Tubulin
A microtubule subunit protein found in large quantities in mammalian brain. It has also been isolated from SPERM FLAGELLUM; CILIA; and other sources. Structurally, the protein is a dimer with a molecular weight of approximately 120,000 and a sedimentation coefficient of 5.8S. It binds to COLCHICINE; VINCRISTINE; and VINBLASTINE.
Tubulin Modulators
Microtubules
Colchicine
Microtubule-Associated Proteins
Podophyllotoxin
A lignan (LIGNANS) found in PODOPHYLLIN resin from the roots of PODOPHYLLUM plants. It is a potent spindle poison, toxic if taken internally, and has been used as a cathartic. It is very irritating to skin and mucous membranes, has keratolytic actions, has been used to treat warts and keratoses, and may have antineoplastic properties, as do some of its congeners and derivatives.
Stathmin
A ubiquitous phosphoprotein that serves as an intracellular substrate for a variety of SIGNAL TRANSDUCTION PATHWAYS. PHOSPHORYLATION of stathmin occurs during CELL CYCLE progression, and stathmin functions as a microtubule-destabilizing protein that promotes MICROTUBULE depolymerization during INTERPHASE and late MITOSIS. Stathmin is expressed at very high levels in a variety of human CANCERS.
Guanosine Triphosphate
Paclitaxel
Polymers
Sea Urchins
Microscopy, Electron
Microscopy using an electron beam, instead of light, to visualize the sample, thereby allowing much greater magnification. The interactions of ELECTRONS with specimens are used to provide information about the fine structure of that specimen. In TRANSMISSION ELECTRON MICROSCOPY the reactions of the electrons that are transmitted through the specimen are imaged. In SCANNING ELECTRON MICROSCOPY an electron beam falls at a non-normal angle on the specimen and the image is derived from the reactions occurring above the plane of the specimen.
Brain
The part of CENTRAL NERVOUS SYSTEM that is contained within the skull (CRANIUM). Arising from the NEURAL TUBE, the embryonic brain is comprised of three major parts including PROSENCEPHALON (the forebrain); MESENCEPHALON (the midbrain); and RHOMBENCEPHALON (the hindbrain). The developed brain consists of CEREBRUM; CEREBELLUM; and other structures in the BRAIN STEM.
Peptide Synthases
Protein Binding
Biopolymers
Nocodazole
Cattle
Tropolone
Cilia
Populations of thin, motile processes found covering the surface of ciliates (CILIOPHORA) or the free surface of the cells making up ciliated EPITHELIUM. Each cilium arises from a basic granule in the superficial layer of CYTOPLASM. The movement of cilia propels ciliates through the liquid in which they live. The movement of cilia on a ciliated epithelium serves to propel a surface layer of mucus or fluid. (King & Stansfield, A Dictionary of Genetics, 4th ed)
Cytoskeleton
Brain Chemistry
Mitosis
Spindle Apparatus
Kinesin
A microtubule-associated mechanical adenosine triphosphatase, that uses the energy of ATP hydrolysis to move organelles along microtubules toward the plus end of the microtubule. The protein is found in squid axoplasm, optic lobes, and in bovine brain. Bovine kinesin is a heterotetramer composed of two heavy (120 kDa) and two light (62 kDa) chains. EC 3.6.1.-.
Macromolecular Substances
Chaperonin Containing TCP-1
Vinca Alkaloids
Axoneme
Benomyl
Sperm Tail
Binding Sites
Swine
Any of various animals that constitute the family Suidae and comprise stout-bodied, short-legged omnivorous mammals with thick skin, usually covered with coarse bristles, a rather long mobile snout, and small tail. Included are the genera Babyrousa, Phacochoerus (wart hogs), and Sus, the latter containing the domestic pig (see SUS SCROFA).
Physarum
Mammalian staufen is a double-stranded-RNA- and tubulin-binding protein which localizes to the rough endoplasmic reticulum. (1/5514)
Staufen (Stau) is a double-stranded RNA (dsRNA)-binding protein involved in mRNA transport and localization in Drosophila. To understand the molecular mechanisms of mRNA transport in mammals, we cloned human (hStau) and mouse (mStau) staufen cDNAs. In humans, four transcripts arise by differential splicing of the Stau gene and code for two proteins with different N-terminal extremities. In vitro, hStau and mStau bind dsRNA via each of two full-length dsRNA-binding domains and tubulin via a region similar to the microtubule-binding domain of MAP-1B, suggesting that Stau cross-links cytoskeletal and RNA components. Immunofluorescent double labeling of transfected mammalian cells revealed that Stau is localized to the rough endoplasmic reticulum (RER), implicating this RNA-binding protein in mRNA targeting to the RER, perhaps via a multistep process involving microtubules. These results are the first demonstration of the association of an RNA-binding protein in addition to ribosomal proteins, with the RER, implicating this class of proteins in the transport of RNA to its site of translation. (+info)Mutations of oncoprotein 18/stathmin identify tubulin-directed regulatory activities distinct from tubulin association. (2/5514)
Oncoprotein 18/stathmin (Op18) is a recently identified phosphorylation-responsive regulator of the microtubule (MT) system. It was originally proposed that Op18 specifically regulates dynamic properties of MTs by associating with tubulin, but it has subsequently been proposed that Op18 acts simply by sequestering of tubulin heterodimers. We have dissected the mechanistic action of Op18 by generation of two distinct classes of mutants. One class has interruptions of the heptad repeats of a potential coiled-coil region of Op18, and the other involves substitution at all four phosphorylation sites with negatively charged Glu residues. Both types of mutation result in Op18 proteins with a limited decrease in tubulin complex formation. However, the MT-destabilizing activities of the coiled-coil mutants are more severely reduced in transfected leukemia cells than those of the Glu-substituted Op18 derivative, providing evidence for tubulin-directed regulatory activities distinct from tubulin complex formation. Analysis of Op18-mediated regulation of tubulin GTPase activity and taxol-promoted tubulin polymerization showed that while wild-type and Glu-substituted Op18 derivatives are active, the coiled-coil mutants are essentially inactive. This suggests that Op18-tubulin contact involves structural motifs that deliver a signal of regulatory importance to the MT system. (+info)Gibberellic acid stabilises microtubules in maize suspension cells to cold and stimulates acetylation of alpha-tubulin. (3/5514)
Gibberellic acid is known to stabilise microtubules in plant organs against depolymerisation. We have now devised a simplified cell system for studying this. Pretreatment of a maize cell suspension with gibberellic acid for just 3 h stabilised protoplast microtubules against depolymerisation on ice. In other eukaryotes, acetylation of alpha-tubulin is known to correlate with microtubule stabilisation but this is not established in plants. By isolating the polymeric tubulin fraction from maize cytoskeletons and immunoblotting with the antibody 6-11B-1, we have demonstrated that gibberellic acid stimulates the acetylation of alpha-tubulin. This is the first demonstrated link between microtubule stabilisation and tubulin acetylation in higher plants. (+info)Arsenic targets tubulins to induce apoptosis in myeloid leukemia cells. (4/5514)
Arsenic exhibits a differential toxicity to cancer cells. At a high concentration (>5 microM), As2O3 causes acute necrosis in various cell lines. At a lower concentration (0.5-5 microm), it induces myeloid cell maturation and an arrest in metaphase, leading to apoptosis. As2O3-treated cells have features found with both tubulin-assembling enhancers (Taxol) and inhibitors (colchicine). Prior treatment of monomeric tubulin with As2O3 markedly inhibits GTP-induced polymerization and microtubule formation in vitro but does not destabilize GTP-induced tubulin polymers. Cross-inhibition experiments indicate that As2O3 is a noncompetitive inhibitor of GTP binding to tubulin. These observations correlate with the three-dimensional structure of beta-tubulin and suggest that the cross-linking of two vicinal cysteine residues (Cys-12 and Cys-213) by trivalent arsenic inactivates the GTP binding site. Furthermore, exogenous GTP can prevent As2O3-induced mitotic arrest. (+info)Identification of a domain in guanylyl cyclase-activating protein 1 that interacts with a complex of guanylyl cyclase and tubulin in photoreceptors. (5/5514)
The membrane-bound guanylyl cyclase in rod photoreceptors is activated by guanylyl cyclase-activating protein 1 (GCAP-1) at low free [Ca2+]. GCAP-1 is a Ca2+-binding protein and belongs to the superfamily of EF-hand proteins. We created an oligopeptide library of overlapping peptides that encompass the entire amino acid sequence of GCAP-1. Peptides were used in competitive screening assays to identify interaction regions in GCAP-1 that directly bind the guanylyl cyclase in bovine photoreceptor cells. We found four regions in GCAP-1 that participate in regulating guanylyl cyclase. A 15-amino acid peptide located adjacent to the second EF-hand motif (Phe73-Lys87) was identified as the main interaction domain. Inhibition of GCAP-1-stimulated guanylyl cyclase activity by the peptide Phe73-Lys87 was completely relieved when an excess amount of GCAP-1 was added. An affinity column made from this peptide was able to bind a complex of photoreceptor guanylyl cyclase and tubulin. Using an anti-GCAP-1 antibody, we coimmunoprecipitated GCAP-1 with guanylyl cyclase and tubulin. Complex formation between GCAP-1 and guanylyl cyclase was observed independent of [Ca2+]. Our experiments suggest that there exists a tight association of guanylyl cyclase and tubulin in rod outer segments. (+info)Characterization of two related Drosophila gamma-tubulin complexes that differ in their ability to nucleate microtubules. (6/5514)
gamma-tubulin exists in two related complexes in Drosophila embryo extracts (Moritz, M., Y. Zheng, B.M. Alberts, and K. Oegema. 1998. J. Cell Biol. 142:1- 12). Here, we report the purification and characterization of both complexes that we name gamma-tubulin small complex (gammaTuSC; approximately 280,000 D) and Drosophila gammaTuRC ( approximately 2,200,000 D). In addition to gamma-tubulin, the gammaTuSC contains Dgrip84 and Dgrip91, two proteins homologous to the Spc97/98p protein family. The gammaTuSC is a structural subunit of the gammaTuRC, a larger complex containing about six additional polypeptides. Like the gammaTuRC isolated from Xenopus egg extracts (Zheng, Y., M.L. Wong, B. Alberts, and T. Mitchison. 1995. Nature. 378:578-583), the Drosophila gammaTuRC can nucleate microtubules in vitro and has an open ring structure with a diameter of 25 nm. Cryo-electron microscopy reveals a modular structure with approximately 13 radially arranged structural repeats. The gammaTuSC also nucleates microtubules, but much less efficiently than the gammaTuRC, suggesting that assembly into a larger complex enhances nucleating activity. Analysis of the nucleotide content of the gammaTuSC reveals that gamma-tubulin binds preferentially to GDP over GTP, rendering gamma-tubulin an unusual member of the tubulin superfamily. (+info)Genetic analysis of viable Hsp90 alleles reveals a critical role in Drosophila spermatogenesis. (7/5514)
The Hsp90 chaperone protein maintains the activities of a remarkable variety of signal transducers, but its most critical functions in the context of the whole organism are unknown. Point mutations of Hsp83 (the Drosophila Hsp90 gene) obtained in two different screens are lethal as homozygotes. We report that eight transheterozygous mutant combinations produce viable adults. All exhibit the same developmental defects: sterile males and sterile or weakly fertile females. We also report that scratch, a previously identified male-sterile mutation, is an allele of Hsp82 with a P-element insertion in the intron that reduces expression. Thus, it is a simple reduction in Hsp90 function, rather than possible altered functions in the point mutants, that leads to male sterility. As shown by light and electron microscopy, all stages of spermatogenesis involving microtubule function are affected, from early mitotic divisions to later stages of sperm maturation, individualization, and motility. Aberrant microtubules are prominent in yeast cells carrying mutations in HSP82 (the yeast Hsp90 gene), confirming that Hsp90 function is connected to microtubule dynamics and that this connection is highly conserved. A small fraction of Hsp90 copurifies with taxol-stabilized microtubule proteins in Drosophila embryo extracts, but Hsp90 does not remain associated with microtubules through repeated temperature-induced assembly and disassembly reactions. If the spermatogenesis phenotypes are due to defects in microtubule dynamics, we suggest these are indirect, reflecting a role for Hsp90 in maintaining critical signal transduction pathways and microtubule effectors, rather than a direct role in the assembly and disassembly of microtubules themselves. (+info)Mechanisms of action of and resistance to antitubulin agents: microtubule dynamics, drug transport, and cell death. (8/5514)
PURPOSE: To analyze the available data concerning mechanisms of action of and mechanisms of resistance to the antitubulin agents, vinca alkaloids and taxanes, and more recently described compounds. DESIGN: We conducted a review of the literature on classic and recent antitubulin agents, focusing particularly on the relationships between antitubulin agents and their intracellular target, the soluble tubulin/microtubule complex. RESULTS AND CONCLUSION: Although it is widely accepted that antitubulin agents block cell division by inhibition of the mitotic spindle, the mechanism of action of antitubulin agents on microtubules remains to be determined. The classic approach is that vinca alkaloids depolymerize microtubules, thereby increasing the soluble tubulin pool, whereas taxanes stabilize microtubules and increase the microtubular mass. More recent data suggest that both classes of agents have a similar mechanism of action, involving the inhibition of microtubule dynamics. These data suggest that vinca alkaloids and taxanes may act synergistically as antitumor agents and may be administered as combination chemotherapy in the clinic. However, enhanced myeloid and neurologic toxicity, as well as a strong dependence on the sequence of administration, presently exclude these combinations outside the context of clinical trials. Although the multidrug resistance phenotype mediated by Pgp appears to be an important mechanism of resistance to these agents, alterations of microtubule structure resulting in altered microtubule dynamics and/or altered binding of antitubulin agents may constitute a significant mechanism of drug resistance. (+info)Microtubule-associated proteins and microtubule-based translocators have different binding sites on tubulin molecule<...
Rationalization of paclitaxel insensitivity of yeast β-tubulin and human βIII-tubulin isotype using principal component...
Requirement for the β<sub>I</sub> and β<sub>IV</sub> tubulin isotypes...
The actin-MRTF-SRF transcriptional circuit controls tubulin acetylation via α-TAT1 gene expression | JCB
Cell cycle regulation of tubulin RNA level, tubulin protein synthesis, and assembly of microtubules in Physarum. - Immunology
Two Drosophila beta tubulin isoforms are not functionally equivalent. | JCB
Tubulin alpha-4A chain
A TOG:αβ-tubulin Complex Structure Reveals Conformation-Based Mechanisms for a Microtubule Polymerase | Science
Patterns of tubulin isotype synthesis and usage during mitotic spindle morphogenesis in Physarum. - Oxford Neuroscience
Regulation of three beta-tubulin mRNAs during rat brain development. - Semantic Scholar
β‐Tubulin mutations that cause severe neuropathies disrupt axonal transport | The EMBO Journal
Tubulin alpha-3C/D chain
β3 tubulin expression characterizes the differentiating mesodermal germ layer during Drosophila embryogenesis | Development
The plant Spc98p homologue colocalizes with γ-tubulin at microtubule nucleation sites and is required for microtubule...
The extended tubulin superfamily. - Oxford Neuroscience
Complex regulation and functional versatility of mammalian alpha- and beta-tubulin isotypes during the differentiation of...
Tubulin post-translational modifications and the construction of microtubular organelles in Trypanosoma brucei. - Immunology
Membrane-Associated α-Tubulin Is Less Acetylated in Postmortem Prefrontal Cortex from Depressed Subjects Relative to Controls:...
Tubulin protein (97% pure): porcine brain - Cytoskeleton, Inc.
Helical microtubule arrays in a collection of twisting tubulin mutants of Arabidopsis thaliana | PNAS
Tubulin glycylases are required for primary cilia, control of cell proliferation and tumor development in colon | The EMBO...
The TUBB1 Q43P functional polymorphism reduces the risk of cardiovascular disease in men by modulating platelet function and...
Microtubule nucleation - wikidoc
Alpha-tubulin 3C - Wikipedia
Deubiquitination of γ-tubulin by BAP1 prevents chromosome instability in breast cancer cells. - Semantic Scholar
βPix-d promotes tubulin acetylation and neurite outgrowth through a PAK/Stathmin1 signaling pathway<...
The where, when and how of microtubule nucleation - one ring to rule them all | Journal of Cell Science
Antievolution.org - Antievolution.org Discussion Board -Topic::Telic Thoughts Thread
A novel polymer of tubulin forms the conoid of Toxoplasma gondii | Journal of Cell Biology | Rockefeller University Press
Neoblast data search
anti-beta Tubulin antibody | GeneTex
anti-beta Tubulin antibody | GeneTex
Preparation of Tubulin from Brain<...
gamma tubulin Antibody 66320-1-Ig | Proteintech
Mutagenetix > Incidental...
Tubulin protein (fluorescent HiLyte 647): porcine brain - Cytoskeleton, Inc.
Bio-Rad Rat anti Tubulin Alpha | Announcement | LabX Ad 4057299
Aggregator | pharmamatrix.ca
gamma Tubulin抗体(ab50721)| Abcam中国
Microtubule assembly-derived by dimerization of TPPP/p25. Evaluation of thermodynamic parameters for multiple equilibrium...
alpha Tubulin / TUBA1A / TUBA3 - AM39110PU-N | acris-antibodies.com
Distinct populations of microtubules: tyrosinated and nontyrosinated alpha tubulin are distributed differently in vivo
Anti-Tubulin Antibody Products | Biocompare.com
Severing enzymes amplify microtubule arrays through lattice GTP-tubulin incorporation | Science
How cancer cells resist the action of microtubule-targeting chemotherapeutic drugs? A study of β-tubulin mutations | Atlas of...
alpha Tubulin抗体[4G1] |Abcam中国|Anti-alpha Tubulin抗体[4G1]
Phosphorylation of tubulin tyrosine ligase: a potential mechanism for regulation of alpha-tubulin tyrosination
Plus it
Role of Fyn in the Rearrangement of Tubulin Cytoskeleton Induced through TCR | The Journal of Immunology
Identification of a class of novel tubulin inhibitors<...
Conformational study of calf brain tubulin<...
Vasohibins encode tubulin detyrosinating activity<...
Exbio antibodies - Mouse Monoclonal to alpha, beta-tubulin dimer TU-10 (IgM)
Theoretical Analysis of Microtubule Dynamics at All Times
Mitotic phosphorylation by NEK6 and NEK7 reduces the microtubule affinity of EML4 to promote chromosome congression | Science...
Exbio antibodies - Mouse Monoclonal to alpha, beta-tubulin dimer TU-10 (IgM)
ABL1 | Vascular Dysfunction Induced in Offspring by Maternal Dietary Fat
Tubulin tyrosine ligase like 12 links to prostate cancer through tubulin posttranslational modification and chromosome ploidy -...
A centrosomal protein FOR20 regulates microtubule assembly dynamics and plays a role in cell migration | Biochemical Journal
AID 214727 - Tested for the inhibition of binding of 5 uM [3H]-colchicine to purified tubulin at 37 degree Centigrade - PubChem
Zinc in the structure of Drosophila Nod (3DC4) and Bovine Tubulin (1JFF) Docked Into The 11-Angstrom Cryo-Em Map of Nucleotide...
Anti-alpha Tubulin antibody - Loading Control (ab4074) | Abcam
RCSB PDB - 4AQV: Model of human kinesin-5 motor domain (3HQD) and mammalian tubulin heterodimer (1JFF) docked into the 9.7...
AMPK activation promotes lipid droplet dispersion on detyrosinated microtubules to increase mitochondrial fatty acid oxidation
Anti Tubulin Alpha 1A Chain Antibody, clone OTI2C8 (PrecisionAb Monoclonal Antibody) | Bio-Rad
Spast - Spastin - Mus musculus (Mouse) - Spast gene & protein
Plus it
Contractile proteins (actin, myosin) and tubulin are revealed within DNA-containing nucleocytoplasm in mature spermatozoa of...
An essential quality control mechanism at the eukaryotic basal body prior to intraflagellar transport. - Lancaster EPrints
Participation of guanine nucleotides in nucleation and elongation steps of microtubule assembly.<...
Plus it
Plus it
THE ROLE OF DIVA IN CELL DIFFERENTIATION | [email protected]
Microtubule Self-Assembly Kinetics - Durham University
Bulinski | Columbia University : Biological Sciences
Vascular targeting in pancreatic cancer: the novel tubulin-binding agent ZD6126 reveals antitumor activity in primary and...
Profile | Biosciences | University of Exeter
3 -Hydroxy-3,4 -dimethoxyflavone blocks tubulin polymerization and is a potent apoptotic inducer in human SK-MEL-1 melanoma...
Lexibulin | CYT997 | CAS#917111-44-5 | CAS#917111-49-0 | tubulin inhibitor | MedKoo Biosciences
Leicester Research Archive: Nek6 Controls Mitotic Progression through Regulating EML3 Localisation to Spindle Microtubules
Two β-tubulin genes, TUB1 and TUB8, of Arabidopsis exhibit largely nonoverlapping patterns of expression, Plant Molecular...
Microtubule assembly dynamics: an attractive target for antica...
Polewards chromosome movement driven by microtubule depolymerization in vitro.
Colchicine inhibits microtubule
AID 332145 - Induction of cellular microtubule disrupting activity in rat A10 cells at 1 ug/ml after 24 hrs by indirect...
AMRI Signs Agreement for Exclusive License of its Tubulin Inhibitor Program ... ( ALBANY N.Y. Feb. 11 2013 /- (L...)
Tubulin
Human δ- and ε-tubulin genes include:[citation needed] δ-tubulin: TUBD1 ε-tubulin: TUBE1 Zeta-tubulin (IPR004058) is present in ... It binds colchicine much more slowly than other isotypes of β-tubulin. β1-tubulin, sometimes called class VI β-tubulin, is the ... The β-tubulin subunit is exposed on the plus end of the microtubule, while the α-tubulin subunit is exposed on the minus end. ... γ-tubulin also has been isolated as a dimer and as a part of a γ-tubulin small complex (γTuSC), intermediate in size between ...
Tubulin domain
Tubulin/FtsZ family, GTPase domain is an evolutionary conserved protein domain. This domain is found in all tubulin chains, as ... FtsZ and tubulin are GTPases, this entry is the GTPase domain. FtsZ can polymerise into tubes, sheets, and rings in vitro and ... Tubulin is the major component of microtubules, while FtsZ is the polymer-forming protein of bacterial cell division, it is ... Nogales E, Downing KH, Amos LA, Löwe J (June 1998). "Tubulin and FtsZ form a distinct family of GTPases". Nat. Struct. Biol. 5 ...
Tubulin GTPase
... phosphate This enzyme participates in tubulin folding and division plane formation. Tubulin Yu XC, Margolin W (September 1997 ... Tubulin+GTPase at the US National Library of Medicine Medical Subject Headings (MeSH) Portal: Biology (Articles with short ... Tubulin GTPase (EC 3.6.5.6) is an enzyme with systematic name GTP phosphohydrolase (microtubule-releasing). This enzyme ... Roychowdhury S, Panda D, Wilson L, Rasenick MM (May 1999). "G protein alpha subunits activate tubulin GTPase and modulate ...
Alpha-tubulin 3C
Genes from the alpha, beta and gamma tubulin families are found in all eukaryotes. The alpha and beta tubulins represent the ... Takeoka A, Shimizu M, Horio T (Dec 2000). "Identification of an alpha-tubulin mutant of fission yeast from gamma-tubulin- ... Tubulin alpha-3C/D chain is a protein that in humans is encoded by the TUBA3C gene. Microtubules of the eukaryotic cytoskeleton ... "Entrez Gene: TUBA3C tubulin, alpha 3c". Klein C, Kramer EM, Cardine AM, Schraven B, Brandt R, Trotter J (Feb 2002). "Process ...
Tubulin-tyrosine ligase
... α-tubulin + ADP + phosphate The 3 substrates of this enzyme are ATP, detyrosinated alpha-tubulin, and L-tyrosine, whereas its 3 ... In enzymology, a tubulin-tyrosine ligase (EC 6.3.2.25) is an enzyme that catalyzes the chemical reaction ATP + detyrosinated α- ... Rudiger M, Wehland J, Weber K (1994). "The carboxy-terminal peptide of detyrosinated alpha tubulin provides a minimal system to ... The systematic name of this enzyme class is alpha-tubulin:L-tyrosine ligase (ADP-forming). Wehland J, Schroder HC, Weber K ( ...
Tubulin beta-4A chain
... is a protein that in humans is encoded by the TUBB4A gene. Two tubulin beta-4 chain proteins are encoded ... Tubulin is the major constituent of microtubules, a key components of the cytoskeleton. It binds two molecules of GTP, one at ... "Entrez Gene: TUBB4 tubulin, beta 4". "UCSC Genome Browser: TUBB4A microarray expression". Hersheson J, Mencacci NE, Davis M, ... Lee MG, Loomis C, Cowan NJ (Sep 1984). "Sequence of an expressed human beta-tubulin gene containing ten Alu family members". ...
Tubulin alpha-1A chain
... is a protein that in humans is encoded by the TUBA1A gene. Tubulin alpha-1A chain is an alpha-tubulin ... Genes from the alpha, beta and gamma tubulin families are found in all eukaryotes. The alpha and beta tubulins represent the ... There are multiple alpha and beta tubulin genes, which are highly conserved among species. This gene encodes alpha tubulin and ... comparing the expressions of rat α-tubulins Tα1 and T26. These two rat α-tubulins are homologs of bα1 and kα1 showing that a ...
Class III β-tubulin
... , otherwise known as βIII-tubulin (β3-tubulin) or β-tubulin III, is a microtubule element of the tubulin ... which do not express Class III β-tubulin. Class III β-tubulin is one of the seven β-tubulin isotypes identified in the human ... Like other β-tubulin isotypes, βIII-tubulin has a GTPase domain which plays an essential role in regulating microtubule ... miR-200c suppresses class III β-tubulin translation. By contrast, cytoplasmic HuR and miR-200c enhance class III β-tubulin ...
Tubulin beta-4B chain
... formerly known as tubulin beta-2C chain is a protein that in humans is encoded by the TUBB4B gene. GRCh38 ... "Entrez Gene: TUBB2C tubulin, beta 2C". Burgoyne RD, Cambray-Deakin MA, Lewis SA, et al. (1989). "Differential distribution of ... 2001). "HLA-B2702 (77-83/83-77) peptide binds to beta-tubulin on human NK cells and blocks their cytotoxic capacity". J. ... Lewis SA, Gilmartin ME, Hall JL, Cowan NJ (Jul 1985). "Three expressed sequences within the human beta-tubulin multigene family ...
Alpha-tubulin N-acetyltransferase
... tubulin N-acetyltransferase, acetyl-CoA:alpha-tubulin-L-lysine N-acetyltransferase, and acetyl-CoA:[alpha-tubulin]-L-lysine 6-N ... Tubulin acetylation is one of the signaling pathways for Na+ and K+-ATPase activity. Tubulin acetylation is also involved in ... Other names in common use include alpha-tubulin acetylase, αTAT, ATAT1, TAT, alpha-TAT, alpha-tubulin acetyltransferase, ... as it has been found that mice lacking ATAT1 possess a deficient tubulin acetylation and a bulge in the dentate gyrus. Tubulin ...
Discovery and development of tubulin inhibitors
Binding site of different drugs on tubulin Taxol bound to tubulin. Vinblastine bound to tubulin. Colchicine bound to tubulin. ... It binds to the soluble tubulin to form colchicine-tubulin complex. This complex along with the normal tubulins then undergoes ... This part of tubulin dimer remains unused because all currently use drugs bind to the β-tubulin. Research in this field can ... The α-tubulin end has negative (-) charges while the β-tubulin end has positive (+) charges. The microtubule grows from ...
Tubulin polymerization promoting protein family member 3
... is a protein that in humans is encoded by the TPPP3 gene. GRCh38: ... "Entrez Gene: Tubulin polymerization promoting protein family member 3". Retrieved 2018-06-19. Martins-de-Souza D, Gattaz WF, ... PDBe-KB provides an overview of all the structure information available in the PDB for Human Tubulin polymerization-promoting ... protein family member 3 PDBe-KB provides an overview of all the structure information available in the PDB for Mouse Tubulin ...
Prosthecobacter
Tubulins, which are components of the microtubule, have never been observed in Gracilicutes before. Tubulin was long thought to ... These genes are called bacterial tubulin a (BtubA) and bacterial tubulin b (BtubB). The properties are not exactly same. ... Nogales E, Downing KH, Amos LA, Löwe J (June 1998). "Tubulin and FtsZ form a distinct family of GTPases". Nature Structural ... Larsen RA, Cusumano C, Fujioka A, Lim-Fong G, Patterson P, Pogliano J (June 2007). "Treadmilling of a prokaryotic tubulin-like ...
Polyglycylation
... of delta2 tubulin". J. Biol. Chem. 277 (48): 46140-46144. doi:10.1074/jbc.M208065200. PMID 12356754. (Post- ... Polyglycylation is a form of posttranslational modification of glutamate residues of the carboxyl-terminal region tubulin in ... Banerjee Asok (2002). "Coordination of posttranslational modifications of bovine brain alpha-tubulin. ... "Polyglycylation of tubulin: a posttranslational modification in axonemal microtubules". Science. 266 (5191): 1688-1691. doi: ...
Two-domain system
Tubulin-like proteins named artubulins are found in the genomes of several ammonium-oxidising Thaumarchaeota. A protein called ... In addition to actin, tubulin, ubiquitin and ESCRT proteins found in TACK archaea, Asgards contain functional genes for several ... Yutin, Natalya; Koonin, Eugene V. (2012). "Archaeal origin of tubulin". Biology Direct. 7: 10. doi:10.1186/1745-6150-7-10. PMC ... tubulin (component of the large cytoskeleton, microtubule) and the ubiquitin system (protein degradation and recycling) that ...
Katanin
ATP hydrolysis is stimulated at a low tubulin/At-p60 ratio and inhibited at higher ratios. The low ratios favor the katanin ... The predicted conformational change also likely decreases the affinity of katanin for tubulin as well as for other katanin ... During cell division, severing at the spindle pole produces free microtubule ends and allows poleward flux of tubulin and ... An experiment using time-lapse digital imaging of fluorescently labeled tubulin demonstrated that axon growth cones pause, and ...
Gary Borisy
Wells, W. A. (2005). "The discovery of tubulin". The Journal of Cell Biology. 169 (4): 552. doi:10.1083/jcb1694fta1. PMC ... characterizing tubulin and its role in cell division. He then did a postdoc at the Medical Research Council Laboratory of ...
Edwin W. Taylor
His work in the laboratory not only led to his discovery of tubulin, the protein subunit of microtubules, but it also developed ... This led to his discovery of tubulin, the protein subunit of microtubules, and to the first kinetic model explaining how these ... After the introduction of tubulin, Taylor was conflicted on what moves the chromosomes and what caused the motile system to ... Crasta, Karen; Aneja, Ritu (September 2017). "50 years on … the discovery of tubulin continues to advance cancer treatment". ...
Pericentriolar material
The PCM contains proteins responsible for microtubule nucleation and anchoring including γ-tubulin, pericentrin and ninein. ... Eddé, B.; Rossier; Le Caer; Desbruyères; Gros; Denoulet (1990). "Posttranslational glutamylation of alpha-tubulin". Science. ... Tubulin epsilon chain PCNT, pericentrin, a matrix scaffold protein CDK5RAP2, cyclin dependant kinase receptor associated ... protein 2, binds gTubRCs that nucleate microtubules NEDD1, binds gTubRCs that stabilise microtubules Gamma Tubulin, nucleates ...
ETV6
"TTL tubulin tyrosine ligase (human)". Entrez Gene. "CHIC2 cysteine rich hydrophobic domain 2 (human)". Entrez Gene. "MDS2 ... adds and removes tyrosine residues on α-tubulin), GOT1 (an Aspartate transaminase), and ACSL6 (a Long-chain-fatty-acid-CoA ...
TUBA4B
"Entrez Gene: Tubulin alpha 4b". Retrieved 2017-02-15. v t e (Genes on human chromosome 2, All stub articles, Human chromosome 2 ... Tubulin alpha 4b is a protein that in humans is encoded by the TUBA4B gene. GRCh38: Ensembl release 89: ENSG00000243910 - ...
Post-translational modification
See tubulin polyglutamylase) polyglycylation, covalent linkage of one to more than 40 glycine residues to the tubulin C- ... covalent linkage of glutamic acid residues to the N-terminus of tubulin and some other proteins. ( ... "Posttranslational glutamylation of alpha-tubulin". Science. 247 (4938): 83-5. Bibcode:1990Sci...247...83E. doi:10.1126/science. ...
Centriole
In cell biology a centriole is a cylindrical organelle composed mainly of a protein called tubulin. Centrioles are found in ... "Posttranslational glutamylation of alpha-tubulin". Science. 247 (4938): 83-5. Bibcode:1990Sci...247...83E. doi:10.1126/science. ...
TUBG1
Tubulin, gamma 1 is a protein in humans that is encoded by the TUBG1 gene. This gene encodes a member of the tubulin ... "Entrez Gene: Tubulin, gamma 1". Zhang X, Chen Q, Feng J, Hou J, Yang F, Liu J, Jiang Q, Zhang C (July 2009). "Sequential ... gamma-tubulin in atypical ductal hyperplasia and carcinoma of the breast". Cancer Science. 100 (4): 580-7. doi:10.1111/j.1349- ... "A direct interaction with NEDD1 regulates gamma-tubulin recruitment to the centrosome". PLOS ONE. 5 (3): e9618. doi:10.1371/ ...
Centrosome
For instance, their capacity to incorporate γ-TuRC complexes (see also: γ-tubulin) can be very variable, and so their capacity ... Eddé, B.; Rossier; Le Caer; Desbruyères; Gros; Denoulet (1990). "Posttranslational glutamylation of alpha-tubulin". Science. ... including γ-tubulin, pericentrin and ninein. In general, each centriole of the centrosome is based on a nine-triplet ...
TUBE1
Chang P, Stearns T (January 2000). "Delta-tubulin and epsilon-tubulin: two new human centrosomal tubulins reveal new aspects of ... Tubulin, epsilon 1 is a protein in humans that is encoded by the TUBE1 gene. This gene encodes a member of the tubulin ... "Entrez Gene: Tubulin, epsilon 1". Chang P, Giddings TH, Winey M, Stearns T (January 2003). "Epsilon-tubulin is required for ... Zanic M, Stear JH, Hyman AA, Howard J (October 2009). May RC (ed.). "EB1 recognizes the nucleotide state of tubulin in the ...
TUBB
"Entrez Gene: TUBB tubulin, beta". Goo YH, Sohn YC, Kim DH, Kim SW, Kang MJ, Jung DJ, Kwak E, Barlev NA, Berger SL, Chow VT, ... Tubulin beta chain is a protein that in humans is encoded by the TUBB gene. TUBB has been shown to interact with NCOA6 and SYT9 ... Volz A, Weiss E, Trowsdale J, Ziegler A (Jan 1994). "Presence of an expressed beta-tubulin gene (TUBB) in the HLA class I ... Lee MG, Lewis SA, Wilde CD, Cowan NJ (Jun 1983). "Evolutionary history of a multigene family: an expressed human beta-tubulin ...
TUBD1
Chang P, Stearns T (January 2000). "Delta-tubulin and epsilon-tubulin: two new human centrosomal tubulins reveal new aspects of ... "Entrez Gene: Tubulin, delta 1". Krebs DL, Uren RT, Metcalf D, Rakar S, Zhang JG, Starr R, De Souza DP, Hanzinikolas K, Eyles J ... Tubulin, delta 1 is a protein in humans that is encoded by the TUBD1 gene. GRCh38: Ensembl release 89: ENSG00000108423 - ... Kato A, Nagata Y, Todokoro K (May 2004). "Delta-tubulin is a component of intercellular bridges and both the early and mature ...
Spasmodic dysphonia
This gene encodes a tubulin gene. The pathophysiology of this condition has yet to be determined. There are a number of ...
TTBK2
Tau tubulin kinase 2 is a protein in humans that is encoded by the TTBK2 gene. This gene encodes a serine-threonine kinase that ... "Entrez Gene: Tau tubulin kinase 2". Retrieved 2012-06-11. Houlden H, Johnson J, Gardner-Thorpe C, Lashley T, Hernandez D, Worth ... purification and crystallization of a human tau-tubulin kinase 2 that phosphorylates tau protein". Acta Crystallographica ... putatively phosphorylates tau and tubulin proteins. Mutations in this gene cause spinocerebellar ataxia type 11 (SCA11); a ...
tubulin complex | SGD
TBCD tubulin folding cofactor D [Homo sapiens (human)] - Gene - NCBI
TFCD_C; Tubulin folding cofactor D C terminal. cl19887. Location:63 → 914. TFCD_C; Tubulin folding cofactor D C terminal. ... TFCD_C; Tubulin folding cofactor D C terminal. cl19887. Location:63 → 887. TFCD_C; Tubulin folding cofactor D C terminal. ... TFCD_C; Tubulin folding cofactor D C terminal. cl19887. Location:63 → 795. TFCD_C; Tubulin folding cofactor D C terminal. ... TFCD_C; Tubulin folding cofactor D C terminal. cl19887. Location:342 → 897. TFCD_C; Tubulin folding cofactor D C terminal. ...
Tubulin News, Articles | The Scientist Magazine®
Anti-gamma Tubulin antibody (ab11317) | Abcam
Rabbit polyclonal gamma Tubulin antibody. Validated in WB, ICC/IF and tested in Mouse, Rat, Human, Chinese hamster. Cited in 88 ... Tubulin is the major constituent of microtubules. Gamma tubulin is found at microtubule organizing centers (MTOC) such as the ... All lanes : Anti-gamma Tubulin antibody (ab11317) at 1/1000 dilution. Lane 1 : A431 cell lysate. Lane 2 : HeLa cell lysate. ... I also see a staining that is typical to alpha and beta tubulin even if it is written on the data sheet it is not suppose to ...
Posttranslational Glutamylation of α-Tubulin - NASA/ADS
... localized within a region of α-tubulin that is important in the interactions of tubulin with microtubule-associated proteins ... Several variants of α-tubulin can be posttranslationally labeled after incubation of cells with [^3H]acetate or [^3H]glutamate ... The high degree of tubulin heterogeneity in neurons is controlled mainly at the posttranslational level. ... localized within a region of α-tubulin that is important in the interactions of tubulin with microtubule-associated proteins ...
Tubulin DAMA colchicine
Addgene: pmEGFP a tubulin IRES puro2b Sequences
Author sequence GATCCGCGGCCGCATAGATAACTGATCCAGTGTGCTGGAATTAATTCGCTGTCTGCGAGGGCCAGCTGTT GGGGTGAGTACTCCCTCTCAAAAGCGGGCATGACTTCTGCGCTAAGATTGTCAGTTTCCAAAAACGAGGA GGATTTGATATTCACCTGGCCCGCGGTGATGCCTTTGAGGGTGGCCGCGTCCATCTGGTCAGAAAAGACA ATCTTTTTGTTGTCAAGCTTGAGGTGTGGCAGGCTTGAGATCTGGCCATACACTTGAGTGACAATGACAT CCACTTTGCCTTTCTCTCCACAGGTGTCCACTCCCAGGTCCAACTGCAGGTCGAGCATGCATCTAGGGCG GCCAATTCCGCCCCTCTCCCTCCCCCCCCCCTAACGTTACTGGCCGAAGCCGCTTGGAATAAGGCCGGTG TGCGTTTGTCTATATGTGATTTTCCACCATATTGCCGTCTTTTGGCAATGTGAGGGCCCGGAAACCTGGC CCTGTCTTCTTGACGAGCATTCCTAGGGGTCTTTCCCCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATG TCGTGAAGGAAGCAGTTCCTCTGGAAGCTTCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCA GCGGAACCCCCCACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCACGTGTATAAGATACACCTGCAAAG GCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGGAAAGAGTCAAATGGCTCTCCTCAAGCG TATTCAACAAGGGGCTGAAGGATGCCCAGAAGGTACCCCATTGTATGGGATCTGATCTGGGGCCTCGGTG CACATGCTTTACATGTGTTTAGTCGAGGTTAAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTT TTCCTTTGAAAAACACGATGATAAGCTTGCCACAACCCACAAGGAGACGACCTTCCATGACCGAGTACAA ...
WikiGenes - TUB3 - alpha-tubulin TUB3
Even the modest excess of beta-tubulin produced by genetic alterations such as deletion of the minor alpha-tubulin gene TUB3 ... Insertions of up to 17 amino acids into a region of alpha-tubulin do not disrupt function in vivo. Schatz, P.J., Georges, G.E ... The two alpha-tubulin isotypes in budding yeast have opposing effects on microtubule dynamics in vitro. Bode, C.J., Gupta, M.L ... Modulation of tubulin polypeptide ratios by the yeast protein Pac10p. Alvarez, P., Smith, A., Fleming, J., Solomon, F. Genetics ...
beta Tubulin Polyclonal Antibody (PA1-16947)
Tau-tubulin kinase 1 phosphorylates TDP-43 at disease-relevant sites and exacerbates TDP-43 pathology - Merck.com
Method for selectively modulating the interactions between survivin and tubulin - Patent US-6346389-B1 - PubChem
Anti-α-Tubulin antibody, Mouse monoclonal clone DM1A, purified from hybridoma cell culture | Sigma-Aldrich
Anti-α-Tubulin antibody, Mouse monoclonal has been used in immunocytofluorescence and western blot analysis; Anti-α-Tubulin a ... Monoclonal Anti-α-Tubulin); monoclonal DM1A, purified from hybridoma cell culture; Suitable for immunoprecipitation (IP); ... β-tubulin isotype I +II, β-tubulin isotype III, tyrosine tubulin, and the acetylated form of α-tubulin) provide a specific and ... Tubulin is a heterodimer that consists of α-tubulin and β-tubulin. Both subunits have a molecular weight of approx. 50 kDa and ...
α 3 Tubulin Anticorpo | SCBT - Santa Cruz Biotechnology
Adquira alpha 3 tubulin anticorpos da Santa Cruz Biotecnologia, Inc. Anticorpos monoclonais estão disponíveis para a maioria ... α 1 Tubulin, α 4 Tubulin, α Tubulin, β Tubulin, β 2 Tubulin, β 3 Tubulin, δ Tubulin, ε Tubulin e γ Tubulin ... α 3 Tubulin Anticorpos e Produtos relacionados. A Santa Cruz Biotecnologia, Inc. oferece uma grande linha de α 3 Tubulin ... Selecione α 3 Tubulin anticorpos da lista de anticorpos monoclonais abaixo. Veja maiores detalhes α 3 Tubulin das ...
RCSB PDB - 1V6E: Solution Structure of a N-terminal Ubiquitin-like Domain in Mouse Tubulin-specific Chaperone B
Solution Structure of a N-terminal Ubiquitin-like Domain in Mouse Tubulin-specific Chaperone B ... Solution Structure of a N-terminal Ubiquitin-like Domain in Mouse Tubulin-specific Chaperone B. Zhao, C., Kigawa, T., Saito, K. ... Solution Structure of a N-terminal Ubiquitin-like Domain in Mouse Tubulin-specific Chaperone B. *PDB DOI: 10.2210/pdb1V6E/pdb ...
positive regulation of tubulin deacetylase activity - Ontology Report - Rat Genome Database
gamma Tubulin (TUBG1) (434-449) Mouse Monoclonal Antibody [Clone ID: TU-32] - AM03180PU-N | OriGene
gamma Tubulin (TUBG1) (434-449) mouse monoclonal antibody, clone TU-32, Aff - Purified ... is a minor member of tubulin family (less that 0.01% of tubulin dimer). The γ-tubulin ring structures, however, serve to ... which is identical for gamma-tubulin 1 and gamma-tubulin 2.. Formulation. PBS, pH~7.4 containing 15 mM Sodium Azide as ... Human gamma-Tubulin peptide, amino acids 434-449. Specificity. The antibody TU-32 recognizes C-terminus (amino acids 434-449 in ...
A structure-based design of new C2- and C13-substituted taxanes: tubulin binding affinities and extended quantitative structure...
... at the C2 and C13 positions of the baccatin core have been synthesized and their binding affinities for mammalian tubulin have ... The tubulin-binding affinity displayed by one of the new compounds (CTX63) proved to be higher than that of docetaxel. , and an ... and oxygen probes within the taxane-binding site of β-tubulin, and (ii) the prospective use of a structure-based QSAR (COMBINE ... Our results shed additional light on the determinants of tubulin-binding affinity for this important class of antitumour agents ...
Nuclear localization of {gamma}-tubulin affects E2F transcriptional activity and S-phase progression.<...
γ-Tubulin mutants showed that the C terminus interacts with the transcription factor E2F1 and that the E2F1-γ-tubulin complex ... γ-Tubulin mutants showed that the C terminus interacts with the transcription factor E2F1 and that the E2F1-γ-tubulin complex ... γ-Tubulin mutants showed that the C terminus interacts with the transcription factor E2F1 and that the E2F1-γ-tubulin complex ... γ-Tubulin mutants showed that the C terminus interacts with the transcription factor E2F1 and that the E2F1-γ-tubulin complex ...
Anti-Alpha Tubulin Antibody | Rabbit anti-Human Polyclonal | LSBio
Alpha Tubulin antibody LS-C336141 is an unconjugated rabbit polyclonal antibody to Alpha Tubulin from human. It is reactive ... Alpha-tubulin antibody can be used for detection of alpha-tubulin by Western blot at 0.25 - 0.5 ug/ml. Antibody can also be ... Alpha Tubulin antibody LS-C336141 is an unconjugated rabbit polyclonal antibody to Alpha Tubulin from human. It is reactive ... IHC‑plus™ Alpha Tubulin Antibody (clone DM1A) LS‑B4053 Species: Human, Monkey, Mouse, Rat, Bovine, Dog, Goat, Guinea pig, ...
Ubiquitin-Proteasome System As A Therapeutic Target: Does Tubulin Care?
... with a primary ubiquitin substrate being tubulin as ubiquitin regulates alpha/beta-tubulin turnover as well as microtubule ... especially in regard to how UPS inhibitors such as bortezomib enhance tubulin polymerization, which could underlie peripheral ... dynamics and function, though ubiquitins full regulatory control over tubulin remains unknown, ... Tubulin polymerization assay using ,99% pure tubulin, fluorescence based (Cat. # BK011P). Microtubule/Tubulin In Vivo Assay ...
β-Tubulin Recombinant monoclonal antibody (S11B) (Mouse IgG1λ) - ENZ-ABS613 - Enzo Life Sciences
Characterization of Drosophila betaTub9EF, a beta-tubulin paralog up-regulated at low temperature - Zurich Open Repository and...
One year on: Live Cell Imaging with SiR-actin, SiR-tubulin & SiR-DNA | Tebubio's blog
SiR-tubulin & SiR-DNA - what have these stains brought to researchers one year on? ... Launched just over a year ago, SiR-Actin (Fig 1) and SiR-Tubulin (Fig 2) have been available on the market providing the most ... I woul d like to take SiR-actin or SiR-tubulin as counterstain to distinguish my cell type in a co-culture system (these two ... In particular, SiR-Actin and SiR-Tubulin are the only stains available on the market which enable live cell imaging of the ...
Tau tubulin kinase 2 phosphorylations in cilia initiation | Faculty of Medicine Masaryk University | MED MUNI
Tubulins | Other protein targets | IUPHAR/BPS Guide to PHARMACOLOGY
Tubulins in the IUPHAR/BPS Guide to PHARMACOLOGY. ... TUBA3 , tubulin, alpha 1a , tubulin, alpha 1A , tubulin Genes. ... tubulin beta class I Previous and unofficial names. beta1-tubulin , TUBB5 , tubulin, beta class I , tubulin, beta 5 class I , ... These are thought to act primarily through β-tubulin, thereby interfering with the normal processes of tubulin polymer ... Tubulins C. Unless otherwise stated all data on this page refer to the human proteins. Gene information is provided for human ( ...
Abstract 5096: ALIBI: a novel, truncated tubulin isotype in AML and stem cells | Citedby Results | Cancer Research | American...
ENZYME - 3.4.17.24 tubulin-glutamate carboxypeptidase
C-terminal L-alpha-aminoacyl-L-glutamyl-L-glutamyl-[tubulin] + H2O <=> C-terminal L-alpha-aminoacyl-L-glutamyl-[tubulin] + L- ... C-terminal L-alpha-aminoacyl-L-glutamyl-[tubulin] + H2O <=> C-terminal L-alpha-aminoacyl-[tubulin] + L-glutamate ... In addition, the enzyme removes two glutamate residues from the C-terminus of beta-tubulin and detyrosinated alpha-tubulin ( ... The latter is cleaved to Delta2-tubulin and further to Delta3- tubulin. ...
EN (en)
γ-Tubulin stands up to be counted | Journal of Cell Biology | Rockefeller University Press
count the number of γ-tubulin complexes that assemble together to nucleate microtubules in S. cerevisiae. ... An extended γ-tubulin ring functions as a stable platform in microtubule nucleation. How γ-tubulin nucleates microtubules in ... In vitro, γ-TuSCs form a spiral with 13 γ-tubulin molecules per turn, which could serve as a template for the 13 tubulin ... γ-Tubulin (green) localizes to the minus end of a single microtubule (red) that has been detached from the spindle pole body. ...