogen mainly through inflammatory mechanisms, it is now recognized that this inflammatory condition is also favorable to the development of tumors. (hindawi.com)
  • It can develop after a bacterial, parasitic, or viral infection [ 1 ]. (hindawi.com)
  • The viral infection or the presence of a tumor cell activates the immune system's response involving a wide range of components that are resumed under two general responses: the "innate immune response" involving mainly neutrophils, monocytes, and dendritic cells and the "adaptive immune response" which implies B and T lymphocytes. (hindawi.com)
  • A preventive DNA vaccine encoding two Zika structural proteins protected Rhesus macaques from viral infection. (the-scientist.com)
  • The effect of infectious bursal disease virus (IBDV) infection on cellular protein expression is essential for viral pathogenesis. (mcponline.org)
  • Comparative analysis of multiple 2-DE gels revealed that the majority of protein expression changes appeared at 48 and 96 h after IBDV infection. (mcponline.org)
  • Mass spectrometry identified 51 altered cellular proteins, including 13 up-regulated proteins and 38 down-regulated proteins 12-96 h after infection. (mcponline.org)
  • Notably 2-DE analysis revealed that IBDV infection induced the increased expression of polyubiquitin, apolipoprotein A-I, heat shock 27-kDa protein 1, actins, tubulins, eukaryotic translation initiation factor 4A isoform 2, acidic ribosomal phosphoprotein, and ribosomal protein SA isoform 2. (mcponline.org)
  • In addition, IBDV infection considerably suppressed those cellular proteins involved in ubiquitin-mediated protein degradation, energy metabolism, intermediate filaments, host translational apparatus, and signal transduction. (mcponline.org)
  • Western blot further confirmed the inhibition of Rho protein GDP dissociation inhibitor expression and the induction of polyubiquitin during IBDV infection. (mcponline.org)
  • Subcellular distribution analysis of the cytoskeletal proteins vimentin and β-tubulin clearly demonstrated that IBDV infection induced the disruption of the vimentin network and microtubules late in IBDV infection. (mcponline.org)
  • Thus, this work effectively provides useful dynamic protein-related information to facilitate further investigation of the underlying mechanism of IBDV infection and pathogenesis. (mcponline.org)
  • The mRNA abundance is not always consistent with the protein level ( 12 ), and viral infection results in post-translational modifications, such as ubiquitination ( 13 ), phosphorylation, and glycosylation ( 14 ) without affecting their transcription rates. (mcponline.org)
  • Therefore, the proteomics analysis of host cellular responses to virus infection is more likely to probe potential cellular factors involved directly or indirectly in viral infection and to identify potential drug targets of antiviral treatment. (mcponline.org)
  • To date, a small but increasing number of studies have used proteomics approaches to reveal the effects of viral infection on the cellular proteome ( 15 ). (mcponline.org)
  • The pathogenesis of viral infection and rational antiviral drug design. (harvard.edu)
  • The first type involves the detection of acute viral infection by detecting viral components. (enzolifesciences.com)
  • The second type is serological testing using immunogenic methods to detect antibodies specific to SARS-CoV-2 proteins that the body produces in response to an infection. (enzolifesciences.com)
  • Marine viruses are abundant and have substantial ecosystem impacts, yet their study is hampered by the dominance of unannotated viral genes. (pnas.org)
  • The five most abundant protein groups comprised 67% of the metaproteomes and were tentatively identified as capsid proteins of predominantly unknown viruses, all of which putatively contain a protein fold that may be the most abundant biological structure on Earth. (pnas.org)
  • Viruses are ecologically important, yet environmental virology is limited by dominance of unannotated genomic sequences representing taxonomic and functional "viral dark matter. (pnas.org)
  • Furthermore, four of the five most abundant PCs in the metaproteome represent capsid proteins containing the HK97-like protein fold previously found in many viruses that infect all three domains of life. (pnas.org)
  • Some of the viruses have evolved their viral product that suppresses the mediation of IFN signaling pathways by counteracting their responses, which are induced by IFN-α/β. (write-right.net)
  • The interaction of nsp1 with one of these proteins, p100, a transcription co-activator that also interacts with regulatory proteins of other viruses, was confirmed by mutual co-immunoprecipitation from lysates of EAV-susceptible mammalian cells. (microbiologyresearch.org)
  • Enveloped viruses comprise a protein-nucleic acid core covered by a membrane bilayer with integral membrane receptor proteins. (purdue.edu)
  • Here, we outline a 'chimeric' scenario under which different types of primordial, selfish replicons gave rise to viruses by recruiting host proteins for virion formation. (nature.com)
  • Conway, James F 2005-04-01 00:00:00 For many viruses, the final stage of assembly involves structural transitions that convert an innocuous precursor particle into an infectious agent. (deepdyve.com)
  • Viruses are often characterized by a small genome, only coding for a few proteins. (ibs.fr)
  • T Cell Responses to Nonstructural Protein 3 Distinguish Infections by Dengue and Zika Viruses. (harvard.edu)
  • Higher viral antigen positive cell frequencies were observed for DENV2 when compared with both vaccine viruses. (scielo.br)
  • During assembly of the bacteriophage (phage) T4 virion, the structural proteins encoded by the phage genes interact with each other in a characteristic sequence. (wikipedia.org)
  • The two-hybrid system: a method to identify and clone genes for proteins that interact with a protein of interest. (microbiologyresearch.org)
  • In addition it has also been shown that mosaic proteins are composed of mobile domains which have spread to different genes during evolution and which are capable of folding themselves. (wikipedia.org)
  • Capripoxviruses (CaPVs) have been shown to be ideal viral vectors for the development of recombinant multivalent vaccines to enable delivery of immunogenic genes from ruminant pathogens. (bireme.br)
  • Each gene codes for one protein, except genes 9 and 11, which each code for two proteins. (bionity.com)
  • While this gene overlap may constrain some viral variability, mutant or variant forms have been identified for all 4 genes ( 2 ). (cdc.gov)
  • Moreover 38 corresponding genes of the differentially expressed proteins were quantitated by real time RT-PCR to examine the transcriptional profiles between infected and uninfected chicken embryo fibroblasts. (mcponline.org)
  • The virus genome contains 10 genes, some of which encode polyproteins which are split into multiple functional proteins after translation, resulting in a total of approximately 24-27 viral proteins. (enzolifesciences.com)
  • This is generally done by the detection of viral RNA genes with molecular genetic methods. (enzolifesciences.com)
  • Interestingly, not only the protocol may vary, but also which viral genes are detected. (enzolifesciences.com)
  • Most countries' health care and disease control centers recommend the detection of 2-3 viral gene segments but which genes and sequences are detected vary greatly (Table 1). (enzolifesciences.com)
  • Since the reverse transcriptase activity of the HBV polymerase protein lacks a proofreading function, random mis-incorporation of bases into the replicating DNA strand occurs. (cdc.gov)
  • The genome of EBOV encodes seven viral structural proteins: one glycoprotein, one nucleoprotein, one RNA-dependent RNA polymerase, and four virion proteins. (cdc.gov)
  • Giovannoni F, Ladelfa MF, Monte M, Jans DA, Hemmerich P, García C. Dengue Non-structural Protein 5 Polymerase Complexes With Promyelocytic Leukemia Protein (PML) Isoforms III and IV to Disrupt PML-Nuclear Bodies in Infected Cells. (harvard.edu)
  • These tests are generally categorized as Nucleic Acid Amplification Tests (NAATs) and all rely on reverse transcription (RT) of the viral RNA into DNA followed by polymerase chain reaction (PCR) amplification of the DNA and subsequent detection. (enzolifesciences.com)
  • Analysis of SCoV particles that were purified by either sucrose gradient equilibrium centrifugation or a virus capture assay, in which intact SCoV particles were specifically immunoprecipitated by anti-S protein monoclonal antibody, demonstrated that 7a protein was associated with purified SCoV particles. (asm.org)
  • Coexpression of 7a protein with SCoV S, M, N, and E proteins resulted in production of virus-like particles (VLPs) carrying 7a protein, while 7a protein was not released from cells expressing 7a protein alone. (asm.org)
  • Viral particles are up to 76.5 nm in diameter [25] [26] and are not enveloped. (bionity.com)
  • The number of viral particles generated in some infected persons can be as high as 10 11 viral particles per day. (cdc.gov)
  • Down-regulates host SERINC3 and SERINC5 thereby excluding these proteins from the viral particles. (uniprot.org)
  • Cleavages distal to the membrane-spanning regions of C and the two envelope glycoproteins prM and E by host signalase in the lumen of the rough ER and a cleavage proximal to the membrane-spanning region of C by viral protease in the cytoplasm are important to the assembly of viral particles ( 32 ). (asm.org)
  • During the export of immature particles through the secretory pathway, cleavage of prM by the trans-Golgi apparatus resident furin allows reorganization of the receptor-binding E protein that is required for the acquisition of infectivity ( 9 , 43 ). (asm.org)
  • Apart from their differences in size and E dimer arrangements, small and large particles are distinguishable by other structural and functional properties, including the N-glycosylation pattern of the E protein ( 2 ) and the ability to agglutinate red blood cells ( 20 , 25 ). (asm.org)
  • Proteins encoded by a VIRAL GENOME that are produced in the organisms they infect, but not packaged into the VIRUS PARTICLES. (harvard.edu)
  • For this purpose, a nasal or throat swab is performed to harvest viral particles and virus-infected mucosa cells. (enzolifesciences.com)
  • Here, we use metaproteomics and metagenomics to examine virion-associated proteins in marine viral communities, providing tentative functions for 677,000 viral genomic sequences and the majority of previously unknown virion-associated proteins in these samples. (pnas.org)
  • Here, we apply paired metaproteomics and dsDNA-targeted metagenomics to identify 1,875 virion-associated proteins from the ocean. (pnas.org)
  • Phage T4 encoded proteins that determine virion structure include major structural components, minor structural components and non-structural proteins that catalyze specific steps in the morphogenesis sequence. (wikipedia.org)
  • Two sets of structural proteins form the virion (Donelan, et al, 2003). (write-right.net)
  • There are six viral proteins (VPs), that form the virus particle (virion). (bionity.com)
  • 18, maturation of virion into infectious particle mediated by viral protease. (els.net)
  • Virion infectivity is drastically higher when SERINC3 or SERINC5 are excluded from the viral envelope, because these host antiviral proteins impare the membrane fusion event necessary for subsequent virion penetration. (uniprot.org)
  • The viral M1 mRNA encodes the M1 matrix protein and is alternatively spliced into the M2 mRNA, which is translated into the M2 ion channel. (flu.org.cn)
  • The genome encodes viral structural proteins. (wikipedia.org)
  • A single-stranded genomic RNA of positive polarity encodes an open reading frame which is translated into a precursor of three structural proteins and at least seven nonstructural proteins ( 27 ). (asm.org)
  • The 5' cap open reading frame encodes a variety of non-structural proteins. (medsci.org)
  • Like other coronaviruses, the SCoV membrane contains three viral proteins, S, M, and E. The ∼30-kb SCoV genomic RNA is bound with N protein to form a nucleocapsid complex, which is surrounded by the viral membrane. (asm.org)
  • A yeast two-hybrid screen did not reveal interactions between EAV nsp1 and other viral non-structural proteins or the nucleocapsid protein, although both nsp1 and the nucleocapsid protein were found to form homomers. (microbiologyresearch.org)
  • NMR studies by the research group of Post to define the structure and dynamics of flavivirus capsid protein, and the association of capsid and nucleocapsid from alphavirus have helped to characterize protein interactions in assembly. (purdue.edu)
  • Rhabdovirus nucleocapsid (IPR000448) The Nucleocapsid (N) Protein is said to have a 'tight' structure. (ebi.ac.uk)
  • The viral nucleocapsid is composed of 3 concentric shells that enclose 11 segments of double-stranded RNA. (cdc.gov)
  • Coronaviruses have at least four major structural proteins, including spikes (S), membranes (M), envelopes (E), and nucleocapsid (N) proteins. (medsci.org)
  • One primarily unannotated PC dominated the dataset, but structural modeling and genomic context identified this PC as a previously unidentified capsid protein from multiple uncultivated tailed virus families. (pnas.org)
  • 2004) Solution structure of dengue virus capsid protein reveals another fold. (purdue.edu)
  • We identified interactions among viral capsid and tegument proteins, detecting phosphorylation of the capsid protein VP26 at sites within its UL37-binding domain, and an acetylation within the major capsid protein VP5. (nih.gov)
  • Phylogenetic analyses based on capsid protein-encoding regions (the VP1 gene of 41 clinical isolates and the entire P1 region of eight clinical isolates) of CVB5 revealed two major cocirculating lineages. (nih.gov)
  • It binds to the HCV capsid protein Core and the two glycoproteins E1 and E2. (mcponline.org)
  • Recent work has succeeded in determining the folds of representative examples of the five major proteins - major capsid protein, scaffolding protein, portal, protease and accessory protein - that are typically involved in capsid assembly. (deepdyve.com)
  • Examples include the SARS coronavirus 3a and 7a accessory proteins. (wikipedia.org)
  • Severe acute respiratory syndrome coronavirus (SCoV) 7a protein is one of the viral accessory proteins. (asm.org)
  • Although other coronaviruses also produce accessory proteins ( 19 , 43 ), the amino acid sequences of all of the SCoV accessory proteins have no homology with those of any other known viral proteins or nonviral proteins. (asm.org)
  • Past studies of other coronaviruses suggested that many of the accessory proteins are important for viral virulence in vivo ( 6 , 32 , 33 , 41 , 44 ). (asm.org)
  • Likewise, SCoV accessory proteins may play roles in SCoV pathogenesis, but the biological functions of these SCoV-specific accessory proteins are largely unexplored. (asm.org)
  • I plan to talk about the four main types of viral proteins, namely viral structural proteins, viral nonstructural proteins, and viral regulatory and accessory proteins. (wikipedia.org)
  • The field of GPCR biology has undergone a radical transformation with the structure determination of over 15 different GPCRs, including the first complex of an activated GPCR bound to a heterotrimeric G protein. (keystonesymposia.org)
  • Structural biology generally focuses on studies of the highly populated ground states (native states) of proteins. (ibs.fr)
  • This work provided new insight into this question," Pingwei Li , who studies innate immunity and structural biology at Texas A&M University, writes in an email to The Scientist . (the-scientist.com)
  • Kathlyn Gomendoza, senior in biology, Wichita , will present "A viral oxidoreductase modifies viral structural proteins, a requirement for virus infectivity. (k-state.edu)
  • The importance of these problems cannot be overestimated, as proteins and peptides, being the major components of the living cell, play the most crucial role in the maintenance of life. (wiley.com)
  • The viral nonstructural protein 3 contains methyltransferase [ 1 ] and 5′ RNA triphosphatase activity [ 2 , 3 ] to generate a 5′ capped genomic viral RNA. (mdpi.com)
  • and a nonstructural protein, VP5. (mcponline.org)
  • Frank, J. A. & Feschotte, C. Co-option of endogenous viral sequences for host cell function. (nature.com)
  • Ultimately, by integrating the identification of CF from the sequence into a statistical machine learning framework, we developed VIRALpro, a tool that enables the detection of sequences of viral structural proteins. (irisa.fr)
  • VIRALpro: a new suite for identifying viral capsid and tail sequences, C. Galiez, C. Magnan, F. Coste, P. Baldi (Bioinformatics) pdf . (irisa.fr)
  • Identifying distant homologous viral sequences in metagenomes using protein structure information. (irisa.fr)
  • a web service to detect capsid and tail proteins in peptidic sequences. (irisa.fr)
  • Viral to metazoan marine plankton nucleotide sequences from the Tara Oceans expedition. (embl.de)
  • The underlying basic principle (Figure 2) of these RT-qPCR -based tests is simple and always the same: specific genetic sequences within the viral genome are used to detect the virus specifically. (enzolifesciences.com)
  • Somewhat surprisingly, some disordered or highly flexible regions of HCV proteins, such as the core and the antigenic fragment 412-423 of E2, present highly conserved sequences among the virus genotypes. (eurekaselect.com)
  • This suggests that there are two promoters for VP in HaDV2 and that the VP of parvoviruses might play a more important role in viral transcription than previously appreciated. (elsevier.com)
  • Monocytes, macrophages, and dendritic cells appear to be early and preferred targets and have an important role in viral dissemination ( 1 , 4 ). (cdc.gov)
  • The influenza virulence factor NS1 protein interacts with the cellular NS1-BP protein to promote splicing and nuclear export of the viral M mRNAs. (flu.org.cn)
  • Overall, the conversion of GSK3 to a tyrosine-directed kinase representsa tightly regulated event that enables a bacterial virulence protein to reprogram innate immune signaling and establish an anti-inflammatory environment. (stanford.edu)
  • Of these seven, the S139N mutant virus-in which an asparagine takes the place of a serine in a surface protein-displayed the greatest virulence in the brains of neonatal mice. (the-scientist.com)
  • NF-kappa-B/Dorsal (IPR000451) The transcription factor NF-kB (Nuclear Factor-kappaB) was first identified as a DNA-binding protein specific for the 10-base pair kB site in the immunoglobulin k light-chain enha. (ebi.ac.uk)
  • Viral RNA is harvested and purified, followed by transcription into cDNA and subsequent amplification and detection by quantitative PCR. (enzolifesciences.com)
  • To uncover the NS1-BP structural and functional activities in splicing and nuclear export, we performed proteomics analysis of nuclear NS1-BP binding partners and showed its interaction with constituents of the splicing and mRNA export machineries. (flu.org.cn)
  • The BACK domain is also the site for interactions with mRNA export factor Aly/REF and is required for viral M mRNA nuclear export. (flu.org.cn)
  • Translation of mRNA into protein represents the final step in the gene-expression pathway, driving the formation of the proteome from genomic information. (surrey.ac.uk)
  • Hepatitis C virus (HCV) core protein is thought to contribute to HCV pathogenesis through its interaction with various signal transduction pathways. (abcam.com)
  • Monocyte chemoattractant proteins (MCPs) are chemokines that stimulate the receptor CCR2, which is found on monocytes and macrophages and is implicated in the pathogenesis of atherosclerosis and type 2 diabetes. (sciencemag.org)
  • Environmental Viral Genomes Shed New Light on Virus-Host Interactions in the Ocean. (embl.de)
  • Both proteins are synthesized in infected cells as a single glycoprotein precursor (GPC), which is proteolytically processed to these two mature subunits ( 13 - 16 ). (pnas.org)
  • Intrinsically disordered proteins (IDPs) or protein regions (IDRs) have been shown to play important roles in regulatory and signaling processes where the structural flexibility allows the protein to adapt to and interact with a large number of distinct molecular partners. (ibs.fr)
  • Depending on published study in which , conserved domain analysis, homology modeling, and molecular docking were used to compare the biological roles of specific proteins of the novel coronavirus. (clinicaltrials.gov)
  • Ψ is the packaging signal sequence allowing encapsidation of the vector RNA into the viral particle. (els.net)
  • This is a reassuring development and critical advance," said Nelson Michael of the Walter Reed Army Institute of Research in Silver Spring, Maryland, whose team is testing a formalin-inactivated viral particle vaccine . (the-scientist.com)
  • These two conformations have been suggested to play a role in minus sense synthesis and viral protein translation, respectively. (umsystem.edu)
  • Protein synthesis is principally regulated at the initiation stage, allowing for rapid, reversible control of gene expression. (surrey.ac.uk)
  • The project relies on the use of most advanced NMR and protein production and analysis methods, including cell-free protein synthesis and fast magic-angle spinning high-field NMR. (weizmann.ac.il)
  • The present invention is based on the development of a dual promoter system (preferably a RNA pol I-pol II system) for the efficient intracellular synthesis of viral RNA. (freepatentsonline.com)
  • The structure-function paradigm stating that a well-defined structure is required for a protein's function has been challenged by the discovery of a large number of highly flexible proteins or protein segments that exist as ensembles of partly collapsed or extended structural conformers in the cell and that are functional as such. (ibs.fr)
  • Again, structural flexibility presents a functional advantage in terms of binding promiscuity, as well as a high tolerance to mutations. (ibs.fr)
  • However, it has long been recognized that higher energy conformational states can play important functional roles, or may be responsible for protein misfolding and fibril formation leading to various human diseases. (ibs.fr)
  • Therefore it is of highest interest to investigate the functional and structural properties of these proteins in order to elucidate their mode of action. (ibs.fr)
  • Experimental Characterization of Fuzzy Protein Assemblies: Interactions of Paramyxoviral NTAIL Domains With Their Functional Partners. (univ-mrs.fr)
  • One will also discover that the over-expression of NSP1 can result to the blockage of IFN-β activation of the promoter which is induced by retinoic acid inducible gene I also called RIG-I. This will not inhibit the induction of IFN-β activation which is perpetrated mitochondrial antiviral-signaling protein (MAVS) and indicates that the RIG-1 is targeted by NSP1. (write-right.net)
  • 2008) Antiviral compounds discovered by virtual screening of small-molecule libraries against dengue virus E protein. (purdue.edu)
  • An antiviral compound, designed to inhibit maturation of assembled dengue virus, was discovered using computational screening of the envelope protein, followed by validation using NMR. (purdue.edu)
  • In recent decades, light was shed on the importance and biological relevance of most HCV proteins, which ultimately led to the development of the first specific antiviral therapy involving inhibition of the NS3 serine protease ( 2 ). (mcponline.org)
  • The outermost layer contains 2 structural viral proteins (VPs): VP4, the protease-cleaved protein (P protein) and VP7, the glycoprotein (G protein). (cdc.gov)
  • The mutation maps to the surface of prM, one of the three Zika structural proteins. (the-scientist.com)
  • Interferon-induced RNA-binding protein involved in the human innate immune response. (genecards.org)
  • The paper is to discuss the role of the non structural protein 1 also known as NSP1 which is found among the rotavirus as it is known to be responsible in the blockage of interferon also known as IFN. (write-right.net)
  • Rotavirus NSP1 contain 55-KDa of RNA binding of protein with a rotavirus gene 5. (write-right.net)
  • In addition to the VPs, there are five non-structural proteins (NSPs), that are only produced in cells infected by rotavirus. (bionity.com)
  • Rotavirus-vaccinated populations have experienced dramatic decreases in rotavirus infections and transmission, so norovirus is now the most common pediatric viral gastroenteritis. (cdc.gov)
  • To dissect the role of FBP2, we engineered a wide range of recombinant FBP2 proteins of different lengths and analysed their interactions with IRES elements using biochemical techniques. (surrey.ac.uk)
  • A G-protein-coupled chemokine receptor: A putative insertion site for a multi-pathogen recombinant capripoxvirus vaccine strategy. (bireme.br)
  • A new recombinant CaPV expressing the viral attachment hemagglutinin (H) of the PPR virus (PPRV) in the GPCR insertion site (rKS1-HPPR-GPCR) was generated in the backbone North African isolate KS1 strain of lumpy skin disease virus (LSDV). (bireme.br)
  • The C-terminal 250 residues are highly disordered, and display numerous interaction sites for other viral and host proteins. (ibs.fr)
  • What pathways are this gene/protein implicaed in? (cancerindex.org)
  • In this study, we utilize gene deletion mutants in the ribosomal protein kinase called S6 kinase (S6K) and eukaryotic translation initiation factor 4E-binding protein (4EBP) pathways downstream of mTORC1 to define the role of mTOR-dependent translation initiation signals in WNV gene expression and growth. (mdpi.com)
  • Alters numerous pathways of T-lymphocytes function and down-regulates immunity surface molecules in order to evade host defense and increase viral infectivity. (uniprot.org)
  • The glycoprotein is the only transmembrane surface protein of the virus and is critical for attachment to host cells and cell membrane fusion ( 3 ). (cdc.gov)
  • Structural and dynamics analysis of intrinsically disordered proteins by high-speed atomic force microscopy. (univ-mrs.fr)
  • An arsenal of methods for the experimental characterization of intrinsically disordered proteins - How to choose and combine them? (univ-mrs.fr)
  • G protein-coupled receptors are essential for intercellular communication in multicellular organisms and they are also the targets for many drugs already in use or under development, for the treatment of, for example, cardiovascular disease, asthma, cancer, neurological dysfunction and metabolic disorders. (keystonesymposia.org)
  • Kappa opioid receptor (IPR000452) G protein-coupled receptors (GPCRs) constitute a vast protein family that encompasses a wide range of functions, including various autocrine, paracrine and endocrine processes. (ebi.ac.uk)
  • Using chimeric MCP proteins and mutated CCR2 receptors, Huma et al . (sciencemag.org)
  • Although interaction between 7a protein and another SCoV accessory protein, 3a, has been reported, 3a protein was dispensable for assembly of 7a protein into VLPs. (asm.org)
  • A) Interaction network of HSV-1 proteins associated with VP26 under both mild and stringent conditions (rectangular nodes) or only under mild condition (hexagon nodes). (nih.gov)
  • Connections indicate proteins associations previously described and line color indicates method used for identifying the interaction. (nih.gov)
  • We showed that of two nuclear localization signals (NLSs) located at amino acids 1153-1159 (NLSA) and 1222-1227 (NLSB), NLSA is sufficient to confer nuclear localization on green fluorescent protein (GFP) by mediating interaction with importin alpha/beta. (nih.gov)
  • We now show that WNV growth and protein expression are dependent on mTORC1 mediated-regulation of the eukaryotic translation initiation factor 4E-binding protein/eukaryotic translation initiation factor 4E-binding protein (4EBP/eIF4E) interaction and eukaryotic initiation factor 4F (eIF4F) complex formation to support viral growth and viral protein expression. (mdpi.com)
  • Initiation factor eIF-4 gamma, MA3 (IPR003891) This entry represents the MI domain (after MA-3 and eIF4G), it is a protein-protein interaction module of ~130 amino acids. (ebi.ac.uk)
  • Our work demonstrates the feasibility of rapidly generating small interaction networks via FACS-FRET and defines the network of intra-HCV protein interactions. (mcponline.org)
  • An impressive body of data was derived from protein interaction or siRNA screens investigating the interplay of HCV proteins with cellular factors ( 3 ⇓ - 5 ). (mcponline.org)
  • The HCV core protein has been previously shown to circulate in the bloodstream of HCV-infected patients and inhibit host immunity through an interaction with gC1qR. (abcam.com)
  • However, little is known about the interaction mode of proteins binding RNA weakly and transiently, such as RNA chaperones. (ibs.fr)
  • Mediates internalization and degradation of host CD4 through the interaction of with the cytoplasmic tail of CD4, the recruitment of AP-2 (clathrin adapter protein complex 2), internalization through clathrin coated pits, and subsequent transport to endosomes and lysosomes for degradation. (uniprot.org)
  • Probing the dynamic properties of two sites simultaneously in a protein-protein interaction process: a SDSL-EPR study. (univ-mrs.fr)
  • As in the case of the p19 promoter, Sp1 facilitates interaction of Rep with the p40 promoter by interaction of the two proteins. (biomedsearch.com)
  • They modulate gene expression, without the assistance of proteins, in response to particular environmental conditions like nutrient availability. (ibs.fr)
  • Regulation of measles virus gene expression by P protein coiled-coil properties. (univ-mrs.fr)
  • Human papillomavirus type 16 E6 protein transcriptionally modulates fibronectin gene expression by i. (biomedsearch.com)
  • A viral structural protein is a viral protein that is a structural component of the mature virus. (wikipedia.org)
  • Specific mutations in the viral peplomer protein, S protein, allowed a SCoV-like virus to cross the species barrier and become a highly infectious human pathogen ( 22 , 35 ). (asm.org)
  • SCoV 3a protein is a viral structural protein ( 15 , 37 ) and is released from 3a-expressing cells and virus-infected cells in membranous structures ( 13 ). (asm.org)
  • The human immunodeficiency virus type 1 (HIV-1) protein Vpr (viral protein R) arrests cells in the G2 phase of the cell cycle, a process that requires activation of the ATR (ataxia-telangiectasia and Rad3-related) pathway. (pubfacts.com)
  • Identification of SNF2h, a chromatin-remodeling factor, as a novel binding protein of Vpr of human immunodeficiency virus type 1. (pubfacts.com)
  • Structural proteins of equine arteritis virus. (microbiologyresearch.org)
  • The GP2 subunit is a transmembrane protein that mediates fusion of the viral and cellular membranes after internalization of the virus into acidified endosomes ( 21 - 24 ). (pnas.org)
  • Although organization of viral factories varies between different virus families, several fundamental similarities exist. (biomedcentral.com)
  • The project will address the homologous and heterologous interactions of viral capsid proteins which are at the center of virus biogenesis and maturation. (weizmann.ac.il)
  • 5. The expression plasmid of claim 1, further comprising a negative strand RNA virus viral gene segment inserted between the pol I promoter and the termination signal. (freepatentsonline.com)
  • Birnavirus VP2 protein (IPR002662) Infectious pancreatic necrosis virus (IPNV), a birnavirus, is an important pathogen in fish farms. (ebi.ac.uk)
  • Birnavirus VP3 protein (IPR002663) VP3 is a minor structural component of the virus. (ebi.ac.uk)
  • External envelope protein of the human immunodeficiency virus which is encoded by the HIV env gene. (harvard.edu)
  • The hepatitis C virus (HCV) core protein represents the first 191 amino acids of the viral precursor polyprotein and is cotranslationally inserted into the membrane of the endoplasmic reticulum. (abcam.com)
  • Here, we present the crystal structure of the secreted, uncleaved ectodomain of the paramyxovirus, human parainfluenza virus 3 fusion (F) protein, a member of the class I viral fusion protein group. (rcsb.org)
  • Currently, we investigate several viral IDPs, among those non-structural protein 5A (NS5A) from the hepatitis C virus. (ibs.fr)
  • Here, we discuss what is known about influenza virus assembly and budding, focusing on the viral and host factors that are involved in the determination of viral morphology. (springer.com)
  • These are structural analogues of sialic acid, and work to inhibit the enzymatic action of NA, thus retaining newly formed virus on the host cells. (springer.com)
  • HA and NA are viral surface proteins and the main antigenic determinants of the virus. (springer.com)
  • It has been shown that some viral cellular transformations happen when the virus genome interacts with the DNA of the host cell. (hindawi.com)
  • These 2 proteins define the serotype of the virus and are considered critical to vaccine development because they are targets for neutralizing antibodies that might be important for protection. (cdc.gov)
  • Bhagat R, Prajapati B, Narwal S, Agnihotri N, Adlakha YK, Sen J, Mani S, Seth P. Zika virus E protein alters the properties of human fetal neural stem cells by modulating microRNA circuitry. (harvard.edu)
  • 13 , 14 However, the amino acid perfectly maintains the stability of the mutual structural conformation of the virus S-protein and the ACE2 receptor in a holistic manner. (medsci.org)
  • A significant amount of these investigations has been focused on the structural characterization of the virus proteins with the aim of developing structure-based innovative therapeutic approaches. (eurekaselect.com)
  • The overall versatility of HCV proteins plays an important role in host protein recognition, drug resistance mechanisms, and virus escape from the host immunogenic system. (eurekaselect.com)
  • The mention to Viral Protein Structural Database (VPDB) have been removed because this resource displays data of poor quality: example http://vpdb.bicpu.edu.in/tabview.php?pdbid=1K4R This entry displays a dengue virus envelope protein but the source organism is HIV? (wikipedia.org)
  • After the virus attaches to a host cell, it injects its viral core (the shell containing its DNA) into the cell's cytoplasm. (wikipedia.org)
  • Many Gram-negative bacterial pathogens antagonize anti-bacterial immunity through translocated effector proteins that inhibit pro-inflammatory signaling. (stanford.edu)
  • Currently we focus on 2 RNA chaperone proteins, the globular well folded bacterial CspA, and an intrinsically disordered viral core protein. (ibs.fr)
  • Thus, a promising strategy would be to specifically inhibit interactions among viral proteins. (mcponline.org)
  • Griffin SDC, Allen JF and Lever AML (2001) The major HIV‐2 packaging signal is present on all HIV‐2 RNA species: co‐translational RNA encapsidation and limiting Gag protein confer specificity. (els.net)
  • The distinct chemistry of proteins at the N- and C-termini provides protein molecules with two positionally and chemically unique sites for post-translational modifications and with the means to control their spatial and temporal interactions and position. (nottingham.ac.uk)
  • Results of RNA transfection experiments suggest that cytoplasmic proteins are insufficient for SNV RU5 translational enhancement of gag or luc RNA. (jove.com)
  • Using a wide range of approaches, we could not detect nor confirm the association of NSP1 with any cellular proteins. (surrey.ac.uk)
  • Inaddition, the intracellular pathogen Salmonella enterica serovar Typhimurium initiates an anti-inflammatorytranscriptional response in macrophages through its effector protein SteE. (stanford.edu)
  • The genome rotaviruses encode six structural proteins known as VPs and six non-structural proteins known as NSPs. (write-right.net)
  • Because the 2 gene segments that encode these proteins can segregate independently, a typing system consisting of both P and G types has been developed. (cdc.gov)
  • This is proteolytically processed by cellular and viral proteases into structural (Core, E1, E2) and nonstructural (p7, NS2, NS3, NS4A/B, and NS5A/B) proteins ( 1 ). (mcponline.org)
  • The 122-amino-acid (aa)-long SCoV 7a protein (also known as X4 protein or U122 protein) is a type I transmembrane protein consisting of a 15-aa signal peptide sequence at its N terminus, an 81-aa luminal domain, a 21-aa transmembrane domain, and a short C-terminal tail ( 30 ). (asm.org)
  • One amino acid change within a viral structural protein makes the difference between mild cases of brain damage and severe microcephaly in mice. (the-scientist.com)
  • Unorthodox immune proteins called natural antibodies target pathogens and remove cellular and molecular waste. (sciencemag.org)
  • Viral infections can alter the cellular epigenetic landscape, through modulation of either DNA methylation profiles or chromatin remodeling enzymes and histone modifications. (nih.gov)
  • Antiretroviral drugs are among the most therapeutically risky drugs for drug-drug interactions due to the potent inhibition and induction of cytochrome (CYP) enzymes as well as transport proteins. (hindawi.com)
  • Two lateral bodies are found outside the viral core, and are believed to hold the enzymes required for viral reproduction. (wikipedia.org)
  • 2014) Modeling ecological drivers in marine viral communities using comparative metagenomics and network analyses. (lsu.edu)
  • Our approach, including a phylogenetics-based reconstruction of viral predecessors, could serve as a starting point for experimental studies of viral evolution and might also provide an alternative strategy for the development of vaccines. (nih.gov)
  • Up to now, I focused on the local relationship between primary and tertiary structure of proteins and its application to protein annotation using machine learning. (irisa.fr)
  • p>An evidence describes the source of an annotation, e.g. an experiment that has been published in the scientific literature, an orthologous protein, a record from another database, etc. (uniprot.org)
  • be used as a measure of the accuracy of the annotation as we cannot define the 'correct annotation' for any given protein. (uniprot.org)
  • Discussing the potential to harness the power of protein chaperones, and future directions for research, discovery, and therapeutics, this book is essential reading for scientists working in the fields of biochemistry, molecular medicine, pharmacology and drug discovery, biotechnology and pharmaceutical companies, advanced students, and anyone interested in this cutting-edge topic. (ellibs.com)
  • The Protein Solid-State NMR group is a dynamic team of biochemists and NMR spectroscopists who work together on the goal to better understand molecular function based on protein structure. (weizmann.ac.il)
  • The main purpose of this series is to represent the current state of art in the protein and peptide science and to cover various related subjects including: protein biosynthesis, folding, non-folding, misfolding, protein function, dysfunction and disease, protein engineering and creation of de novo proteins with a desired function, fuel molecular and cell science, technology, and medicine. (wiley.com)
  • Hsu and Luo, "Molecular dissection of G protein preference using Gsα chimeras reveals novel ligand signaling of GPCRs," Am J Physiol Endocrinol Metab. (freepatentsonline.com)
  • These developments have provided a solid foundation for studying the regulation of translation initiation by mechanisms that include the modulation of initiation factor activity, internal ribosome initiation and through sequence-specific RNA-binding proteins. (surrey.ac.uk)
  • Structural fragments : comparison, predictability from sequence and application to identification of viral proteins. (irisa.fr)
  • Class I viral fusion proteins share common mechanistic and structural features but little sequence similarity. (rcsb.org)
  • Note that the 'protein existence' evidence does not give information on the accuracy or correctness of the sequence(s) displayed. (uniprot.org)
  • Of particular relevance is the emerging idea that HCV uses local structural flexibility as an alternative tool to sequence variability to evade the immune response of the host organism. (eurekaselect.com)
  • In addition, we are interested in the mechanisms of RNA chaperone proteins that assist in RNA folding. (ibs.fr)
  • For the mammalian reovirus (MRV), the non-structural protein μNS is the primary organizer in factory formation. (biomedcentral.com)
  • Conformational footprinting of proteins using a combination of top-down electron transfer dissociation and ion mobility. (univ-mrs.fr)