Viruses parasitic on plants higher than bacteria.
Viruses whose genetic material is RNA.
Ribonucleic acid that makes up the genetic material of viruses.
A family of RNA plant viruses infecting dicotyledons. Transmission is mainly by mechanical inoculation and through propagative plant material. All species elicit formation of multivesicular inclusion bodies. There are at least eight genera: Aureusvirus, Avenavirus, CARMOVIRUS, Dianthovirus, Machlomovirus, Necrovirus, Panicovirus, and TOMBUSVIRUS.
PLANTS, or their progeny, whose GENOME has been altered by GENETIC ENGINEERING.
Expanded structures, usually green, of vascular plants, characteristically consisting of a bladelike expansion attached to a stem, and functioning as the principal organ of photosynthesis and transpiration. (American Heritage Dictionary, 2d ed)
Proteins found in plants (flowers, herbs, shrubs, trees, etc.). The concept does not include proteins found in vegetables for which VEGETABLE PROTEINS is available.
A polynucleotide consisting essentially of chains with a repeating backbone of phosphate and ribose units to which nitrogenous bases are attached. RNA is unique among biological macromolecules in that it can encode genetic information, serve as an abundant structural component of cells, and also possesses catalytic activity. (Rieger et al., Glossary of Genetics: Classical and Molecular, 5th ed)
The usually underground portions of a plant that serve as support, store food, and through which water and mineral nutrients enter the plant. (From American Heritage Dictionary, 1982; Concise Dictionary of Biology, 1990)
The functional hereditary units of PLANTS.
Small double-stranded, non-protein coding RNAs (21-31 nucleotides) involved in GENE SILENCING functions, especially RNA INTERFERENCE (RNAi). Endogenously, siRNAs are generated from dsRNAs (RNA, DOUBLE-STRANDED) by the same ribonuclease, Dicer, that generates miRNAs (MICRORNAS). The perfect match of the siRNAs' antisense strand to their target RNAs mediates RNAi by siRNA-guided RNA cleavage. siRNAs fall into different classes including trans-acting siRNA (tasiRNA), repeat-associated RNA (rasiRNA), small-scan RNA (scnRNA), and Piwi protein-interacting RNA (piRNA) and have different specific gene silencing functions.
Concentrated pharmaceutical preparations of plants obtained by removing active constituents with a suitable solvent, which is evaporated away, and adjusting the residue to a prescribed standard.
New immature growth of a plant including stem, leaves, tips of branches, and SEEDLINGS.
The ultimate exclusion of nonsense sequences or intervening sequences (introns) before the final RNA transcript is sent to the cytoplasm.
Plants whose roots, leaves, seeds, bark, or other constituent parts possess therapeutic, tonic, purgative, curative or other pharmacologic attributes, when administered to man or animals.
A process that changes the nucleotide sequence of mRNA from that of the DNA template encoding it. Some major classes of RNA editing are as follows: 1, the conversion of cytosine to uracil in mRNA; 2, the addition of variable number of guanines at pre-determined sites; and 3, the addition and deletion of uracils, templated by guide-RNAs (RNA, GUIDE).
Plants or plant parts which are harmful to man or other animals.
Deoxyribonucleic acid that makes up the genetic material of plants.
Processes orchestrated or driven by a plethora of genes, plant hormones, and inherent biological timing mechanisms facilitated by secondary molecules, which result in the systematic transformation of plants and plant parts, from one stage of maturity to another.
The most abundant form of RNA. Together with proteins, it forms the ribosomes, playing a structural role and also a role in ribosomal binding of mRNA and tRNAs. Individual chains are conventionally designated by their sedimentation coefficients. In eukaryotes, four large chains exist, synthesized in the nucleolus and constituting about 50% of the ribosome. (Dorland, 28th ed)
Basic functional unit of plants.
Enzymes that catalyze DNA template-directed extension of the 3'-end of an RNA strand one nucleotide at a time. They can initiate a chain de novo. In eukaryotes, three forms of the enzyme have been distinguished on the basis of sensitivity to alpha-amanitin, and the type of RNA synthesized. (From Enzyme Nomenclature, 1992).
Ribonucleic acid in bacteria having regulatory and catalytic roles as well as involvement in protein synthesis.
Parts of plants that usually grow vertically upwards towards the light and support the leaves, buds, and reproductive structures. (From Concise Dictionary of Biology, 1990)
The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.
RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.
The process of intracellular viral multiplication, consisting of the synthesis of PROTEINS; NUCLEIC ACIDS; and sometimes LIPIDS, and their assembly into a new infectious particle.
A gene silencing phenomenon whereby specific dsRNAs (RNA, DOUBLE-STRANDED) trigger the degradation of homologous mRNA (RNA, MESSENGER). The specific dsRNAs are processed into SMALL INTERFERING RNA (siRNA) which serves as a guide for cleavage of the homologous mRNA in the RNA-INDUCED SILENCING COMPLEX. DNA METHYLATION may also be triggered during this process.
RNA consisting of two strands as opposed to the more prevalent single-stranded RNA. Most of the double-stranded segments are formed from transcription of DNA by intramolecular base-pairing of inverted complementary sequences separated by a single-stranded loop. Some double-stranded segments of RNA are normal in all organisms.
A plant genus of the family BRASSICACEAE that contains ARABIDOPSIS PROTEINS and MADS DOMAIN PROTEINS. The species A. thaliana is used for experiments in classical plant genetics as well as molecular genetic studies in plant physiology, biochemistry, and development.
The genetic complement of a plant (PLANTS) as represented in its DNA.
A plant genus of the family SOLANACEAE. Members contain NICOTINE and other biologically active chemicals; its dried leaves are used for SMOKING.
An organism of the vegetable kingdom suitable by nature for use as a food, especially by human beings. Not all parts of any given plant are edible but all parts of edible plants have been known to figure as raw or cooked food: leaves, roots, tubers, stems, seeds, buds, fruits, and flowers. The most commonly edible parts of plants are FRUIT, usually sweet, fleshy, and succulent. Most edible plants are commonly cultivated for their nutritional value and are referred to as VEGETABLES.
The parts of plants, including SEEDS.
The spatial arrangement of the atoms of a nucleic acid or polynucleotide that results in its characteristic 3-dimensional shape.
Any of the hormones produced naturally in plants and active in controlling growth and other functions. There are three primary classes: auxins, cytokinins, and gibberellins.
The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.
A family of proteins that promote unwinding of RNA during splicing and translation.
RNA that has catalytic activity. The catalytic RNA sequence folds to form a complex surface that can function as an enzyme in reactions with itself and other molecules. It may function even in the absence of protein. There are numerous examples of RNA species that are acted upon by catalytic RNA, however the scope of this enzyme class is not limited to a particular type of substrate.
The processes of RNA tertiary structure formation.
Proteins that originate from plants species belonging to the genus ARABIDOPSIS. The most intensely studied species of Arabidopsis, Arabidopsis thaliana, is commonly used in laboratory experiments.
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
A DNA-dependent RNA polymerase present in bacterial, plant, and animal cells. It functions in the nucleoplasmic structure and transcribes DNA into RNA. It has different requirements for cations and salt than RNA polymerase I and is strongly inhibited by alpha-amanitin. EC 2.7.7.6.
The extent to which an RNA molecule retains its structural integrity and resists degradation by RNASE, and base-catalyzed HYDROLYSIS, under changing in vivo or in vitro conditions.
The complete genetic complement contained in a DNA or RNA molecule in a virus.
Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.
The inherent or induced capacity of plants to withstand or ward off biological attack by pathogens.
Post-transcriptional biological modification of messenger, transfer, or ribosomal RNAs or their precursors. It includes cleavage, methylation, thiolation, isopentenylation, pseudouridine formation, conformational changes, and association with ribosomal protein.
RNA molecules which hybridize to complementary sequences in either RNA or DNA altering the function of the latter. Endogenous antisense RNAs function as regulators of gene expression by a variety of mechanisms. Synthetic antisense RNAs are used to effect the functioning of specific genes for investigative or therapeutic purposes.
Established cell cultures that have the potential to propagate indefinitely.
Ribonucleic acid in fungi having regulatory and catalytic roles as well as involvement in protein synthesis.
Proteins found in any species of virus.
The small RNA molecules, 73-80 nucleotides long, that function during translation (TRANSLATION, GENETIC) to align AMINO ACIDS at the RIBOSOMES in a sequence determined by the mRNA (RNA, MESSENGER). There are about 30 different transfer RNAs. Each recognizes a specific CODON set on the mRNA through its own ANTICODON and as aminoacyl tRNAs (RNA, TRANSFER, AMINO ACYL), each carries a specific amino acid to the ribosome to add to the elongating peptide chains.
Nucleic acid structures found on the 5' end of eukaryotic cellular and viral messenger RNA and some heterogeneous nuclear RNAs. These structures, which are positively charged, protect the above specified RNAs at their termini against attack by phosphatases and other nucleases and promote mRNA function at the level of initiation of translation. Analogs of the RNA caps (RNA CAP ANALOGS), which lack the positive charge, inhibit the initiation of protein synthesis.
An enzyme that catalyses RNA-template-directed extension of the 3'- end of an RNA strand by one nucleotide at a time, and can initiate a chain de novo. (Enzyme Nomenclature, 1992, p293)
A thin layer of cells forming the outer integument of seed plants and ferns. (Random House Unabridged Dictionary, 2d ed)
A multistage process that includes cloning, physical mapping, subcloning, sequencing, and information analysis of an RNA SEQUENCE.
The relationships of groups of organisms as reflected by their genetic makeup.
The biosynthesis of RNA carried out on a template of DNA. The biosynthesis of DNA from an RNA template is called REVERSE TRANSCRIPTION.
RNA transcripts of the DNA that are in some unfinished stage of post-transcriptional processing (RNA PROCESSING, POST-TRANSCRIPTIONAL) required for function. RNA precursors may undergo several steps of RNA SPLICING during which the phosphodiester bonds at exon-intron boundaries are cleaved and the introns are excised. Consequently a new bond is formed between the ends of the exons. Resulting mature RNAs can then be used; for example, mature mRNA (RNA, MESSENGER) is used as a template for protein production.
A large family of RNA helicases that share a common protein motif with the single letter amino acid sequence D-E-A-D (Asp-Glu-Ala-Asp). In addition to RNA helicase activity, members of the DEAD-box family participate in other aspects of RNA metabolism and regulation of RNA function.
RNA which does not code for protein but has some enzymatic, structural or regulatory function. Although ribosomal RNA (RNA, RIBOSOMAL) and transfer RNA (RNA, TRANSFER) are also untranslated RNAs they are not included in this scope.
Short chains of RNA (100-300 nucleotides long) that are abundant in the nucleus and usually complexed with proteins in snRNPs (RIBONUCLEOPROTEINS, SMALL NUCLEAR). Many function in the processing of messenger RNA precursors. Others, the snoRNAs (RNA, SMALL NUCLEOLAR), are involved with the processing of ribosomal RNA precursors.
Closable openings in the epidermis of plants on the underside of leaves. They allow the exchange of gases between the internal tissues of the plant and the outside atmosphere.
Members of the group of vascular plants which bear flowers. They are differentiated from GYMNOSPERMS by their production of seeds within a closed chamber (OVARY, PLANT). The Angiosperms division is composed of two classes, the monocotyledons (Liliopsida) and dicotyledons (Magnoliopsida). Angiosperms represent approximately 80% of all known living plants.
Proteins encoded by a VIRAL GENOME that are produced in the organisms they infect, but not packaged into the VIRUS PARTICLES. Some of these proteins may play roles within the infected cell during VIRUS REPLICATION or act in regulation of virus replication or VIRUS ASSEMBLY.
A species of ENTEROVIRUS which is the causal agent of POLIOMYELITIS in humans. Three serotypes (strains) exist. Transmission is by the fecal-oral route, pharyngeal secretions, or mechanical vector (flies). Vaccines with both inactivated and live attenuated virus have proven effective in immunizing against the infection.
Widely used technique which exploits the ability of complementary sequences in single-stranded DNAs or RNAs to pair with each other to form a double helix. Hybridization can take place between two complimentary DNA sequences, between a single-stranded DNA and a complementary RNA, or between two RNA sequences. The technique is used to detect and isolate specific sequences, measure homology, or define other characteristics of one or both strands. (Kendrew, Encyclopedia of Molecular Biology, 1994, p503)
Proteins that bind to RNA molecules. Included here are RIBONUCLEOPROTEINS and other proteins whose function is to bind specifically to RNA.
The biosynthesis of PEPTIDES and PROTEINS on RIBOSOMES, directed by MESSENGER RNA, via TRANSFER RNA that is charged with standard proteinogenic AMINO ACIDS.
Deoxyribonucleic acid that makes up the genetic material of viruses.
Ribonucleic acid in plants having regulatory and catalytic roles as well as involvement in protein synthesis.
The encapsulated embryos of flowering plants. They are used as is or for animal feed because of the high content of concentrated nutrients like starches, proteins, and fats. Rapeseed, cottonseed, and sunflower seed are also produced for the oils (fats) they yield.
A plant species of the family SOLANACEAE, native of South America, widely cultivated for their edible, fleshy, usually red fruit.
Short sequences (generally about 10 base pairs) of DNA that are complementary to sequences of messenger RNA and allow reverse transcriptases to start copying the adjacent sequences of mRNA. Primers are used extensively in genetic and molecular biology techniques.
The first continuously cultured human malignant CELL LINE, derived from the cervical carcinoma of Henrietta Lacks. These cells are used for VIRUS CULTIVATION and antitumor drug screening assays.
The assembly of VIRAL STRUCTURAL PROTEINS and nucleic acid (VIRAL DNA or VIRAL RNA) to form a VIRUS PARTICLE.
RNA present in neoplastic tissue.
A genus of plant viruses that infects ANGIOSPERMS. Transmission occurs mechanically and through soil, with one species transmitted via a fungal vector. The type species is Tomato bushy stunt virus.
Poisoning by the ingestion of plants or its leaves, berries, roots or stalks. The manifestations in both humans and animals vary in severity from mild to life threatening. In animals, especially domestic animals, it is usually the result of ingesting moldy or fermented forage.
Ribonucleic acid in protozoa having regulatory and catalytic roles as well as involvement in protein synthesis.
The reproductive organs of plants.
The functional hereditary units of VIRUSES.
The loss of water vapor by plants to the atmosphere. It occurs mainly from the leaves through pores (stomata) whose primary function is gas exchange. The water is replaced by a continuous column of water moving upwards from the roots within the xylem vessels. (Concise Dictionary of Biology, 1990)
A variation of the PCR technique in which cDNA is made from RNA via reverse transcription. The resultant cDNA is then amplified using standard PCR protocols.
Macromolecular molds for the synthesis of complementary macromolecules, as in DNA REPLICATION; GENETIC TRANSCRIPTION of DNA to RNA, and GENETIC TRANSLATION of RNA into POLYPEPTIDES.
The process in which substances, either endogenous or exogenous, bind to proteins, peptides, enzymes, protein precursors, or allied compounds. Specific protein-binding measures are often used as assays in diagnostic assessments.
The protoplasm and plasma membrane of plant, fungal, bacterial or archaeon cells without the CELL WALL.
Any of the processes by which cytoplasmic factors influence the differential control of gene action in viruses.
A localized proliferation of plant tissue forming a swelling or outgrowth, commonly with a characteristic shape and unlike any organ of the normal plant. Plant tumors or galls usually form in response to the action of a pathogen or a pest. (Holliday, P., A Dictionary of Plant Pathology, 1989, p330)
An enzyme that catalyzes the conversion of linear RNA to a circular form by the transfer of the 5'-phosphate to the 3'-hydroxyl terminus. It also catalyzes the covalent joining of two polyribonucleotides in phosphodiester linkage. EC 6.5.1.3.
A transfer RNA which is specific for carrying lysine to sites on the ribosomes in preparation for protein synthesis.
Complex nucleoprotein structures which contain the genomic DNA and are part of the CELL NUCLEUS of PLANTS.
The type species of LENTIVIRUS and the etiologic agent of AIDS. It is characterized by its cytopathic effect and affinity for the T4-lymphocyte.
The process of moving specific RNA molecules from one cellular compartment or region to another by various sorting and transport mechanisms.
The above-ground plant without the roots.
The parts of a macromolecule that directly participate in its specific combination with another molecule.
Viruses which produce a mottled appearance of the leaves of plants.
RNA molecules found in the nucleus either associated with chromosomes or in the nucleoplasm.
The restriction of a characteristic behavior, anatomical structure or physical system, such as immune response; metabolic response, or gene or gene variant to the members of one species. It refers to that property which differentiates one species from another but it is also used for phylogenetic levels higher or lower than the species.
The infective system of a virus, composed of the viral genome, a protein core, and a protein coat called a capsid, which may be naked or enclosed in a lipoprotein envelope called the peplos.
The outer protein protective shell of a virus, which protects the viral nucleic acid.
The large family of plants characterized by pods. Some are edible and some cause LATHYRISM or FAVISM and other forms of poisoning. Other species yield useful materials like gums from ACACIA and various LECTINS like PHYTOHEMAGGLUTININS from PHASEOLUS. Many of them harbor NITROGEN FIXATION bacteria on their roots. Many but not all species of "beans" belong to this family.
A DNA-dependent RNA polymerase present in bacterial, plant, and animal cells. The enzyme functions in the nucleolar structure and transcribes DNA into RNA. It has different requirements for cations and salts than RNA polymerase II and III and is not inhibited by alpha-amanitin. EC 2.7.7.6.
A plant species of the family POACEAE. It is a tall grass grown for its EDIBLE GRAIN, corn, used as food and animal FODDER.
A DNA-dependent RNA polymerase present in bacterial, plant, and animal cells. It functions in the nucleoplasmic structure where it transcribes DNA into RNA. It has specific requirements for cations and salt and has shown an intermediate sensitivity to alpha-amanitin in comparison to RNA polymerase I and II. EC 2.7.7.6.
In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships.
Within a eukaryotic cell, a membrane-limited body which contains chromosomes and one or more nucleoli (CELL NUCLEOLUS). The nuclear membrane consists of a double unit-type membrane which is perforated by a number of pores; the outermost membrane is continuous with the ENDOPLASMIC RETICULUM. A cell may contain more than one nucleus. (From Singleton & Sainsbury, Dictionary of Microbiology and Molecular Biology, 2d ed)
The interactions between a host and a pathogen, usually resulting in disease.
Small, linear single-stranded RNA molecules functionally acting as molecular parasites of certain RNA plant viruses. Satellite RNAs exhibit four characteristic traits: (1) they require helper viruses to replicate; (2) they are unnecessary for the replication of helper viruses; (3) they are encapsidated in the coat protein of the helper virus; (4) they have no extensive sequence homology to the helper virus. Thus they differ from SATELLITE VIRUSES which encode their own coat protein, and from the genomic RNA; (=RNA, VIRAL); of satellite viruses. (From Maramorosch, Viroids and Satellites, 1991, p143)
Material prepared from plants.
A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.
A group of adenine ribonucleotides in which the phosphate residues of each adenine ribonucleotide act as bridges in forming diester linkages between the ribose moieties.
A genus of tripartite plant viruses in the family BROMOVIRIDAE. Transmission is by beetles. Brome mosaic virus is the type species.
Complexes of RNA-binding proteins with ribonucleic acids (RNA).
Enzymes that catalyze the hydrolysis of ester bonds within RNA. EC 3.1.-.
The sequence at the 5' end of the messenger RNA that does not code for product. This sequence contains the ribosome binding site and other transcription and translation regulating sequences.
Very young plant after GERMINATION of SEEDS.
Extrachromosomal, usually CIRCULAR DNA molecules that are self-replicating and transferable from one organism to another. They are found in a variety of bacterial, archaeal, fungal, algal, and plant species. They are used in GENETIC ENGINEERING as CLONING VECTORS.
Single-stranded complementary DNA synthesized from an RNA template by the action of RNA-dependent DNA polymerase. cDNA (i.e., complementary DNA, not circular DNA, not C-DNA) is used in a variety of molecular cloning experiments as well as serving as a specific hybridization probe.
The outward appearance of the individual. It is the product of interactions between genes, and between the GENOTYPE and the environment.
The act of feeding on plants by animals.
Units that convert some other form of energy into electrical energy.
The rate dynamics in chemical or physical systems.
A genus of FLAVIVIRIDAE causing parenterally-transmitted HEPATITIS C which is associated with transfusions and drug abuse. Hepatitis C virus is the type species.
Constituent of the 60S subunit of eukaryotic ribosomes. 28S rRNA is involved in the initiation of polypeptide synthesis in eukaryotes.
A plant species of the genus SOLANUM, family SOLANACEAE. The starchy roots are used as food. SOLANINE is found in green parts.
Models used experimentally or theoretically to study molecular shape, electronic properties, or interactions; includes analogous molecules, computer-generated graphics, and mechanical structures.
Constituent of the 40S subunit of eukaryotic ribosomes. 18S rRNA is involved in the initiation of polypeptide synthesis in eukaryotes.
A group of ribonucleotides (up to 12) in which the phosphate residues of each ribonucleotide act as bridges in forming diester linkages between the ribose moieties.
Small kinetoplastid mitochondrial RNA that plays a major role in RNA EDITING. These molecules form perfect hybrids with edited mRNA sequences and possess nucleotide sequences at their 5'-ends that are complementary to the sequences of the mRNA's immediately downstream of the pre-edited regions.
Total mass of all the organisms of a given type and/or in a given area. (From Concise Dictionary of Biology, 1990) It includes the yield of vegetative mass produced from any given crop.
A creeping annual plant species of the CUCURBITACEAE family. It has a rough succulent, trailing stem and hairy leaves with three to five pointed lobes.
Viral proteins found in either the NUCLEOCAPSID or the viral core (VIRAL CORE PROTEINS).
The type species of CARDIOVIRUS causing encephalomyelitis and myocarditis in rodents, pigs, and monkeys. Infection in man has been reported with CNS involvement but without myocarditis.
DNA sequences which are recognized (directly or indirectly) and bound by a DNA-dependent RNA polymerase during the initiation of transcription. Highly conserved sequences within the promoter include the Pribnow box in bacteria and the TATA BOX in eukaryotes.
An enzyme that synthesizes DNA on an RNA template. It is encoded by the pol gene of retroviruses and by certain retrovirus-like elements. EC 2.7.7.49.
Constituent of 30S subunit prokaryotic ribosomes containing 1600 nucleotides and 21 proteins. 16S rRNA is involved in initiation of polypeptide synthesis.
A plant genus of the family POACEAE. The EDIBLE GRAIN, barley, is widely used as food.
The process of cumulative change at the level of DNA; RNA; and PROTEINS, over successive generations.
A protein-nucleic acid complex which forms part or all of a virion. It consists of a CAPSID plus enclosed nucleic acid. Depending on the virus, the nucleocapsid may correspond to a naked core or be surrounded by a membranous envelope.
Sugar-rich liquid produced in plant glands called nectaries. It is either produced in flowers or other plant structures, providing a source of attraction for pollinating insects and animals, as well as being a nutrient source to animal mutualists which provide protection of plants against herbivores.
The type species of ALPHAVIRUS normally transmitted to birds by CULEX mosquitoes in Egypt, South Africa, India, Malaya, the Philippines, and Australia. It may be associated with fever in humans. Serotypes (differing by less than 17% in nucleotide sequence) include Babanki, Kyzylagach, and Ockelbo viruses.
A species of ENTEROVIRUS infecting humans and containing 36 serotypes. It is comprised of all the echoviruses and a few coxsackieviruses, including all of those previously named coxsackievirus B.
Eighteen-carbon cyclopentyl polyunsaturated fatty acids derived from ALPHA-LINOLENIC ACID via an oxidative pathway analogous to the EICOSANOIDS in animals. Biosynthesis is inhibited by SALICYLATES. A key member, jasmonic acid of PLANTS, plays a similar role to ARACHIDONIC ACID in animals.
Theoretical representations that simulate the behavior or activity of biological processes or diseases. For disease models in living animals, DISEASE MODELS, ANIMAL is available. Biological models include the use of mathematical equations, computers, and other electronic equipment.
The level of protein structure in which combinations of secondary protein structures (alpha helices, beta sheets, loop regions, and motifs) pack together to form folded shapes called domains. Disulfide bridges between cysteines in two different parts of the polypeptide chain along with other interactions between the chains play a role in the formation and stabilization of tertiary structure. Small proteins usually consist of only one domain but larger proteins may contain a number of domains connected by segments of polypeptide chain which lack regular secondary structure.
The sequence at the 3' end of messenger RNA that does not code for product. This region contains transcription and translation regulating sequences.
Synthetic transcripts of a specific DNA molecule or fragment, made by an in vitro transcription system. This cRNA can be labeled with radioactive uracil and then used as a probe. (King & Stansfield, A Dictionary of Genetics, 4th ed)
The arrangement of two or more amino acid or base sequences from an organism or organisms in such a way as to align areas of the sequences sharing common properties. The degree of relatedness or homology between the sequences is predicted computationally or statistically based on weights assigned to the elements aligned between the sequences. This in turn can serve as a potential indicator of the genetic relatedness between the organisms.
The property of objects that determines the direction of heat flow when they are placed in direct thermal contact. The temperature is the energy of microscopic motions (vibrational and translational) of the particles of atoms.
The relationship between two different species of organisms that are interdependent; each gains benefits from the other or a relationship between different species where both of the organisms in question benefit from the presence of the other.
A deoxyribonucleotide polymer that is the primary genetic material of all cells. Eukaryotic and prokaryotic organisms normally contain DNA in a double-stranded state, yet several important biological processes transiently involve single-stranded regions. DNA, which consists of a polysugar-phosphate backbone possessing projections of purines (adenine and guanine) and pyrimidines (thymine and cytosine), forms a double helix that is held together by hydrogen bonds between these purines and pyrimidines (adenine to thymine and guanine to cytosine).
A test used to determine whether or not complementation (compensation in the form of dominance) will occur in a cell with a given mutant phenotype when another mutant genome, encoding the same mutant phenotype, is introduced into that cell.
A genus of plant viruses of the family BROMOVIRIDAE, which infect cucurbits and solanaceous plants. Transmission occurs via aphids in a non-persistent manner, and also via seeds. The type species Cucumber mosaic virus, a CUCUMOVIRUS, should not be confused with Cucumber green mottle mosaic virus, a TOBAMOVIRUS.
The synthesis by organisms of organic chemical compounds, especially carbohydrates, from carbon dioxide using energy obtained from light rather than from the oxidation of chemical compounds. Photosynthesis comprises two separate processes: the light reactions and the dark reactions. In higher plants; GREEN ALGAE; and CYANOBACTERIA; NADPH and ATP formed by the light reactions drive the dark reactions which result in the fixation of carbon dioxide. (from Oxford Dictionary of Biochemistry and Molecular Biology, 2001)
A strain of ENCEPHALOMYOCARDITIS VIRUS, a species of CARDIOVIRUS, isolated from rodents and lagomorphs and occasionally causing febrile illness in man.
A sequence of amino acids in a polypeptide or of nucleotides in DNA or RNA that is similar across multiple species. A known set of conserved sequences is represented by a CONSENSUS SEQUENCE. AMINO ACID MOTIFS are often composed of conserved sequences.
Interruption or suppression of the expression of a gene at transcriptional or translational levels.
The outer layer of the woody parts of plants.
Constituent of 50S subunit of prokaryotic ribosomes containing about 3200 nucleotides. 23S rRNA is involved in the initiation of polypeptide synthesis.
A plant genus of the family POACEAE that is the source of EDIBLE GRAIN. A hybrid with rye (SECALE CEREALE) is called TRITICALE. The seed is ground into FLOUR and used to make BREAD, and is the source of WHEAT GERM AGGLUTININS.
The part of a cell that contains the CYTOSOL and small structures excluding the CELL NUCLEUS; MITOCHONDRIA; and large VACUOLES. (Glick, Glossary of Biochemistry and Molecular Biology, 1990)
A group of alicyclic hydrocarbons with the general formula R-C5H9.
The type species of the genus INFLUENZAVIRUS A that causes influenza and other diseases in humans and animals. Antigenic variation occurs frequently between strains, allowing classification into subtypes and variants. Transmission is usually by aerosol (human and most non-aquatic hosts) or waterborne (ducks). Infected birds shed the virus in their saliva, nasal secretions, and feces.
Acetic acid derivatives of the heterocyclic compound indole. (Merck Index, 11th ed)
Physiological functions characteristic of plants.
A family of RNA viruses infecting insects and fish. There are two genera: Alphanodavirus and Betanodavirus.
Elements of limited time intervals, contributing to particular results or situations.
Plant cell inclusion bodies that contain the photosynthetic pigment CHLOROPHYLL, which is associated with the membrane of THYLAKOIDS. Chloroplasts occur in cells of leaves and young stems of plants. They are also found in some forms of PHYTOPLANKTON such as HAPTOPHYTA; DINOFLAGELLATES; DIATOMS; and CRYPTOPHYTA.
A species of CERCOPITHECUS containing three subspecies: C. tantalus, C. pygerythrus, and C. sabeus. They are found in the forests and savannah of Africa. The African green monkey (C. pygerythrus) is the natural host of SIMIAN IMMUNODEFICIENCY VIRUS and is used in AIDS research.
A sequence of successive nucleotide triplets that are read as CODONS specifying AMINO ACIDS and begin with an INITIATOR CODON and end with a stop codon (CODON, TERMINATOR).
The unconsolidated mineral or organic matter on the surface of the earth that serves as a natural medium for the growth of land plants.
A genus of plant viruses in the family FLEXIVIRIDAE, that cause mosaic and ringspot symptoms. Transmission occurs mechanically. Potato virus X is the type species.
Viruses which lack a complete genome so that they cannot completely replicate or cannot form a protein coat. Some are host-dependent defectives, meaning they can replicate only in cell systems which provide the particular genetic function which they lack. Others, called SATELLITE VIRUSES, are able to replicate only when their genetic defect is complemented by a helper virus.
Endogenous substances, usually proteins, which are effective in the initiation, stimulation, or termination of the genetic transcription process.
A plant genus of the family Cruciferae. It contains many species and cultivars used as food including cabbage, cauliflower, broccoli, Brussel sprouts, kale, collard greens, MUSTARD PLANT; (B. alba, B. junica, and B. nigra), turnips (BRASSICA NAPUS) and rapeseed (BRASSICA RAPA).
The sequential correspondence of nucleotides in one nucleic acid molecule with those of another nucleic acid molecule. Sequence homology is an indication of the genetic relatedness of different organisms and gene function.
Detection of RNA that has been electrophoretically separated and immobilized by blotting on nitrocellulose or other type of paper or nylon membrane followed by hybridization with labeled NUCLEIC ACID PROBES.
Any DNA sequence capable of independent replication or a molecule that possesses a REPLICATION ORIGIN and which is therefore potentially capable of being replicated in a suitable cell. (Singleton & Sainsbury, Dictionary of Microbiology and Molecular Biology, 2d ed)
A functional system which includes the organisms of a natural community together with their environment. (McGraw Hill Dictionary of Scientific and Technical Terms, 4th ed)
Proteins prepared by recombinant DNA technology.
A compound obtained from the bark of the white willow and wintergreen leaves. It has bacteriostatic, fungicidal, and keratolytic actions.
Systems of medicine based on cultural beliefs and practices handed down from generation to generation. The concept includes mystical and magical rituals (SPIRITUAL THERAPIES); PHYTOTHERAPY; and other treatments which may not be explained by modern medicine.
Knobbed structures formed from and attached to plant roots, especially of LEGUMES, which result from symbiotic infection by nitrogen fixing bacteria such as RHIZOBIUM or FRANKIA. Root nodules are structures related to MYCORRHIZAE formed by symbiotic associations with fungi.
Substances released by PLANTS such as PLANT GUMS and PLANT RESINS.
The small RNAs which provide spliced leader sequences, SL1, SL2, SL3, SL4 and SL5 (short sequences which are joined to the 5' ends of pre-mRNAs by TRANS-SPLICING). They are found primarily in primitive eukaryotes (protozoans and nematodes).
Protein or glycoprotein substances of plant origin that bind to sugar moieties in cell walls or membranes. Some carbohydrate-metabolizing proteins (ENZYMES) from PLANTS also bind to carbohydrates, however they are not considered lectins. Many plant lectins change the physiology of the membrane of BLOOD CELLS to cause agglutination, mitosis, or other biochemical changes. They may play a role in plant defense mechanisms.
The type species of TOBAMOVIRUS which causes mosaic disease of tobacco. Transmission occurs by mechanical inoculation.
Proteins conjugated with nucleic acids.
Recombinant proteins produced by the GENETIC TRANSLATION of fused genes formed by the combination of NUCLEIC ACID REGULATORY SEQUENCES of one or more genes with the protein coding sequences of one or more genes.
A family of small RNA viruses comprising some important pathogens of humans and animals. Transmission usually occurs mechanically. There are nine genera: APHTHOVIRUS; CARDIOVIRUS; ENTEROVIRUS; ERBOVIRUS; HEPATOVIRUS; KOBUVIRUS; PARECHOVIRUS; RHINOVIRUS; and TESCHOVIRUS.
Separation of particles according to density by employing a gradient of varying densities. At equilibrium each particle settles in the gradient at a point equal to its density. (McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)
The reproductive cells of plants.
The uptake of naked or purified DNA by CELLS, usually meaning the process as it occurs in eukaryotic cells. It is analogous to bacterial transformation (TRANSFORMATION, BACTERIAL) and both are routinely employed in GENE TRANSFER TECHNIQUES.
Symbiotic combination (dual organism) of the MYCELIUM of FUNGI with the roots of plants (PLANT ROOTS). The roots of almost all higher plants exhibit this mutually beneficial relationship, whereby the fungus supplies water and mineral salts to the plant, and the plant supplies CARBOHYDRATES to the fungus. There are two major types of mycorrhizae: ectomycorrhizae and endomycorrhizae.
Proteins that form the CAPSID of VIRUSES.
Agents used in the prophylaxis or therapy of VIRUS DISEASES. Some of the ways they may act include preventing viral replication by inhibiting viral DNA polymerase; binding to specific cell-surface receptors and inhibiting viral penetration or uncoating; inhibiting viral protein synthesis; or blocking late stages of virus assembly.
The intracellular transfer of information (biological activation/inhibition) through a signal pathway. In each signal transduction system, an activation/inhibition signal from a biologically active molecule (hormone, neurotransmitter) is mediated via the coupling of a receptor/enzyme to a second messenger system or to an ion channel. Signal transduction plays an important role in activating cellular functions, cell differentiation, and cell proliferation. Examples of signal transduction systems are the GAMMA-AMINOBUTYRIC ACID-postsynaptic receptor-calcium ion channel system, the receptor-mediated T-cell activation pathway, and the receptor-mediated activation of phospholipases. Those coupled to membrane depolarization or intracellular release of calcium include the receptor-mediated activation of cytotoxic functions in granulocytes and the synaptic potentiation of protein kinase activation. Some signal transduction pathways may be part of larger signal transduction pathways; for example, protein kinase activation is part of the platelet activation signal pathway.
Positive stranded rna virus transcription is the method of transcription. The virus exits the host cell by tubule-guided viral ... Plants serve as the natural host. Transmission routes are mechanical. "Viral Zone". ExPASy. Retrieved 15 June 2015. ICTV. " ... Plants serve as natural hosts. There are currently 56 species in this subfamily, divided among 3 genera. The genera Comovirus, ... Viral replication is cytoplasmic. Entry into the host cell is achieved by penetration into the host cell. Replication follows ...
The virus exits the host cell by budding, and tubule-guided viral movement. Plants serve as the natural host. The virus is ... Replication follows the negative stranded RNA virus replication model. Negative stranded rna virus transcription, using ... Viral replication is cytoplasmic. Entry into the host cell is achieved by attachment of the viral G glycoproteins to host ... Plants serve as natural hosts. Table legend: "*" denotes type species. Cytorhabdovirions are enveloped, with bullet shaped and ...
Plants serve as the natural host. Transmission routes are grafting. "Viral Zone". ExPASy. Retrieved 15 June 2015. ICTV. "Virus ... Replication follows the positive stranded RNA virus replication model. Positive stranded rna virus transcription is the method ... Plants serve as natural hosts. There are currently six species in this genus including the type species Apple stem pitting ... Viral replication is cytoplasmic, and is lysogenic. Entry into the host cell is achieved by penetration into the host cell. ...
The virus exits the host cell by tripartite non-tubule guided viral movement, and tubule-guided viral movement. Plants and ... Replication follows the positive stranded RNA virus replication model. Positive stranded rna virus transcription is the method ... Viral replication is cytoplasmic, and is lysogenic. Entry into the host cell is achieved by penetration into the host cell. ... Plants and fungi serve as natural hosts. There are currently 87 species in this family, divided among 7 genera. Diseases ...
Plants serve as the natural host. Transmission routes are mechanical, seed borne, and contact. "Viral Zone". ExPASy. Retrieved ... Positive stranded RNA virus transcription, using the premature termination model of subgenomic RNA transcription is the method ... Machlomovirus is a genus of plant viruses, in the family Tombusviridae. Plants serve as natural hosts. There is currently only ... Viral replication is cytoplasmic. Entry into the host cell is achieved by penetration into the host cell. Replication follows ...
... is a family of positive-strand RNA viruses. Plants serve as natural hosts. The name of the family is derived from ... The virus exits the host cell by tripartite non-tubule guided viral movement, and monopartite non-tubule guided viral movement ... Replication follows the positive stranded RNA virus replication model. Positive stranded RNA virus transcription is the method ... Plants serve as the natural host. Viruses include in the family Virgaviridae are characterized by unique alpha-like replication ...
The virus exits the host cell by tripartite non-tubule guided viral movement. Plant serve as the natural host. The virus is ... Replication follows the positive stranded RNA virus replication model. Positive stranded RNA virus transcription is the method ... Plant serve as natural hosts. There are currently four species in this genus including the type species Beet necrotic yellow ... Viral replication is cytoplasmic. Entry into the host cell is achieved by penetration into the host cell. ...
Positive stranded RNA virus transcription is the method of transcription. The virus exits the host cell by tubule-guided viral ... Poaceae plants serve as the natural host. The virus is transmitted via a vector (wheat curl mite). Transmission routes are ... Poaceae plants serve as natural hosts. There are currently three species in this genus, including the type species Triticum ... Viral replication is cytoplasmic. Entry into the host cell is achieved by penetration into the host cell. Replication follows ...
At least some species require vectors such as aphids or mealybugs for their transmission from plant to plant. The viral RNA ... These secondary structures have been found to be important in viral RNA replication. Viral replication is cytoplasmic. Entry ... Positive stranded rna virus transcription is the method of transcription. The virus exits the host cell by tubule-guided viral ... Closterovirus, also known as beet yellows viral group, is a genus of viruses, in the family Closteroviridae. Plants serve as ...
Positive stranded RNA virus transcription is the method of transcription. The virus exits the host cell by tubule-guided viral ... Plants serve as natural hosts. There are currently ten species in this genus including the type species Maclura mosaic virus. ... Viral replication is cytoplasmic. Entry into the host cell is achieved by penetration into the host cell. Replication follows ... Plants serve as the natural host. The virus is transmitted via a vector (insects). Transmission routes are vector and ...
Positive stranded rna virus transcription is the method of transcription. The virus exits the host cell by tubule-guided viral ... Plants serve as natural hosts. There are currently 56 species in this family, divided among 4 genera, seven species of which ... Viral replication is cytoplasmic. Entry into the host cell is achieved by penetration into the host cell. Replication follows ... Plants serve as the natural host. Transmission routes are mechanical. Fuchs, M; Bar-Joseph, M; Candresse, T; Maree, HJ; ...
UTR to control expression of defective interfering RNAs and viral RNA replication. "Viral Zone". ExPASy. Retrieved 15 June 2015 ... The virus exits the host cell by tubule-guided viral movement. Plants serve as the natural host. Transmission routes are ... Positive stranded rna virus transcription, using the premature termination model of subgenomic RNA transcription is the method ... untranslated region of the tomato bushy stunt virus genome modulates viral RNA replication". J. Mol. Biol. 305 (4): 741-56. doi ...
The virus exits the host cell by monopartite non-tubule guided viral movement. Plants serve as the natural host. The virus is ... Replication follows the positive stranded RNA virus replication model. Positive stranded RNA virus transcription is the method ... Plants serve as natural hosts. There are currently three species in this genus including the type species Tobacco rattle virus ... Genomes are linear and segmented, bipartite, positive-sense, single-stranded RNA around 26.84.5kb in total length (8600-11300 ...
Positive stranded RNA virus transcription is the method of transcription. The virus exits the host cell by tubule-guided viral ... Plants serve as natural hosts. There are currently six species in this genus including the type species Wheat streak mosaic ... Plants serve as the natural host. The virus is transmitted via a vector (mite). Transmission routes are vector and mechanical ... Viral replication is cytoplasmic. Entry into the host cell is achieved by penetration into the host cell. Replication follows ...
Recombination occurs by a mechanism in which the viral RNA-dependent RNA polymerase switches templates during RNA synthesis ( ... Plants serve as the natural host. Transmission routes are mechanical, seed borne, and contact. RNA recombination occurs ... Mechanism of RNA recombination in carmo- and tombusviruses: evidence for template switching by the RNA-dependent RNA polymerase ... In other plants however, such as the Calla lily, the disease is of more concern, as the plant is of significant economic ...
The virus exits the host cell by monopartite non-tubule guided viral movement. Plants serve as the natural host. The virus is ... Replication follows the positive stranded RNA virus replication model. Positive stranded RNA virus transcription is the method ... Plants serve as natural hosts. There are currently only one species in this genus: the type species Grapevine fleck virus. ... "Viral Zone". ExPASy. Retrieved 15 June 2015. CS1 maint: discouraged parameter (link) ICTV. "Virus Taxonomy: 2014 Release". ...
The virus exits the host cell by tubule-guided viral movement. Plants serve as the natural host. The virus is transmitted via a ... Replication follows the positive stranded RNA virus replication model. Positive stranded rna virus transcription is the method ... Viralzone: Luteoviridae "Luteoviridae - Positive Sense RNA Viruses - Positive Sense RNA Viruses (2011)". International ... Plants serve as natural hosts. There are currently 51 species in this family, divided among three genera, with seven unassigned ...
"Viral Zone". ExPASy. Retrieved 15 June 2015. Lai MM. RNA recombination in animal and plant viruses. Microbiol Rev. 1992 Mar;56( ... genomes are able to undergo RNA-RNA homologous recombination upon infection of plant cells. The RNA-dependent RNA polymerase ... Factors regulating template switch in vitro by viral RNA-dependent RNA polymerases: implications for RNA-RNA recombination. ... The virus exits the host cell by tubule-guided viral movement. Plants serve as the natural host. Transmission routes are ...
Positive stranded RNA virus transcription is the method of transcription. The virus exits the host cell by tubule-guided viral ... Plants serve as the natural host. The virus is transmitted via a vector (but not SMOV). Transmission routes are vector, seed ... Viral replication is cytoplasmic, and is lysogenic. Entry into the host cell is achieved by penetration into the host cell. ... Plants (specifically Satsuma mandarin trees) serve as natural hosts. There are currently five species in this genus, including ...
The virus exits the host cell by tubule-guided viral movement. Plants serve as the natural host. The virus is transmitted via a ... Replication follows the positive stranded RNA virus replication model. Positive stranded RNA virus transcription is the method ... Plants serve as natural hosts. There are currently 14 species in this genus including the type species Southern bean mosaic ... Translation of ORF2a from the genomic RNA is dependent on a leaky scanning mechanism.[citation needed] ORF3 encodes the coat ...
Positive stranded RNA virus transcription is the method of transcription. The virus exits the host cell by tubule-guided viral ... Plants serve as the natural host. The virus is transmitted via a vector (unknown). Transmission routes are vector. "Viral Zone ... Plants serve as natural hosts. There is currently only one species in this genus: the type species Blackberry virus Y. Group: ... Viral replication is cytoplasmic. Entry into the host cell is achieved by penetration into the host cell. Replication follows ...
Positive stranded RNA virus transcription is the method of transcription. The virus exits the host cell by tubule-guided viral ... They induce characteristic inclusion bodies (pinwheels) within infected plant cells. Viral replication is cytoplasmic. Entry ... RNA dependent RNA polymerase): 57 kDa Capsid protein: 34 kDa There may be some variation in the number of the proteins ... They infect plants and are transmitted by whiteflies (Bemisia tabaci). The name of the genus is derived from Ipomoea - the ...
Positive stranded RNA virus transcription is the method of transcription. The virus exits the host cell by tubule-guided viral ... Plants serve as the natural host. Transmission routes are mechanical. "ICTV Report Closteroviridae". "Viral Zone". ExPASy. ... Plants serve as natural hosts. There are currently seven species in this genus, including the type species Grapevine leafroll- ... Viral replication is cytoplasmic. Entry into the host cell is achieved by penetration into the host cell. Replication follows ...
The virus exits the host cell by tubule-guided viral movement. Plants serve as the natural host. The virus is transmitted via a ... Replication follows the positive stranded RNA virus replication model. Positive stranded RNA virus transcription is the method ... Plants serve as natural hosts. There are currently 26 species in this genus including the type species Potato leafroll virus. ... Viral replication is cytoplasmic. Entry into the host cell is achieved by penetration into the host cell. ...
Plants serve as the natural host. Transmission routes are mechanical, seed borne, and contact. "Viral Zone". ExPASy. Retrieved ... Positive stranded RNA virus transcription, using the premature termination model of subgenomic RNA transcription is the method ... Plants serve as natural hosts. There is currently only one species in this genus: the type species Galinsoga mosaic virus. ... Viral replication is cytoplasmic. Entry into the host cell is achieved by penetration into the host cell. Replication follows ...
Positive stranded RNA virus transcription is the method of transcription. Plants as well as some other root and tuber crops in ... Viral replication is cytoplasmic. Entry into the host cell is achieved by penetration into the host cell. Replication follows ... Plants as well as some other root and tuber crops in the andes serve as natural hosts. There are currently two species in this ... "Viral Zone". ExPASy. Retrieved 13 August 2015. CS1 maint: discouraged parameter (link) ICTV. "Virus Taxonomy: 2014 Release". ...
Positive stranded RNA virus transcription is the method of transcription. The virus exits the host cell by tubule-guided viral ... Plants, specifically angiosperms such as pome fruits, citrus, and pear, serve as natural hosts for this plant pathogen. There ... Plants, pome fruits, citrus, and pear serve as the natural host. Transmission routes are grafting. It is transmitted by mites ... Viral replication is cytoplasmic. Entry into the host cell is achieved by penetration into the host cell. Replication follows ...
The virus exits the host cell by monopartite non-tubule guided viral movement. Plants serve as the natural host. The virus is ... Replication follows the positive stranded RNA virus replication model. Positive stranded RNA virus transcription is the method ... Plants serve as natural hosts. There are currently 28 species in this genus including the type species Turnip yellow mosaic ... Viral replication is cytoplasmic and lysogenic. Entry into the host cell is achieved by penetration into the host cell. ...
Each of the viral RNA molecules contains four hair-pin structures and a pseudoknot in the 3'UTR. The pseudoknot is unusual in ... The virus exits the host cell by tubule-guided viral movement. Plants serve as the natural host. The virus is transmitted via a ... In the related genus Closterovirus, these secondary structures have been found to be important in viral RNA replication. ... Replication follows the positive stranded RNA virus replication model. Positive stranded RNA virus transcription is the method ...
Xin-Cheng Qin et al.: A tick-borne segmented RNA virus contains genome segments derived from unsegmented viral ancestors, in: ... Virgaviridae: a new Familie of rod-shaped plant viruses. . In: Arch Virol. . 154, Nr. 12, 2009, S. 1967-72. doi:10.1007/s00705- ... 3 RNA-Viren *3.1 Doppelsträngige RNA-Viren (dsRNA, double stranded RNA). *3.2 Einzelstrang-RNA-Viren mit negativer Polarität ( ... ss(−)RNA: negative single-stranded RNA). *3.3 Einzelstrang-RNA-Viren mit positiver Polarität (ss(+)RNA: positive single ...
... meningitis and other viral haemorrhagic fevers may resemble EVD.[1] Blood samples are tested for viral RNA, viral antibodies or ... Plants, arthropods, rodents, and birds have also been considered possible viral reservoirs.[1][29] ... viral RNA, or antibodies in blood[1]. Differential diagnosis. Malaria, cholera, typhoid fever, meningitis, other viral ... detecting the viral RNA by polymerase chain reaction (PCR)[6][23] and detecting proteins by enzyme-linked immunosorbent assay ( ...
... strand RNA genome is replicated through a double-stranded RNA intermediate that is formed using viral RDRP (RNA-Dependent RNA ... Within the order Picornavirales, there are related viral families, such as the plant infecting Secoviridae, and the insect ... It has both icosahedral virus particles, viral RNA-dependent RNA polymerase and protease and viral replication proteins. But ... Also, the 3' end elements of viral RNA are significant and efficient for RNA replication of picornaviruses. The 3' end of ...
... were split off as a third domain because of the large differences in their ribosomal RNA structure. The particular RNA ... Plants and other organisms consume the latter.[181]. In the sulfur cycle, archaea that grow by oxidizing sulfur compounds ... the impact of viral infection is higher on archaea than on bacteria and virus-induced lysis of archaea accounts for up to one- ... although there are many introns in their transfer RNA and ribosomal RNA genes,[146] and introns may occur in a few protein- ...
... and viral genes.[8][2] The TATA box was found in protein coding genes transcribed by RNA polymerase II.[2] ... "Plant Physiology. 173 (1): 715-727. doi:10.1104/pp.16.01504. PMC 5210749. PMID 27881725.. ... the TATA box is found at RNA polymerase II promoter regions, although some in vitro studies have demonstrated that RNA ... "RNA polymerase III accurately initiates transcription from RNA polymerase II promoters in vitro". The Journal of Biological ...
Plant Biology[11]. Plant genome sequencing; epigenetics and stem cell fate; stem cell signaling; plant-environment interactions ... RNA interference (RNAi) and small-RNA biology; DNA replication; RNA splicing; signal transduction; genome structure; non-coding ... A.D. Hershey and Martha Chase, "Independent Functions of Viral Protein and Nucleic Acid in Growth of Bacteriophage," J. General ... increase fruit yield in flowering plants, e.g., tomato. Other initiatives: genetics of aquatic plants for biofuel development; ...
This is mostly shown for plant RNA viruses. Viroplasm is the location within the infected cell where viral replication and ... may help to develop new therapeutic approaches against virus infections in animal and plant cells. Viral evolution Viral ... A viroplasm is an inclusion body in a cell where viral replication and assembly occurs. They may be thought of as viral ... Some of the membrane components are used for viral replication while some others will be modified to produce viral envelopes, ...
The N protein contributes to viral replication, and coats the genomic RNA within the virion. Presently the soybean thrips ( ... Typically thrips feeding alone on soybean plants does not cause economic damage, however it may if the plant is under some ... The NSs protein is also a non-structural protein and contributes to suppression of RNA silencing during plant infection. ... The L segment is 9010 nt and encodes for the RNA-dependent RNA polymerase (RdRp). The M segment is 4955 nt and to encode for ...
This step will also make viral enzymes and capsid proteins (8). Viral RNA will be made in the nucleus. These pieces are then ... RNA: consists of a dimer RNA. It has a cap at the 5' end and a poly(A) tail at the 3' end. The RNA genome also has terminal ... Next, some of these RNA molecules are translated into viral proteins. For example, the gag gene is translated into molecules of ... The host cell then treats the viral DNA as part of its own genome, transcribing and translating the viral genes along with the ...
೪೧.೦ ೪೧.೧ Eddy SR (December 2001). "Non-coding RNA genes and the modern RNA world". Nat. Rev. Genet. 2 (12): 919-29. doi: ... Puchta, H.; Fauser, F. (2013). "Gene targeting in plants: 25 years later". Int. J. Dev. Biol 57 (6-7-8): 629-637. doi:10.1387/ ... Hershey, AD; Chase, M (1952). "Independent functions of viral protein and nucleic acid in growth of bacteriophage". The Journal ... ೯೦.೦ ೯೦.೧ Claverie JM (September 2005). "Fewer genes, more noncoding RNA". Science 309 (5740): 1529-30. Bibcode:2005Sci... ...
ingesting contaminated plants Foodborne illnesses (commonly diarrheal diseases) Campylobacter spp., Escherichia coli, ... "Haemorrhagic fevers, Viral". World Health Organization. Archived from the original on 27 July 2019. Retrieved 19 June 2019.. ... but there is increasing evidence from DNA and RNA sequencing, that measles, smallpox, influenza, HIV, and diphtheria came to ... Other haemorrhagic fevers (Crimean-Congo haemorrhagic fever, Dengue fever, Lassa fever, Marburg viral haemorrhagic fever, Rift ...
Bocobza SE, Aharoni A (2008). "Switching the light on plant riboswitches". Trends Plant Sci. 13 (10): 526-33. doi:10.1016/j. ... Through the process of viral infection into hosts the three domains of life evolved.[83][84] Another interesting proposal is ... Atkins JF, Gesteland RF, Cech T (2006). The RNA world: the nature of modern RNA suggests a prebiotic RNA world. Plainview, N.Y ... of RNAs with molecular properties predicted for RNAs of the RNA World constitutes an additional argument supporting the RNA ...
RNA silencing mechanisms are also important in the plant systemic response, as they can block virus replication.[40] The ... When a part of a plant becomes infected with a microbial or viral pathogen, in case of an incompatible interaction triggered by ... Most plant immune responses involve systemic chemical signals sent throughout a plant. Plants use pattern-recognition receptors ... Baulcombe D (September 2004). "RNA silencing in plants". Nature. 431 (7006): 356-63. Bibcode:2004Natur.431..356B. doi:10.1038/ ...
Liu, Y.; Bassham, D. C. (2012). "Autophagy: Pathways for Self-Eating in Plant Cells". Annual Review of Plant Biology. 63: 215- ... detecting single stranded RNA. Following activation of the toll-like receptor, intracellular signaling cascades are initiated, ... these findings have not been examined in non-viral systems. ... of regulatory signaling during stress particularly after viral ... "Subversion of cellular autophagosomal machinery by RNA viruses". PLoS Biol. 3 (5): e156. doi:10.1371/journal.pbio.0030156. PMC ...
Zohary D, Hopf M, Weiss E (2012). Domestication of Plants in the Old World: The origin and spread of plants in the old world. ... "Independent functions of viral protein and nucleic acid in growth of bacteriophage". The Journal of General Physiology. 36 (1 ... "A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity". Science. 337 (6096): 816-21. Bibcode:2012Sci ... "How does GM differ from conventional plant breeding?". royalsociety.org (dalam bahasa Inggris). Diakses tanggal 2017-11-14.. ...
RNA2 (2.9 kb) encodes the 2a protein (94 kDa), the RNA-dependent RNA polymerase, responsible for replication of the viral ... The sequence similarities of RNA replication genes and strategies for BMV have been shown to extend to a wide range of plant ... Brome mosaic virus (BMV) is a small (28 nm, 86S), positive-stranded, icosahedral RNA plant virus belonging to the genus ... 3a and coat protein are essential for systemic infection in plants but not RNA replication. Lucas, R. W.; Larson, S. B.; ...
Liu Y, Bassham DC (2012). "Autophagy: pathways for self-eating in plant cells". Annual Review of Plant Biology. 63: 215-37. doi ... detecting single stranded RNA. Following activation of the toll-like receptor, intracellular signaling cascades are initiated, ... these findings have not been examined in non-viral systems. ... The role of lipophagy in plant cells however remain elusive.[41 ... "Nature Plants. 3 (3). doi:10.1038/nplants.2017.26.. *^ An, Heeseon; Harper, J. Wade (February 2018). "Systematic analysis of ...
The resulting capped leader RNA is used to prime transcription on the viral genome. However some plant viruses do not use cap, ... Plants do not move, and so plant-to-plant transmission usually involves vectors (such as insects). Plant cells are surrounded ... Instead, the naked viral RNA may alter the function of the cells through a mechanism similar to RNA interference, in which the ... 2006). "Cap-independent translation of plant viral RNAs". Virus Research. 119 (1): 63-75. doi:10.1016/j.virusres.2005.10.010. ...
Viral genomes, which are usually RNA, take over the cell machinery and make both new viral RNA and the protein coat of the ... Hamilton A. & Baulcombe D (1999). "A species of small antisense RNA in posttranscriptional gene silencing in plants". Science ... They are transfer RNA (tRNA) and ribosomal RNA (rRNA).. tRNA[change , change source]. Transfer RNA (tRNA) is a short molecule ... RNA is physically different from DNA: DNA contains two intercoiled strands, but RNA only contains one single strand. RNA also ...
Viral pathogenesis • Preventive and therapeutic vaccines. 11: 63-9. doi:10.1016/j.coviro.2015.02.002. PMC 4827424. PMID ... "Transgenic plants of Nicotiana tabacum L. express aglycosylated monoclonal antibody with antitumor activity". Biotecnologia ... This enzymatic process produces one of the fundamental biopolymers found in cells (along with DNA, RNA, and proteins). ... glycosylation is often used by viruses to shield the underlying viral protein from immune recognition. A significant example is ...
As in all RNA viruses, mutations in influenza occur frequently because the virus' RNA polymerase has no proofreading mechanism ... However, viral genomes are constantly mutating, producing new forms of these antigens. If one of these new forms of an antigen ... Plant virus (Plant to Human). *Animal virus. *Human virome. *Archea virus. *Amoeba virus ... 3 substitutions per site per year during viral genome replication.[7] Mutations in the surface proteins allow the virus to ...
This enzyme is unique among viral polymerases in that it has reverse transcriptase activity to convert RNA into DNA to ... Inside this capsid the genome is converted from RNA to pdsDNA through activity of the polymerase as an RNA-dependent-DNA- ... The pgRNA is inserted into an assembled viral capsid containing the viral polymerase. ... Viral Polymerase[edit]. Hepadnaviridae encode their own polymerase, rather than co-opting host machinery as some other viruses ...
The plant extract QS21 is a liposome made up of plant saponins.[13] It is a part of the Shingrix vaccine approved in 2017.[14] ... and endocytosed nucleic acids such as double-stranded RNA (dsRNA), single-stranded DNA (ssDNA), and unmethylated CpG ... Squalene is an oil, made up of carbon and hydrogen atoms, produced by plants and is present in many foods. Squalene is also ...
... cycling viral RNA-dependent RNA polymerase much the same as the ribosome is hypothesized to cycle. ... The Plant Journal. 59 (5): 814-25. doi:10.1111/j.1365-313X.2009.03915.x. PMID 19453442.. ... A 5' cap (also termed an RNA cap, an RNA 7-methylguanosine cap, or an RNA m7G cap) is a modified guanine nucleotide that has ... Messenger RNA (mRNA) is a large family of RNA molecules that convey genetic information from DNA to the ribosome, where they ...
In Citrus plants, research has shown that glutamate decarboxylase plays a key role in citrate metabolism. With the increase of ... The bilateral delivery of glutamic acid decarboxylase (GAD) by an adeno-associated viral vector into the subthalamic nucleus of ... Woo TU, Walsh JP, Benes FM (July 2004). "Density of glutamic acid decarboxylase 67 messenger RNA-containing neurons that ... glutamate decarboxylase via direct exposure, citrate levels have been seen to significantly increase within plants, and in ...
This is because the virus genome is split between eight independent pieces of RNA, which allows pieces of RNA from different ... No circulating flu has yet shown any resistance to zanamivir (Relenza), the other available anti-viral. Swine Before being ... that the virus may be the product of three strains from three continents that swapped genes in a lab or a vaccine-making plant ... Gene sequences for every viral gene were made available through the Global Initiative on Sharing Avian Influenza Data (GISAID ...
... concluded that the risks to human health associated with the use of specific viral DNA sequences in GM plants are negligible, ... van Beilen JB, Poirier Y (May 2008). "Production of renewable polymers from crop plants". The Plant Journal. 54 (4): 684-701. ... An example of this is the engineering of a plant to express a pesticide, thereby ending the need of external application of ... Genetically modified crops ("GM crops", or "biotech crops") are plants used in agriculture, the DNA of which has been modified ...
"Molecular Plant Pathology. 19 (4): 1029-1044. doi:10.1111/mpp.12580. PMC 5772912. PMID 29024322.. ... "Loss of the flagellum happened only once in the fungal lineage: phylogenetic structure of kingdom Fungi inferred from RNA ... viral, or subviral.[15] ... a b The first eukaryotes were "neither plants, animals, nor ... "Molecular Plant Pathology. 16 (4): 413-34. doi:10.1111/mpp.12190. PMC 6638381. PMID 25178392.. ...
RNA sequencing[edit]. RNA sequencing was one of the earliest forms of nucleotide sequencing. The major landmark of RNA ... and identification of individually labeled bases within a synthetic 3,272 base-pair DNA molecule and a 7,249 base-pair viral ... plant, and microbial species. ... A successful RNA extraction will yield a RNA sample that should ... This method is based on use of RNA polymerase (RNAP), which is attached to a polystyrene bead. One end of DNA to be sequenced ...
RNA viral community in human feces: prevalence of plant pathogenic viruses.. Zhang T1, Breitbart M, Lee WH, Run JQ, Wei CL, Soh ... The vast majority of the 36,769 viral sequences obtained were similar to plant pathogenic RNA viruses. The most abundant fecal ... Many RNA viruses are known to be associated with gastroenteritis; however, the enteric RNA viral community present in healthy ... and viral RNA was extracted and cloned into shotgun viral cDNA libraries for sequencing analysis. ...
Viral small interfering RNAs target host genes to mediate disease symptoms in plants.. Smith NA1, Eamens AL, Wang MB. ... Viral Small Interfering RNAs Target Host Genes to Mediate Disease Symptoms in Plants ... Viral Small Interfering RNAs Target Host Genes to Mediate Disease Symptoms in Plants ... Viral Small Interfering RNAs Target Host Genes to Mediate Disease Symptoms in Plants ...
Viral resistance has been developed in diverse crops with SRGE technology and a few viral resistant crops have been approved ... Viral resistance has been developed in diverse crops with SRGE technology and a few viral resistant crops have been approved ... Small RNA based genetic engineering (SRGE) technology had been explored for crop protection against viruses for nearly thirty ... Small RNA based genetic engineering (SRGE) technology had been explored for crop protection against viruses for nearly thirty ...
In one such evasion strategy, the plant viral protein p19 suppresses a plants anti-viral RNA silencing response. p19 binds ... Double-stranded RNA triggers the RNA silencing pathway and most plant viruses use a double-stranded RNA to replicate their ... RNA_Silencing". Categories: RNA Silencing , Post-transcriptional gene silencing (PTGS) , Small Interfering RNA , Virus , Plant ... User:Wayne Decatur/Plant Viral Protein p19 Suppression of RNA Silencing. From Proteopedia. , User:Wayne Decatur ...
... M. S. ... A benign viral satellite RNA, in combination with a mild strain of cucumber mosaic virus (CMV-S), was used as a "vaccine" or " ... The yield from preinoculated and challenged pepper plants was 80% that of untreated plants, while the yield from preinoculated ... Plant Sciences Institute, Molecular Plant Pathology Laboratory, Agricultural Research Service, United States Department of ...
... insights from plant viral infections-a BARD workshop report, Plant Molecular Biology" on DeepDyve, the largest online rental ... insights from plant viral infections-a BARD workshop report. Induction and suppression of RNA silencing: insights from plant ... Induction and suppression of RNA silencing: insights from plant viral infections-a BARD workshop report. Scholthof, Karen-Beth ... An international workshop on Induction and Suppression of RNA Silencing: Insights from Plant Viral Infections was sponsored ...
rgs-CaM Detects and Counteracts Viral RNA Silencing Suppressors in Plant Immune Priming. Files in This Item: 2017rgs-CaM ... rgs-CaM Detects and Counteracts Viral RNA Silencing Suppressors in Plant Immune Priming. ... We previously reported the antiviral function of rgs-CaM, which binds to and directs degradation of viral RNA silencing ... Primary infection of a plant with a pathogen that causes high accumulation of salicylic acid in the plant typically via a ...
Flores, R. (2001). A naked plant-specific RNA ten-fold smaller than the smallest known viral RNA: The viroid. C.R. Acad. Sci. ... CANDIDATE RNAS FOR THE MOBILE SILENCING SIGNAL. siRNAs. Small RNAs associated with RNA silencing were discovered in plants ( ... Plant viruses encode special proteins to facilitate movement of viral RNA (reviewed in Lazarowitz and Beachy, 1999), but there ... VIRAL SUPPRESSORS AND THE MOBILE SIGNAL. The discovery in 1998 that certain plant viruses encode proteins that suppress RNA ...
Plant defense responses against viral and bacterial pathogen infections. Focus on RNA-binding proteins (RBPs) Read on Sciendo ...
Plant virus 7. Animal virus 8. Influenza virus - Humans, Animals, Avians 9. Vaccination 10. RNA virus enzyme 11. DNA virus 12. ... Proper steps are taken by the researchers while preparing therapeutics in order to cure the Viral disease, such as they are ... The host organism for a virus can vary from a small seed,to a large whale, in the due course, which includes plants, human ... Related keywords for IJVSR: 1. Virology 2. HIV (Human Immunodeficiency Virus) 3. EBOLA 4. Viral Vaccines 5. HPV (Human ...
RNA Extraction, Northern Blot, and RT-PCR Analysis. RNA from leaf tissues of soybean plants at the V1/V2 growth stage was ... Construction of Viral Vectors, in Vitro Transcription, and Plant Inoculation. Generation of silencing vectors, in vitro ... sojae than V plants; at 9 d, approximately 60% of the S4a or S4b plants survived infection versus none of the control plants ( ... B, Northern-blot analysis showing expression of PR1a in V, S4a, or S4b plants or V plants inoculated with an avirulent (AvrB) ...
From stars to stripes: RNA‐directed shaping of plant viral protein templates-structural synthetic virology for smart biohybrid ... viral capsids32, peptide amphiphiles33, elastin-mimetic peptides34,35, and DNA ribbons36, along with many others37 exhibit TH ... cryo-electron microscopy and atomic force microscopy were used to identify and characterize partly assembled viral capsids on ...
... plants and microbes. The journal welcomes studies on viruses as well as on viral infections and diseases. The journal will ... feature articles on new virus discovery, molecular characterization of viruses, viral pathogenesis and host immunity, vaccine ... PLANT POSITIVE-STRANDED RNA VIRUSES: STRUCTURE, EXPRESSION AND REGULATION OF THE VIRAL GENES ...
In one such evasion strategy, the plant viral protein p19 suppresses a plants anti-viral RNA silencing response. p19 binds ... Double-stranded RNA triggers the RNA silencing pathway and most plant viruses use a double-stranded RNA to replicate their ... Plant viral suppressors of RNA silencing., Roth BM, Pruss GJ, Vance VB, Virus Res. 2004 Jun 1;102(1):97-108. PMID:15068885. ... Categories: RNA Silencing , Post-transcriptional gene silencing (PTGS) , Small Interfering RNA , Virus , Plant Virus , Double- ...
Plant scientists at Iowa State University have completed a new study that describes the genetic pathways at work when corn ... plants respond to stress brought on by heat, a step that could lead to crops better capable of withstanding ... ... Microscopy deep learning predicts viral infections. 6 hours ago Researchers develop most comprehensive RNA atlas to date. Jun ... A better understanding of how corn plants cope with stress can help plant breeders engineer crops that can better tolerate and ...
Plant Proteins / metabolism* * Plant Viral Movement Proteins * Plants, Toxic* * Potexvirus / genetics * RNA, Messenger / ... Inoculation of sink leaves with a movement protein-defective virus showed that virally expressed GFP, but not viral RNA, was ...
... controls translation reinitiation of major open reading frames on polycistronic RNA. We show here that TAV function depends on ... A plant viral "reinitiation" factor interacts with the host translational machinery Cell. 2001 Sep 21;106(6):723-33. doi: ... Transient expression of eIF3g and L24 in plant protoplasts strongly affects TAV-mediated reinitiation activity. We demonstrate ... controls translation reinitiation of major open reading frames on polycistronic RNA. We show here that TAV function depends on ...
10.2 From RNA to protein 439. 10.3 Mechanisms of plant viral translation 447 ... Biochemistry and Molecular Biology of Plants, 2nd Edition has been hailed as a major contribution to the plant sciences ... Biochemistry and Molecular Biology of Plants holds a unique place in the plant sciences literature as it provides the only ... 21.9 Plant gene silencing confers virus resistance, tolerance, and attenuation 1042. 21.10 Control of plant pathogens by ...
Positive stranded rna virus transcription is the method of transcription. The virus exits the host cell by tubule-guided viral ... Plants serve as the natural host. Transmission routes are mechanical. "Viral Zone". ExPASy. Retrieved 15 June 2015. ICTV. " ... Plants serve as natural hosts. There are currently 56 species in this subfamily, divided among 3 genera. The genera Comovirus, ... Viral replication is cytoplasmic. Entry into the host cell is achieved by penetration into the host cell. Replication follows ...
The virus exits the host cell by budding, and tubule-guided viral movement. Plants serve as the natural host. The virus is ... Replication follows the negative stranded RNA virus replication model. Negative stranded rna virus transcription, using ... Viral replication is cytoplasmic. Entry into the host cell is achieved by attachment of the viral G glycoproteins to host ... Plants serve as natural hosts. Table legend: "*" denotes type species. Cytorhabdovirions are enveloped, with bullet shaped and ...
We aimed at unraveling the roles of small RNAs (sRNAs) in the complex immune signaling network controlling the establishment of ... an interesting novel sRNAs-gibberellin regulatory circuit being activated as early as 3 days post inoculation before viral ... We aimed at unraveling the roles of small RNAs (sRNAs) in the complex immune signaling network controlling the establishment of ... an interesting novel sRNAs-gibberellin regulatory circuit being activated as early as 3 days post inoculation before viral ...
RNA viruses in higher plants. Inductors are structured elements of the viral genome or double-stranded RNAs that are generated ... Another RNA silencing pathway in plants is mediated by micro RNAs (miRs) that are processed by DCL1 from genome-encoded RNA ... by cellular RNA polymerases or during viral replication via (-)RNA intermediates. The RNA triggers are processed by the Dicers ... RNA amplification or RISC assembly in anti-viral but also cellular RNA silencing. Though VSRs of different viruses show little ...
21-24 nucleotide viral siRNAs which are generated by the evolutionary conserved RNA interference (RNAi) machinery that ... which generates double-stranded RNA precursors of viral siRNAs. Consistent with our finding and hypothesis, we demonstrate that ... Here we show that, similar to RNA viruses, the entire genome sequences of DNA viruses are densely covered with siRNAs in both ... Our findings show that deep siRNA sequencing allows for de novo reconstruction of any DNA or RNA virus genome and its ...
Burgyan, J.; Havelda, Z. Viral suppressors of RNA silencing. Trends Plant Sci. 2011, 16, 265-272. [Google Scholar] [CrossRef] ... Shimura, H.; Pantaleo, V. Viral induction and suppression of RNA silencing in plants. Biochim. Biophys. Acta 2011, 1809, 601- ... The disturbance of the plants RNA silencing machinery by viruses was also discussed. Most viral proteins discovered so far ... RB proteins are also targeted by proteins encoded by plant viruses. The 20 kDa CLINK protein from members of the plant viral ...
In this work, we report that plant viruses can also be found frequently in the gut and oropharynx of children during their ... In 100% of the fecal samples and 65% of the oropharynx samples at least one plant virus was identified. Tobamoviruses in the ... Whether the common presence of plant viruses at an early age influences the infants immune system, either directly or through ... Plant viruses have been reported to be common in the gut of human adults, presumably as result of food ingestion. ...
Resistance to Plum pox virus in plants expressing cytosolic and nuclear single-chain antibodies against the viral RNA NIb ... Resistance to Plum pox virus in plants expressing cytosolic and nuclear single-chain antibodies against the viral RNA NIb ... in transgenic plants was successfully used as a strategy to interfere with viral infection. Different scFv2A fusion proteins ... Plant Pathology, 60(5), 967-976.. Abstract. The expression of engineered single-chain variable fragments specific to the NIb ...
Plant Cell. 1990;2(4):279-289.. Ecker JR, Davis RW. Inhibition of gene expression in plant cells by expression of antisense RNA ... Plant Cell. 1998;10:937- 946.. Voinnet O. RNA silencing as a plant immune system against viruses. Trends Genet. 2001;17(8):449- ... RNA-directed de novo methylation of genomic sequences in plants. Cell. 1994;76(3):567-576.. Baulcombe D. RNA silencing in ... Tao X, Zhou X. A modified viral satellite DNA that suppresses gene expression in plants. The Plant Journal. 2004;38(5): 850-860 ...
NucleoSpin Plant RNA is a next-generation kit designed for the rapid isolation of genomic DNA from plant cells and tissue, with ... Viral Transduction * Selection Guides * Viral Systems * Comparison of Viral Systems * Adenoviral Systems ... Mini Spin Kit for Isolation & Purification of Total RNA from Plants-NucleoSpin RNA Plant. NucleoSpin RNA Plant is designed for ... high-quality RNA from a wide variety of plant and fungal samples. The working procedure is similar to the standard RNA ...
In addition to causing direct damage to the host plant, hemipteran insects are often vectors of viral pathogens. Insect anti- ... Plant genetic resistance against hemipterans provides a model to explore the regulatory roles of sRNAs in plant defense. Aphid ... Plant genetic resistance against hemipterans provides a model to explore the regulatory roles of sRNAs in plant defense. Aphid ... Plant responses to hemipteran feeding are determined by changes in the host transcriptome that appear to be fine-tuned by sRNAs ...
... these siRNAs generated from viral RNAs are extragenomic in origin. Defense regulation mediated by endogenous small RNAs has ... treated defense-signaling mutants and WT Col-0 plants. U6 RNA was used for small RNA quantification. (C) Relative ... Arabidopsis plants were grown at 23°C ± 1°C at 12-h light/12-h dark photoperiod. N. benthamiana plants were grown at 23°C ± 1°C ... RNA-dependent RNA polymerase;. Dex,. dexamethasone;. hpi,. h postinoculation;. dpi,. days postinoculation;. PPR,. ...
  • RNA viral community in human feces: prevalence of plant pathogenic viruses. (nih.gov)
  • Here, we present a comparative metagenomic analysis of the RNA viruses found in three fecal samples from two healthy human individuals. (nih.gov)
  • For this study, uncultured viruses were concentrated by tangential flow filtration, and viral RNA was extracted and cloned into shotgun viral cDNA libraries for sequencing analysis. (nih.gov)
  • The vast majority of the 36,769 viral sequences obtained were similar to plant pathogenic RNA viruses. (nih.gov)
  • Intriguingly, the fecal PMMV was infectious to host plants, suggesting that humans might act as a vehicle for the dissemination of certain plant viruses. (nih.gov)
  • Small RNAs regulate a large set of gene expression in all plants and constitute a natural immunity against viruses. (frontiersin.org)
  • Small RNA based genetic engineering (SRGE) technology had been explored for crop protection against viruses for nearly 30 years. (frontiersin.org)
  • In this review we summarized the efforts generating viral resistance with SRGE in different crops, analyzed the evolution of the technology, its efficacy in different crops for different viruses and its application status in different crops. (frontiersin.org)
  • Plant viruses impose serious threats to wide range of crops in modern agriculture and it is estimated that economic loss caused by viral pathogen ranks the second compared to those caused by other pathogens ( Simon-Mateo and Garcia, 2011 ). (frontiersin.org)
  • Due to their devastating threat to crop production, plant viruses has been studied extensively since the first virus, TMV, was discovered. (frontiersin.org)
  • One function of RNA silencing, which is also called post-transcriptional gene silencing (PTGS) or RNA interference (RNAi), is to act in surveillance against molecular parasites, such as viruses. (proteopedia.org)
  • Double-stranded RNA triggers the RNA silencing pathway and most plant viruses use a double-stranded RNA to replicate their genome. (proteopedia.org)
  • Various plant viruses have developed evasion techniques to circumvent this surveillance system. (proteopedia.org)
  • The use of this technology for biological control of plant viruses is discussed. (apsnet.org)
  • Primary infection of a plant with a pathogen that causes high accumulation of salicylic acid in the plant typically via a hypersensitive response confers enhanced resistance against secondary infection with a broad spectrum of pathogens, including viruses. (hokudai.ac.jp)
  • Consistent with the antiviral nature of RNA silencing in plants, many plant viruses have evolved proteins that suppress RNA silencing (reviewed in Li and Ding, 2001 ). (plantcell.org)
  • During plant and virus co- evolution, m ost viruses developed v iral s uppressor proteins of R NA silencing (VSRs). (uni-halle.de)
  • It uses viruses as vectors to carry targeted plant genes. (journalcjast.com)
  • common to both plants and animals, control endogenous gene expression in response to external stimuli and protect the host from invasive viruses. (frontiersin.org)
  • In the absence of a fossil record and with little obvious interordinal molecular homology, information concerning the macroevolution and paleontological history of viruses has, until recently, been limited to extrapolation from observable genetic diversity among extant viral species. (nature.com)
  • Higher plants use RNA silencing as a defense mechanism against viral infections, but viruses may encode suppressor proteins that counteract these defenses. (csic.es)
  • Previous two to three decades have witnessed Abiotic (temperature, light, water, salt etc.) and Biotic (bacteria, fungi, viruses etc.) stresses in crop plants to be increasing and documented as a severe menace to global food security, making it hard for the plants to endure in such circumstances. (springer.com)
  • Phylogenetic analysis showed that this gene is closely related to those of plant cryptic viruses. (apsnet.org)
  • VI Negative-Sense Single- Stranded RNA Viruses (reviewed by Kormelink et al. (scribd.com)
  • II Plant Viruses and Silencing Pathways (reviewed by Csorba et al. (scribd.com)
  • 4. A recombinant DNA molecule according to claim 3 , wherein the said structural gene upon expression leads to resistance against plant pathogens selected from the group consisting of insects, fungi, bacteria and viruses. (google.com)
  • Plant viruses pose serious threats to stable crop yield. (mdpi.com)
  • For survival, plant viruses and herbivores have evolved strategies to convergently target JA signaling. (mdpi.com)
  • There are many plant viruses in natural and agricultural ecosystems. (mdpi.com)
  • The majority of plant viruses are transmitted by piercing-sucking insects. (mdpi.com)
  • Plant-mediated interactions between viruses and insect vectors greatly influence the population dynamics of the vectors and plant disease epidemiology. (mdpi.com)
  • Since then, increasing evidence has clearly demonstrated that insect-borne plant viruses generally have effects on their vectors directly and/or indirectly. (mdpi.com)
  • Furthermore, several insect-borne plant viruses have been shown to indirectly manipulate the behaviors of their vectors to promote their own transmission. (mdpi.com)
  • These persistent transmitted viruses, such as geminiviruses, bunyaviruses and luteoviruses, often increase the attraction of their vectors to virus-infected plants [ 6 , 7 , 8 , 9 ]. (mdpi.com)
  • CRISPR-Cas9 has been harnessed to confer virus interference against DNA viruses in eukaryotes, including plants. (biomedcentral.com)
  • In addition, CRISPR-Cas13 systems have been used to target RNA viruses and the transcriptome in mammalian and plant cells. (biomedcentral.com)
  • Recently, CRISPR-Cas13a has been shown to confer modest interference against RNA viruses. (biomedcentral.com)
  • Here, we characterized a set of different Cas13 variants to identify those with the most efficient, robust, and specific interference activities against RNA viruses in planta using Nicotiana benthamiana . (biomedcentral.com)
  • Our data show that LwaCas13a, PspCas13b, and CasRx variants mediate high interference activities against RNA viruses in transient assays. (biomedcentral.com)
  • CasRx targets either one virus alone or two RNA viruses simultaneously, with robust interference efficiencies. (biomedcentral.com)
  • Plant viruses are obligate parasites that rely mostly on host cells to complete their life (infection) cycle. (biomedcentral.com)
  • Therefore, plant viruses threaten world agriculture and the food security of the rapidly growing world population. (biomedcentral.com)
  • Most viruses infecting plants are RNA viruses, which comprise diverse groups and subgroups that are classified based on phylogenetic relationships determined by sequence homologies among the conserved virus genes, such as RNA-dependent RNA polymerase (RdRp), coat protein (CP), and movement protein (MP) [ 4 ]. (biomedcentral.com)
  • Viruses with positive-sense, single-stranded RNA genomes represent most of these viruses. (biomedcentral.com)
  • RNA interference (RNAi), for example, is an innate antiviral immunity mechanism that has been successfully used to combat various plant viruses [ 7 , 8 ]. (biomedcentral.com)
  • Plant viruses evolved to encode viral suppressors of RNA silencing (VSRs) that interfere with the function of key components in the silencing pathway. (plantphysiol.org)
  • Most plant viruses have evolved to encode viral suppressors of RNA silencing (VSRs) that use varied mechanisms to target components in the silencing pathway ( Incarbone and Dunoyer, 2013 ). (plantphysiol.org)
  • An important aspect of RNA interference is its role in protecting organisms from some deleterious effects of viruses [8] . (wikiversity.org)
  • On episode #92 of the podcast This Week in Virology , Vincent, Rich, Karla, and Marilyn recorded TWiV at the 29th Annual Meeting of the American Society for Virology in Bozeman, where they discussed plant viruses and how they make plants resistant to adverse conditions, and identification of dominant negative drug targets. (virology.ws)
  • Do plant viruses modify cell wall? (biochemistry.org)
  • Our technologies can be used in different combinations to purify large macromolecular complexes such as viruses, virus-like particles, viral subassemblies, exosomes, membrane vesicles, large protein complexes, ribonucleoprotein complexes etc. (helsinki.fi)
  • More than 1000 plant diseases are caused by viruses. (angelfire.com)
  • Damage to the cell wall of a plant cell allows plant viruses to enter. (angelfire.com)
  • Plant viruses may be transferred by contaminated machinery, fungi, nematode worms, and sucking insects like aphids. (angelfire.com)
  • Viruses must use the metabolic machinery of a live host cell to produce more viral particles. (angelfire.com)
  • RNA viruses deserve their reputation as Nature's swiftest evolvers. (biology-online.org)
  • Over the last two decades it has become increasingly clear that many RNA viruses add the capacity to exchange genetic material with one another, and to acquire genes from their hosts, to this evolutionary repertoire. (biology-online.org)
  • Two distinct but not mutually exclusive types of genetic exchange operate in RNA viruses. (biology-online.org)
  • The first, reassortment, occurs only in multipartite viruses and involves swapping one or more of the discrete RNA molecules that make up the segmented viral genome. (biology-online.org)
  • A second process, recombination, can occur ineither segmented or unsegmented viruses when `donor'nucleotide sequence is introduced into a single, contiguous ` acceptor ' RNA molecule to produce a new RNA containing genetic information from more than one source. (biology-online.org)
  • hybrid sequences resulting from aberrant homologous recombination (when similar viruses exchange sequence without maintaining strict alignment) and nonhomologous recombination (recombination between unrelated RNA sequences) are also commonly observed (Lai, 1992). (biology-online.org)
  • 1997) presented evidence for a splicing-like, transesterication mechanism to explain the in vitro generation of recombinants between RNAs associated with Qb bacteriophage ± a possible exception to the copy±choice model of recombination in RNA viruses. (biology-online.org)
  • Jamie Potter, Assistant Professor of Biology , will be working with 2 students in collaboration with Dr. Keith Perry , Associate Professor at Cornell University Department of Plant Pathology and Plant-Microbe Biology, on the detection of plant RNA viruses in grapevine. (houghton.edu)
  • We will be focusing on Grapevine leaf roll-associated viruses, GLRaV, in Vitis vinifera and related Vitis species through collection and analysis of plant samples from western New York vineyards and adjacent wild cultivars using newly developed molecular macroarray diagnostic techniques. (houghton.edu)
  • Of most interest within the study of Botany are viruses that are plant pathogens . (wikibooks.org)
  • The majority of plant viruses have single-stranded, messenger-sense RNA genomes (Class IV) and encode only between one and 12 proteins. (wikibooks.org)
  • However, some other viruses, for example Tobacco mosaic virus (TMV), are transmitted mechanically by physical contact between plant tissue and virus-contaminated surfaces. (wikibooks.org)
  • RNA interference has an important role in defending cells against parasitic nucleotide sequences - viruses and transposons. (wikipedia.org)
  • Double-stranded RNA viruses (dsRNA viruses) are a polyphyletic group of viruses that have double-stranded genomes made of ribonucleic acid. (wikipedia.org)
  • Double-stranded RNA viruses are classified in two separate phyla Duplornaviricota and Pisuviricota (specifically class Duplopiviricetes), which are in the kingdom Orthornavirae and realm Riboviria. (wikipedia.org)
  • Double-stranded RNA viruses evolved two separate times from positive-strand RNA viruses. (wikipedia.org)
  • Double-stranded RNA viruses include the rotaviruses, known globally as a common cause of gastroenteritis in young children, and bluetongue virus, an economically significant pathogen of cattle and sheep. (wikipedia.org)
  • Based on phylogenetic analysis of RdRp, the two clades do not share a common dsRNA ancestor but are instead separately descended from different positive-sense, single-stranded RNA viruses. (wikipedia.org)
  • The class Duplopiviricetes is the second clade of dsRNA viruses and is in the phylum Pisuviricota, which also contains positive-sense single-stranded RNA viruses. (wikipedia.org)
  • Duplopiviricetes mostly contains plant and fungal viruses and includes the following four families: Amalgaviridae, Hypoviridae, Partitiviridae, and Picobirnaviridae. (wikipedia.org)
  • The rate of evolution of an RNA plant virus has never been estimated using temporally spaced sequence data, by contrast to the information available on an increasing range of animal viruses. (asm.org)
  • The overall and synonymous evolution rates of RYMV were within the range of the rates of 50 RNA animal viruses, below the average but above the distribution median. (asm.org)
  • The results show that an RNA plant virus such as RYMV evolves as rapidly as most RNA animal viruses. (asm.org)
  • Knowledge of the molecular clock of plant viruses provides methods for testing a wide range of biological hypotheses. (asm.org)
  • The mutation rates of RNA viruses (i.e., the number of nucleotide misincorporations per site and per round of replication) are 10 4 to 10 5 times higher than those of their DNA hosts ( 8 , 9 ). (asm.org)
  • Such a high mutation rate is attributed to the lack of repair function of the RNA polymerase of these viruses, the short replication times, and the large populations in infected hosts ( 7 ). (asm.org)
  • A high mutation rate often results in rapid evolution of RNA animal viruses. (asm.org)
  • This allowed the measure of the evolution rates of an extensive range of animal viruses through the analysis of heterochronous sequences, i.e., sequences of viral genes isolated at different times ( 11 , 36 ). (asm.org)
  • A large variation in the evolution rates of RNA animal viruses was subsequently found and was attributed mostly to differences in replication rates ( 24 , 26 ). (asm.org)
  • Interestingly, some RNA viruses change little or not at all over time. (asm.org)
  • Role of host factors in the replication of positive strand RNA viruses. (upf.edu)
  • Scheller N, Díez J. RNA viruses hijack the mRNA decay machinery to multiply. (upf.edu)
  • Information catastrophe in RNA viruses through replication thresholds: J. Theor. (upf.edu)
  • We study plant viruses with a particular emphasis on understanding the molecular basis of virus-host interactions. (unl.edu)
  • Research applications include the development of novel strategies for genetically engineering resistance against viral pathogens, and in the area of plant biotechnology, using RNA viruses as transient vectors for vaccine development against animal viruses. (unl.edu)
  • 2011) Robust RNAi-Based Resistance to Mixed Infection of Three Viruses in Soybean Plants Expressing Separate Short Hairpins from a Single Transgene. (unl.edu)
  • 2005. Suppressors of RNA silencing encoded by plant viruses and their role in viral infections. (unl.edu)
  • We investigate viruses that infect bacteria, insects, plants, and the extreme thermophile Sulfolobus . (scripps.edu)
  • These viruses have genomes of single-stranded RNA, and double-stranded DNA. (scripps.edu)
  • Distinct from stable transgenic plants, plant RNA viruses provide a temporary, transient expression system. (hindawi.com)
  • The research team will be studying single-stranded (ss) RNA plant viruses. (esrf.eu)
  • Single-stranded (ss)RNA viruses often follow a simple architecture with an icosahedral capsid containing the genome in the form of ssRNA. (esrf.eu)
  • For these studies, infectious clones of embryo-invading plant RNA viruses will be modified to express bacterial genes and guide nucleic acids for genome editing. (usda.gov)
  • Modified viruses will be introduced into plants (barley, corn, soybean) biolistically. (usda.gov)
  • Replication of RNA viruses is carried out by membrane-bound multisubunit replicase complexes, which consist of virus- and host-coded proteins ( 5 , 6 , 19 ). (asm.org)
  • Biochemical features of RdRps for several positive-strand RNA viruses, including poliovirus ( 3 ), flaviviruses ( 12 , 18 , 22 , 23 , 45 ), plant potyviruses ( 16 ), and potexviruses ( 21 ) have been examined in some detail by using purified preparations obtained from heterologous expression systems. (asm.org)
  • Short-interfering RNAs (siRNAs) and microRNAs (miRNAs) play an important role in regulation of host gene expression and defense against invasive nucleic acids such as transposons, transgenes, and viruses. (springer.com)
  • In plants, siRNA-directed silencing is a major defense mechanism that restricts replication and spread of RNA and DNA viruses as well as viroids and viral satellites. (springer.com)
  • These duplexes are sorted by several distinct Argonaute (AGO) proteins to form RNA-induced silencing complexes (RISCs) that can potentially target cognate viral RNA for posttranscriptional gene silencing (PTGS) and, in the case of DNA viruses, also viral DNA for cytosine methylation and transcriptional gene silencing (TGS). (springer.com)
  • To establish successful infection, plant viruses have evolved various mechanisms of silencing evasion as well as silencing suppression through effector proteins that interfere with the biogenesis and/or action of viral siRNAs. (springer.com)
  • Because most plant viruses have RNA genomes (RNA genomes can slide from cell to cell via plasmodesmata, berry berry sneaky), a really effective antiviral for plants is RNA interference . (scienceblogs.com)
  • and for destroying RNA viruses. (scienceblogs.com)
  • Except viruses have evolved ways of interfering with RNA interference. (scienceblogs.com)
  • RNA silencing suppression (RSS) is kinda a common thing in plant viruses, considering their main adversary in plant hosts is RNA silencing machinery. (scienceblogs.com)
  • As if this wasnt weird enough, RNAi doesnt work on these viruses through chopping up their RNA. (scienceblogs.com)
  • I wonder can plant viruses become endogenous in the plant genome? (scienceblogs.com)
  • The sequence of the ORF3 protein showed limited but significant similarity to capsid proteins of several plant and animal viruses, although phylogenetic analysis failed to reveal its most likely origin. (microbiologyresearch.org)
  • The PMMV-like viral genome sequence segments from Lib 1 (A), Lib 2 (B), and Lib 3 (C) were aligned with the reference PMMV genome sequence (6,357 bp). (nih.gov)
  • The Cucumber mosaic virus (CMV) Y-satellite RNA (Y-Sat) has a small non-protein-coding RNA genome that induces yellowing symptoms in infected Nicotiana tabacum (tobacco). (nih.gov)
  • The CHLI mRNA contains a 22-nucleotide (nt) complementary sequence to the Y-Sat genome, and in Y-Sat-infected plants, CHLI expression is dramatically down-regulated. (nih.gov)
  • I nductors are structured elements of the viral genome or double-stranded RNAs that are generated by cellular RNA polymerases or during viral replication via (-)RNA intermediates. (uni-halle.de)
  • Another RNA silencing pathway in plants is mediated by micro RNAs (miRs) that are processed by DCL1 from genome-encoded RNA precursors. (uni-halle.de)
  • The transgenic plant of the present invention comprises within its genome a foreign MinD or MinE gene or a foreign gene which expresses a protein which has the same functional activity as the Arabidopsis thaliana MinD or MinE protein. (freepatentsonline.com)
  • Finally, the present invention concerns a method of transforming the chloroplasts genome of the transgenic plants of the present invention which contain large chloroplasts. (freepatentsonline.com)
  • The typical AAV genome contains two protein-encoding genes termed rep and cap that, respectively, encode nonstructural proteins essential for viral genome replication and structural proteins that form the viral capsid. (nature.com)
  • Transports viral genome to neighboring plant cells directly through plasmosdesmata, without any budding. (uniprot.org)
  • The genome of the virus may consist of single stranded or double stranded DNA or RNA. (wikibooks.org)
  • When the dsRNA is exogenous (coming from infection by a virus with an RNA genome or laboratory manipulations), the RNA is imported directly into the cytoplasm and cleaved to short fragments by Dicer. (wikipedia.org)
  • The initiating dsRNA can also be endogenous (originating in the cell), as in pre-microRNAs expressed from RNA-coding genes in the genome. (wikipedia.org)
  • The double-stranded genome is used to transcribe a positive-strand RNA by the viral RNA-dependent RNA polymerase (RdRp). (wikipedia.org)
  • The positive-strand RNA can also be replicated by the RdRp to create a new double-stranded viral genome. (wikipedia.org)
  • Thanks to the bipartite nature of the CPMV genome which allows the manipulation of RNA-1 without modifying RNA-2, we show here that this specificity is due to a functional linking between the two processes of viral replication and encapsidation. (jic.ac.uk)
  • Thus, genes from animals and bacteria may be inserted into a plant genome, to create a novel transgenic plant. (appropedia.org)
  • We have identified the genome of a novel viral satellite in deep sequence analysis of double-stranded RNA from grapevine. (usda.gov)
  • In RNA Abundance Analysis: Methods and Protocols , expert researchers cover a wide range of techniques on RNA extraction, detection, quantification, visualization, and genome-wide profiling, from conventional methods to state-of-the-art high throughput approaches. (springer.com)
  • This volume includes detailed techniques to examine mRNAs, small non-coding RNAs, protein-associated small RNAs, sulfur-containing RNAs, viral and satellite RNAs, RNA isoforms, and alternatively spliced RNA variants from various organisms, as well as key discussions of computational data processing for genome-wide datasets. (springer.com)
  • Using a genome-wide association study in C. elegans wild populations and quantitative trait locus mapping, we identify a 159 base-pair deletion in the conserved drh-1 gene (encoding a RIG-I-like helicase) as a major determinant of viral sensitivity. (ens.fr)
  • In particular, the capsid must uptake only the viral genome and not the nucleic acids coming from the host cell, which suggests some selectivity on the part of the capsid proteins. (esrf.eu)
  • it encourages transcription of the HIV genome, but it doesnt bind to DNA, it binds to the HIV RNA). (scienceblogs.com)
  • DDX56 relocalizes from the nucleus to the cytoplasm, where it binds to a stem-loop in the viral genome and destabilizes incoming genomes. (asm.org)
  • Transformation of tobacco with a RNA interference (RNAi) vector targeting CHLI induced Y-Sat-like symptoms. (nih.gov)
  • RNA silencing is a sequence-specific RNA degradation mechanism that occurs in a broad range of eukaryotic organisms including fungi (quelling), animals (RNA interference [RNAi]), and plants (post-transcriptional gene silencing). (plantcell.org)
  • Fire A, Xu S, Montgomery MK, Kostas SA, Driver SE, Mello CC. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. (journalcjast.com)
  • RNA interference, mediated by small interfering RNAs (siRNAs), is a conserved regulatory process that has evolved as an antiviral defense mechanism in plants and animals. (pnas.org)
  • Our data establish CasRx as the most robust Cas13 variant for RNA virus interference applications in planta and demonstrate its suitability for studying key questions relating to virus biology. (biomedcentral.com)
  • RNA interference requires that two base pair-complementary strands of RNA to come together to form double stranded RNA [2] . (wikiversity.org)
  • The Nobel Prize in Physiology or Medicine in 2006 was awarded to Andrew Z. Fire and Craig C. Mello for their research on RNA interference [3] . (wikiversity.org)
  • The goal of this learning project is to complement the Wikipedia article about RNA interference in two ways. (wikiversity.org)
  • This means providing learning resources for people who would normally be unable to understand a technical Wikipedia article on the topic of RNA interference. (wikiversity.org)
  • Explore a user-friendly introduction to the practical medical implications of RNA interference that arise from the Nobel Prize-winning scientific research of Andrew Z. Fire and Craig C. Mello. (wikiversity.org)
  • If you were able to read and appreciate the Wikipedia article about RNA interference then continue reading below and participate in further exploration of this subject. (wikiversity.org)
  • RNA interference was discovered as a mechanism used by cells for regulating gene expression . (wikiversity.org)
  • There is also active study of the potential value of RNA interference for medical applications [4] . (wikiversity.org)
  • Several proteins (colored ovals) are required for efficient RNA interference. (wikiversity.org)
  • This section and the next few sections briefly introduce RNA interference (RNAi) and will orient you towards the activities . (wikiversity.org)
  • The normal function of RNA interference inside cells depends on the production of double stranded RNA (dsRNA). (wikiversity.org)
  • Such a role for RNA interference was first found in plants, but has also been found in some animals [9] . (wikiversity.org)
  • RNA interference is now a widely used biology research technique that can be applied to both cultured cells [10] and whole animals [11] . (wikiversity.org)
  • RNA interference can be used to selectively reduce the level of expression of a specific protein. (wikiversity.org)
  • RNA silencing, also known as RNA interference, is a conserved biological response to double-stranded RNA that regulates gene expression. (mskcc.org)
  • RNA interference (RNAi) is a biological process in which RNA molecules are involved in sequence-specific suppression of gene expression by double-stranded RNA, through translation or transcriptional repression. (wikipedia.org)
  • Andrew Fire and Craig C. Mello shared the 2006 Nobel Prize in Physiology or Medicine for their work on RNA interference in the nematode worm Caenorhabditis elegans, which they published in 1998. (wikipedia.org)
  • Two types of small ribonucleic acid (RNA) molecules - microRNA (miRNA) and small interfering RNA (siRNA) - are central to RNA interference. (wikipedia.org)
  • Moreover, transcription can be inhibited via the pre-transcriptional silencing mechanism of RNA interference, through which an enzyme complex catalyzes DNA methylation at genomic positions complementary to complexed siRNA or miRNA. (wikipedia.org)
  • Lentiviral delivery of designed shRNAs and the mechanism of RNA interference in mammalian cells. (wikipedia.org)
  • RNA interference ( RNAi ) is a biological process in which RNA molecules inhibit gene expression or translation, by neutralizing targeted mRNA molecules. (wikipedia.org)
  • The advent of RNA interference (RNAi) technology has truly revolutionized modern biology. (thefreelibrary.com)
  • 2003)]. While the ribosomal and transfer RNAs participate in protein synthesis on ribosomes, a new class of functional RNAs can prevent protein synthesis through interference with translating mRNAs. (thefreelibrary.com)
  • RNA interference defends against viral infection in plant and animal cells. (ens.fr)
  • Plants circumvent the viral infection through RNA interference phenomena by utilizing small RNAs. (ias.ac.in)
  • Long-distance movement of RNA interference (RNAi)-derived signals in plants plays an important role in development and in defense against viral attack. (sciencemag.org)
  • In the plant RNA interference (RNAi) pathway, 21-nucleotide duplexes of small interfering RNA (siRNA) are processed from longer double-stranded RNA precursors by the RNaseIII Dicer-like 4 (DCL4). (sciencemag.org)
  • Andersson MG, Haasnoot PC, Xu N, Berenjian S, Berkhout B, Akusjärvi G (2005) Suppression of RNA interference by adenovirus virus-associated RNA. (springer.com)
  • Viral replication is cytoplasmic. (wikipedia.org)
  • Replication follows the positive stranded RNA virus replication model. (wikipedia.org)
  • Replication follows the negative stranded RNA virus replication model. (wikipedia.org)
  • Both viral families encode an endonuclease essential for viral genomic DNA replication that might facilitate non-homologous molecular recombination with host genomic sequences. (nature.com)
  • This raises the possibility that the RNA-2 product is potentially involved in the regulation of cell-to-cell movement of viral infectious material during CMV replication. (wikigenes.org)
  • Much of what we know of viral replication comes from our study of bacteriophages . (angelfire.com)
  • RNAs are formed when the viral RNA-dependent RNA polymerase complex switches, mid-replication, from one RNA molecule to another. (biology-online.org)
  • These proteins function in virus transmission, in replication, cell-to-cell and systemic movement, in the structure of the virus, and in the suppression of plant host defense mechanisms. (wikibooks.org)
  • Galão RP, Chari A, Alves-Rodrigues I, Lobão D, Mas A, Kambach C, Fischer U, Díez J. LSm1-7 complexes bind to specific sites in viral RNA genomes and regulate their translation and replication. (upf.edu)
  • Scheller N, Mina LB, Galão RP, Chari A, Giménez-Barcons M, Noueiry A, Fischer U, Meyerhans A, Díez J. Translation and replication of hepatitis C virus genomic RNA depends on ancient cellular proteins that control mRNA fates. (upf.edu)
  • Saccharomyces cerevisiae: auseful model to study fundamental biology of viral replication. (upf.edu)
  • Host deadenylation-dependent mRNA decapping factors are required for a key step in brome mosaic virus RNA replication. (upf.edu)
  • Identification and Characterization of a host protein involved in template selection for viral RNA replication. (upf.edu)
  • Here, we characterized a pro-viral role of CCR4 in replication of a plant cytorhabdovirus , Barley yellow striate mosaic virus (BYSMV). (elifesciences.org)
  • Overexpression of HvCCR4 promoted BYSMV replication in plants. (elifesciences.org)
  • Biochemistry experiments revealed that HvCCR4 was recruited into N-RNA complexes by the BYSMV P protein and triggered turnover of N-bound cellular mRNAs, thereby releasing RNA-free N protein to bind viral genomic RNA for optimal viral replication. (elifesciences.org)
  • Our results demonstrate that the co-opted CCR4-mediated RNA decay facilitates cytorhabdovirus replication in plants and insects. (elifesciences.org)
  • Replication of grapevine fanleaf virus satellite RNA transcripts in Chenopodium quinoa protoplasts. (semanticscholar.org)
  • Encapsidation of viral RNA in Picornavirales: studies on cowpea mosaic virus demonstrate dependence on viral replication. (jic.ac.uk)
  • To elucidate linkage between replication and encapsidation in Picornavirales, we have taken advantage of the bipartite nature of the plant-infecting member of the order, cowpea mosaic virus (CPMV), to decouple the two processes. (jic.ac.uk)
  • RNA-free virus-like particles (eVLPs) can be generated by transiently co-expressing the RNA-2-encoded coat protein precursor (VP60) with the RNA-1-encoded 24K protease, in the absence of the replication machinery (Saunders et al. (jic.ac.uk)
  • We have made use of the ability to produce assembled capsids of CPMV in the absence of replication to examine the putative linkage between RNA replication and packaging in the Picornavirales We have created a series of mutant RNA-1 and RNA-2 molecules and have assessed the effect of the mutations on both the replication and packaging of the viral RNAs. (jic.ac.uk)
  • We demonstrate that mutations that affect replication have a concomitant impact on encapsidation, and that RNA-1 -mediated replication is required for encapsidation of both RNA-1 and RNA-2. (jic.ac.uk)
  • This close coupling between replication and encapsidation provides a means for the specific packaging of viral RNAs. (jic.ac.uk)
  • Moreover, we demonstrate that this feature of CPMV can be used to specifically encapsidate custom RNA by placing a sequence of choice between the RNA-2 sequences required for replication.IMPORTANCE The mechanism whereby members of the order Picornavirales specifically package their genomic RNAs is poorly understood. (jic.ac.uk)
  • Research with monopartite members of the order, such as poliovirus, have indicated that packaging is linked to replication, though the presence of 'packaging signals' along the length of the viral RNA has also been suggested. (jic.ac.uk)
  • W e investigate model virus systems that provide insights for understanding viral assembly, maturation, entry, localization, and replication. (scripps.edu)
  • During viral replication in the host cell, the capsid proteins and nucleic acids are synthesized and have to self-assemble into a fully infectious viral particle. (esrf.eu)
  • This is unusual because most proteins use loops and helices to bind double-stranded RNA, for example, see 1di2 , 2zi0 , 2hvy or 2az0 . (proteopedia.org)
  • SAR-induced plants strongly and rapidly express a number of antibiotics and pathogenesis-related proteins targeted against secondary infection, which can account for enhanced resistance against bacterial and fungal pathogens but are not thought to control viral infection. (hokudai.ac.jp)
  • One of the myriad plant defense responses activated upon pathogen invasion is signaling induced via the activation of resistance (R) proteins. (plantphysiol.org)
  • This led to the proposition that plants express "decoy" proteins that mimic Avr-guardee recognition in the presence of the R protein. (plantphysiol.org)
  • This decoy model suggests that, unlike guardees, decoy proteins do not directly contribute to host basal immunity, such that Avr-derived alterations of decoys do not enhance pathogen virulence in plants lacking the R protein ( van der Hoorn and Kamoun, 2008 ). (plantphysiol.org)
  • Ribosomal RNA, DNA, proteins, and small RNA molecules (such as transfer RNA, micro RNA, and small nucleolar RNA) do not bind to the beads and are discarded. (thermofisher.com)
  • As effectors in the RNA silencing pathway, ARGONAUTE (AGO) proteins are targeted by some VSRs, such as that encoded by Turnip crinkle virus (TCV). (plantphysiol.org)
  • This host silencing machinery is triggered by viral double-stranded RNAs, which are cleaved by Dicer-like (DCL) nucleases associated with double-stranded RNA binding proteins into 21-24-nucleotide RNA duplexes called "viral small interfering RNAs" (vsiRNAs). (plantphysiol.org)
  • This discovery has quickly resulted in the widespread use of artificial interfering RNAs as an important laboratory research technique for altering the amount of specific proteins inside cells. (wikiversity.org)
  • The siRNA can form a molecular complex with proteins that first strip away the sense strand of RNA, making the antisense inhibitory RNA (iRNA) available for base pairing with messenger RNA (mRNA). (wikiversity.org)
  • The host cell makes new viral proteins and new copies of the viral nucleic acid. (angelfire.com)
  • Next, the viral proteins and viral nucleic acid are assembled into new virions. (angelfire.com)
  • Viroids are infectious agents that consist of single-stranded RNA, which does not encode any proteins. (wikibooks.org)
  • The positive-strand RNA may be used as messenger RNA (mRNA) which can be translated into viral proteins by the host cell's ribosomes. (wikipedia.org)
  • Plants have been studied extensively for the production of pharmaceutical proteins, as they represent an inexpensive and scalable alternative to common expression systems. (hindawi.com)
  • Plants offer advantages over microbial or mammalian host systems: the bioprocessing is more effective, they have all of the cellular machinery needed to complete posttranslational modifications of proteins, and they are intrinsically safe. (hindawi.com)
  • The combination of a plant production system and a PVX-based vector is a promising platform for the production of recombinant proteins [ 11 - 15 ]. (hindawi.com)
  • In mammals, RIG-I-domain containing proteins trigger an interferon-based innate immunity pathway in response to RNA virus infection. (ens.fr)
  • The self-assembly of viral particles can be performed in vitro from purified capsid proteins and ssRNA. (esrf.eu)
  • Well this clever lab noticed that Tat also had some features in common with plant viral proteins involved with RSS. (scienceblogs.com)
  • 1- If you put HIV-1 Tat or Tomato Bushy Stunt Virus P19 in plant cells , the viral proteins interfere with RNAi. (scienceblogs.com)
  • The synthetic R N A substrate mimics the 21-nt double-stranded siRNAs that occur in the double-strand RNA-induced RNAi silencing pathway. (proteopedia.org)
  • RNAi: Double-stranded RNA directs the ATP dependent cleavage of mRNA at 21 to 23 nucleotide intervals. (journalcjast.com)
  • Insect anti-viral RNAi machinery is activated to limit virus accumulation, suggesting a role in insect immunity. (frontiersin.org)
  • The RNAi pathway is found in many eukaryotes, including animals, and is initiated by the enzyme Dicer, which cleaves long double-stranded RNA (dsRNA) molecules into short double-stranded fragments of ~21 nucleotide siRNAs. (wikipedia.org)
  • RNAi is an RNA-dependent gene silencing process that is controlled by the RNA-induced silencing complex (RISC) and is initiated by short double-stranded RNA molecules in a cell's cytoplasm, where they interact with the catalytic RISC component argonaute. (wikipedia.org)
  • Exogenous dsRNA initiates RNAi by activating the ribonuclease protein Dicer, which binds and cleaves double-stranded RNAs (dsRNAs) in plants, or short hairpin RNAs (shRNAs) in humans, to produce double-stranded fragments of 20-25 base pairs with a 2-nucleotide overhang at the 3' end. (wikipedia.org)
  • RNAi is an important biological mechanism in the regulation of gene expression in plants, fungi, and animals [for review see Dykxhoorn et al. (thefreelibrary.com)
  • We propose that RIG-I acts as modular viral recognition factor that couples viral recognition to different effector pathways including RNAi and interferon responses. (ens.fr)
  • A viral protein that counters RNAi though sequestering siRNAs blocked spreading of a transgene RNAi silencing signal. (sciencemag.org)
  • RNAi is not cell-autonomous in higher plants, but the nature of the mobile nucleic acid(s) signal remains unknown. (sciencemag.org)
  • Using cell-specific rescue of DCL4 function and cell-specific inhibition of RNAi movement, we genetically establish that exogenous and endogenous siRNAs, as opposed to their precursor molecules, act as mobile silencing signals between plant cells. (sciencemag.org)
  • So RNAi is great for regulating the expression of cellular genes at the RNA level (gene regulation isnt just at the DNA level! (scienceblogs.com)
  • The size of viral genomes varies widely and may encode between one and 250 genes. (wikibooks.org)
  • 2. Establish standard procedures to heritably modify plant genomes using viral vectors. (usda.gov)
  • Guide nucleic acids will be produced from viral genomes utilizing hapten-induced or partially active ribozymes. (usda.gov)
  • We cloned and sequenced their RNA genomes. (microbiologyresearch.org)
  • In one such evasion strategy, the plant viral protein p19 suppresses a plant's anti-viral RNA silencing response. (proteopedia.org)
  • includes both protein and RNA in the complex. (proteopedia.org)
  • Here, we show that SAR against cucumber mosaic virus (CMV) in tobacco plants (Nicotiana tabacum) involves a calmodulin-like protein, rgs-CaM. (hokudai.ac.jp)
  • This study showed that enhanced resistance against cucumber mosaic virus is caused by a tobacco calmodulin-like protein, rgs-CaM, which detects and counteracts the major viral virulence factor (RNA silencing suppressor) after SAR induction. (hokudai.ac.jp)
  • Inoculation of sink leaves with a movement protein-defective virus showed that virally expressed GFP, but not viral RNA, was capable of trafficking between sink cells during infection. (nih.gov)
  • 1. A vector comprising an exogenous gene which encodes a protein which has the same functional activity as a protein encoded by the Arabidopsis thaliana MinE or MinD gene and which when expressed in a plant cell causes the plant cell to have enlarged and/or a reduced number of chloroplasts. (freepatentsonline.com)
  • Equivalence of microbially-produced and plant-produced B.t.t. protein also called Colorado potato beetle active protein from Bacillus thuringiensis subsp. (nap.edu)
  • Here we characterized the Tobacco rattle virus-encoded 16-kDa (TRV-16K) protein as a suppressor that blocked local RNA silencing induced by single (s)- and double-stranded (ds) RNA, indicating that TRV-16K interfered with a step in the silencing pathway downstream of dsRNA formation. (csic.es)
  • A method is provided for introducing a foreign gene into a plant cell by means of an Olpidium zoospore vector having associated with it a reassembled nucleoprotein complex comprising the foreign gene and reassociated coat protein of a zoospore-transmissable virus. (google.com)
  • The protein-containing complex was named "RNA-induced silencing complex", RISC. (wikiversity.org)
  • In other cases, the protein-coding RNA sense strand might be produced by a virus and the antisense RNA strand produced by the host cell. (wikiversity.org)
  • The RNA looping hypothesis provides a logical explanation for translational augmentation by translation-enhancing elements located upstream and/or downstream of a protein-coding region. (pnas.org)
  • We are also interested in (3) protein-RNA complexes along the microRNA (miRNA) biogenesis pathway that mediate processing of primary miRNAs to their precursor counterparts, and processes associated with miRNA guide strand-mediated cleavage, translation inhibition or degradation of target RNAs. (mskcc.org)
  • One strand of the small RNA duplex is subsequently loaded onto the Argonaute protein to yield an active RNA-induced silencing complex. (mskcc.org)
  • The capsid protein of turnip crinkle virus overcomes two separate barriers to facilitate viral systemic movement in Arabidopsis. (unl.edu)
  • Upon binding through base-pairing to target mRNA, siRNAs recruit RNases to a protein complex called the RNA-induced silencing complex (RISC) that degrades the targeted sequence. (thefreelibrary.com)
  • The larger (sCYMV-L1) has only linear molecules 1145 nucleotides long, a poly(A) tail, a long open reading frame (ORF) coding for a protein of Mr 39,636 resembling in composition those of other large nepovirus satellite RNAs, a 5' leader sequence of 16 nucleotides and a 3' non-coding region of 40 nucleotides. (semanticscholar.org)
  • Immunodetection of grapevine fanleaf virus satellite RNA-encoded protein in infected Chenopodium quinoa. (semanticscholar.org)
  • But translation of the longer frame showed a protein sequence similar to those of other plant virus satellites. (usda.gov)
  • We are studying viral entry and early expression and assembly of the capsid protein. (scripps.edu)
  • These viral components are protected by a nanometre-scale protein shell called the capsid. (esrf.eu)
  • The individual products within the TRIzol reagent family are tailored to isolate total RNA or to simultaneously isolate RNA, DNA, and protein from diverse biological sources, including samples of human, animal, plant, yeast, bacterial, and viral origin. (thermofisher.com)
  • A plant virus protein has RSS activity in mammalian cells. (scienceblogs.com)
  • Tat has RSS activity, and if you knock it out, it can be compensated for by a plant virus RSS protein. (scienceblogs.com)
  • RNA1 potentially encoded a 97.5 kDa protein carrying the GDD motif typical of RNA-dependent RNA polymerases (RdRps). (microbiologyresearch.org)
  • RNA2 encoded a 31.6 kDa protein which, expressed in bacteria as a His-tag fusion protein and in plants through agroinfiltration, reacted specifically with antibodies made against tubular structures found in the cytoplasm. (microbiologyresearch.org)
  • This protein was also expressed in bacteria and plants, and reacted specifically with antisera against the OuMV coat protein. (microbiologyresearch.org)
  • Through genetic screening, we found that the conserved RNA binding protein DDX56 is antiviral against chikungunya virus in insects and humans. (asm.org)
  • The receptor binding protein, hemagglutinin-neuraminidase (HN), and the fusion protein (F) facilitate viral fusion and entry into cells through a process involving HN activation by receptor binding, which triggers conformational changes in F to activate it to reach its fusion-competent state. (asm.org)
  • Moreover, the assembly of viral "species" into higher-order taxonomic groupings has been even more tenuous, since these groupings were based initially on limited numbers of morphological features and more recently on overall genomic similarities. (asm.org)
  • For bacteriophages, such dissections of genomic sequences reveal fundamental flaws in the Linnaean paradigm that necessitate a new view of viral evolution, classification, and taxonomy. (asm.org)
  • The Mag-Bind® Plant DNA DS 96 Kit allows rapid and reliable isolation of high-quality genomic DNA from plants and other tissues that are particularly difficult to lyse or very high in polysaccharide content. (omegabiotek.com)
  • The ability to manipulate both the viral pathogen and the host plant using molecular genetic and genomic tools makes our model system particularly suitable for examining molecular basis of plant innate immunity and the role of the silencing pathway in defense against viral infection. (unl.edu)
  • TCV RNA contains five open reading frames, of which two are expressed from the genomic RNAs (shown by shaded boxes) and three (shown by black boxes) are expressed from two subgenomic RNAs. (asm.org)
  • The sizes of the three genomic RNAs of OuMV, the type member of the genus, were 2814, 1064 and 974 nt and each had one open reading frame. (microbiologyresearch.org)
  • Small RNA sequencing and 5' RACE analyses confirmed that this 22-nt sequence was targeted for mRNA cleavage by Y-Sat-derived siRNAs. (nih.gov)
  • As expected to insure recognition of any anti-viral siRNAs, there are no base-specific contacts. (proteopedia.org)
  • The mechanism for RNA silencing involves an initial processing of the inducing dsRNA into small interfering RNAs (siRNAs) of 21 to 25 nucleotides, corresponding to both sense and antisense strands of the target gene ( Hamilton and Baulcombe, 1999 ). (plantcell.org)
  • Endogenous small interfering RNAs (siRNAs) and microRNAs (miRNAs) have emerged as important regulators of eukaryotic gene expression by guiding mRNA cleavage, translational inhibition, or chromatin modification ( 1 , 2 ). (pnas.org)
  • However, their biological roles are largely unknown except for the functions of transacting siRNAs (ta-siRNA) in plant development and hormone signaling ( 4 ) and the roles of some chromatin-associated siRNAs in DNA methylation and transcriptional gene silencing ( 4 ). (pnas.org)
  • 100 nat-siRNAs in the Massively Parallel Signature Sequencing (MPSS) and Arabidopsis Small RNA Project (ASRP) databases ( 9 , 17 ). (pnas.org)
  • To address whether endogenous siRNAs play a role in gene expression reprogramming in R gene-mediated disease resistance, we searched the small RNA databases ( 9 , 17 ) and examined nat-siRNAs generated from NAT pairs that are potentially regulated by bacterial pathogenesis. (pnas.org)
  • However, in plants, most siRNAs are generated by RNA-dependent RNA polymerase [1] . (wikiversity.org)
  • The response is mediated by small interfering RNAs (siRNAs), which guide the sequence-specific degradation of cognate messenger RNAs (mRNAs). (mskcc.org)
  • Our long-term goals are to structurally characterize and mechanistically define events associated with (1) processing of long double-stranded RNAs into siRNAs by the endonuclease acvtivity of Dicer and (2) guide-strand-mediated cleavage of target RNAs by Argonaute, the key component exhibiting slicer activity, within the RNA-induced silencing complex (RISC). (mskcc.org)
  • These short double-stranded fragments are called small interfering RNAs (siRNAs). (wikipedia.org)
  • Genetic and biochemical data indicate that siRNAs [19- to 25-nucleotide double-stranded (ds)RNAs] are produced from much larger RNAs by Dicer. (thefreelibrary.com)
  • p. 912 , published online 22 April) now show that in Arabidopsis , both exogenous and endogenous small interfering RNAs (siRNAs), rather than their long double-stranded precursor RNAs, are the molecules that transfer information between plant cells. (sciencemag.org)
  • Furthermore, siRNA-processing enzymes were required in the source, and not the recipient, cells for spreading, and bombardment of plants with double-stranded siRNAs directly showed siRNA spread between cells. (sciencemag.org)
  • Single-stranded siRNAs then guide Argonaute 1 (AGO1) to execute posttranscriptional silencing of complementary target RNAs. (sciencemag.org)
  • In addition to causing direct damage to the host plant, hemipteran insects are often vectors of viral pathogens. (frontiersin.org)
  • Bacterial pathogens in plants: Life up against the Wall. (springer.com)
  • Jasmonate (JA) and its derivatives (JAs) are lipid-based phytohormones with similar structures to animal prostaglandins, conferring plant defenses against various biotic and abiotic challenges, especially pathogens and herbivores. (mdpi.com)
  • 2-hydroxybenzoic acid) regulates several key plant responses including, most notably, defence against pathogens. (portlandpress.com)
  • The Evolution And Molecular Epidemiology Of Single-Stranded DNA and RNA Viral Pathogens Of Humans Other Animals And Plants. (sanbi.ac.za)
  • Plants are invaded by an array of pathogens of which only a few succeed in causing disease. (ias.ac.in)
  • Plants also possess systemic acquired resistance (SAR), which provides long-term defense against a broad-spectrum of pathogens. (ias.ac.in)
  • Trans-generational immune priming allows the plant to heritably shield their progeny towards pathogens previously encountered. (ias.ac.in)
  • Although the interferon (IFN) signaling pathway is a key host mechanism to restrict infection of a diverse range of viral pathogens, its unrestrained activity either at baseline or in the context of an immune response can result in host cell damage and injury. (asm.org)
  • The outcome of a virus infection on a plant is determined both by the genotype of the virus and that of the plant. (frontiersin.org)
  • All plants challenged 3 weeks after vaccination showed nearly complete protection from subsequent infection by severe strains. (apsnet.org)
  • We found that rgs-CaM-mediated immunity is ineffective against CMV infection in normally growing tobacco plants but is activated as a result of SAR induction via salicylic acid signaling. (hokudai.ac.jp)
  • Further analysis using a combination of the salicylic acid analogue benzo-(1,2,3)-thiadiazole-7-carbothioic acid S-methyl ester (BTH) and the Ca2+ ionophore A23187 revealed that rgs-CaM functions as an immune receptor that induces salicylic acid signaling by simultaneously perceiving both viral RSS and Ca2+ influx as infection cues, implying its autoactivation. (hokudai.ac.jp)
  • Thus, secondary infection of SAR-induced tobacco plants with CMV seems to be effectively inhibited through 2b recognition and degradation by rgs-CaM, leading to reinforcement of antiviral RNA silencing and other salicylic acid-mediated antiviral responses. (hokudai.ac.jp)
  • rgs-CaM-mediated SAR illustrates the growth versus defense trade-off in plants, as it targets the major virulence factor only under specific biotic stress conditions, thus avoiding the cost of constitutive activation while reducing the damage from virus infection. (hokudai.ac.jp)
  • Here, we propose to apply a newly developed in vitro system that enables studies on P19 and P38 independently from the viral infection and assembly processes. (uni-halle.de)
  • As the name suggests, virus-induced gene silencing uses the host plant's natural defense mechanisms against viral infection to silence plant genes. (journalcjast.com)
  • Covey S, Al-Kaff N, Lángara A, Turner D. Plants combat infection by gene silencing. (journalcjast.com)
  • Virus-derived long sRNAs strongly resemble insect piRNAs, leading to the speculation that the piRNA pathway is induced in response to viral infection. (frontiersin.org)
  • The teeming microbial populations in the terrestrial and aquatic environments serving as a horizontal gene transfer highway and reservoir, facilitating the multiplication, recombination of vectors and infection of all plant and animals species. (sfsu.edu)
  • This process captured and analyzed growth and leaf color of Arabidopsis ( Arabidopsis thaliana ) plants in response to virus infection over time. (plantphysiol.org)
  • Type I interferons (IFNs) are so-named as a result of they intrude with viral an infection in vertebrate cells. (plantaeuropa.org)
  • Virus infection of plants alters pollinator preference: A payback for susceptible hosts? (biochemistry.org)
  • Once the virus is transmitted and has successfully entered into the plant cell, it moves locally from cell to cell until it enters the phloem, which allows the virus to enter distant tissue to cause a systemic infection. (wikibooks.org)
  • The study of the mechanisms of viral infection cycles became more important after molecular biology tools became available. (wikibooks.org)
  • We have been exploring mechanisms of host plant resistance in Arabidopsis to turnip crinkle virus (TCV) infection. (unl.edu)
  • 2004. Passive Protection to Bovine Rotavirus (BRV) Infection Induced by a BRV VP8* Produced in Plants Using a TMV-based Vector. (unl.edu)
  • For cytologic studies of viral entry and infection, we use fluorescence and electron microscopy and particles assembled in heterologous expression systems. (scripps.edu)
  • Recently, studies on viral entry indicated the presence of an "eluted" particle early in infection that has initiated its disassembly program but is then eluted back into the medium. (scripps.edu)
  • Salicylic-acid-mediated systemic acquired immunity provokes the defense response throughout the plant system during pathogen infection at a particular site. (ias.ac.in)
  • Citrus plants infected by the HLB bacterium may not show visible symptoms sometimes for years following infection. (ias.ac.in)
  • During viral infection, host Dicer-like (DCL) enzymes catalyze production of 21-, 22-, and 24-nucleotide viral siRNA duplexes from longer double-stranded RNA (dsRNA) precursors generated by viral and/or host RNA polymerases. (springer.com)
  • Sequencing of several cDNA clones derived from 6.0-kbp dsRNA revealed the presence of a RNA-dependent RNA polymerase (RDRP) gene. (apsnet.org)
  • Northern blot analysis revealed three dsRNAs in preparations of both dsRNA and total RNA from R . multiflora plants. (deepdyve.com)
  • We previously reported the antiviral function of rgs-CaM, which binds to and directs degradation of viral RNA silencing suppressors (RSSs), including CMV 2b, via autophagy. (hokudai.ac.jp)
  • The mechanisms involved in systemic RNA silencing in plant systems are being actively investigated using grafting and transient expression approaches ( Figure 1 ) in conjunction with a variety of plant viral suppressors of silencing that act at different steps in the silencing pathway. (plantcell.org)
  • Several virus-encoded suppressors also exert an inhibitory effect on endogenous small RNA regulatory pathways. (csic.es)
  • A versatile assay for the identification of RNA silencing suppressors based on complementation of viral movement. (unl.edu)
  • Plant virus silencing suppressors and RNA silencing in plants. (unl.edu)
  • Negative stranded rna virus transcription, using polymerase stuttering is the method of transcription. (wikipedia.org)
  • In vitro assays revealed that the recombinant p88 has an RNA-dependent RNA polymerase (RdRp) activity and can also bind to RNA. (asm.org)
  • The catalytic subunit of the viral replicase complexes is a virus-coded RNA-dependent RNA polymerase (RdRp). (asm.org)
  • The Dynabeads® mRNA DIRECT™ Kit is designed for simple and rapid isolation of pure, intact polyadenylated (polyA) mRNA directly from the crude lysate of animal and plant cells and tissues. (thermofisher.com)
  • A typical mammalian cell contains about 10-30 pg of total RNA, from which 1-5% is mRNA. (thermofisher.com)
  • Diagram showing how the anti-sense RNA (the yellow strand in this diagram) of the RISC complex targets destruction of complementary mRNA. (wikiversity.org)
  • Here we show that 43S ribosomal complexes recruited to locations downstream of a reporter gene can direct translation of the reporter independent of the 5′ end, suggesting that 43S ribosomal complex recognizes the initiation codon by "RNA looping" of the intervening mRNA segment between the ribosome recruiting site and the initiation codon. (pnas.org)
  • RNAs are the direct products of genes, and these small RNAs can direct enzyme complexes to degrade messenger RNA (mRNA) molecules and thus decrease their activity by preventing translation, via post-transcriptional gene silencing. (wikipedia.org)
  • RNA regulatory molecules either reduce or eliminate target gene expression by binding mRNA and targeting it for degradation by cellular enzymes. (thefreelibrary.com)
  • How this RNA pathogen induces such symptoms has been a longstanding question. (nih.gov)
  • Plant defense responses against viral and bacterial pathogen infections. (degruyter.com)
  • Potato virus Y is the most economically important potato viral pathogen. (frontiersin.org)
  • During biotic stress, plants identify the pathogen associated molecular patterns (PAMPs), which initiates a downstream signaling cascade leading to PAMP-triggered immunity (PTI). (frontiersin.org)
  • 1998. Transcriptional and posttranscriptional plant gene silencing in response to a pathogen. (nap.edu)
  • Although it has been most thoroughly studied with respect to its functions in pathogen resistance, SA sits within a complex regulatory network affecting signalling by other phytohormones and it directly or indirectly affects a wide range of plant responses [ 1 ]. (portlandpress.com)
  • The nematode Caenorhabditis elegans and its natural pathogen, the positive-strand RNA virus Orsay,have recently emerged as a new animal model of host-virus interaction. (ens.fr)
  • We discuss the plant-pathogen interactions and integrated defense responses in the context of presenting an integral understanding in plant molecular immunity. (ias.ac.in)
  • Al-Kaff NS, Covey SN, Kreike MM, Page AM, Pinder R, Dale PJ (1998) Transcriptional and posttranscriptional plant gene silencing in response to a pathogen. (springer.com)
  • Viral small interfering RNAs target host genes to mediate disease symptoms in plants. (nih.gov)
  • The virus vector is used to induce RNA-mediated silencing of a gene or genes in the host plant. (journalcjast.com)
  • Such genes need to be properly utilized to generate resistant crop plants for future generations. (springer.com)
  • Just as microbiologists discarded dubious morphological traits in favor of more accurate molecular yardsticks of evolutionary change, virologists can gain new insight into viral evolution through the rigorous analyses afforded by the molecular phylogenetics of viral genes. (asm.org)
  • Powerful new techniques for gene transfer recently have been developed for moving single genes and whole blocks of genes from one plant to another and even for moving genes from non-plants into plants. (google.com)
  • This invention relates to a novel method for introducing foreign genes into both monocotyledonous and dicotyledonous plants, thereby circumventing many of the limitations associated with the present-day technology in this field. (google.com)
  • Base pair-complementary RNA strands (ssRNA) can be produced by transcription of both template DNA strands of some genes (Figure 1). (wikiversity.org)
  • Biological methods we use include the genetic engineering of viral genes and their expression in Escherichia coli , mammalian cells, insect cells, and yeast and the characterization of these gene products by physical methods. (scripps.edu)
  • Because many of the bacterial genes for gene editing are larger than plant virus vectors can accommodate, the bacterial genes will be split into multiple segments and reassembled in planta using intein-mediated approaches. (usda.gov)
  • Plants will be allowed to set seed, and progeny seed will be assayed for modifications to the targeted genes using high-through-put mismatch detection approaches. (usda.gov)
  • The bottom two panels are of a small RNA northern blot gel hybridized with a 21-nt Locked Nucleic Acids (LNA) probe (5′ ATGAGAAATGCAGAGCTGAAA 3′) complementary to the CHLI-targeting Y-Sat siRNA (from nt. (nih.gov)
  • Germline endogenous viral elements (EVEs) genetically preserve viral nucleotide sequences useful to the study of viral evolution, gene mutation, and the phylogenetic relationships among host organisms. (nature.com)
  • Here, we describe a lineage-specific, adeno-associated virus (AAV)-derived endogenous viral element (mAAV-EVE1) found within the germline of numerous closely related marsupial species. (nature.com)
  • CPV exhibits striking capsid stability and is fully capable of endogenous RNA transcription and processing. (wikipedia.org)
  • RNA silencing is a gene inactivation system in many eukaryotes that relies on tiny RNAs as the targeting molecules. (proteopedia.org)
  • Further comprised by the invention are recombinant DNA, plasmid and vector molecules suitably adapted to the specific conditions of the process according to the invention and the transgenic plant products obtainable in accordance with the said process. (google.com)
  • On the other hand, type VI CRISPR/Cas systems are distinct in that they exclusively target RNA molecules [ 10 , 11 ]. (biomedcentral.com)
  • Ratcliff F, Harrison B, Baulcombe D. A similarity between viral defense and gene silencing in plants. (journalcjast.com)
  • The role of sRNA in plant defense responses is complex. (frontiersin.org)
  • Plant genetic resistance against hemipterans provides a model to explore the regulatory roles of sRNAs in plant defense. (frontiersin.org)
  • Acts as a suppressor of RNA-mediated gene silencing, also known as post-transcriptional gene silencing (PTGS), a mechanism of plant viral defense that limits the accumulation of viral RNAs. (uniprot.org)
  • and French, R. (2012) Triticum mosaic poacevirus enlists P1 rather than HC-Pro to suppress RNA silencing-mediated host defense. (unl.edu)
  • This review summarizes the molecular mechanisms of plant immune system, and the latest breakthroughs reported in plant defense. (ias.ac.in)
  • Blevins T, Rajeswaran R, Aregger M, Borah BK, Schepetilnikov M, Baerlocher L, Farinelli L, Meins F Jr, Hohn T, Pooggin MM (2011) Massive production of small RNAs from a non-coding region of cauliflower mosaic virus in plant defense and viral counter-defense. (springer.com)
  • We show that the yellowing symptoms are a result of small interfering RNA (siRNA)-directed RNA silencing of the chlorophyll biosynthetic gene, CHLI. (nih.gov)
  • p19 binds with high affinity to the double-stranded RNA silencing mediator, called siRNA , and this binding sequesters the siRNA, preventing its participation in later steps of RNA silencing. (proteopedia.org)
  • In antiviral RISC the vsiRNA guide strand directs the AGO/RISC to the cognate viral RNA that is inactivated by cleavage in the siRNA-RNA duplex. (uni-halle.de)
  • Cells can trim double stranded RNA to form small inhibitory RNA (siRNA). (wikiversity.org)
  • An siRNA can be processed to the single strand anti-sense RNA and used to target mRNAs for destruction. (wikiversity.org)
  • The sense and antisense RNA strands form double strand RNA (Figure 2, top) that is processed to small (about 20 base pairs long) inhibitory RNA (siRNA). (wikiversity.org)
  • Dicer also participates in small interfering RNA (siRNA) production from long RNA duplexes. (mskcc.org)
  • Each siRNA is unwound into two single-stranded RNAs (ssRNAs), the passenger strand and the guide strand. (wikipedia.org)
  • R2D2 carries tandem double-stranded RNA-binding domains to recognize the thermodynamically stable terminus of siRNA duplexes, whereas Dicer-2 the other less stable extremity. (wikipedia.org)
  • Axtell MJ, Jan C, Rajagopalan R, Bartel DP (2006) A two-hit trigger for siRNA biogenesis in plants. (springer.com)
  • Taken together, these findings provide the first demonstration of small RNA-mediated viral disease symptom production and offer an explanation of the species specificity of the viral disease. (nih.gov)
  • and cucumber mosaic virus (CMV) can infect more than 1200 plant species in 100 families, including many vegetables and ornamentals ( Zitter and Murphy, 2009 ). (frontiersin.org)
  • A species of small antisense RNA in posttranscriptional gene silencing in plants. (journalcjast.com)
  • 1991. Nuclear DNA content of some important plant species. (nap.edu)
  • The wealth of nucleotide sequence information that catalyzed a revolution in the taxonomy of free-living organisms necessitates a reevaluation of the concept of viral species, genera, families, and higher levels of classification. (asm.org)
  • Other RNA species lacking a polyA tail will not hybridize to the beads and are readily washed away. (thermofisher.com)
  • donous and dicotyledonous plant species. (deepdyve.com)
  • SViroids are nucleic acid species of relatively low molecular weight and unique structure that cause several important diseases of cultivated plants. (umsystem.edu)
  • Since these two species are frequently isolated from gastrointestinal tract of herbivores, they seem to be typical of animals fed plant diets. (ias.ac.in)
  • The systemic spread of silencing reflects the existence of an as yet unidentified mobile silencing signal as an integral component of the RNA silencing pathway. (plantcell.org)
  • AtICS1:EC 5.4.4.2, also known as isochorismate hydroxymutase) as the enzyme encoded by the wild-type SID2 allele showed that, in this plant, SA is synthesised from chorismic acid, derived from the shikimic acid pathway, and that SA biosynthesis occurs in the plastid [ 5 , 10 - 12 ]. (portlandpress.com)
  • Arabidopsis DRB4, AGO1, and AGO7 participate in a DCL4-initiated antiviral RNA silencing pathway that is negatively regulated by DCL1. (unl.edu)
  • Plant virology: Sign turns yellow for Y-sat-infected tobacco. (nih.gov)
  • show leaf yellowing ( C ) that is associated with dramatic down-regulation of the CHLI gene ( D ). ( E ), The CHLI gene is silenced in CMV Y-Sat-infected tobacco plants. (nih.gov)
  • Modern plant virology commenced at the end of 19th century with the research on tobacco mosaic disease done by Russian scientist Dmittrii Iwanowski and Dutch microbiologist Martinus Beijerinck who discovered the causal agent was much smaller in size compared to other microbes because it can pass bacteria-proof filter candle ( Roger, 2014 ). (frontiersin.org)
  • 14. The transgenic plant according to claim 10, wherein said transgenic plant is a tobacco plant. (freepatentsonline.com)
  • 1991. Measuring the potential contribution of plant breeding to crop yields: Flue-cured tobacco 1954-1987. (nap.edu)
  • The best-documented example is an RNA plant virus, Tobacco mild green mosaic virus , which showed no increase in genetic diversity over the 90 years considered, in the longest series of isolates with known isolation times for any virus ( 20 ). (asm.org)
  • In order to increase its expression and activity, we produced tobacco plants expressing KGF1 via Agrobacterium-mediated transformation using a potato virus X (PVX) -based vector (pgR107). (hindawi.com)
  • As determined by fluorescence and Western blot of leaf extracts, the KGF1 gene was correctly translated into the tobacco plants. (hindawi.com)
  • The present findings indicated that KGF1 from tobacco maintains its biological activity, implying prospective industrial production in a plant bioreactor. (hindawi.com)
  • In this study, we employed a tobacco viral expression system to improve the expression efficiency and activity of KGF1. (hindawi.com)
  • Nucleotide sequence and structural analysis of two satellite RNAs associated with chicory yellow mottle virus. (semanticscholar.org)
  • The two satellite RNAs associated with CYMV infections were sequenced. (semanticscholar.org)
  • With the help of an in vitro replicase assay based on an RdRp preparation obtained from TCV-infected plants, these satellite RNAs were widely used to dissect cis -acting elements involved in RNA accumulation ( 13 , 24 , 29 , 37 , 39 , 40 ). (asm.org)
  • 2. A recombinant DNA molecule according to claim 1 , wherein the said DNA comprises a chimaeric DNA construct comprising an expressible DNA in operable linkage with expression signals active in plant cells, wherein said expression signals are selected from the group consisting of promoter and termination sequences. (google.com)
  • Nucleotide Sequences 1986/1987, Volume VII: Structural RNA, Synthetic, and Unannotated Sequences presents data that reflect the information found in GenBank Release 44.0 of August 1986. (elsevier.com)
  • This book is a valuable resource for molecular biologists and other investigators collecting the large number of reported DNA and RNA sequences and making them available in computer-readable form. (elsevier.com)
  • 2012) P1 functions as a suppressor of RNA silencing and an enhancer of disease symptoms. (unl.edu)
  • Turnip crinkle virus (TCV) is a positive single-stranded RNA virus belonging to the Carmovirus genus of the Tombusviridae family. (plantphysiol.org)
  • Flock House virus is a T = 3, single-stranded RNA virus that infects Drosophila . (scripps.edu)
  • Turnip crinkle virus (TCV) is a small, plus-sense, single-stranded RNA virus of plants. (asm.org)
  • Induction and suppression of RNA silencing: insights from plant viral infections-a BARD. (deepdyve.com)
  • Scholthof, Herman 2010-12-22 00:00:00 An international workshop on ''Induction and Suppression of RNA Silencing: Insights from Plant Viral Infections'' was sponsored by the United States-Israel Binational Agricultural Research and Development Fund (BARD) and organized in Eilat, Israel in March 2010. (deepdyve.com)
  • This review focuses on advances in understanding the nature of systemic silencing in plants and the signal(s) that induces silencing at distant sites. (plantcell.org)
  • A Guide to Plant Systems for the Study of Systemic Silencing. (plantcell.org)
  • Silencing may spread from silenced rootstocks to scions or from locally silenced regions of a plant to upper parts of the same plant. (plantcell.org)
  • Silencing GmRIN4a or GmRIN4b in rpg1-b plants enhances basal resistance to virulent strains of P. syringae and the oomycete Phytophthora sojae . (plantphysiol.org)
  • As a key-feature of silencing, vsiRNAs are incorporated into RNA-induced silencing complexes (RISC) that contain ARGONAUTE (AGO) nucleases and other, yet uncharacterized components. (uni-halle.de)
  • An RNA-directed nuclease mediates post-transcriptional gene silencing in Drosophila cells. (journalcjast.com)
  • Recent research indicates significant roles for sRNA-mediated gene silencing during plant-hemipteran interactions that involve all three of these biological processes. (frontiersin.org)
  • TRV-16K also prevented partially cell-to-cell movement and systemic propagation of silencing but not transitive amplification of RNA silencing. (csic.es)
  • RNA-based silencing functions as an important antiviral immunity mechanism in plants. (plantphysiol.org)
  • Structural biology of RNA silencing and its functional implications. (mskcc.org)
  • RNase III enzymes play central roles in RNA silencing by processing double-stranded RNA precursors into small RNA duplexes. (mskcc.org)
  • The passenger strand is degraded and the guide strand is incorporated into the RNA-induced silencing complex (RISC). (wikipedia.org)
  • The most well-studied outcome is post-transcriptional gene silencing, which occurs when the guide strand pairs with a complementary sequence in a messenger RNA molecule and induces cleavage by Argonaute 2 (Ago2), the catalytic component of the RISC. (wikipedia.org)
  • Dr Attila Molnar of the University of Edinburgh, Institute of Molecular Plant Sciences will give this seminar entitled 'Mobile silencing RNAs in plants' at the James Hutton Institute in Dundee. (hutton.ac.uk)
  • silencing across the plant has been recognised for nearly two decades, however, only recent publications demonstrated beyond a doubt that sRNAs act as mobile silencing signals. (hutton.ac.uk)
  • His research led to the discovery of microRNAs, a special type of silencing RNAs, in Chlamydomonas , which were previously only known to associate with multicellular organisms. (hutton.ac.uk)
  • In his second project in the Baulcombe lab, he demonstrated that systemic silencing is mediated by mobile small RNAs, and provided the first evidence in any organism that mobile small RNAs direct epigenetic changes in distant tissues. (hutton.ac.uk)
  • HIV-1 Tat interferes with RNA silencing machinery in plants . (scienceblogs.com)
  • These "fossilised" genetic elements represent ancient viral integration events within host DNA. (nature.com)
  • Indeed, many studies have shown the remarkable genetic stability of RNA plant virus populations from different geographical regions, hosts, and collection times ( 21 ). (asm.org)
  • The ability to scrutinize biological function by knocking out virtually any gene using small interfering (si)RNAs now allows genetic studies to be completed at a genomewide level. (thefreelibrary.com)
  • In particular, viral nucleic acids have to be compacted and packaged into the capsid. (esrf.eu)
  • The seminal text Plant Virology is now in its fifth edition. (scribd.com)
  • The fifth edition of Plant Virology updates and revises many details of the previous edition while retaining the important earlier results that constitute the field's conceptual foundation. (scribd.com)
  • Around 70 years ago, the discovery of the phenomenon that aphids ( Aphis fabae ) benefit from feeding on virus-infected leaves initiated a new research area in plant virology and the tripartite interaction of virus-vector-plant [ 1 ]. (mdpi.com)
  • It has been ten years since the publication of the third edition of this seminal text on plant virology, during which there has been an explosion of conceptual and factual advances. (indigo.ca)
  • For example, it is not well understood how P binds to N 0 to prevent binding to cellular mRNAs and facilitate specific viral gRNA and agRNA interactions. (elifesciences.org)
  • Essential and easy to use, RNA Abundance Analysis: Methods and Protocols provides a comprehensive set of techniques and methods on isolating and analyzing mRNAs, small RNAs, and modified RNAs, which can assist you in your gene expression studies. (springer.com)
  • Transgene-mediated suppression of chalcone synthase expression in Petunia hybrida results from an increase in RNA turnover. (journalcjast.com)
  • Al-Kaff NS, Kreike MM, Covey SN, Pitcher R, Page AM, Dale PJ (2000) Plants rendered herbicide-susceptible by cauliflower mosaic virus-elicited suppression of a 35S promoter-regulated transgene. (springer.com)
  • Research Interests: Our research project is focused on the host immune response to viral infections. (unl.edu)
  • Currently, regulation of CCR4 and its deadenylase activity in viral infections is not well understood. (elifesciences.org)
  • 2012) Virus infections in wild plant populations are both frequent and often unapparent. (unl.edu)
  • Both the recombinant and the plant TCV RdRp preparations are capable of de novo initiation on both plus- and minus-strand satC and satD templates, which are small parasitic RNAs associated with TCV infections. (asm.org)
  • In addition, TCV infections are associated with several satellite (sat) RNAs ( 37 ), including satD (194 nucleotides [nt]) and satC (356 nt). (asm.org)
  • Plants dont have immune systems like you and I (dir), but they have evolved their own ways of dealing with viral infections. (scienceblogs.com)
  • PMMV was also detected in 12 (66.7%) of 18 fecal samples collected from healthy individuals on two continents, indicating that this plant virus is prevalent in the human population. (nih.gov)
  • A benign viral satellite RNA, in combination with a mild strain of cucumber mosaic virus (CMV-S), was used as a "vaccine" or "preinoculum" to demonstrate the feasibility of protecting pepper ( Capsicum annuum cv. (apsnet.org)
  • The host organism for a virus can vary from a small seed,to a large whale, in the due course, which includes plants, human beings, animals and even birds. (slideshare.net)
  • Plant virus 7. (slideshare.net)
  • RNA virus enzyme 11. (slideshare.net)
  • The cauliflower mosaic virus transactivator, TAV, controls translation reinitiation of major open reading frames on polycistronic RNA. (nih.gov)
  • Positive stranded rna virus transcription is the method of transcription. (wikipedia.org)
  • The virus exits the host cell by tubule-guided viral movement. (wikipedia.org)
  • 2010). Pepper mild mottle virus, a plant virus associated with specific immune responses, fever, abdominal pains, and pruritus in humans. (springer.com)
  • What is worse, a successful plant virus evolves multiple strategies to manipulate host defenses to promote the population of the insect vector and thereby furthers the disease pandemic. (mdpi.com)
  • Here, we review the roles of JA signaling in the tripartite interactions among plant, virus, and insect vectors, with a focus on the molecular and biochemical mechanisms that drive vector-borne plant viral diseases. (mdpi.com)
  • Roger Hull graduated in Botany from Cambridge University in 1960, and subsequently studied plant virus epidemiology at London University's Wye College, gaining a PhD in 1964. (indigo.ca)
  • Plant virus capsids as facile medical and agricultural nanoparticles. (biochemistry.org)
  • The entire plant or animal virus enters the host cell. (angelfire.com)
  • First, we brie¯y review current knowledge of RNA virus recombination and describe new methods for detecting its occurrence using gene sequence data. (biology-online.org)
  • We then discuss some of the evolutionary implications of virus recombination and some of the constraints that may shape the variety of RNA virus recombination. (biology-online.org)
  • In some cases of RNA virus recombination, the donor sequence neatly replaces a homologous region of the acceptor sequence leaving its structure unchanged. (biology-online.org)
  • Determination of sequence and structural requirements for pathogenicity of a cucumber mosaic virus satellite RNA (Y-satRNA). (plantcell.org)
  • Hepatitis C virus population analysis of a single source nosocomial outbreak reveals an inverse correlation between viral load and quasispecies complexity. (upf.edu)
  • Mutation of host dnaJ homolog inhibits negative-strand RNA synthesis of brome mosaic virus. (upf.edu)
  • In vitro activity of the hairpin ribozyme derived from the negative strand of arabis mosaic virus satellite RNA. (semanticscholar.org)
  • The nucleotide sequence of a satellite RNA associated with strawberry latent ringspot virus. (semanticscholar.org)
  • The nucleotide sequence of satellite RNA in grapevine fanleaf virus, strain F13. (semanticscholar.org)
  • Neither frame was related to any known plant virus gene. (usda.gov)
  • 1. Develop systems to express guide RNAs and Cas9-like enzymes from virus vector systems in crop plants. (usda.gov)
  • Another approach to obtain viral RdRps is to purify them from virus-infected cells. (asm.org)
  • Turnip crinkle virus (TCV), a carmovirus, is a well-characterized model plus-strand RNA virus (reviewed in references 5 and 37 ). (asm.org)
  • Paramyxoviruses, including human parainfluenza virus type 3, are internalized into host cells by fusion between viral and target cell membranes. (asm.org)
  • Biochemistry and Molecular Biology of Plants, 2nd Edition has been hailed as a major contribution to the plant sciences literature and critical acclaim has been matched by global sales success. (wiley.com)
  • Biochemistry and Molecular Biology of Plants holds a unique place in the plant sciences literature as it provides the only comprehensive, authoritative, integrated single volume book in this essential field of study. (wiley.com)
  • In silico gene reconstruction and molecular modelling indicate remarkable conservation of viral structure over a geologic timescale. (nature.com)
  • Biochemistry and molecular biology of plants (pp. 1158-1249). (springer.com)
  • This has important implications for our understanding of the fundamental molecular biology of Picornavirales,and opens the door to novel research and therapeutic applications in the field of custom RNA packaging and delivery technologies. (jic.ac.uk)
  • RNA abundance analysis is one of the most important approaches for gene expression studies in the field of molecular biology. (springer.com)
  • Invitrogen TRIzol products are referenced in thousands of journal publications, reflecting the trust that molecular biologists have placed in TRIzol Reagent to deliver high-quality, intact RNA from many kinds of biological materials. (thermofisher.com)
  • This observation illustrates the potential for a novel type of long distance signalling mechanism in plants. (hutton.ac.uk)
  • Inhibition of gene expression in plant cells by expression of antisense RNA. (journalcjast.com)
  • Small RNAs (sRNAs) are essential regulators of eukaryotic gene expression and function. (frontiersin.org)
  • However, it was only in 1998 that experiments were described showing the unexpected power of double stranded RNA to block gene expression [6] . (wikiversity.org)
  • Several conserved serine and threonine residues in p19 mediate key interactions with 2'-hydroxyls specifying RNA as the substrate, rather than DNA. (proteopedia.org)
  • This view only shows part of the network of interactions with the ribose sugar 2'-hydroxyls of the RNA. (proteopedia.org)
  • Each 'reading' helix is connected to the structured core of p19 by a short flexible loop and several side-chain interactions this presumably allows some flexibility in the positioning of the RNA end-capping tryptophan residues. (proteopedia.org)
  • 1997. Signaling in plant-microbe interactions. (nap.edu)
  • The present invention further concerns a method of producing the transgenic plants of the present invention which contain large chloroplasts. (freepatentsonline.com)
  • Comparison of the E. coli- expressed p88, the N-terminal deletion mutant of p88, and a TCV RdRp preparation obtained from infected plants revealed that these preparations show remarkable similarities in RNA template recognition and usage. (asm.org)
  • Further comparison of the single-component recombinant TCV RdRp and the multicomponent plant TCV RdRp will help dissect the functions of various components of the TCV replicase. (asm.org)
  • this resistance was classified as immunity when extracts failed to transmit from inoculated leaves to test plants. (wiley.com)
  • Isolate and purify total RNA from plant cells and tissue, and filamentous fungi without the use of organic compounds (e.g. (clontech.com)
  • Several methods have been explored for introducing nucleic acid into a variety of cell types with the hope of developing a successful technique for the transformation of eukaryotic cells of plants and animals. (google.com)
  • When the viral nucleic acid enters the cell, it migrates to the host's chromosome. (angelfire.com)
  • The viral nucleic acid reprograms the cell's DNA. (angelfire.com)
  • The cell begins to follow the instructions of the viral nucleic acid. (angelfire.com)
  • Binds to GTP and to single-stranded RNA and single-stranded DNA in a non-sequence-specific manner. (rcsb.org)
  • NucleoSpin RNA Plant is designed for isolation and purification of DNA-free, high-quality RNA from a wide variety of plant and fungal samples. (clontech.com)
  • E.Z.N.A.® Plant RNA Kit provides a convenient and rapid method for the isolation of total RNA from a variety of plant samples. (omegabiotek.com)
  • Viral resistance has been developed in diverse crops with SRGE technology and a few viral resistant crops have been approved for commercial release. (frontiersin.org)
  • This phenomenon is called systemic acquired resistance (SAR), which is a plant priming for adaption to repeated biotic stress. (hokudai.ac.jp)
  • Aphid-induced sRNA expression in resistance genotypes delivers a new paradigm in understanding the regulation of R gene-mediated resistance in host plants. (frontiersin.org)
  • The system combines CTAB-based lysis, which eliminates the need for organic solvents, with the convenience of Mag-Bind® Particles to eliminate polysaccharides, phenolic compounds, and enzyme inhibitors from plant tissue lysates. (omegabiotek.com)
  • p19 specifies the presence of a 5'-phosphate at the 5'-end of each RNA strand via hydrogen binding between the phosphate and a conserved tryptophan (W42). (proteopedia.org)
  • Single strand RNA transcripts: ssRNA. (wikiversity.org)
  • The presence of peculiar metabolites in a variety of plant tissues or fungi, however, may lead to solidification of the lysate, resulting in a non-processible slurry. (clontech.com)
  • Double-stranded RNAs (dsRNAs) are widespread in plant pathogenic fungi, but their functions in fungal hosts remain mostly unclear, with a few exceptions. (apsnet.org)
  • Conversely, knockdown of the small brown planthopper CCR4 inhibited viral accumulation in the insect vector. (elifesciences.org)
  • Because the inserted gene produces the toxin all the time, the expression of the gene in all tissues and all the time would have unknown consequences on the life forms normally associated with the plant. (appropedia.org)
  • The recombinant KGF1 was purified from plant tissues by heparin affinity chromatography, and cell proliferation in NIH/3T3 cells was stimulated by the purified KGF1. (hindawi.com)
  • 3- If you mutate HIV-1 Tat in the putative RSS active sites, you dont get much viral production. (scienceblogs.com)