AnatomyOrganismsChemicals and DrugsAnalytical, Diagnostic and Therapeutic Techniques and EquipmentPhenomena and ProcessesTechnology, Industry, Agriculture
TubulinTubulin ModulatorsMicrotubulesColchicineMicrotubule ProteinsMicrotubule-Associated ProteinsDemecolcinePodophyllotoxinStathminGuanosine TriphosphateVinblastinePaclitaxelPolymersSea UrchinsMaytansineMicroscopy, ElectronBrainPeptide SynthasesProtein BindingBiopolymersNocodazoleCattleTropoloneCiliaCytoskeletonBrain ChemistryMitosisPolyglutamic AcidKineticsSpindle ApparatusKinesinMacromolecular SubstancesChaperonin Containing TCP-1Vinca AlkaloidsAxonemeBenomylSperm TailBinding SitesSwinePhysarumAcetylationGuanosine Diphosphate
Tubulin
A microtubule subunit protein found in large quantities in mammalian brain. It has also been isolated from SPERM FLAGELLUM; CILIA; and other sources. Structurally, the protein is a dimer with a molecular weight of approximately 120,000 and a sedimentation coefficient of 5.8S. It binds to COLCHICINE; VINCRISTINE; and VINBLASTINE.
Tubulin Modulators
Agents that interact with TUBULIN to inhibit or promote polymerization of MICROTUBULES.
Microtubules
Slender, cylindrical filaments found in the cytoskeleton of plant and animal cells. They are composed of the protein TUBULIN and are influenced by TUBULIN MODULATORS.
Colchicine
A major alkaloid from Colchicum autumnale L. and found also in other Colchicum species. Its primary therapeutic use is in the treatment of gout, but it has been used also in the therapy of familial Mediterranean fever (PERIODIC DISEASE).
Microtubule Proteins
Proteins found in the microtubules.
Microtubule-Associated Proteins
High molecular weight proteins found in the MICROTUBULES of the cytoskeletal system. Under certain conditions they are required for TUBULIN assembly into the microtubules and stabilize the assembled microtubules.
Demecolcine
An alkaloid isolated from Colchicum autumnale L. and used as an antineoplastic.
Podophyllotoxin
A lignan (LIGNANS) found in PODOPHYLLIN resin from the roots of PODOPHYLLUM plants. It is a potent spindle poison, toxic if taken internally, and has been used as a cathartic. It is very irritating to skin and mucous membranes, has keratolytic actions, has been used to treat warts and keratoses, and may have antineoplastic properties, as do some of its congeners and derivatives.
Stathmin
A ubiquitous phosphoprotein that serves as an intracellular substrate for a variety of SIGNAL TRANSDUCTION PATHWAYS. PHOSPHORYLATION of stathmin occurs during CELL CYCLE progression, and stathmin functions as a microtubule-destabilizing protein that promotes MICROTUBULE depolymerization during INTERPHASE and late MITOSIS. Stathmin is expressed at very high levels in a variety of human CANCERS.
Guanosine Triphosphate
Guanosine 5'-(tetrahydrogen triphosphate). A guanine nucleotide containing three phosphate groups esterified to the sugar moiety.
Vinblastine
Antitumor alkaloid isolated from Vinca rosea. (Merck, 11th ed.)
Paclitaxel
A cyclodecane isolated from the bark of the Pacific yew tree, TAXUS BREVIFOLIA. It stabilizes MICROTUBULES in their polymerized form leading to cell death.
Polymers
Compounds formed by the joining of smaller, usually repeating, units linked by covalent bonds. These compounds often form large macromolecules (e.g., BIOPOLYMERS; PLASTICS).
Sea Urchins
Somewhat flattened, globular echinoderms, having thin, brittle shells of calcareous plates. They are useful models for studying FERTILIZATION and EMBRYO DEVELOPMENT.
Maytansine
An ansa macrolide isolated from the MAYTENUS genus of East African shrubs.
Microscopy, Electron
Microscopy using an electron beam, instead of light, to visualize the sample, thereby allowing much greater magnification. The interactions of ELECTRONS with specimens are used to provide information about the fine structure of that specimen. In TRANSMISSION ELECTRON MICROSCOPY the reactions of the electrons that are transmitted through the specimen are imaged. In SCANNING ELECTRON MICROSCOPY an electron beam falls at a non-normal angle on the specimen and the image is derived from the reactions occurring above the plane of the specimen.
Brain
The part of CENTRAL NERVOUS SYSTEM that is contained within the skull (CRANIUM). Arising from the NEURAL TUBE, the embryonic brain is comprised of three major parts including PROSENCEPHALON (the forebrain); MESENCEPHALON (the midbrain); and RHOMBENCEPHALON (the hindbrain). The developed brain consists of CEREBRUM; CEREBELLUM; and other structures in the BRAIN STEM.
Peptide Synthases
Ligases that catalyze the joining of adjacent AMINO ACIDS by the formation of carbon-nitrogen bonds between their carboxylic acid groups and amine groups.
Protein Binding
The process in which substances, either endogenous or exogenous, bind to proteins, peptides, enzymes, protein precursors, or allied compounds. Specific protein-binding measures are often used as assays in diagnostic assessments.
Biopolymers
Polymers synthesized by living organisms. They play a role in the formation of macromolecular structures and are synthesized via the covalent linkage of biological molecules, especially AMINO ACIDS; NUCLEOTIDES; and CARBOHYDRATES.
Nocodazole
Nocodazole is an antineoplastic agent which exerts its effect by depolymerizing microtubules.
Cattle
Domesticated bovine animals of the genus Bos, usually kept on a farm or ranch and used for the production of meat or dairy products or for heavy labor.
Tropolone
A seven-membered aromatic ring compound. It is structurally related to a number of naturally occurring antifungal compounds (ANTIFUNGAL AGENTS).
Cilia
Populations of thin, motile processes found covering the surface of ciliates (CILIOPHORA) or the free surface of the cells making up ciliated EPITHELIUM. Each cilium arises from a basic granule in the superficial layer of CYTOPLASM. The movement of cilia propels ciliates through the liquid in which they live. The movement of cilia on a ciliated epithelium serves to propel a surface layer of mucus or fluid. (King & Stansfield, A Dictionary of Genetics, 4th ed)
Cytoskeleton
The network of filaments, tubules, and interconnecting filamentous bridges which give shape, structure, and organization to the cytoplasm.
Brain Chemistry
Changes in the amounts of various chemicals (neurotransmitters, receptors, enzymes, and other metabolites) specific to the area of the central nervous system contained within the head. These are monitored over time, during sensory stimulation, or under different disease states.
Mitosis
A type of CELL NUCLEUS division by means of which the two daughter nuclei normally receive identical complements of the number of CHROMOSOMES of the somatic cells of the species.
Polyglutamic Acid
A peptide that is a homopolymer of glutamic acid.
Kinetics
The rate dynamics in chemical or physical systems.
Spindle Apparatus
A microtubule structure that forms during CELL DIVISION. It consists of two SPINDLE POLES, and sets of MICROTUBULES that may include the astral microtubules, the polar microtubules, and the kinetochore microtubules.
Kinesin
A microtubule-associated mechanical adenosine triphosphatase, that uses the energy of ATP hydrolysis to move organelles along microtubules toward the plus end of the microtubule. The protein is found in squid axoplasm, optic lobes, and in bovine brain. Bovine kinesin is a heterotetramer composed of two heavy (120 kDa) and two light (62 kDa) chains. EC 3.6.1.-.
Macromolecular Substances
Compounds and molecular complexes that consist of very large numbers of atoms and are generally over 500 kDa in size. In biological systems macromolecular substances usually can be visualized using ELECTRON MICROSCOPY and are distinguished from ORGANELLES by the lack of a membrane structure.
Chaperonin Containing TCP-1
A group II chaperonin found in eukaryotic CYTOSOL. It is comprised of eight subunits with each subunit encoded by a separate gene. This chaperonin is named after one of its subunits which is a T-COMPLEX REGION-encoded polypeptide.
Vinca Alkaloids
A group of indole-indoline dimers which are ALKALOIDS obtained from the VINCA genus of plants. They inhibit polymerization of TUBULIN into MICROTUBULES thus blocking spindle formation and arresting cells in METAPHASE. They are some of the most useful ANTINEOPLASTIC AGENTS.
Axoneme
A bundle of MICROTUBULES and MICROTUBULE-ASSOCIATED PROTEINS forming the core of each CILIUM or FLAGELLUM. In most eukaryotic cilia or flagella, an axoneme shaft has 20 microtubules arranged in nine doublets and two singlets.
Benomyl
A systemic agricultural fungicide used for control of certain fungal diseases of stone fruit.
Sperm Tail
The posterior filiform portion of the spermatozoon (SPERMATOZOA) that provides sperm motility.
Binding Sites
The parts of a macromolecule that directly participate in its specific combination with another molecule.
Swine
Any of various animals that constitute the family Suidae and comprise stout-bodied, short-legged omnivorous mammals with thick skin, usually covered with coarse bristles, a rather long mobile snout, and small tail. Included are the genera Babyrousa, Phacochoerus (wart hogs), and Sus, the latter containing the domestic pig (see SUS SCROFA).
Physarum
A genus of protozoa, formerly also considered a fungus. Characteristics include the presence of violet to brown spores.
Acetylation
Formation of an acetyl derivative. (Stedman, 25th ed)
Guanosine Diphosphate
A guanine nucleotide containing two phosphate groups esterified to the sugar moiety.

Mammalian staufen is a double-stranded-RNA- and tubulin-binding protein which localizes to the rough endoplasmic reticulum. (1/5514)

Staufen (Stau) is a double-stranded RNA (dsRNA)-binding protein involved in mRNA transport and localization in Drosophila. To understand the molecular mechanisms of mRNA transport in mammals, we cloned human (hStau) and mouse (mStau) staufen cDNAs. In humans, four transcripts arise by differential splicing of the Stau gene and code for two proteins with different N-terminal extremities. In vitro, hStau and mStau bind dsRNA via each of two full-length dsRNA-binding domains and tubulin via a region similar to the microtubule-binding domain of MAP-1B, suggesting that Stau cross-links cytoskeletal and RNA components. Immunofluorescent double labeling of transfected mammalian cells revealed that Stau is localized to the rough endoplasmic reticulum (RER), implicating this RNA-binding protein in mRNA targeting to the RER, perhaps via a multistep process involving microtubules. These results are the first demonstration of the association of an RNA-binding protein in addition to ribosomal proteins, with the RER, implicating this class of proteins in the transport of RNA to its site of translation.  (+info)

Mutations of oncoprotein 18/stathmin identify tubulin-directed regulatory activities distinct from tubulin association. (2/5514)

Oncoprotein 18/stathmin (Op18) is a recently identified phosphorylation-responsive regulator of the microtubule (MT) system. It was originally proposed that Op18 specifically regulates dynamic properties of MTs by associating with tubulin, but it has subsequently been proposed that Op18 acts simply by sequestering of tubulin heterodimers. We have dissected the mechanistic action of Op18 by generation of two distinct classes of mutants. One class has interruptions of the heptad repeats of a potential coiled-coil region of Op18, and the other involves substitution at all four phosphorylation sites with negatively charged Glu residues. Both types of mutation result in Op18 proteins with a limited decrease in tubulin complex formation. However, the MT-destabilizing activities of the coiled-coil mutants are more severely reduced in transfected leukemia cells than those of the Glu-substituted Op18 derivative, providing evidence for tubulin-directed regulatory activities distinct from tubulin complex formation. Analysis of Op18-mediated regulation of tubulin GTPase activity and taxol-promoted tubulin polymerization showed that while wild-type and Glu-substituted Op18 derivatives are active, the coiled-coil mutants are essentially inactive. This suggests that Op18-tubulin contact involves structural motifs that deliver a signal of regulatory importance to the MT system.  (+info)

Gibberellic acid stabilises microtubules in maize suspension cells to cold and stimulates acetylation of alpha-tubulin. (3/5514)

Gibberellic acid is known to stabilise microtubules in plant organs against depolymerisation. We have now devised a simplified cell system for studying this. Pretreatment of a maize cell suspension with gibberellic acid for just 3 h stabilised protoplast microtubules against depolymerisation on ice. In other eukaryotes, acetylation of alpha-tubulin is known to correlate with microtubule stabilisation but this is not established in plants. By isolating the polymeric tubulin fraction from maize cytoskeletons and immunoblotting with the antibody 6-11B-1, we have demonstrated that gibberellic acid stimulates the acetylation of alpha-tubulin. This is the first demonstrated link between microtubule stabilisation and tubulin acetylation in higher plants.  (+info)

Arsenic targets tubulins to induce apoptosis in myeloid leukemia cells. (4/5514)

Arsenic exhibits a differential toxicity to cancer cells. At a high concentration (>5 microM), As2O3 causes acute necrosis in various cell lines. At a lower concentration (0.5-5 microm), it induces myeloid cell maturation and an arrest in metaphase, leading to apoptosis. As2O3-treated cells have features found with both tubulin-assembling enhancers (Taxol) and inhibitors (colchicine). Prior treatment of monomeric tubulin with As2O3 markedly inhibits GTP-induced polymerization and microtubule formation in vitro but does not destabilize GTP-induced tubulin polymers. Cross-inhibition experiments indicate that As2O3 is a noncompetitive inhibitor of GTP binding to tubulin. These observations correlate with the three-dimensional structure of beta-tubulin and suggest that the cross-linking of two vicinal cysteine residues (Cys-12 and Cys-213) by trivalent arsenic inactivates the GTP binding site. Furthermore, exogenous GTP can prevent As2O3-induced mitotic arrest.  (+info)

Identification of a domain in guanylyl cyclase-activating protein 1 that interacts with a complex of guanylyl cyclase and tubulin in photoreceptors. (5/5514)

The membrane-bound guanylyl cyclase in rod photoreceptors is activated by guanylyl cyclase-activating protein 1 (GCAP-1) at low free [Ca2+]. GCAP-1 is a Ca2+-binding protein and belongs to the superfamily of EF-hand proteins. We created an oligopeptide library of overlapping peptides that encompass the entire amino acid sequence of GCAP-1. Peptides were used in competitive screening assays to identify interaction regions in GCAP-1 that directly bind the guanylyl cyclase in bovine photoreceptor cells. We found four regions in GCAP-1 that participate in regulating guanylyl cyclase. A 15-amino acid peptide located adjacent to the second EF-hand motif (Phe73-Lys87) was identified as the main interaction domain. Inhibition of GCAP-1-stimulated guanylyl cyclase activity by the peptide Phe73-Lys87 was completely relieved when an excess amount of GCAP-1 was added. An affinity column made from this peptide was able to bind a complex of photoreceptor guanylyl cyclase and tubulin. Using an anti-GCAP-1 antibody, we coimmunoprecipitated GCAP-1 with guanylyl cyclase and tubulin. Complex formation between GCAP-1 and guanylyl cyclase was observed independent of [Ca2+]. Our experiments suggest that there exists a tight association of guanylyl cyclase and tubulin in rod outer segments.  (+info)

Characterization of two related Drosophila gamma-tubulin complexes that differ in their ability to nucleate microtubules. (6/5514)

gamma-tubulin exists in two related complexes in Drosophila embryo extracts (Moritz, M., Y. Zheng, B.M. Alberts, and K. Oegema. 1998. J. Cell Biol. 142:1- 12). Here, we report the purification and characterization of both complexes that we name gamma-tubulin small complex (gammaTuSC; approximately 280,000 D) and Drosophila gammaTuRC ( approximately 2,200,000 D). In addition to gamma-tubulin, the gammaTuSC contains Dgrip84 and Dgrip91, two proteins homologous to the Spc97/98p protein family. The gammaTuSC is a structural subunit of the gammaTuRC, a larger complex containing about six additional polypeptides. Like the gammaTuRC isolated from Xenopus egg extracts (Zheng, Y., M.L. Wong, B. Alberts, and T. Mitchison. 1995. Nature. 378:578-583), the Drosophila gammaTuRC can nucleate microtubules in vitro and has an open ring structure with a diameter of 25 nm. Cryo-electron microscopy reveals a modular structure with approximately 13 radially arranged structural repeats. The gammaTuSC also nucleates microtubules, but much less efficiently than the gammaTuRC, suggesting that assembly into a larger complex enhances nucleating activity. Analysis of the nucleotide content of the gammaTuSC reveals that gamma-tubulin binds preferentially to GDP over GTP, rendering gamma-tubulin an unusual member of the tubulin superfamily.  (+info)

Genetic analysis of viable Hsp90 alleles reveals a critical role in Drosophila spermatogenesis. (7/5514)

The Hsp90 chaperone protein maintains the activities of a remarkable variety of signal transducers, but its most critical functions in the context of the whole organism are unknown. Point mutations of Hsp83 (the Drosophila Hsp90 gene) obtained in two different screens are lethal as homozygotes. We report that eight transheterozygous mutant combinations produce viable adults. All exhibit the same developmental defects: sterile males and sterile or weakly fertile females. We also report that scratch, a previously identified male-sterile mutation, is an allele of Hsp82 with a P-element insertion in the intron that reduces expression. Thus, it is a simple reduction in Hsp90 function, rather than possible altered functions in the point mutants, that leads to male sterility. As shown by light and electron microscopy, all stages of spermatogenesis involving microtubule function are affected, from early mitotic divisions to later stages of sperm maturation, individualization, and motility. Aberrant microtubules are prominent in yeast cells carrying mutations in HSP82 (the yeast Hsp90 gene), confirming that Hsp90 function is connected to microtubule dynamics and that this connection is highly conserved. A small fraction of Hsp90 copurifies with taxol-stabilized microtubule proteins in Drosophila embryo extracts, but Hsp90 does not remain associated with microtubules through repeated temperature-induced assembly and disassembly reactions. If the spermatogenesis phenotypes are due to defects in microtubule dynamics, we suggest these are indirect, reflecting a role for Hsp90 in maintaining critical signal transduction pathways and microtubule effectors, rather than a direct role in the assembly and disassembly of microtubules themselves.  (+info)

Mechanisms of action of and resistance to antitubulin agents: microtubule dynamics, drug transport, and cell death. (8/5514)

PURPOSE: To analyze the available data concerning mechanisms of action of and mechanisms of resistance to the antitubulin agents, vinca alkaloids and taxanes, and more recently described compounds. DESIGN: We conducted a review of the literature on classic and recent antitubulin agents, focusing particularly on the relationships between antitubulin agents and their intracellular target, the soluble tubulin/microtubule complex. RESULTS AND CONCLUSION: Although it is widely accepted that antitubulin agents block cell division by inhibition of the mitotic spindle, the mechanism of action of antitubulin agents on microtubules remains to be determined. The classic approach is that vinca alkaloids depolymerize microtubules, thereby increasing the soluble tubulin pool, whereas taxanes stabilize microtubules and increase the microtubular mass. More recent data suggest that both classes of agents have a similar mechanism of action, involving the inhibition of microtubule dynamics. These data suggest that vinca alkaloids and taxanes may act synergistically as antitumor agents and may be administered as combination chemotherapy in the clinic. However, enhanced myeloid and neurologic toxicity, as well as a strong dependence on the sequence of administration, presently exclude these combinations outside the context of clinical trials. Although the multidrug resistance phenotype mediated by Pgp appears to be an important mechanism of resistance to these agents, alterations of microtubule structure resulting in altered microtubule dynamics and/or altered binding of antitubulin agents may constitute a significant mechanism of drug resistance.  (+info)

Microtubule-associated proteins and microtubule-based translocators have different binding sites on tubulin molecule<...
TY - JOUR. T1 - Microtubule-associated proteins and microtubule-based translocators have different binding sites on tubulin molecule. AU - Rodionov, V. I.. AU - Gyoeva, F. K.. AU - Kashina, A. S.. AU - Kuznetsov, S. A.. AU - Gelfand, V. I.. PY - 1990/4/25. Y1 - 1990/4/25. N2 - It has been previously shown that a class of microtubule proteins, the so-called microtubule-associated proteins (MAPs), binds to the C-terminal part of tubulin subunits. We show here that microtubules composed of tubulin whose 4-kDa C-terminal domain was cleaved by subtilisin (S-microtubules) are unable to bind MAPs but can still bind the anterograde translocator protein kinesin and the retrograde translocator dynein. Binding of both motors to S-microtubules, like their binding to normal microtubules, was ATP-dependent. In addition, direct competition experiments showed that binding sites for kinesin and MAPs on the microtubule surface lattice do not overlap. Furthermore, S-microtubules stimulated the ATPase activity of ...
https://www.scholars.northwestern.edu/en/publications/microtubule-associated-proteins-and-microtubule-based-translocato
Rationalization of paclitaxel insensitivity of yeast β-tubulin and human βIII-tubulin isotype using principal component...Rationalization of paclitaxel insensitivity of yeast β-tubulin and human βIII-tubulin isotype using principal component...
The chemotherapeutic agent paclitaxel arrests cell division by binding to the hetero-dimeric protein tubulin. Subtle differences in tubulin sequences, across eukaryotes and among β-tubulin isotypes, can have profound impact on paclitaxel-tubulin binding. To capture the experimentally observed paclitaxel-resistance of human βIII tubulin isotype and yeast β-tubulin, within a common theoretical framework, we have performed structural principal component analyses of β-tubulin sequences across eukaryotes. The paclitaxel-resistance of human βIII tubulin isotype and yeast β-tubulin uniquely mapped on to the lowest two principal components, defining the paclitaxel-binding site residues of β-tubulin. The molecular mechanisms behind paclitaxel-resistance, mediated through key residues, were identified from structural consequences of characteristic mutations that confer paclitaxel-resistance. Specifically, Ala277 in βIII isotype was shown to be crucial for paclitaxel-resistance. The present analysis
https://bmcresnotes.biomedcentral.com/articles/10.1186/1756-0500-5-395/figures/6
Requirement for the β<sub>I</sub> and β<sub>IV</sub> tubulin isotypes...
TY - JOUR. T1 - Requirement for the βI and βIV tubulin isotypes in mammalian cilia. AU - Jensen-Smith, Heather C.. AU - Ludueña, Richard F.. AU - Hallworth, Richard. N1 - Copyright: Copyright 2008 Elsevier B.V., All rights reserved.. PY - 2003/7/1. Y1 - 2003/7/1. N2 - [Nielsen et al., 2001: Curr Biol 11:529-533], based on studies in Drosophila, have proposed that β tubulin in axonemal microtubules must contain a specific acidic seven amino acid sequence in its carboxyl terminus. In mammals, the two βIV isotypes (βIVa and βIVb) contain that sequence. In order to test the application of this hypothesis to mammals, we have examined the expression of β tubulin isotypes in four different ciliated tissues (trachea, ependyma, uterine tube, and testis) using isotype-specific antibodies and indirect immunofluorescence. We find that βIV tubulin is present in all ciliated cell types examined, but so is β1 tubulin. Taken together with recent studies that show that β1 and βIV tubulin are both ...
https://creighton.pure.elsevier.com/en/publications/requirement-for-the-%CE%B2subisub-and-%CE%B2subivsub-tubulin-isotypes-in-ma
The actin-MRTF-SRF transcriptional circuit controls tubulin acetylation via α-TAT1 gene expression | JCBThe actin-MRTF-SRF transcriptional circuit controls tubulin acetylation via α-TAT1 gene expression | JCB
The role of formins in microtubules is not well understood. In this study, we have investigated the mechanism by which INF2, a formin mutated in degenerative renal and neurological hereditary disorders, controls microtubule acetylation. We found that silencing of INF2 in epithelial RPE-1 cells produced a dramatic drop in tubulin acetylation, increased the G-actin/F-actin ratio, and impaired myocardin-related transcription factor (MRTF)/serum response factor (SRF)-dependent transcription, which is known to be repressed by increased levels of G-actin. The effect on tubulin acetylation was caused by the almost complete absence of α-tubulin acetyltransferase 1 (α-TAT1) messenger RNA (mRNA). Activation of the MRTF-SRF transcriptional complex restored α-TAT1 mRNA levels and tubulin acetylation. Several functional MRTF-SRF-responsive elements were consistently identified in the α-TAT1 gene. The effect of INF2 silencing on microtubule acetylation was also observed in epithelial ECV304 cells, but not ...
http://jcb.rupress.org/content/early/2018/01/09/jcb.201702157
Cell cycle regulation of tubulin RNA level, tubulin protein synthesis, and assembly of microtubules in Physarum. - Immunology
The temporal relationship between tubulin expression and the assembly of the mitotic spindle microtubules has been investigated during the naturally synchronous cell cycle of the Physarum plasmodium. The cell cycle behavior of the tubulin isoforms was examined by two-dimensional gel electrophoresis of proteins labeled in vivo and by translation of RNA in vitro. alpha 1-, alpha 2-, beta 1-, and beta 2-tubulin synthesis increases coordinately until metaphase, and then falls, with beta 2 falling more rapidly than beta 1. Nucleic acid hybridization demonstrated that alpha- and beta-tubulin RNAs accumulate coordinately during G2, peaking at metaphase. Quantitative analysis demonstrated that alpha-tubulin RNA increases with apparent exponential kinetics, peaking with an increase over the basal level of greater than 40-fold. After metaphase, tubulin RNA levels fall exponentially, with a short half-life (19 min). Electron microscopic analysis of the plasmodium showed that the accumulation of tubulin RNA begins
https://www.immunology.ox.ac.uk/publications/8259
Two Drosophila beta tubulin isoforms are not functionally equivalent. | JCBTwo Drosophila beta tubulin isoforms are not functionally equivalent. | JCB
We have tested the functional capacity of different beta tubulin isoforms in vivo by expressing beta 3-tubulin either in place of or in addition to beta 2-tubulin in the male germ line of Drosophila melanogaster. The testes-specific isoform, beta 2, is conserved relative to major metazoan beta tubulins, while the developmentally regulated isoform, beta 3, is considerably divergent in sequence. beta 3-tubulin is normally expressed in discrete subsets of cells at specific times during development, but is not expressed in the male germ line. beta 2-Tubulin is normally expressed only in the postmitotic germ cells of the testis, and is required for all microtubule-based functions in these cells. The normal functions of beta 2-tubulin include assembly of meiotic spindles, axonemes, and at least two classes of cytoplasmic microtubules, including those associated with the differentiating mitochondrial derivatives. A hybrid gene was constructed in which 5 sequences from the beta 2 gene were joined to ...
http://jcb.rupress.org/content/111/3/1009
Tubulin alpha-4A chainTubulin alpha-4A chain
Microtubules of the eukaryotic cytoskeleton perform essential and diverse functions and are composed of a heterodimer of alpha and beta tubulin. The genes encoding these microtubule constituents are part of the tubulin superfamily, which is composed of six distinct families. Genes from the alpha, beta and gamma tubulin families are found in all eukaryotes. The alpha and beta tubulins represent the major components of microtubules, while gamma tubulin plays a critical role in the nucleation of microtubule assembly. There are multiple alpha and beta tubulin genes and they are highly conserved among and between species. This gene encodes an alpha tubulin that is a highly conserved homolog of a rat testis-specific alpha tubulin. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2013 ...
https://pharos.nih.gov/idg/targets/P68366
A TOG:αβ-tubulin Complex Structure Reveals Conformation-Based Mechanisms for a Microtubule Polymerase | ScienceA TOG:αβ-tubulin Complex Structure Reveals Conformation-Based Mechanisms for a Microtubule Polymerase | Science
Stu2p/XMAP215/Dis1 family proteins are evolutionarily conserved regulatory factors that use αβ-tubulin-interacting tumor overexpressed gene (TOG) domains to catalyze fast microtubule growth. Catalysis requires that these polymerases discriminate between unpolymerized and polymerized forms of αβ-tubulin, but the mechanism by which they do so has remained unclear. Here, we report the structure of the TOG1 domain from Stu2p bound to yeast αβ-tubulin. TOG1 binds αβ-tubulin in a way that excludes equivalent binding of a second TOG domain. Furthermore, TOG1 preferentially binds a curved conformation of αβ-tubulin that cannot be incorporated into microtubules, contacting α- and β-tubulin surfaces that do not participate in microtubule assembly. Conformation-selective interactions with αβ-tubulin explain how TOG-containing polymerases discriminate between unpolymerized and polymerized forms of αβ-tubulin and how they selectively recognize the growing end of the microtubule.. ...
http://science.sciencemag.org/content/337/6096/857
Patterns of tubulin isotype synthesis and usage during mitotic spindle morphogenesis in Physarum. - Oxford Neuroscience
Tubulin synthesis in the naturally synchronous plasmodium of Physarum polycephalum is a markedly periodic event restricted to the late G2 period of the cell cycle. Mitosis in the plasmodium is intranuclear, and there are no cytoplasmic microtubules at any stage of the cell cycle. We have combined a biochemical investigation of the synthesis of the plasmodial tubulin isotypes and their participation in the mitotic spindle with a microscopic study (immunofluorescence) of the development of spindle microtubules throughout the cell cycle. We have shown that all four tubulin isotypes identified in the plasmodium (alpha 1, alpha 2, beta 1 and beta 2) are present in the mitotic spindle. The stoichiometry of isotype usage in the mitotic spindle generally reflects the overall abundance of isotypes in the plasmodium as a whole: beta 2 greater than alpha 1 greater than alpha 2 greater than beta 1. We have also shown that tubulins synthesized in the G2 period of one cell cycle can be incorporated into the spindles
https://www.neuroscience.ox.ac.uk/publications/5840
Regulation of three beta-tubulin mRNAs during rat brain development. - Semantic ScholarRegulation of three beta-tubulin mRNAs during rat brain development. - Semantic Scholar
The nucleotide sequence of a complete rat brain beta-tubulin T beta 15 has been determined from three overlapping cDNA clones. The overall length of the T beta 15 sequence is 1589 bp and shows between 84.5% and 88.6% homology within the coding region as compared with chick and human beta-tubulin sequences. On the other hand, the 3-non-coding region is highly divergent. Comparison of the derived amino acid sequences from different species demonstrates that the amino acid changes are not randomly distributed, but rather there are several conserved and two highly variable regions common to beta-tubulin polypeptides from various sources. The T beta 15 sequence encodes a dominant neuronal 1.8-kb beta-tubulin mRNA species. Two other minor beta-tubulin mRNA species of 2.6 and 2.9 kb are present in rat brain. By using two synthetic oligonucleotide probes complementary to the carboxyl-terminal divergent region and to the amino-terminal conserved region, we have shown that the three mRNAs are distinct species,
https://www.semanticscholar.org/paper/Regulation-of-three-beta-tubulin-mRNAs-during-rat-Ginzburg-Teichman/759d006787b1619242b2928ccdcd8c4fde8a172e
β‐Tubulin mutations that cause severe neuropathies disrupt axonal transport | The EMBO Journal
Although TUBB3 is a neuron‐specific isoform of β‐tubulin, only about 20% of total β‐tubulin in neuronal cells is TUBB3 (Joshi and Cleveland, 1989). TUBB3(E410K) and TUBB3(D417H) mutants induce neuronal diseases in an autosomal dominant manner, meaning that only 10% of mutant tubulin can significantly induce neuronal phenotypes. How is this small amount of mutated TUBB3 able to strongly affect neurons? Because our assay used CMV and CAG promoters and unknown copy numbers of transfected vectors, we could not quantify the amount of tubulin incorporated into microtubules in our system. Nevertheless, we think our results give insights to this question. Microtubules are composed of α‐ and β‐tubulin dimers. The size of each tubulin dimer is 8 nm (Nogales et al, 1999). Our analysis showed that TUBB3(E410K) and TUBB3(D417H) were incorporated into microtubules in cells and could inhibit axonal transport (Supplementary Figure S1; Figure 8A). The inhibition of motor domain accumulation, axonal ...
http://emboj.embopress.org/content/32/10/1352
Tubulin alpha-3C/D chainTubulin alpha-3C/D chain
Microtubules of the eukaryotic cytoskeleton perform essential and diverse functions and are composed of a heterodimer of alpha and beta tubulin. The genes encoding these microtubule constituents are part of the tubulin superfamily, which is composed of six distinct families. Genes from the alpha, beta and gamma tubulin families are found in all eukaryotes. The alpha and beta tubulins represent the major components of microtubules, while gamma tubulin plays a critical role in the nucleation of microtubule assembly. There are multiple alpha and beta tubulin genes and they are highly conserved among and between species. This gene is an alpha tubulin gene that encodes a protein 99% identical to the mouse testis-specific Tuba3 and Tuba7 gene products. This gene is located in the 13q11 region, which is associated with the genetic diseases Clouston hidrotic ectodermal dysplasia and Kabuki syndrome. [provided by RefSeq, Jul 2008 ...
https://pharos.nih.gov/idg/targets/Q13748
β3 tubulin expression characterizes the differentiating mesodermal germ layer during Drosophila embryogenesis | Developmentβ3 tubulin expression characterizes the differentiating mesodermal germ layer during Drosophila embryogenesis | Development
During embryogenesis, the β3 tubulin gene of Drosophila is transcribed predominantly in the mesoderm. We have raised antibodies specific to the C-terminal domain of the β3 tubulin and analysed by immunostaining the distribution of this tubulin isotype during Drosophila embryogenesis. The protein is first detectable in the cephalic mesoderm at maximal germband extension. Shortly afterwards, β3 tubulin is expressed in single cells at identical positions of the thoracic and abdominal segments. We suggest that these cells represent muscle pioneer cells of Drosophila. During later embryonic development the somatic musculature, musculature, visceral musculature, dorsal vessel and macrophages contain β3 tubulin. In dorsalizing mutants dorsal, snail and twist, which do not form a ventral furrow during gastrulation, β3 expression is greatly reduced but not completely abolished. Our analysis shows that β3 tubulin immunostaining characterizes the differentiation of mesodermal derivatives during ...
http://dev.biologists.org/content/104/4/525
The plant Spc98p homologue colocalizes with γ-tubulin at microtubule nucleation sites and is required for microtubule...The plant Spc98p homologue colocalizes with γ-tubulin at microtubule nucleation sites and is required for microtubule...
The molecular mechanisms responsible for microtubule (MT) nucleation have not yet been identified in higher plants. Unlike other eukaryotic cells, no centrosome-like organelles are present to nucleate MT assembly. In animal cells, the centrosome functions as a microtubule-organizing center (MTOC), and in fungi, the spindle pole body (SPB) plays this role. MT nucleation is initiated by γ-tubulin ring complexes, or γ-TuRCs ( Zheng et al., 1995), which are recruited from the cytoplasm to the MTOC and activated ( Schiebel, 2000). The smallest complex unit capable of MT nucleation, the γ-tubulin small complex (γ-TuSC), was identified in yeast ( Knop and Schiebel, 1997) and in Drosophila ( Oegema et al., 1999; Gunawardane et al., 2000). The γ-TuSC, which is thought to be a γ-TuRC precursor, contains γ-tubulin, known as a universal nucleator ( Oakley, 1992) and two additional proteins, spindle pole body components Spc98p and Spc97p or their homologues. These proteins are essential for the ...
http://jcs.biologists.org/content/115/11/2423
The extended tubulin superfamily. - Oxford Neuroscience
Although most eukaryotic cells can express multiple isotypes of alphabeta-tubulin, the significance of this diversity has not always been apparent. Recent data indicate that particular alphabeta-tubulin isotypes, both genome encoded and those derived by post-translational modification, can directly influence microtubule structure and function--thus validating ideas originally proposed in the multitubulin hypothesis over 25 years ago. It has also become increasingly evident over the past year that some (but intriguingly not all) eukaryotes encode several other tubulin proteins, and to date five further members of the tubulin superfamily, gamma, delta, epsilon, zeta and eta, have been identified. Although the role of gamma-tubulin in the nucleation of microtubule assembly is now well established, far less is known about the functions of delta-, epsilon-, zeta- and eta-tubulin. Recent work has expanded our knowledge of the functions and localisation of these newer members of the tubulin superfamily, and
https://www.neuroscience.ox.ac.uk/publications/7534
Complex regulation and functional versatility of mammalian alpha- and beta-tubulin isotypes during the differentiation of...Complex regulation and functional versatility of mammalian alpha- and beta-tubulin isotypes during the differentiation of...
In the accompanying paper (Gu, W., S. A. Lewis, and N. J. Cowan. 1988. J. Cell Biol. 106: 2011-2022), we report the generation of three antisera, each of which uniquely recognizes a different mammalian alpha-tubulin isotype, plus a fourth antibody that distinguishes between microtubules containing the tyrosinated and nontyrosinated form of the only known mammalian alpha-tubulin gene product that lacks an encoded carboxy-terminal tyrosine residue. These sera, together with five sera we raised that distinguish among the known mammalian beta-tubulin isotypes, have been used to study patterns of tubulin isotype-specific expression in muscle and testis, two tissues in which characteristic developmental changes are accompanied by dramatic rearrangements in microtubule structures. As in the case of cells in culture, there is no evidence to suggest that there is subcellular sorting of different tubulin isotypes among different kinds of microtubule, even in a cell type (the developing spermatid) that ...
https://rupress.org/jcb/article/106/6/2023/28376/Complex-regulation-and-functional-versatility-of
Tubulin post-translational modifications and the construction of microtubular organelles in Trypanosoma brucei. - Immunology
We have used specific monoclonal antibodies to facilitate a study of acetylated and tyrosinated alpha-tubulin in the microtubule (MT) arrays in the Trypanosoma brucei cell. Acetylated alpha-tubulin is not solely located in the stable microtubular arrays but is present even in the ephemeral microtubules of the mitotic spindle. Moreover, there is a uniform distribution of this isoform in all arrays. Studies of flagella complexes show that acetylation is concomitant with assembly of MTs. There is no subsequent major modulation in the content of acetylated alpha-tubulin in MTs. Conversely, polymerizing flagellar MTs have a high tyrosinated alpha-tubulin content, which is subsequently reduced to a basal level at a discrete point in the cell cycle. The MTs of the intranuclear mitotic spindle appear never to contain tyrosinated alpha-tubulin, suggesting that they are actually constructed of detyrosinated alpha-tubulin or that detyrosination is extremely rapid at this time in the cell cycle. T. brucei therefore
https://www.immunology.ox.ac.uk/publications/14681
Membrane-Associated α-Tubulin Is Less Acetylated in Postmortem Prefrontal Cortex from Depressed Subjects Relative to Controls:...Membrane-Associated α-Tubulin Is Less Acetylated in Postmortem Prefrontal Cortex from Depressed Subjects Relative to Controls:...
Postmortem results presented here dovetail well with results in a cellular model revealing that increased tubulin acetylation causes the antidepressant signature response of Gαs translocation from lipid rafts (Singh et al., 2018) Current findings in postmortem brain tissue suggest that acetylation status of tubulin may be important for sequestration of Gαs in lipid rafts, as seen in depression (Donati et al., 2008). The findings lend a molecular rationale to antidepressant effects observed in HDAC6-depleted (Espallergues et al., 2012; Fukada et al., 2012; Lee et al., 2012) or pharmacological inhibitor-treated animals (Jochems et al., 2014), where increased tubulin acetylation induced behavioral effects similar to that of traditional antidepressants. While any study relying on immunodetection is subject to variability, the ability to use the comparator of acetylated to total α-tubulin lends stability to the data.. The tubulin post-translational modifications observed in postmortem brain tissue ...
https://www.jneurosci.org/node/649783.full.print
Tubulin protein (97% pure): porcine brain - Cytoskeleton, Inc.Tubulin protein (97% pure): porcine brain - Cytoskeleton, Inc.
Tubulin protein derived from Porcine brain provides a good target for drug discovery. Highly pure protein provided in lyophilized format from Cytoskeleton, Inc.
https://www.cytoskeleton.com/hts03
Helical microtubule arrays in a collection of twisting tubulin mutants of Arabidopsis thaliana | PNASHelical microtubule arrays in a collection of twisting tubulin mutants of Arabidopsis thaliana | PNAS
Screening for Arabidopsis mutants that displayed twisted growth of elongating organs and abnormal growth responses to propyzamide resulted in a large collection of dominant-negative tubulin mutants. The data presented here provide some of the strongest evidence to date showing conserved residues of both α- and β-tubulins directly contribute to the stability and helical pattern of cortical microtubule arrays.. Incorporation of mutant tubulins into the microtubule polymer suggests that the structure and/or dynamics of cortical microtubules are altered in these mutants. Many of the affected amino acid residues are located at the longitudinal interface of the α- and β-tubulins within and between the αβ-heterodimer and at the lateral interface between two adjacent protofilaments, indicating that the mutations generally affect the protein-protein interactions but not the stability or the folding of tubulin monomers. Several mutated residues, such as P325 and T439 in α-tubulin and S95 and G96 in ...
https://www.pnas.org/content/104/20/8544?ijkey=d915b5c124e4b9a1371a9a82ec981d10a17ba261&keytype2=tf_ipsecsha
Tubulin glycylases are required for primary cilia, control of cell proliferation and tumor development in colon | The EMBO...
Posttranslational modifications of tubulin are thought to fine‐tune MT functions in specific cells and tissues. Modifications that take place on the C‐terminal tails of tubulin are involved in the regulation of interactions between MTs and associated proteins (reviewed in: Janke & Bulinski, 2011). The three principal modifications found in these tail domains are detyrosination, (poly)glutamylation and (poly)glycylation. While first insights into the molecular mechanisms that are controlled by detyrosination (Peris et al, 2006, 2009; Bieling et al, 2008) and polyglutamylation (Kubo et al, 2010; Lacroix et al, 2010) have been obtained, little is known about the roles and mechanisms of glycylation.. In contrast to other tubulin modifications, glycylation has so far only been detected in motile cilia and flagella in different organisms (Bré et al, 1996). In line with this rather restricted occurrence of glycylation, only three modifying enzymes are expressed in mammals (Rogowski et al, 2009), ...
http://emboj.embopress.org/content/early/2014/09/01/embj.201488466
The TUBB1 Q43P functional polymorphism reduces the risk of cardiovascular disease in men by modulating platelet function and...The TUBB1 Q43P functional polymorphism reduces the risk of cardiovascular disease in men by modulating platelet function and...
While the heterozygous Q43P β1-tubulin carriers have a reduced function, the β1-tubulin-deficient mice present with only minor abnormalities in platelet hemostatic functions. Besides the fact that human platelets are more easy to handle and study in detail than mouse platelets, this can probably be explained by the fact that the loss of β1-tubulin expression in mouse platelets was overcome by overexpression of the other platelet β-tubulin variants,7 while the Q43P carrier platelets not only show reduced β1-tubulin but also total β-tubulin protein levels. In addition, incorporation of GFP-tagged Q43P β1-tubulin into wild-type tubulin structures seems to be inefficient and delocalized.. Due to the platelet dysfunction phenotype, the Q43P β1-tubulin variant could not only be conceived as a genetic risk factor for the development of thrombocytopenia but also as a protective genetic factor against cardiovascular disease. Indeed, a case-control study showed that the prevalence of Q43P ...
http://www.bloodjournal.org/content/106/7/2356.long?sso-checked=true
Microtubule nucleation - wikidocMicrotubule nucleation - wikidoc
Microtubules are filaments of the cytoskeleton. They typically form through the polymerization of α- and β-tubulin dimers elongating existing microtubules. The de novo formation of microtubules requires an initiation event called microtubule nucleation. Microtubule nucleation requires the action of a third type of tubulin, γ-tubulin, which is distinct from the α and β subunits which compose the microtubules themselves. The γ-tubulin combines with several other associated proteins to form a circular structure known as the γ-tubulin ring complex (γ-TuRC). This complex acts as a scaffold for α/β tubulin dimers to begin polymerization. It also acts as a cap of the (−) end while microtubule growth continues towards the (+) direction. The γ-TuRC is typically found as the core functional unit in a microtubule organizing center (MTOC), such as the centrosome in animal cells or the spindle pole bodies in fungi and algae. However, the cells of higher plants for example lack distinct MTOCs and ...
https://www.wikidoc.org/index.php/Microtubule_nucleation
Alpha-tubulin 3C - WikipediaAlpha-tubulin 3C - Wikipedia
Microtubules of the eukaryotic cytoskeleton perform essential and diverse functions and are composed of a heterodimer of alpha and beta tubulin. The genes encoding these microtubule constituents are part of the tubulin superfamily, which is composed of six distinct families. Genes from the alpha, beta and gamma tubulin families are found in all eukaryotes. The alpha and beta tubulins represent the major components of microtubules, while gamma tubulin plays a critical role in the nucleation of microtubule assembly. There are multiple alpha and beta tubulin genes and they are highly conserved among and between species. This gene is an alpha tubulin gene that encodes a protein 99% to the mouse testis-specific Tuba3 and Tuba7 gene products. This gene is located in the 13q11 region, which is associated with the genetic diseases Clouston hidrotic ectodermal dysplasia and Kabuki syndrome. Alternative splicing has been observed for this gene and two variants have been identified.[4] ...
https://en.wikipedia.org/wiki/TUBA3C
Deubiquitination of γ-tubulin by BAP1 prevents chromosome instability in breast cancer cells. - Semantic ScholarDeubiquitination of γ-tubulin by BAP1 prevents chromosome instability in breast cancer cells. - Semantic Scholar
Microtubule nucleation requires the γ-tubulin ring complex, and during the M-phase (mitosis) this complex accumulates at the centrosome to support mitotic spindle formation. The posttranslational modification of γ-tubulin through ubiquitination is vital for regulating microtubule nucleation and centrosome duplication. Blocking the BRCA1/BARD1-dependent ubiquitination of γ-tubulin causes centrosome amplification. In the current study, we identified BRCA1-associated protein-1 (BAP1) as a deubiquitination enzyme for γ-tubulin. BAP1 was downregulated in metastatic adenocarcinoma breast cell lines compared with noncancerous human breast epithelial cells. Furthermore, low expression of BAP1 was associated with reduced overall survival of patients with breast cancer. Reduced expression of BAP1 in breast cancer cell lines was associated with mitotic abnormalities. Importantly, rescue experiments including expression of full length but not the catalytic mutant of BAP1 reduced ubiquitination of γ-tubulin and
https://www.semanticscholar.org/paper/Deubiquitination-of-%CE%B3-tubulin-by-BAP1-prevents-chr-Zarrizi-Menard/e68b2bc8c397f6d62be1d43206cc023e85d00bb8
βPix-d promotes tubulin acetylation and neurite outgrowth through a PAK/Stathmin1 signaling pathway<...
TY - JOUR. T1 - βPix-d promotes tubulin acetylation and neurite outgrowth through a PAK/Stathmin1 signaling pathway. AU - Kwon, Younghee. AU - Jeon, Ye Won. AU - Kwon, Minjae. AU - Cho, Yongcheol. AU - Park, Dongeun. AU - Shin, Jung Eun. PY - 2020. Y1 - 2020. N2 - Microtubules are a major cytoskeletal component of neurites, and the regulation of microtubule stability is essential for neurite morphogenesis. βPix (ARHGEF7) is a guanine nucleotide exchange factor for the small GTPases Rac1 and Cdc42, which modulate the organization of actin filaments and microtubules. βPix is expressed as alternatively spliced variants, including the ubiquitous isoform βPix-a and the neuronal isoforms βPix-b and βPix-d, but the function of the neuronal isoforms remains unclear. Here, we reveal the novel role of βPix neuronal isoforms in regulating tubulin acetylation and neurite outgrowth. At DIV4, hippocampal neurons cultured from βPix neuronal isoform knockout (βPix-NIKO) mice exhibit defects in neurite ...
https://koreauniv.pure.elsevier.com/en/publications/%CE%B2pix-d-promotes-tubulin-acetylation-and-neurite-outgrowth-through
The where, when and how of microtubule nucleation - one ring to rule them all | Journal of Cell ScienceThe where, when and how of microtubule nucleation - one ring to rule them all | Journal of Cell Science
The function of microtubules depends on their arrangement into highly ordered arrays. Spatio-temporal control over the formation of new microtubules and regulation of their properties are central to the organization of these arrays. The nucleation of new microtubules requires γ-tubulin, an essential protein that assembles into multi-subunit complexes and is found in all eukaryotic organisms. However, the way in which γ-tubulin complexes are regulated and how this affects nucleation and, potentially, microtubule behavior, is poorly understood. γ-tubulin has been found in complexes of various sizes but several lines of evidence suggest that only large, ring-shaped complexes function as efficient microtubule nucleators. Human γ-tubulin ring complexes (γTuRCs) are composed of γ-tubulin and the γ-tubulin complex components (GCPs) 2, 3, 4, 5 and 6, which are members of a conserved protein family. Recent work has identified additional unrelated γTuRC subunits, as well as a large number of more ...
http://jcs.biologists.org/content/early/2012/11/06/jcs.106971
Antievolution.org - Antievolution.org Discussion Board -Topic::Telic Thoughts ThreadAntievolution.org - Antievolution.org Discussion Board -Topic::Telic Thoughts Thread
MTs are cylindrical polymers 25 nanometers (nm = 10-9 meter) in diameter, comprised of 13 longitudinal protofilaments which are each chains of the protein tubulin (Figure 8). Each tubulin is a peanut-shaped dimer (8 nm by 4 nm by 5 nm) which consists of two slightly different monomers known as alpha and beta tubulin, (each 4 nm by 4 nm by 5 nm, weighing 55,000 daltons). Tubulin subunits within MTs are arranged in a hexagonal lattice which is slightly twisted, resulting in differing neighbor relationships among each subunit and its six nearest neighbors (Figure 9). Thus pathways along contiguous tubulins form helical pathways which repeat every 3, 5 and 8 rows (the Fibonacci series). Alpha tubulin monomers are more negatively charged than beta monomers, so each tubulin (and each MT as a whole) is a ferroelectric dipole with positive (beta monomer) and negative (alpha monomer) ends.[xxiii ...
http://www.antievolution.org/cgi-bin/ikonboard/ikonboard.cgi?s=50aaaf4940c5fa8c
A novel polymer of tubulin forms the conoid of Toxoplasma gondii | Journal of Cell Biology | Rockefeller University PressA novel polymer of tubulin forms the conoid of Toxoplasma gondii | Journal of Cell Biology | Rockefeller University Press
Along the length of the conoid fibers, tubulin molecules are spaced 4 nm apart, just as in microtubules. It seems probable that conoid protofilaments exhibit parallel, as opposed to antiparallel, orientation (implying that the fiber as a whole is a polar structure) as has been observed in all naturally occurring tubulin polymers, but the signal-to-noise ratio in images of conoid fibers obtained to date is too low to confirm this supposition. However, the lack of circular symmetry in cross-section means that the lateral association of protofilaments in conoid fibers must be quite different from microtubules. The noncircular cross-sectional profile implies that the bonds between adjacent protofilaments are very different at one end of the comma compared to the other: adjacent protofilaments at the curved end must be rotated by ∼30° with respect to each other (similar to the 360/13 = 27.7 degrees in a canonical 13 protofilament microtubule), whereas adjacent protofilaments at the tail of the ...
https://rupress.org/jcb/article/156/6/1039/1113/A-novel-polymer-of-tubulin-forms-the-conoid-of
Neoblast data search
Mlig034227.g3 {REF} {Length: 2733} {Pfam: Tubulin/FtsZ family, GTPase domain [PF00091.25, score=231.9]; Tubulin C-terminal domain [PF03953.17, score=146.9]; Misato Segment II tubulin-like domain [PF10644.9, score=25.7]} {Human: ENSG00000188229, TUBB4B, tubulin beta 4B class IVb, [RH, Score=920, Expect=0.0]; ENSG00000137285, TUBB2B, tubulin beta 2B class IIb, [RH, Score=908, Expect=0.0]; ENSG00000104833, TUBB4A, tubulin beta 4A class IVa, [RH, Score=905, Expect=0.0]; ENSG00000232575, TUBB, tubulin beta class I, [RH, Score=903, Expect=0.0]; ENSG00000196230, TUBB, tubulin beta class I, [RH, Score=903, Expect=0.0]; ENSG00000183311, TUBB, tubulin beta class I, [RH, Score=903, Expect=0.0]; ENSG00000227739, TUBB, tubulin beta class I, [RH, Score=903, Expect=0.0]; ENSG00000235067, TUBB, tubulin beta class I, [RH, Score=903, Expect=0.0]; ENSG00000229684, TUBB, tubulin beta class I, [RH, Score=903, Expect=0.0]; ENSG00000137267, TUBB2A, tubulin beta 2A class IIa, [RH, Score=903, Expect=0.0]; ...
http://neoblast451.macgenome.org/searchgene?gc=35
anti-beta Tubulin antibody | GeneTexanti-beta Tubulin antibody | GeneTex
beta Tubulin antibody (tubulin, beta) for ICC/IF, IHC-P, WB. Anti-beta Tubulin pAb (GTX101279) is tested in Human, Mouse, Rat, Hamster samples. 100% Ab-Assurance.
http://www.genetex.com/beta-Tubulin-antibody-GTX101279.html
anti-beta Tubulin antibody | GeneTexanti-beta Tubulin antibody | GeneTex
beta Tubulin antibody (tubulin, beta) for ICC/IF, IHC-P, WB. Anti-beta Tubulin pAb (GTX112659) is tested in Human, Mouse samples. 100% Ab-Assurance.
http://www.genetex.com/beta-Tubulin-antibody-GTX112659.html
Preparation of Tubulin from Brain<...Preparation of Tubulin from Brain<...
TY - JOUR. T1 - Preparation of Tubulin from Brain. AU - Williams, Robley C.. AU - Lee, James C.. PY - 1982/1/1. Y1 - 1982/1/1. N2 - This chapter presents procedure for preparation of tubulin from brain. Two methods for preparing tubulin is presented (a) purification by cycles of assembly and disassembly followed by chromatography on phospbocellulose (b) purification by the modified Weisenberg procedure, each of which yields several hundred milligrams of purified protein. The principal properties of the tubulin prepared by the two methods appear to be identical and a choice of one route or the other can be made on the basis of available apparatus or of the investigators familiarity with the manipulations involved. The tubulin that results from either preparation is substantially free of microtubule-associated proteins. The protein concentration of the solution is determined spectrophotometrically in 6 M guanidine hydrochloride at 275 nm with an absorptivity value of 1.03 ml/(mg cm). It is then ...
https://researchexperts.utmb.edu/en/publications/preparation-of-tubulin-from-brain
gamma tubulin Antibody 66320-1-Ig | Proteintechgamma tubulin Antibody 66320-1-Ig | Proteintech
gamma tubulin Antibody 66320-1-Ig has been identified with ELISA, IF, IHC, WB. 66320-1-Ig detected 48-55 kDa band in NCCIT, HepG2, HSCT6, NIH/3T3 cell with 1:1000-1:8000 dilution...
https://www.ptglab.com/Products/tubulin-gamma-Antibody-66320-1-Ig.htm
Mutagenetix > Incidental...Mutagenetix > Incidental...
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta tubulin protein family. Beta tubulins are one of two core protein families (alpha and beta tubulins) that heterodimerize and assemble to form microtubules. This protein is specifically expressed in platelets and megakaryocytes and may be involved in proplatelet production and platelet release. A mutations in this gene is associated with autosomal dominant macrothrombocytopenia. Two pseudogenes of this gene are found on chromosome Y.[provided by RefSeq, Jul 2010 ...
https://mutagenetix.utsouthwestern.edu/incidental/incidental_rec.cfm?mid=178923
Tubulin protein (fluorescent HiLyte 647): porcine brain - Cytoskeleton, Inc.Tubulin protein (fluorescent HiLyte 647): porcine brain - Cytoskeleton, Inc.
HiLyte 647 labeled tubulin is used for studying microtubule dynamics in live cells. Offered at |99% purity and lyophilized format. Multiple sizes and bulk discounts available.
https://www.cytoskeleton.com/tubulins/live-cell-imaging-tubulin/tl670m
Bio-Rad Rat anti Tubulin Alpha | Announcement | LabX Ad 4057299Bio-Rad Rat anti Tubulin Alpha | Announcement | LabX Ad 4057299
Rat anti Tubulin alpha antibody, clone YL1/2 recognizes the alpha subunit of tubulin, specifically binding tyrosylated Tubulin (Tyr-Tubulin) (Wehland
http://www.labx.com/item/bio-rad-rat-anti-tubulin-alpha/4057299
Aggregator | pharmamatrix.ca
The cardinal role of microtubules in cell mitosis makes them interesting drug targets for many pharmacological treatments, including those against cancer. Moreover, different expression patterns between cell types for several tubulin isotypes represent a great opportunity to improve the selectivity and specificity of the employed drugs and to design novel compounds with higher activity only on cells of interest. In this context, tubulin isotype βIII represents an excellent target for anti-tumoral therapies since it is overexpressed in most cancer cells and correlated with drug resistance. Colchicine is a well-known antimitotic agent, which is able to bind the tubulin dimer and to halt the mitotic process. However, it shows high toxicity also on normal cells and it is not specific for isotype βIII. In this context, the search for colchicine derivatives is a matter of great importance in cancer research. In this study, homology modeling techniques, molecular docking, and molecular dynamics ...
http://pharmamatrix.ca/aggregator
gamma Tubulin抗体(ab50721)| Abcam中国gamma Tubulin抗体(ab50721)| Abcam中国
购买gamma Tubulin兔多克隆抗体(ab50721)，gamma Tubulin抗体经WB验证，3篇文献引用，1个独立用户反馈。产品出库一年都在质保范围内。中国现货速达。
http://www.abcam.cn/gamma-tubulin-antibody-ab50721.html
Microtubule assembly-derived by dimerization of TPPP/p25. Evaluation of thermodynamic parameters for multiple equilibrium...Microtubule assembly-derived by dimerization of TPPP/p25. Evaluation of thermodynamic parameters for multiple equilibrium...
Background: The disordered Tubulin Polymerization Promoting Protein/p25 (TPPP/p25) modulates the dynamics and stability of the microtubule system. In this paper the role of dimerization in its microtubulerelated functions is established, and an approach is proposed to evaluate thermodynamic constants for multiple equilibrium systems from ITC measurements. Methods: For structural studies size exclusion chromatography, SDS-PAGE, chemical cross-linking, circular dichroism, fluorescence spectroscopy and isothermal titration calorimetry were used; the functional effect was analyzed by tubulin polymerization assay. Numerical simulation of the multiple equilibrium was performed with Mathematica software. Results: The dimerization of TPPP/p25 is promoted by elevation of the protein concentration and by GTP addition. The dimeric form displaying enhanced tubulin polymerization promoting activity is stabilized by disulfide bond or chemical cross-linking. The GTP binding to the dimeric form ...
https://library.wolfram.com/infocenter/Articles/8368/
alpha Tubulin / TUBA1A / TUBA3 - AM39110PU-N | acris-antibodies.com
alpha Tubulin / TUBA1A / TUBA3, 0.1 mg. Tubulin is one of the main components of the cytoskeleton. It is a heterodimeric structure consisting of interlocking alpha and beta chains.
https://www.acris-antibodies.com/antibodies/primary-antibodies/alpha-tubulin-tuba1a-tuba3-am39110pu-n.htm
Distinct populations of microtubules: tyrosinated and nontyrosinated alpha tubulin are distributed differently in vivoDistinct populations of microtubules: tyrosinated and nontyrosinated alpha tubulin are distributed differently in vivo
A unique post-translational modification of tubulin has previously been described in which a tyrosine residue is reversibly added to the C terminus of the alpha-tubulin subunit. We have prepared peptide antibodies that specifically react (shown by competitive immunoassay and Western blots) with the …
https://pubmed.ncbi.nlm.nih.gov/6386177/?dopt=Abstract
Anti-Tubulin Antibody Products | Biocompare.comAnti-Tubulin Antibody Products | Biocompare.com
44 reviews. Compare Anti-Tubulin Antibody Products from leading suppliers on Biocompare. View specifications, prices, citations, reviews, and more.
https://www.biocompare.com/pfu/110447/soids/4626/Antibodies/Tubulin?rlpi_8764=2
Severing enzymes amplify microtubule arrays through lattice GTP-tubulin incorporation | ScienceSevering enzymes amplify microtubule arrays through lattice GTP-tubulin incorporation | Science
Taxol-stabilized GDP-microtubules were prepared by polymerizing 10 μl of 100 μM glycerol-free porcine tubulin (Cytoskeleton, Denver, CO) in 80 mM K-PIPES (pH 6.8), 1 mM MgCl2, 1 mM EGTA, 10% DMSO, and 1 mM GTP for 1 hour in a 37°C water bath. Taxol was added to 20 μM final concentration, and the reaction was incubated on the bench top for 1 to 2 hours. Microtubules were loaded onto a 60% glycerol cushion [BRB80, 60% (v/v) glycerol, and 20 μM Taxol] at 37°C by using a pipette tip with the tip cut off. Nonpolymerized tubulin was removed by centrifugation in a TLA100 rotor at 35,000 rpm for 15 min at 37°C. The pellet was gently resuspended to 2.5 μM tubulin in BRB80 supplemented with 20 μM Taxol and 1 mM GTP at 37°C by using a pipette tip with the tip cut off.. For GDP-microtubules, all polymerization and severing reactions were performed at 37°C. Twenty microliters of 100 μM glycerol-free porcine tubulin (Cytoskeleton) was polymerized in 10% DMSO, 1 mM GTP, and 10 mM MgCl2 for 1 hour ...
https://science.sciencemag.org/content/361/6404/eaau1504
How cancer cells resist the action of microtubule-targeting chemotherapeutic drugs? A study of β-tubulin mutations | Atlas of...How cancer cells resist the action of microtubule-targeting chemotherapeutic drugs? A study of β-tubulin mutations | Atlas of...
Microtubules (MTs) are essential structural components of cells. They are made up of polymers of protein subunits of α,β-tubulin and are highly dynamic, undergoing rapid phases of assembly and disassembly. The dynamic behavior of MTs is essential for their cellular activities.
http://atlasofscience.org/how-cancer-cells-resist-the-action-of-microtubule-targeting-chemotherapeutic-drugs-a-study-of-%CE%B2-tubulin-mutations/
alpha Tubulin抗体[4G1] |Abcam中国|Anti-alpha Tubulin抗体[4G1]alpha Tubulin抗体[4G1] |Abcam中国|Anti-alpha Tubulin抗体[4G1]
alpha Tubulin小鼠单克隆抗体[4G1](ab28439)可与小鼠, 大鼠, 人样本反应并经WB, ELISA, Flow Cyt, ICC/IF实验严格验证，被3篇文献引用。所有产品均提供质保服务，中国75%以上现货。
http://www.abcam.cn/alpha-tubulin-antibody-4g1-ab28439.html
Phosphorylation of tubulin tyrosine ligase: a potential mechanism for regulation of alpha-tubulin tyrosinationPhosphorylation of tubulin tyrosine ligase: a potential mechanism for regulation of alpha-tubulin tyrosination
The tubulin tyrosination/detyrosination cycle is a well-established posttranslational modification, which is carried out by two enzymes: Tubulin Tyrosine Ligase (TTL) and Tubulin Tyrosine Carboxypeptidase (TTCP). In this paper, I present evidence suggesting that the cycle itself is under the hierarc …
https://pubmed.ncbi.nlm.nih.gov/10842328/?dopt=Abstract
Plus itPlus it
Interfering with microtubule dynamics is a validated approach for anticancer treatment and by selectively targeting the colchicine binding site on tubulin, microtubule destabilizing agents can evade mechanisms of drug resistance that commonly develop with other antimitotic agents such as taxanes and vinca alkaloids. We have recently reported the discovery of a potent and metabolically stable tubulin inhibitor (DJ101) that specifically targets the colchicine binding site on the beta tubulin subunit, disrupts tubulin polymerization and effectively circumvents drug efflux pumps that decrease the efficacy of existing tubulin inhibitors. To further pre-clinically evaluate DJ101 as a novel tubulin inhibitor and confirm its mechanism of action, we first visually demonstrated the ability of DJ101 to disrupt microtubule dynamics and elucidated the changes in microtubule structure and cell morphology through immunofluorescence techniques. Furthermore, we solved the crystal structure of DJ101 in complex ...
http://cancerres.aacrjournals.org/content/77/13_Supplement/3223
Role of Fyn in the Rearrangement of Tubulin Cytoskeleton Induced through TCR | The Journal of ImmunologyRole of Fyn in the Rearrangement of Tubulin Cytoskeleton Induced through TCR | The Journal of Immunology
The translocation of the microtubule-organizing center (MTOC), its associated signaling complex, and the secretory apparatus is the most characteristic early event that involves the tubulin cytoskeleton of T or NK cells after their interaction with APC or target cells. Our results show that Fyn kinase activity is essential for MTOC reorientation in an Ag-dependent system. Moreover, T cells from Fyn-deficient mice are unable to rearrange their tubulin cytoskeleton in response to anti-CD3-coated beads. Analysis of conjugates of T cells from transgenic OT-I mice with dendritic cells revealed that an antagonist peptide induces translocation of the MTOC, and that this process is impaired in T cells from Fyn−/− OT-I mice. In addition, Fyn deficiency significantly affects the MTOC relocation mediated by agonist peptide stimulation. These results reveal Fyn to be a key regulator of tubulin cytoskeleton reorganization in T cells.. ...
https://www.jimmunol.org/content/176/7/4201.abstract
Identification of a class of novel tubulin inhibitors<...Identification of a class of novel tubulin inhibitors<...
TY - JOUR. T1 - Identification of a class of novel tubulin inhibitors. AU - Yi, Xin. AU - Zhong, Bo. AU - Smith, Kerri M.. AU - Geldenhuys, Werner J.. AU - Feng, Ye. AU - Pink, John J.. AU - Dowlati, Afshin. AU - Xu, Yan. AU - Zhou, Aimin. AU - Su, Bin. PY - 2012/4/12. Y1 - 2012/4/12. N2 - We previously developed a series of anticancer agents based on cyclooxygenase-2 (COX-2) inhibitor nimesulide as a lead compound. However, the molecular targets of these agents still remain unclear. In this study, we synthesized a biotinylated probe based on a representative molecule of the compound library and performed protein pull-down assays to purify the anticancer targets of the compound. Via proteomic approaches, the major proteins bound to the probe were identified to be tubulin and heat shock protein 27 (Hsp27), and the compound inhibited tubulin polymerization by binding at the colchicine domain. However, the tubulin inhibitory effect of the compound activated the Hsp27 phosphorylation and possibly ...
https://scholars.houstonmethodist.org/en/publications/identification-of-a-class-of-novel-tubulin-inhibitors
Conformational study of calf brain tubulin<...Conformational study of calf brain tubulin<...
TY - JOUR. T1 - Conformational study of calf brain tubulin. AU - Lee, James C.. AU - Corfman, Debra. AU - Frigon, Ronald P.. AU - Timasheff, Serge N.. PY - 1978/1/15. Y1 - 1978/1/15. N2 - The conformation of calf brain tubulin has been monitored by circular dichroism, optical rotatory dispersion, and spectrophotometric titration as a function of pH, temperature, ligand concentrations, and denaturants. At pH 7, calf brain tubulin maintains its structural integrity between 5 and 37 °C as determined by circular dichroism. Furthermore, the presence of MgCl2 up to 1.6 × 10-2m does not induce any observable changes in the circular dichroism spectra, nor does 10-4m CaCl2. With increasing pH, the spectral data can best be described as a gradual loosening of the secondary structure between pH 7 and 9. Both spectral and titrimetric data suggest a major unfolding of tubulin between pH 9 and 10. The apparent pK of tyrosine shifts from 10.85 to 9.98 upon transferring from buffer to 6 m guanidine ...
https://researchexperts.utmb.edu/en/publications/conformational-study-of-calf-brain-tubulin
Vasohibins encode tubulin detyrosinating activity<...
TY - JOUR. T1 - Vasohibins encode tubulin detyrosinating activity. AU - Nieuwenhuis, Joppe. AU - Adamopoulos, Athanassios. AU - Bleijerveld, Onno B. AU - Mazouzi, Abdelghani. AU - Stickel, Elmer. AU - Celie, Patrick. AU - Altelaar, Maarten. AU - Knipscheer, Puck. AU - Perrakis, Anastassis. AU - Blomen, Vincent A. AU - Brummelkamp, Thijn R. N1 - Copyright © 2017 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.. PY - 2017/12/15. Y1 - 2017/12/15. N2 - Tubulin is subjected to a number of posttranslational modifications to generate heterogeneous microtubules. The modifications include removal and ligation of the C-terminal tyrosine of ⍺-tubulin. The enzymes responsible for detyrosination, an activity first observed 40 years ago, have remained elusive. We applied a genetic screen in haploid human cells to find regulators of tubulin detyrosination. We identified SVBP, a peptide that regulates the ...
https://pure.knaw.nl/portal/en/publications/vasohibins-encode-tubulin-detyrosinating-activity
Exbio antibodies - Mouse Monoclonal to alpha, beta-tubulin dimer TU-10 (IgM)Exbio antibodies - Mouse Monoclonal to alpha, beta-tubulin dimer TU-10 (IgM)
The microtubules are intracellular dynamic polymers made up of evolutionarily conserved polymorphic alpha/beta-tubulin heterodimers and a large number of microtubule-associated proteins (MAPs). The microtubules consist of 13 protofilaments and have an outer diameter 25 nm. Microtubules have their intrinsic polarity; highly dynamic plus ends and less dynamic minus ends. Microtubules are required for vital processes in eukaryotic cells including mitosis, meiosis, maintenance of cell shape and intracellular transport. Microtubules are also necessary for movement of cells by means of flagella and cilia. In mammalian tissue culture cells microtubules have their minus ends anchored in microtubule organizing centers (MTOCs). The GTP (guanosintriphosphate) molecule is an essential for tubulin heterodimer to associate with other heterodimers to form microtubule. In vivo, microtubule dynamics vary considerably. Microtubule polymerization is reversible and a populations of microtubules in cells are on ...
http://www.exbio.cz/products/clone.py?START=11&VIEW=1
Theoretical Analysis of Microtubule Dynamics at All TimesTheoretical Analysis of Microtubule Dynamics at All Times
Microtubules are biopolymers consisting of tubulin dimer subunits. As a major component of cytoskeleton they are essential for supporting most important cellular processes such as cell division, signaling, intracellular transport and cell locomotion. The hydrolysis of guanosine triphosphate (GTP) molecules attached to each tubulin subunit supports the nonequilibrium nature of microtubule dynamics. One of the most spectacular properties of microtubules is their dynamic instability when their growth from continuous attachment of tubulin dimers stochastically alternates with periods of shrinking. Despite the critical importance of this process to all cellular activities, its mechanism remains not fully understood. We investigated theoretically microtubule dynamics at all times by analyzing explicitly temporal evolution of various length clusters of unhydrolyzed subunits. It is found that the dynamic behavior of microtubules depends strongly on initial conditions. Our theoretical findings provide a ...
https://scholarship.rice.edu/handle/1911/78733
Mitotic phosphorylation by NEK6 and NEK7 reduces the microtubule affinity of EML4 to promote chromosome congression | Science...Mitotic phosphorylation by NEK6 and NEK7 reduces the microtubule affinity of EML4 to promote chromosome congression | Science...
The mechanism by which EML4 stabilizes microtubules in cells, either directly or indirectly, also remains enigmatic. However, EML4 shares many features with the ch-TOG (XMAP215) family of MAPs in that both proteins have separable domains for binding the microtubule lattice and soluble tubulin. ch-TOG acts as a processive microtubule polymerase by binding to the microtubule with a basic region and then using its multiple TOG domains to add soluble tubulin to the growing microtubule plus-ends (40, 41). However, although EML4 has a basic NTD that binds the microtubule polymer and a TAPE domain that binds soluble tubulin, there was no detectable concentration of EML4 at plus ends of microtubules where it could promote growth through acting as a microtubule polymerase. Similar to tau, EML4 is abundant in the nervous system, suggesting that it may have a major function in stabilizing the long microtubules present in neurons (11). At the molecular level, proteins of the tau family bind to more than one ...
https://stke.sciencemag.org/content/12/594/eaaw2939
Exbio antibodies - Mouse Monoclonal to alpha, beta-tubulin dimer TU-10 (IgM)Exbio antibodies - Mouse Monoclonal to alpha, beta-tubulin dimer TU-10 (IgM)
The microtubules are intracellular dynamic polymers made up of evolutionarily conserved polymorphic alpha/beta-tubulin heterodimers and a large number of microtubule-associated proteins (MAPs). The microtubules consist of 13 protofilaments and have an outer diameter 25 nm. Microtubules have their intrinsic polarity; highly dynamic plus ends and less dynamic minus ends. Microtubules are required for vital processes in eukaryotic cells including mitosis, meiosis, maintenance of cell shape and intracellular transport. Microtubules are also necessary for movement of cells by means of flagella and cilia. In mammalian tissue culture cells microtubules have their minus ends anchored in microtubule organizing centers (MTOCs). The GTP (guanosintriphosphate) molecule is an essential for tubulin heterodimer to associate with other heterodimers to form microtubule. In vivo, microtubule dynamics vary considerably. Microtubule polymerization is reversible and a populations of microtubules in cells are on ...
http://www.exbio.cz/products/clone.py?idclone=CLO000000000000287
ABL1 | Vascular Dysfunction Induced in Offspring by Maternal Dietary FatABL1 | Vascular Dysfunction Induced in Offspring by Maternal Dietary Fat
Reversible acetylation of -tubulin can be an evolutionarily conserved modification in microtubule networks. SP1-reliant IL-10 transcription. Amazingly, the augmented p38 signaling is definitely suppressed by MEC17 inactivation. Our results determine reversible microtubule acetylation like a kinase signaling modulator and an essential component in the inflammatory response. Intro Acetylation on lysine (K) 40 of -tubulin can be an evolutionarily conserved changes managed from the acetyltransferase MEC17 (also termed TAT1)1, 2 as well as the deacetylase HDAC63, 4. The prevalence and extremely enriched distribution of -tubulin acetylation in the microtubule network suggests a simple function of the changes5, 6. 488-81-3 manufacture Remarkably, mice missing MEC17 or HDAC6 are grossly regular despite an extraordinary perturbation in microtubule acetylation7C10. -tubulin acetylation on K40 can be dispensable in Tetrahymena11. Hence under laboratory circumstances, microtubule acetylation is certainly ...
http://sc-26196.com/tag/abl1/
Tubulin tyrosine ligase like 12 links to prostate cancer through tubulin posttranslational modification and chromosome ploidy -...Tubulin tyrosine ligase like 12 links to prostate cancer through tubulin posttranslational modification and chromosome ploidy -...
Wiley Online Library is migrating to a new platform powered by Atypon, the leading provider of scholarly publishing platforms. The new Wiley Online Library will be migrated over the weekend of February 24 and 25 and will be live on February 26, 2018. For more information, please visit our migration page:http://www.wileyactual.com/WOLMigration ...
http://onlinelibrary.wiley.com/doi/10.1002/ijc.25261/references
A centrosomal protein FOR20 regulates microtubule assembly dynamics and plays a role in cell migration | Biochemical JournalA centrosomal protein FOR20 regulates microtubule assembly dynamics and plays a role in cell migration | Biochemical Journal
Here, we report that a centrosomal protein FOR20 [FOP (FGFR1 (fibroblast growth factor receptor 1) oncogene protein)-like protein of molecular mass of 20 kDa; also named as C16orf63, FLJ31153 or PHSECRG2] can regulate the assembly and stability of microtubules. Both FOR20 IgG antibody and GST (glutathione S-transferase)-tagged FOR20 could precipitate tubulin from the HeLa cell extract, indicating a possible interaction between FOR20 and tubulin. FOR20 was also detected in goat brain tissue extract and it cycled with microtubule-associated proteins. Furthermore, FOR20 bound to purified tubulin and inhibited the assembly of tubulin in vitro. The overexpression of FOR20 depolymerized interphase microtubules and the depletion of FOR20 prevented nocodazole-induced depolymerization of microtubules in HeLa cells. In addition, the depletion of FOR20 suppressed the dynamics of individual microtubules in live HeLa cells. FOR20-depleted MDA-MB-231 cells displayed zigzag motion and migrated at a slower rate ...
http://www.biochemj.org/content/474/16/2841
AID 214727 - Tested for the inhibition of binding of 5 uM [3H]-colchicine to purified tubulin at 37 degree Centigrade - PubChemAID 214727 - Tested for the inhibition of binding of 5 uM [3H]-colchicine to purified tubulin at 37 degree Centigrade - PubChem
BioAssay record AID 214727 submitted by ChEMBL: Tested for the inhibition of binding of 5 uM [3H]-colchicine to purified tubulin at 37 degree Centigrade.
https://pubchem.ncbi.nlm.nih.gov/bioassay/214727
Zinc in the structure of Drosophila Nod (3DC4) and Bovine Tubulin (1JFF) Docked Into The 11-Angstrom Cryo-Em Map of Nucleotide...
Mono- and Stereopictres of 5.0 Angstrom coordination sphere of Zinc atom in PDB 3dco: Drosophila Nod (3DC4) and Bovine Tubulin (1JFF) Docked Into The 11-Angstrom Cryo-Em Map of Nucleotide-Free Nod Complexed to the Microtubule
http://zinc.atomistry.com/pdb3dco.html
Anti-alpha Tubulin antibody - Loading Control (ab4074) | AbcamAnti-alpha Tubulin antibody - Loading Control (ab4074) | Abcam
Rabbit polyclonal alpha Tubulin antibody - Loading Control. Validated in WB, ICC/IF and tested in Mouse, Rat, Chicken, Cow, Human, Chinese hamster. Cited in 263 publication(s). Independently reviewed…
https://www.abcam.com/alpha-tubulin-antibody-loading-control-ab4074.html
RCSB PDB - 4AQV: Model of human kinesin-5 motor domain (3HQD) and mammalian tubulin heterodimer (1JFF) docked into the 9.7...RCSB PDB - 4AQV: Model of human kinesin-5 motor domain (3HQD) and mammalian tubulin heterodimer (1JFF) docked into the 9.7...
4AQV: Model of human kinesin-5 motor domain (3HQD) and mammalian tubulin heterodimer (1JFF) docked into the 9.7-angstrom cryo-EM map of microtubule-bound kinesin-5 motor domain in the AMPPPNP state.
https://www.rcsb.org/structure/4AQV
AMPK activation promotes lipid droplet dispersion on detyrosinated microtubules to increase mitochondrial fatty acid oxidationAMPK activation promotes lipid droplet dispersion on detyrosinated microtubules to increase mitochondrial fatty acid oxidation
Lipid droplets (LDs) are intracellular organelles that provide fatty acids (FAs) to cellular processes including synthesis of membranes and production of metabolic energy. While known to move bidirectionally along microtubules (MTs), the role of LD motion and whether it facilitates interaction with other organelles are unclear. Here we show that during nutrient starvation, LDs and mitochondria relocate on detyrosinated MT from the cell centre to adopt a dispersed distribution. In the cell periphery, LD-mitochondria interactions increase and LDs efficiently supply FAs for mitochondrial beta-oxidation. This cellular adaptation requires the activation of the energy sensor AMPK, which in response to starvation simultaneously increases LD motion, reorganizes the network of detyrosinated MTs and activates mitochondria. In conclusion, we describe the existence of a specialized cellular network connecting the cellular energetic status and MT dynamics to coordinate the functioning of LDs and mitochondria ...
http://www.recercat.cat/handle/2072/302351
Anti Tubulin Alpha 1A Chain Antibody, clone OTI2C8 (PrecisionAb Monoclonal Antibody) | Bio-RadAnti Tubulin Alpha 1A Chain Antibody, clone OTI2C8 (PrecisionAb Monoclonal Antibody) | Bio-Rad
Tubulin alpha 1A chain antibody for detecting human tubulin alpha-1A chain. Validated on up to 12 cell lysates for western blotting. Try a trial size today.
https://www.bio-rad-antibodies.com/monoclonal/human-tubulin-alpha-1a-chain-antibody-oti2c8-vma00173.html
Spast - Spastin - Mus musculus (Mouse) - Spast gene & proteinSpast - Spastin - Mus musculus (Mouse) - Spast gene & protein
ATP-dependent microtubule severing protein that specifically recognizes and cuts microtubules that are polyglutamylated (PubMed:19141076 PubMed:20530212). Preferentially recognizes and acts on microtubules decorated with short polyglutamate tails: severing activity increases as the number of glutamates per tubulin rises from one to eight, but decreases beyond this glutamylation threshold (By similarity). Severing activity is not dependent on tubulin acetylation or detyrosination (By similarity). Microtubule severing promotes reorganization of cellular microtubule arrays and the release of microtubules from the centrosome following nucleation (By similarity). It is critical for the biogenesis and maintenance of complex microtubule arrays in axons, spindles and cilia (By similarity). SPAST is involved in abscission step of cytokinesis and nuclear envelope reassembly during anaphase in cooperation with the ESCRT-III complex (By similarity). Recruited at the midbody, probably by IST1, and participates in
https://www.uniprot.org/uniprot/Q9QYY8
Plus itPlus it
The taccalonolides are highly acetylated steroids that stabilize cellular microtubules and overcome multiple mechanisms of taxane resistance. Recently, two potent taccalonolides, AF and AJ, were identified that bind to tubulin directly and enhance microtubule polymerization. Extensive studies were conducted to characterize these new taccalonolides. AF and AJ caused aberrant mitotic spindles and bundling of interphase microtubules that differed from the effects of either paclitaxel or laulimalide. AJ also distinctly affected microtubule polymerization in that it enhanced the rate and extent of polymerization in the absence of any noticeable effect on microtubule nucleation. In addition, the resulting microtubules were found to be profoundly cold stable. These data, along with studies showing synergistic antiproliferative effects between AJ and either paclitaxel or laulimalide, suggest a distinct binding site. Direct binding studies demonstrated that AJ could not be displaced from microtubules by ...
http://cancerres.aacrjournals.org/content/early/2013/11/07/0008-5472.CAN-13-1346
Contractile proteins (actin, myosin) and tubulin are revealed within DNA-containing nucleocytoplasm in mature spermatozoa of...
TY - JOUR. T1 - Contractile proteins (actin, myosin) and tubulin are revealed within DNA-containing nucleocytoplasm in mature spermatozoa of Libinia emarginata L.. AU - Perez, R. A.. AU - Langford, G. M.. AU - Eckberg, W. R.. AU - Anderson, W. A.. PY - 1986. Y1 - 1986. UR - http://www.scopus.com/inward/record.url?scp=0022636940&partnerID=8YFLogxK. UR - http://www.scopus.com/inward/citedby.url?scp=0022636940&partnerID=8YFLogxK. M3 - Article. C2 - 2427742. AN - SCOPUS:0022636940. VL - 18. SP - 471. EP - 480. JO - Journal of Submicroscopic Cytology. JF - Journal of Submicroscopic Cytology. IS - 3. ER - ...
https://experts.syr.edu/en/publications/contractile-proteins-actin-myosin-and-tubulin-are-revealed-within
An essential quality control mechanism at the eukaryotic basal body prior to intraflagellar transport. - Lancaster EPrintsAn essential quality control mechanism at the eukaryotic basal body prior to intraflagellar transport. - Lancaster EPrints
Constructing a eukaryotic cilium/flagellum is a demanding task requiring the transport of proteins from their cytoplasmic synthesis site into a spatially and environmentally distinct cellular compartment. The clear potential hazard is that import of aberrant proteins could seriously disable cilia/flagella assembly or turnover processes. Here, we reveal that tubulin protein destined for incorporation into axonemal microtubules interacts with a tubulin cofactor C (TBCC) domain-containing protein that is specifically located at the mature basal body transitional fibres. RNA interference-mediated ablation of this protein results in axonemal microtubule defects but no effect on other microtubule populations within the cell. Bioinformatics analysis indicates that this protein belongs to a clade of flagellum-specific TBCC-like proteins that includes the human protein, XRP2, mutations which lead to certain forms of the hereditary eye disease retinitis pigmentosa. Taken with other observations regarding ...
http://eprints.lancs.ac.uk/9241/
Participation of guanine nucleotides in nucleation and elongation steps of microtubule assembly.<...
TY - JOUR. T1 - Participation of guanine nucleotides in nucleation and elongation steps of microtubule assembly.. AU - Karr, T. L.. AU - Podrasky, A. E.. AU - Purich, D. L.. PY - 1979/11. Y1 - 1979/11. N2 - Critical concentrations for formation of microtubules from subunits with GTP and its beta, gamma-imido and beta, gamma-methylene analogs are similar when adequate time is given for equilibration. Dilution of microtubules into GTP and GDP yielded values of 0.1 and 0.19 mg/ml for the critical concentration, results similar to those reported by Carlier and Pantaloni [Carlier, M. & Pantaloni, D. (1978) Biochemistry 17, 1908-1915]. GDP is capable of supporting elongation of preformed microtubules, but it efficiently poisons the nucleation events. Reported experiments also demonstrate that the critical tubulin concentration of the tubulin-GDP complex can be accurately measured in both the assembly and disassembly directions. Evidence is presented that GTP is involved in early nucleation events but ...
https://asu.pure.elsevier.com/en/publications/participation-of-guanine-nucleotides-in-nucleation-and-elongation
Plus itPlus it
A study of the interaction of colchicine and purified rat brain microtubule protein is presented. Experimental data agree with a theory derived to describe the system. Protein stabilized with 0.1 mM vinblastine and 1 mM GTP lost the ability to bind colchicine in a first-order reaction, with a rate constant of 1.1 ± 0.1 x 10-5 sec -1. The colchicine-microtubule protein complex appeared to be stable. The rate constant for the second-order association of colchicine and microtubule protein is 128.7 ± 6.5 M-1 sec-1, while the rate constant for dissociation is 8.1 ± 0.8 x 10-6 sec-1. The dissociation constant calculated from these two numbers is 6.3 x 10-8 M. By using other ligands to perturb the interaction between colchicine and microtubule protein, the affinities of these ligands for microtubule protein could be measured. The methods developed are applicable in general for ligands of microtubule protein. Podophyllotoxin binds firmly to microtubule protein (Kd = 0.28 ± 0.06 µM), while ...
http://molpharm.aspetjournals.org/content/13/3/560
Plus itPlus it
ABT-751 (Abbott Laboratories, Abbott Park, IL) is an orally bioavailable sulfonamide that binds to the colchicine binding site on β-tubulin and inhibits the polymerization of microtubules (1, 2). ABT-751 had antitumor activity in a panel of 30 tumor cell lines in vitro including cell lines resistant to Vinca alkaloids and taxanes due to P-glycoprotein overexpression (3). In pediatric solid tumor cell lines, the ABT-751 IC50 was ,3 μmol/L in neuroblastoma cell lines and ,6 μmol/L in other pediatric solid tumor cell lines (4). ABT-751 was active as a single agent in xenograft models of human tumors including gastric, colorectal, lung, and breast cancer models (3), and in combination, ABT-751 enhanced the efficacy of radiation, cisplatin, and fluorouracil (5). In childhood cancer murine models, ABT-751 resulted in the regression of rhabdomyosarcoma and Wilms tumor models and prolonged time to tumor progression in neuroblastoma xenografts (6).. In adults with refractory solid tumors, a dose ...
http://clincancerres.aacrjournals.org/content/14/4/1111
THE ROLE OF DIVA IN CELL DIFFERENTIATION | ScholarBank@NUSTHE ROLE OF DIVA IN CELL DIFFERENTIATION | [email protected]
Diva (death inducer binding to vBcl-2 and Apaf-1) is a Bcl-2 family member, and has been reported to play roles in apoptosis and oocyte maturation. Diva has also been shown to interact with Nm23-H2/NDPK B, which is involved in cellular differentiation. The main aim of this study was to elucidate the function and possible mechanisms for Diva in cellular differentiation in the brain. In the present study, in PC-12 cells, Diva expression was decreased after differentiation and reciprocally, NDPK B expression was increased and it translocated into the nucleus. Endogenous Diva was also shown to interact with both ß-tubulin and NDPK B. Overexpression of Diva in PC-12 cells did not change the expression level of NDPK B, but inhibited its nuclear localization. Diva-overexpressing cells had a decreased percentage of differentiated cells and average neurite length was shortened. This was due to the formation of more Diva/NDPK B and Diva/ß-tubulin complexes, at the expense of NDPK B/ß-tubulin complexes. ...
http://scholarbank.nus.edu.sg/handle/10635/34692
Microtubule Self-Assembly Kinetics - Durham UniversityMicrotubule Self-Assembly Kinetics - Durham University
5 September 2013 14:00 in CM101. Microtubule assembly and disassembly is vital for many fundamental cellular processes. Our current understanding of microtubule assembly kinetics is based on a one-dimensional assembly model, which assumes that each protofilament of a microtubule behaves independently. In this model, the subunit disassociation rate from a microtubule tip is independent of free subunit concentration. Using Total-Internal-Reflection-Fluorescence (TIRF) microscopy and a laser tweezers assay to measure in vitro microtubule assembly with nanometer resolution accuracy, we now find that the subunit dissociation rate from a microtubule tip increases at higher free subunit concentrations. This is because there is a shift in microtubule tip structure from relatively blunt at low free concentrations to relatively tapered at high free concentrations, which we confirmed experimentally by TIRF microscopy. Because both the association and the dissociation rates increase at higher free subunit ...
https://www.dur.ac.uk/mathematical.sciences/events/seminars/seminararchives/?seminar=3361
Bulinski | Columbia University : Biological SciencesBulinski | Columbia University : Biological Sciences
The common theme of our labs research is the function of microtubules in directed cell motility. Mostmicrotubules in proliferating cells are highly dynamic, that is, assembly of microtubulesfrom tubulin subunits and disassembly of microtubule polymers into subunits, occurs within a matter of minutes. However, differentiating and migrating cells in culture or within vertebrate organisms selectively stabilize a subset of microtubules.For example, migratingfibroblasts use the polarization of stabilized microtubules as a determinants of persistent motility in that direction.. Meanwhile, since several cytoplasmic enzymes are capable of post-translationally modifying the tubulin subunits found within microtubule polymers. These post-translational modifications confer one or more chemical marks along the length of microtubules in the stable subpopulation. The selective stabilization of microtubules that face the leading edge of migrating fibroblasts has been studied rather extensively; our work has ...
http://biology.columbia.edu/people/bulinski
Vascular targeting in pancreatic cancer: the novel tubulin-binding agent ZD6126 reveals antitumor activity in primary and...
ZD6126 is a novel vascular-targeting agent that acts by disrupting the tubulin cytoskeleton of an immature tumor endothelium, leading to an occlusion of tumor blood vessels and a subsequent tumor necrosis. We wanted to evaluate ZD6126 in primary and metastatic tumor models of human pancreatic cancer. Nude mice were injected orthotopically with L3.6pl pancreatic cancer cells. In single and multiple dosing experiments, mice received ZD6126, gemcitabine, a combination of both agents, or no treatment. For the induction of metastatic diseases, additional groups of mice were injected with L3.6pl cells into the spleen. Twenty-four hours after a single-dose treatment, ZD6126 therapy led to an extensive central tumor necrosis, which was not seen after gemcitabine treatment. Multiple dosing of ZD6126 resulted in a significant growth inhibition of primary tumors and a marked reduction of spontaneous liver and lymph node metastases. Experimental metastatic diseases could be significantly controlled by a combination
https://www.oncology.ox.ac.uk/publications/315726
Profile | Biosciences | University of ExeterProfile | Biosciences | University of Exeter
Mitotic spindles are primarily composed of microtubules (MTs), generated by polymerization of α- and β-Tubulin hetero-dimers [1, 2]. Tubulins undergo a series of protein folding and post-translational modifications in order to fulfill their functions [3, 4]. Defects in Tubulin polymerization dramatically affect spindle formation and disrupt chromosome segregation. We recently described a role for the product of the conserved misato (mst) gene in regulating mitotic MT generation in flies [5], but the molecular function of Mst remains unknown. Here, we use affinity purification mass spectrometry (AP-MS) to identify interacting partners of Mst in the Drosophila embryo. We demonstrate that Mst associates stoichiometrically with the hetero-octameric Tubulin Chaperone Protein-1 (TCP-1) complex, with the hetero-hexameric Tubulin Prefoldin complex, and with proteins having conserved roles in generating MT-competent Tubulin. We show that RNAi-mediated invivo depletion of any TCP-1 subunit phenocopies ...
http://biosciences.exeter.ac.uk/staff/profile/index.php?web_id=james_wakefield&tab=pubs&view=date
3 -Hydroxy-3,4 -dimethoxyflavone blocks tubulin polymerization and is a potent apoptotic inducer in human SK-MEL-1 melanoma...
Flavonoids are naturally occurring polyphenolic compounds and are among the most promising anticancer agents. A series of flavonols and their 3-methyl ether derivatives were synthesized and assessed for cytotoxicity. It was found that 3′-hydroxy-3,4′-dimethoxyflavone (flavonoid 7a) displayed strong cytotoxicity against human SK-MEL-1 melanoma cells and blocked tubulin polymerization, but had no significant cytotoxic effects against quiescent or proliferating human peripheral blood mononuclear cells. Our analyses showed that flavonoid 7a induces G2-M cell cycle arrest and apoptosis in melanoma cells which is associated with cytochrome c release and activation of both extrinsic and intrinsic apoptotic pathways of cell death ...
https://accedacris.ulpgc.es/handle/10553/53525
Lexibulin | CYT997 | CAS#917111-44-5 | CAS#917111-49-0 | tubulin inhibitor | MedKoo BiosciencesLexibulin | CYT997 | CAS#917111-44-5 | CAS#917111-49-0 | tubulin inhibitor | MedKoo Biosciences
Lexibulin, also known as CYT997, is a n orally bioavailable small-molecule with tubulin-inhibiting, vascular-disrupting, and potential antineoplastic activities. Lexibulin inhibits tubulin polymerization in tumor blood vessel endothelial cells and tumor cells, blocking the formation of the mitotic spindle and leading to cell cycle arrest at the G2/M phase; this may result in disruption of the tumor vasculature and tumor blood flow, and tumor cell death. Check for active clinical trials or closed clinical trials using this agent.
http://www.medkoo.com/products/5399
Leicester Research Archive: Nek6 Controls Mitotic Progression through Regulating EML3 Localisation to Spindle Microtubules
EMLs are a highly conserved family of microtubule-associated proteins that play a role in microtubule stability. In humans there are six EMLs. EML1, EML2, EML3 and EML4 consist of a largely unstructured basic N-terminal domain (NTD) that contains a short coiled-coil mediating trimerisation, and a highly structured C-terminal domain (CTD) named the TAPE domain. Microtubule binding is conferred through the NTD whilst the TAPE domain binds to soluble tubulin dimers. EML5 and EML6 lack the N-terminal region but have three continuous TAPE domains encoded within a single polypeptide. Previous proteomic studies had identified EML3 as a binding partner of Nek6, a serine/threonine kinase that promotes mitotic spindle assembly. In this study, we have explored the microtubule binding properties of EML3 and its regulation by Nek6. Using a stable cell line expressing YFP-EML3, fixed and time lapse imaging revealed that EML3 associates along the length of microtubules and exhibits rapid recovery following ...
https://lra.le.ac.uk/handle/2381/37774
Two β-tubulin genes, TUB1 and TUB8, of Arabidopsis exhibit largely nonoverlapping patterns of expression, Plant Molecular...Two β-tubulin genes, TUB1 and TUB8, of Arabidopsis exhibit largely nonoverlapping patterns of expression, Plant Molecular...
Read Two β-tubulin genes, TUB1 and TUB8, of Arabidopsis exhibit largely nonoverlapping patterns of expression, Plant Molecular Biology on DeepDyve, the largest online rental service for scholarly research with thousands of academic publications available at your fingertips.
https://www.deepdyve.com/lp/springer_journal/two-tubulin-genes-tub1-and-tub8-of-arabidopsis-exhibit-largely-IoFmKnB7CS
Microtubule assembly dynamics: an attractive target for antica...Microtubule assembly dynamics: an attractive target for antica...
Microtubule assembly dynamics: an attractive target for anticancer drugs.: Microtubules, composed of alphabeta tubulin dimers, are dynamic polymers of eukaryoti
https://www.mysciencework.com/publication/show/microtubule-assembly-dynamics-attractive-target-anticancer-drugs-259686bd
Polewards chromosome movement driven by microtubule depolymerization in vitro.
We constructed complexes between isolated chromosomes and microtubules made from purified tubulin to study the movement of chromosomes towards the minus end of microtubules in vitro, a process analogous to the movement of chromosomes towards the pole of the spindle at anaphase of mitosis. Our results show that the energy for this movement is derived solely from microtubule depolymerization, and indicate that anaphase movement of chromosomes is both powered and regulated by microtubule depolymerization at the kinetochore ...
http://vivo.mblwhoilibrary.org/display/publication43883
Colchicine inhibits microtubuleColchicine inhibits microtubule
Activation by Microtubule-Promoting Cosolvents. These metrics are regularly updated to reflect usage leading up to the last few days. February 3, Letters to Editor: Wheat is typically tetraploid and rye diploid, with their triploid hybrid infertile; treatment of triploid triticale with colchicine gives fertile hexaploid triticale.. Biochemical Pharmacology 78 9 A fluorescence stopped flow study of colchicine binding to tubulin. Soft Matter 7 24 Microtubules are long polymers made of smaller units monomers of the protein tubulin. Symptoms of toxicity include gastrointestinal upset, fever, muscle painlow blood cell countsand organ failure.. More:. ...
http://tropicalmoka.com/claritin-loratadine/colchicine-inhibits-microtubule.php
AID 332145 - Induction of cellular microtubule disrupting activity in rat A10 cells at 1 ug/ml after 24 hrs by indirect...AID 332145 - Induction of cellular microtubule disrupting activity in rat A10 cells at 1 ug/ml after 24 hrs by indirect...
BioAssay record AID 332145 submitted by ChEMBL: Induction of cellular microtubule disrupting activity in rat A10 cells at 1 ug/ml after 24 hrs by indirect immunofluorescence technique.
https://pubchem.ncbi.nlm.nih.gov/bioassay/332145
AMRI Signs Agreement for Exclusive License of its Tubulin Inhibitor Program ... ( ALBANY N.Y. Feb. 11 2013 /- (L...)AMRI Signs Agreement for Exclusive License of its Tubulin Inhibitor Program ... ( ALBANY N.Y. Feb. 11 2013 /- (L...)
... ALBANY N.Y. Feb. 11 2013 /- ...(Logo: a href http://photos.prnewswire.com/prnh/20120229/NY611...Under the terms of the license agreement AMRI received an undisclosed... We are very pleased to continue to work with Bessor on the further de...,AMRI,Signs,Agreement,for,Exclusive,License,of,its,Tubulin,Inhibitor,Program,for,Cancer,biological,advanced biology technology,biology laboratory technology,biology device technology,latest biology technology
http://www.bio-medicine.org/biology-technology-1/AMRI-Signs-Agreement-for-Exclusive-License-of-its-Tubulin-Inhibitor-Program-for-Cancer-24442-1/
TubulinTubulin
Human δ- and ε-tubulin genes include:[citation needed] δ-tubulin: TUBD1 ε-tubulin: TUBE1 Zeta-tubulin (IPR004058) is present in ... It binds colchicine much more slowly than other isotypes of β-tubulin. β1-tubulin, sometimes called class VI β-tubulin, is the ... The β-tubulin subunit is exposed on the plus end of the microtubule, while the α-tubulin subunit is exposed on the minus end. ... γ-tubulin also has been isolated as a dimer and as a part of a γ-tubulin small complex (γTuSC), intermediate in size between ...
https://en.wikipedia.org/wiki/Tubulin
Tubulin domainTubulin domain
Tubulin/FtsZ family, GTPase domain is an evolutionary conserved protein domain. This domain is found in all tubulin chains, as ... FtsZ and tubulin are GTPases, this entry is the GTPase domain. FtsZ can polymerise into tubes, sheets, and rings in vitro and ... Tubulin is the major component of microtubules, while FtsZ is the polymer-forming protein of bacterial cell division, it is ... Nogales E, Downing KH, Amos LA, Löwe J (June 1998). "Tubulin and FtsZ form a distinct family of GTPases". Nat. Struct. Biol. 5 ...
https://en.wikipedia.org/wiki/Tubulin_domain
Tubulin GTPaseTubulin GTPase
... phosphate This enzyme participates in tubulin folding and division plane formation. Tubulin Yu XC, Margolin W (September 1997 ... Tubulin+GTPase at the US National Library of Medicine Medical Subject Headings (MeSH) Portal: Biology (Articles with short ... Tubulin GTPase (EC 3.6.5.6) is an enzyme with systematic name GTP phosphohydrolase (microtubule-releasing). This enzyme ... Roychowdhury S, Panda D, Wilson L, Rasenick MM (May 1999). "G protein alpha subunits activate tubulin GTPase and modulate ...
https://en.wikipedia.org/wiki/Tubulin_GTPase
Alpha-tubulin 3CAlpha-tubulin 3C
Genes from the alpha, beta and gamma tubulin families are found in all eukaryotes. The alpha and beta tubulins represent the ... Takeoka A, Shimizu M, Horio T (Dec 2000). "Identification of an alpha-tubulin mutant of fission yeast from gamma-tubulin- ... Tubulin alpha-3C/D chain is a protein that in humans is encoded by the TUBA3C gene. Microtubules of the eukaryotic cytoskeleton ... "Entrez Gene: TUBA3C tubulin, alpha 3c". Klein C, Kramer EM, Cardine AM, Schraven B, Brandt R, Trotter J (Feb 2002). "Process ...
https://en.wikipedia.org/wiki/Alpha-tubulin_3C
Tubulin-tyrosine ligaseTubulin-tyrosine ligase
... α-tubulin + ADP + phosphate The 3 substrates of this enzyme are ATP, detyrosinated alpha-tubulin, and L-tyrosine, whereas its 3 ... In enzymology, a tubulin-tyrosine ligase (EC 6.3.2.25) is an enzyme that catalyzes the chemical reaction ATP + detyrosinated α- ... Rudiger M, Wehland J, Weber K (1994). "The carboxy-terminal peptide of detyrosinated alpha tubulin provides a minimal system to ... The systematic name of this enzyme class is alpha-tubulin:L-tyrosine ligase (ADP-forming). Wehland J, Schroder HC, Weber K ( ...
https://en.wikipedia.org/wiki/Tubulin—tyrosine_ligase
Tubulin beta-4A chainTubulin beta-4A chain
... is a protein that in humans is encoded by the TUBB4A gene. Two tubulin beta-4 chain proteins are encoded ... Tubulin is the major constituent of microtubules, a key components of the cytoskeleton. It binds two molecules of GTP, one at ... "Entrez Gene: TUBB4 tubulin, beta 4". "UCSC Genome Browser: TUBB4A microarray expression". Hersheson J, Mencacci NE, Davis M, ... Lee MG, Loomis C, Cowan NJ (Sep 1984). "Sequence of an expressed human beta-tubulin gene containing ten Alu family members". ...
https://en.wikipedia.org/wiki/Tubulin_beta-4A_chain
Tubulin alpha-1A chainTubulin alpha-1A chain
... is a protein that in humans is encoded by the TUBA1A gene. Tubulin alpha-1A chain is an alpha-tubulin ... Genes from the alpha, beta and gamma tubulin families are found in all eukaryotes. The alpha and beta tubulins represent the ... There are multiple alpha and beta tubulin genes, which are highly conserved among species. This gene encodes alpha tubulin and ... comparing the expressions of rat α-tubulins Tα1 and T26. These two rat α-tubulins are homologs of bα1 and kα1 showing that a ...
https://en.wikipedia.org/wiki/Tubulin_alpha-1A_chain
Class III β-tubulinClass III β-tubulin
... , otherwise known as βIII-tubulin (β3-tubulin) or β-tubulin III, is a microtubule element of the tubulin ... which do not express Class III β-tubulin. Class III β-tubulin is one of the seven β-tubulin isotypes identified in the human ... Like other β-tubulin isotypes, βIII-tubulin has a GTPase domain which plays an essential role in regulating microtubule ... miR-200c suppresses class III β-tubulin translation. By contrast, cytoplasmic HuR and miR-200c enhance class III β-tubulin ...
https://en.wikipedia.org/wiki/Class_III_β-tubulin
Tubulin beta-4B chainTubulin beta-4B chain
... formerly known as tubulin beta-2C chain is a protein that in humans is encoded by the TUBB4B gene. GRCh38 ... "Entrez Gene: TUBB2C tubulin, beta 2C". Burgoyne RD, Cambray-Deakin MA, Lewis SA, et al. (1989). "Differential distribution of ... 2001). "HLA-B2702 (77-83/83-77) peptide binds to beta-tubulin on human NK cells and blocks their cytotoxic capacity". J. ... Lewis SA, Gilmartin ME, Hall JL, Cowan NJ (Jul 1985). "Three expressed sequences within the human beta-tubulin multigene family ...
https://en.wikipedia.org/wiki/Tubulin_beta-4B_chain
Alpha-tubulin N-acetyltransferaseAlpha-tubulin N-acetyltransferase
... tubulin N-acetyltransferase, acetyl-CoA:alpha-tubulin-L-lysine N-acetyltransferase, and acetyl-CoA:[alpha-tubulin]-L-lysine 6-N ... Tubulin acetylation is one of the signaling pathways for Na+ and K+-ATPase activity. Tubulin acetylation is also involved in ... Other names in common use include alpha-tubulin acetylase, αTAT, ATAT1, TAT, alpha-TAT, alpha-tubulin acetyltransferase, ... as it has been found that mice lacking ATAT1 possess a deficient tubulin acetylation and a bulge in the dentate gyrus. Tubulin ...
https://en.wikipedia.org/wiki/Alpha-tubulin_N-acetyltransferase
Discovery and development of tubulin inhibitorsDiscovery and development of tubulin inhibitors
Binding site of different drugs on tubulin Taxol bound to tubulin. Vinblastine bound to tubulin. Colchicine bound to tubulin. ... It binds to the soluble tubulin to form colchicine-tubulin complex. This complex along with the normal tubulins then undergoes ... This part of tubulin dimer remains unused because all currently use drugs bind to the β-tubulin. Research in this field can ... The α-tubulin end has negative (-) charges while the β-tubulin end has positive (+) charges. The microtubule grows from ...
https://en.wikipedia.org/wiki/Discovery_and_development_of_tubulin_inhibitors
Tubulin polymerization promoting protein family member 3Tubulin polymerization promoting protein family member 3
... is a protein that in humans is encoded by the TPPP3 gene. GRCh38: ... "Entrez Gene: Tubulin polymerization promoting protein family member 3". Retrieved 2018-06-19. Martins-de-Souza D, Gattaz WF, ... PDBe-KB provides an overview of all the structure information available in the PDB for Human Tubulin polymerization-promoting ... protein family member 3 PDBe-KB provides an overview of all the structure information available in the PDB for Mouse Tubulin ...
https://en.wikipedia.org/wiki/Tubulin_polymerization_promoting_protein_family_member_3
ProsthecobacterProsthecobacter
Tubulins, which are components of the microtubule, have never been observed in Gracilicutes before. Tubulin was long thought to ... These genes are called bacterial tubulin a (BtubA) and bacterial tubulin b (BtubB). The properties are not exactly same. ... Nogales E, Downing KH, Amos LA, Löwe J (June 1998). "Tubulin and FtsZ form a distinct family of GTPases". Nature Structural ... Larsen RA, Cusumano C, Fujioka A, Lim-Fong G, Patterson P, Pogliano J (June 2007). "Treadmilling of a prokaryotic tubulin-like ...
https://en.wikipedia.org/wiki/Prosthecobacter
PolyglycylationPolyglycylation
... of delta2 tubulin". J. Biol. Chem. 277 (48): 46140-46144. doi:10.1074/jbc.M208065200. PMID 12356754. (Post- ... Polyglycylation is a form of posttranslational modification of glutamate residues of the carboxyl-terminal region tubulin in ... Banerjee Asok (2002). "Coordination of posttranslational modifications of bovine brain alpha-tubulin. ... "Polyglycylation of tubulin: a posttranslational modification in axonemal microtubules". Science. 266 (5191): 1688-1691. doi: ...
https://en.wikipedia.org/wiki/Polyglycylation
Two-domain systemTwo-domain system
Tubulin-like proteins named artubulins are found in the genomes of several ammonium-oxidising Thaumarchaeota. A protein called ... In addition to actin, tubulin, ubiquitin and ESCRT proteins found in TACK archaea, Asgards contain functional genes for several ... Yutin, Natalya; Koonin, Eugene V. (2012). "Archaeal origin of tubulin". Biology Direct. 7: 10. doi:10.1186/1745-6150-7-10. PMC ... tubulin (component of the large cytoskeleton, microtubule) and the ubiquitin system (protein degradation and recycling) that ...
https://en.wikipedia.org/wiki/Two-domain_system
KataninKatanin
ATP hydrolysis is stimulated at a low tubulin/At-p60 ratio and inhibited at higher ratios. The low ratios favor the katanin ... The predicted conformational change also likely decreases the affinity of katanin for tubulin as well as for other katanin ... During cell division, severing at the spindle pole produces free microtubule ends and allows poleward flux of tubulin and ... An experiment using time-lapse digital imaging of fluorescently labeled tubulin demonstrated that axon growth cones pause, and ...
https://en.wikipedia.org/wiki/Katanin
Gary BorisyGary Borisy
Wells, W. A. (2005). "The discovery of tubulin". The Journal of Cell Biology. 169 (4): 552. doi:10.1083/jcb1694fta1. PMC ... characterizing tubulin and its role in cell division. He then did a postdoc at the Medical Research Council Laboratory of ...
https://en.wikipedia.org/wiki/Gary_Borisy
Edwin W. TaylorEdwin W. Taylor
His work in the laboratory not only led to his discovery of tubulin, the protein subunit of microtubules, but it also developed ... This led to his discovery of tubulin, the protein subunit of microtubules, and to the first kinetic model explaining how these ... After the introduction of tubulin, Taylor was conflicted on what moves the chromosomes and what caused the motile system to ... Crasta, Karen; Aneja, Ritu (September 2017). "50 years on … the discovery of tubulin continues to advance cancer treatment". ...
https://en.wikipedia.org/wiki/Edwin_W._Taylor
Pericentriolar materialPericentriolar material
The PCM contains proteins responsible for microtubule nucleation and anchoring including γ-tubulin, pericentrin and ninein. ... Eddé, B.; Rossier; Le Caer; Desbruyères; Gros; Denoulet (1990). "Posttranslational glutamylation of alpha-tubulin". Science. ... Tubulin epsilon chain PCNT, pericentrin, a matrix scaffold protein CDK5RAP2, cyclin dependant kinase receptor associated ... protein 2, binds gTubRCs that nucleate microtubules NEDD1, binds gTubRCs that stabilise microtubules Gamma Tubulin, nucleates ...
https://en.wikipedia.org/wiki/Pericentriolar_material
ETV6ETV6
"TTL tubulin tyrosine ligase (human)". Entrez Gene. "CHIC2 cysteine rich hydrophobic domain 2 (human)". Entrez Gene. "MDS2 ... adds and removes tyrosine residues on α-tubulin), GOT1 (an Aspartate transaminase), and ACSL6 (a Long-chain-fatty-acid-CoA ...
https://en.wikipedia.org/wiki/ETV6
TUBA4BTUBA4B
"Entrez Gene: Tubulin alpha 4b". Retrieved 2017-02-15. v t e (Genes on human chromosome 2, All stub articles, Human chromosome 2 ... Tubulin alpha 4b is a protein that in humans is encoded by the TUBA4B gene. GRCh38: Ensembl release 89: ENSG00000243910 - ...
https://en.wikipedia.org/wiki/TUBA4B
Post-translational modificationPost-translational modification
See tubulin polyglutamylase) polyglycylation, covalent linkage of one to more than 40 glycine residues to the tubulin C- ... covalent linkage of glutamic acid residues to the N-terminus of tubulin and some other proteins. ( ... "Posttranslational glutamylation of alpha-tubulin". Science. 247 (4938): 83-5. Bibcode:1990Sci...247...83E. doi:10.1126/science. ...
https://en.wikipedia.org/wiki/Post-translational_modification
CentrioleCentriole
In cell biology a centriole is a cylindrical organelle composed mainly of a protein called tubulin. Centrioles are found in ... "Posttranslational glutamylation of alpha-tubulin". Science. 247 (4938): 83-5. Bibcode:1990Sci...247...83E. doi:10.1126/science. ...
https://en.wikipedia.org/wiki/Centriole
TUBG1TUBG1
Tubulin, gamma 1 is a protein in humans that is encoded by the TUBG1 gene. This gene encodes a member of the tubulin ... "Entrez Gene: Tubulin, gamma 1". Zhang X, Chen Q, Feng J, Hou J, Yang F, Liu J, Jiang Q, Zhang C (July 2009). "Sequential ... gamma-tubulin in atypical ductal hyperplasia and carcinoma of the breast". Cancer Science. 100 (4): 580-7. doi:10.1111/j.1349- ... "A direct interaction with NEDD1 regulates gamma-tubulin recruitment to the centrosome". PLOS ONE. 5 (3): e9618. doi:10.1371/ ...
https://en.wikipedia.org/wiki/TUBG1
CentrosomeCentrosome
For instance, their capacity to incorporate γ-TuRC complexes (see also: γ-tubulin) can be very variable, and so their capacity ... Eddé, B.; Rossier; Le Caer; Desbruyères; Gros; Denoulet (1990). "Posttranslational glutamylation of alpha-tubulin". Science. ... including γ-tubulin, pericentrin and ninein. In general, each centriole of the centrosome is based on a nine-triplet ...
https://en.wikipedia.org/wiki/Centrosome
TUBE1TUBE1
Chang P, Stearns T (January 2000). "Delta-tubulin and epsilon-tubulin: two new human centrosomal tubulins reveal new aspects of ... Tubulin, epsilon 1 is a protein in humans that is encoded by the TUBE1 gene. This gene encodes a member of the tubulin ... "Entrez Gene: Tubulin, epsilon 1". Chang P, Giddings TH, Winey M, Stearns T (January 2003). "Epsilon-tubulin is required for ... Zanic M, Stear JH, Hyman AA, Howard J (October 2009). May RC (ed.). "EB1 recognizes the nucleotide state of tubulin in the ...
https://en.wikipedia.org/wiki/TUBE1
TUBBTUBB
"Entrez Gene: TUBB tubulin, beta". Goo YH, Sohn YC, Kim DH, Kim SW, Kang MJ, Jung DJ, Kwak E, Barlev NA, Berger SL, Chow VT, ... Tubulin beta chain is a protein that in humans is encoded by the TUBB gene. TUBB has been shown to interact with NCOA6 and SYT9 ... Volz A, Weiss E, Trowsdale J, Ziegler A (Jan 1994). "Presence of an expressed beta-tubulin gene (TUBB) in the HLA class I ... Lee MG, Lewis SA, Wilde CD, Cowan NJ (Jun 1983). "Evolutionary history of a multigene family: an expressed human beta-tubulin ...
https://en.wikipedia.org/wiki/TUBB
TUBD1TUBD1
Chang P, Stearns T (January 2000). "Delta-tubulin and epsilon-tubulin: two new human centrosomal tubulins reveal new aspects of ... "Entrez Gene: Tubulin, delta 1". Krebs DL, Uren RT, Metcalf D, Rakar S, Zhang JG, Starr R, De Souza DP, Hanzinikolas K, Eyles J ... Tubulin, delta 1 is a protein in humans that is encoded by the TUBD1 gene. GRCh38: Ensembl release 89: ENSG00000108423 - ... Kato A, Nagata Y, Todokoro K (May 2004). "Delta-tubulin is a component of intercellular bridges and both the early and mature ...
https://en.wikipedia.org/wiki/TUBD1
Spasmodic dysphoniaSpasmodic dysphonia
This gene encodes a tubulin gene. The pathophysiology of this condition has yet to be determined. There are a number of ...
https://en.wikipedia.org/wiki/Spasmodic_dysphonia
TTBK2TTBK2
Tau tubulin kinase 2 is a protein in humans that is encoded by the TTBK2 gene. This gene encodes a serine-threonine kinase that ... "Entrez Gene: Tau tubulin kinase 2". Retrieved 2012-06-11. Houlden H, Johnson J, Gardner-Thorpe C, Lashley T, Hernandez D, Worth ... purification and crystallization of a human tau-tubulin kinase 2 that phosphorylates tau protein". Acta Crystallographica ... putatively phosphorylates tau and tubulin proteins. Mutations in this gene cause spinocerebellar ataxia type 11 (SCA11); a ...
https://en.wikipedia.org/wiki/TTBK2
tubulin complex | SGDtubulin complex | SGD
Gene Ontology Term: tubulin complex. GO ID. GO:0045298 Aspect. Cellular Component. Description. A heterodimer of tubulins alpha ...
https://www.yeastgenome.org/go/GO:0045298
TBCD tubulin folding cofactor D [Homo sapiens (human)] - Gene - NCBITBCD tubulin folding cofactor D [Homo sapiens (human)] - Gene - NCBI
TFCD_C; Tubulin folding cofactor D C terminal. cl19887. Location:63 → 914. TFCD_C; Tubulin folding cofactor D C terminal. ... TFCD_C; Tubulin folding cofactor D C terminal. cl19887. Location:63 → 887. TFCD_C; Tubulin folding cofactor D C terminal. ... TFCD_C; Tubulin folding cofactor D C terminal. cl19887. Location:63 → 795. TFCD_C; Tubulin folding cofactor D C terminal. ... TFCD_C; Tubulin folding cofactor D C terminal. cl19887. Location:342 → 897. TFCD_C; Tubulin folding cofactor D C terminal. ...
https://www.ncbi.nlm.nih.gov/gene/6904
Tubulin News, Articles | The Scientist Magazine®Tubulin News, Articles | The Scientist Magazine®
A newly discovered family of tubulins-members of the cytoskeleton-encoded by bacteriophages plays a role in arranging the ... Technique allows researchers to see the inner workings of cellular scaffolding molecules actin and tubulin. ...
https://www.the-scientist.com/tag/tubulin
Anti-gamma Tubulin antibody (ab11317) | AbcamAnti-gamma Tubulin antibody (ab11317) | Abcam
Rabbit polyclonal gamma Tubulin antibody. Validated in WB, ICC/IF and tested in Mouse, Rat, Human, Chinese hamster. Cited in 88 ... Tubulin is the major constituent of microtubules. Gamma tubulin is found at microtubule organizing centers (MTOC) such as the ... All lanes : Anti-gamma Tubulin antibody (ab11317) at 1/1000 dilution. Lane 1 : A431 cell lysate. Lane 2 : HeLa cell lysate. ... I also see a staining that is typical to alpha and beta tubulin even if it is written on the data sheet it is not suppose to ...
https://www.abcam.com/gamma-tubulin-antibody-ab11317.html?pageNumber=2
Posttranslational Glutamylation of α-Tubulin - NASA/ADSPosttranslational Glutamylation of α-Tubulin - NASA/ADS
... localized within a region of α-tubulin that is important in the interactions of tubulin with microtubule-associated proteins ... Several variants of α-tubulin can be posttranslationally labeled after incubation of cells with [^3H]acetate or [^3H]glutamate ... The high degree of tubulin heterogeneity in neurons is controlled mainly at the posttranslational level. ... localized within a region of α-tubulin that is important in the interactions of tubulin with microtubule-associated proteins ...
https://ui.adsabs.harvard.edu/abs/1990Sci...247...83E
Tubulin DAMA colchicineTubulin DAMA colchicine
Protein Data Bank structure code 1SA0 (tubulin-DAMA colchicine:RB3-SLD). Ravelli, R. B. G.; Gigant, B.; Curmi, P. A.; Jourdain ...
https://personalpages.manchester.ac.uk/staff/T.Wallace/Tubulin_colchicine.html
Addgene: pmEGFP a tubulin IRES puro2b SequencesAddgene: pmEGFP a tubulin IRES puro2b Sequences
Author sequence GATCCGCGGCCGCATAGATAACTGATCCAGTGTGCTGGAATTAATTCGCTGTCTGCGAGGGCCAGCTGTT GGGGTGAGTACTCCCTCTCAAAAGCGGGCATGACTTCTGCGCTAAGATTGTCAGTTTCCAAAAACGAGGA GGATTTGATATTCACCTGGCCCGCGGTGATGCCTTTGAGGGTGGCCGCGTCCATCTGGTCAGAAAAGACA ATCTTTTTGTTGTCAAGCTTGAGGTGTGGCAGGCTTGAGATCTGGCCATACACTTGAGTGACAATGACAT CCACTTTGCCTTTCTCTCCACAGGTGTCCACTCCCAGGTCCAACTGCAGGTCGAGCATGCATCTAGGGCG GCCAATTCCGCCCCTCTCCCTCCCCCCCCCCTAACGTTACTGGCCGAAGCCGCTTGGAATAAGGCCGGTG TGCGTTTGTCTATATGTGATTTTCCACCATATTGCCGTCTTTTGGCAATGTGAGGGCCCGGAAACCTGGC CCTGTCTTCTTGACGAGCATTCCTAGGGGTCTTTCCCCTCTCGCCAAAGGAATGCAAGGTCTGTTGAATG TCGTGAAGGAAGCAGTTCCTCTGGAAGCTTCTTGAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCA GCGGAACCCCCCACCTGGCGACAGGTGCCTCTGCGGCCAAAAGCCACGTGTATAAGATACACCTGCAAAG GCGGCACAACCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGGAAAGAGTCAAATGGCTCTCCTCAAGCG TATTCAACAAGGGGCTGAAGGATGCCCAGAAGGTACCCCATTGTATGGGATCTGATCTGGGGCCTCGGTG CACATGCTTTACATGTGTTTAGTCGAGGTTAAAAAAACGTCTAGGCCCCCCGAACCACGGGGACGTGGTT TTCCTTTGAAAAACACGATGATAAGCTTGCCACAACCCACAAGGAGACGACCTTCCATGACCGAGTACAA ...
https://www.addgene.org/21042/sequences/
WikiGenes - TUB3 - alpha-tubulin TUB3WikiGenes - TUB3 - alpha-tubulin TUB3
Even the modest excess of beta-tubulin produced by genetic alterations such as deletion of the minor alpha-tubulin gene TUB3 ... Insertions of up to 17 amino acids into a region of alpha-tubulin do not disrupt function in vivo. Schatz, P.J., Georges, G.E ... The two alpha-tubulin isotypes in budding yeast have opposing effects on microtubule dynamics in vitro. Bode, C.J., Gupta, M.L ... Modulation of tubulin polypeptide ratios by the yeast protein Pac10p. Alvarez, P., Smith, A., Fleming, J., Solomon, F. Genetics ...
https://www.wikigenes.org/e/gene/e/854915.html
beta Tubulin Polyclonal Antibody (PA1-16947) beta Tubulin Polyclonal Antibody (PA1-16947)
Invitrogen Anti-beta Tubulin Polyclonal, Catalog # PA1-16947. Tested in Western Blot (WB), Immunocytochemistry (ICC/IF) and ...
https://www.thermofisher.com/antibody/product/beta-Tubulin-Antibody-Polyclonal/PA1-16947
Tau-tubulin kinase 1 phosphorylates TDP-43 at disease-relevant sites and exacerbates TDP-43 pathology - Merck.comTau-tubulin kinase 1 phosphorylates TDP-43 at disease-relevant sites and exacerbates TDP-43 pathology - Merck.com
Tau-tubulin kinase 1 phosphorylates TDP-43 at disease-relevant sites and exacerbates TDP-43 pathology. ...
https://www.merck.com/publication/tau-tubulin-kinase-1-phosphorylates-tdp-43-at-disease-relevant-sites-and-exacerbates-tdp-43-pathology/
Method for selectively modulating the interactions between survivin and tubulin - Patent US-6346389-B1 - PubChemMethod for selectively modulating the interactions between survivin and tubulin - Patent US-6346389-B1 - PubChem
US-6346389-B1 chemical patent summary.
https://pubchem.ncbi.nlm.nih.gov/patent/US-6346389-B1
Anti-α-Tubulin antibody, Mouse monoclonal clone DM1A, purified from hybridoma cell culture | Sigma-AldrichAnti-α-Tubulin antibody, Mouse monoclonal clone DM1A, purified from hybridoma cell culture | Sigma-Aldrich
Anti-α-Tubulin antibody, Mouse monoclonal has been used in immunocytofluorescence and western blot analysis; Anti-α-Tubulin a ... Monoclonal Anti-α-Tubulin); monoclonal DM1A, purified from hybridoma cell culture; Suitable for immunoprecipitation (IP); ... β-tubulin isotype I +II, β-tubulin isotype III, tyrosine tubulin, and the acetylated form of α-tubulin) provide a specific and ... Tubulin is a heterodimer that consists of α-tubulin and β-tubulin. Both subunits have a molecular weight of approx. 50 kDa and ...
https://www.sigmaaldrich.com/ES/es/product/sigma/t6199
α 3 Tubulin Anticorpo | SCBT - Santa Cruz Biotechnologyα 3 Tubulin Anticorpo | SCBT - Santa Cruz Biotechnology
Adquira alpha 3 tubulin anticorpos da Santa Cruz Biotecnologia, Inc. Anticorpos monoclonais estão disponíveis para a maioria ... α 1 Tubulin, α 4 Tubulin, α Tubulin, β Tubulin, β 2 Tubulin, β 3 Tubulin, δ Tubulin, ε Tubulin e γ Tubulin ... α 3 Tubulin Anticorpos e Produtos relacionados. A Santa Cruz Biotecnologia, Inc. oferece uma grande linha de α 3 Tubulin ... Selecione α 3 Tubulin anticorpos da lista de anticorpos monoclonais abaixo. Veja maiores detalhes α 3 Tubulin das ...
https://www.scbt.com/pt/browse/alpha-3-tubulin-Anticorpos/_/N-12zu6cz
RCSB PDB - 1V6E: Solution Structure of a N-terminal Ubiquitin-like Domain in Mouse Tubulin-specific Chaperone BRCSB PDB - 1V6E: Solution Structure of a N-terminal Ubiquitin-like Domain in Mouse Tubulin-specific Chaperone B
Solution Structure of a N-terminal Ubiquitin-like Domain in Mouse Tubulin-specific Chaperone B ... Solution Structure of a N-terminal Ubiquitin-like Domain in Mouse Tubulin-specific Chaperone B. Zhao, C., Kigawa, T., Saito, K. ... Solution Structure of a N-terminal Ubiquitin-like Domain in Mouse Tubulin-specific Chaperone B. *PDB DOI: 10.2210/pdb1V6E/pdb ...
https://www.rcsb.org/structure/1v6e
positive regulation of tubulin deacetylase activity - Ontology Report - Rat Genome Databasepositive regulation of tubulin deacetylase activity - Ontology Report - Rat Genome Database
positive regulation of tubulin deacetylase activity. go back to main search page ... Any process that activates or increases the frequency, rate or extent of tubulin deacetylase activity. ...
https://rgd.mcw.edu/rgdweb/ontology/annot.html?acc_id=GO:0150068
gamma Tubulin (TUBG1) (434-449) Mouse Monoclonal Antibody [Clone ID: TU-32] - AM03180PU-N | OriGenegamma Tubulin (TUBG1) (434-449) Mouse Monoclonal Antibody [Clone ID: TU-32] - AM03180PU-N | OriGene
gamma Tubulin (TUBG1) (434-449) mouse monoclonal antibody, clone TU-32, Aff - Purified ... is a minor member of tubulin family (less that 0.01% of tubulin dimer). The γ-tubulin ring structures, however, serve to ... which is identical for gamma-tubulin 1 and gamma-tubulin 2.. Formulation. PBS, pH~7.4 containing 15 mM Sodium Azide as ... Human gamma-Tubulin peptide, amino acids 434-449. Specificity. The antibody TU-32 recognizes C-terminus (amino acids 434-449 in ...
https://www.origene.com/catalog/antibodies/primary-antibodies/am03180pu-n/gamma-tubulin-tubg1-434-449-mouse-monoclonal-antibody-clone-id-tu-32
A structure-based design of new C2- and C13-substituted taxanes: tubulin binding affinities and extended quantitative structure...A structure-based design of new C2- and C13-substituted taxanes: tubulin binding affinities and extended quantitative structure...
... at the C2 and C13 positions of the baccatin core have been synthesized and their binding affinities for mammalian tubulin have ... The tubulin-binding affinity displayed by one of the new compounds (CTX63) proved to be higher than that of docetaxel. , and an ... and oxygen probes within the taxane-binding site of β-tubulin, and (ii) the prospective use of a structure-based QSAR (COMBINE ... Our results shed additional light on the determinants of tubulin-binding affinity for this important class of antitumour agents ...
https://pubs.rsc.org/en/content/articlelanding/2013/OB/c3ob40407b
Nuclear localization of {gamma}-tubulin affects E2F transcriptional activity and S-phase progression.<...Nuclear localization of {gamma}-tubulin affects E2F transcriptional activity and S-phase progression.<...
γ-Tubulin mutants showed that the C terminus interacts with the transcription factor E2F1 and that the E2F1-γ-tubulin complex ... γ-Tubulin mutants showed that the C terminus interacts with the transcription factor E2F1 and that the E2F1-γ-tubulin complex ... γ-Tubulin mutants showed that the C terminus interacts with the transcription factor E2F1 and that the E2F1-γ-tubulin complex ... γ-Tubulin mutants showed that the C terminus interacts with the transcription factor E2F1 and that the E2F1-γ-tubulin complex ...
https://portal.research.lu.se/en/publications/nuclear-localization-of-gamma-tubulin-affects-e2f-transcriptional
Anti-Alpha Tubulin Antibody | Rabbit anti-Human Polyclonal | LSBioAnti-Alpha Tubulin Antibody | Rabbit anti-Human Polyclonal | LSBio
Alpha Tubulin antibody LS-C336141 is an unconjugated rabbit polyclonal antibody to Alpha Tubulin from human. It is reactive ... Alpha-tubulin antibody can be used for detection of alpha-tubulin by Western blot at 0.25 - 0.5 ug/ml. Antibody can also be ... Alpha Tubulin antibody LS-C336141 is an unconjugated rabbit polyclonal antibody to Alpha Tubulin from human. It is reactive ... IHC‑plus™ Alpha Tubulin Antibody (clone DM1A) LS‑B4053 Species: Human, Monkey, Mouse, Rat, Bovine, Dog, Goat, Guinea pig, ...
https://www.lsbio.com/antibodies/alpha-tubulin-antibody-elisa-if-immunofluorescence-ihc-wb-western-ls-c336141/346638
Ubiquitin-Proteasome System As A Therapeutic Target: Does Tubulin Care?Ubiquitin-Proteasome System As A Therapeutic Target: Does Tubulin Care?
... with a primary ubiquitin substrate being tubulin as ubiquitin regulates alpha/beta-tubulin turnover as well as microtubule ... especially in regard to how UPS inhibitors such as bortezomib enhance tubulin polymerization, which could underlie peripheral ... dynamics and function, though ubiquitins full regulatory control over tubulin remains unknown, ... Tubulin polymerization assay using ,99% pure tubulin, fluorescence based (Cat. # BK011P). Microtubule/Tubulin In Vivo Assay ...
https://www.cytoskeleton.com/ubiquitin-proteasome-system-as-a-therapeutic-target-does-tubulin-care
β-Tubulin Recombinant monoclonal antibody (S11B) (Mouse IgG1λ) - ENZ-ABS613 - Enzo Life Sciencesβ-Tubulin Recombinant monoclonal antibody (S11B) (Mouse IgG1λ) - ENZ-ABS613 - Enzo Life Sciences
"β-Tubulin Recombinant monoclonal antibody (S11B) (Mouse IgG1λ) - ENZ-ABS613 ...
https://www.enzolifesciences.com/ENZ-ABS613/beta-tubulin-recombinant-monoclonal-antibody-s11b-mouse-igg1-lambda/
Characterization of Drosophila betaTub9EF, a beta-tubulin paralog up-regulated at low temperature - Zurich Open Repository and...Characterization of Drosophila betaTub9EF, a beta-tubulin paralog up-regulated at low temperature - Zurich Open Repository and...
Characterization of Drosophila betaTub9EF, a beta-tubulin paralog up-regulated at low temperature. 2016, University of Zurich, ... Characterization of Drosophila betaTub9EF, a beta-tubulin paralog up-regulated at low temperature ...
https://www.zora.uzh.ch/id/eprint/130027/
One year on: Live Cell Imaging with SiR-actin, SiR-tubulin & SiR-DNA | Tebubios blogOne year on: Live Cell Imaging with SiR-actin, SiR-tubulin & SiR-DNA | Tebubio's blog
SiR-tubulin & SiR-DNA - what have these stains brought to researchers one year on? ... Launched just over a year ago, SiR-Actin (Fig 1) and SiR-Tubulin (Fig 2) have been available on the market providing the most ... I woul d like to take SiR-actin or SiR-tubulin as counterstain to distinguish my cell type in a co-culture system (these two ... In particular, SiR-Actin and SiR-Tubulin are the only stains available on the market which enable live cell imaging of the ...
https://www.tebu-bio.com/blog/one-year-on-live-cell-imaging-with-sir-actin-sir-tubulin-and-sir-dna/
Tau tubulin kinase 2 phosphorylations in cilia initiation | Faculty of Medicine Masaryk University | MED MUNITau tubulin kinase 2 phosphorylations in cilia initiation | Faculty of Medicine Masaryk University | MED MUNI
Tau tubulin kinase 2 phosphorylations in cilia initiation. Authors. KOVAŘÍKOVÁ Petra BERNATÍK Ondřej HANÁKOVÁ Kateřina ZDRÁHAL ...
https://www.med.muni.cz/en/research-and-development/research-and-development/publishing-activity/publikace-lf-mu/1397232
Tubulins | Other protein targets | IUPHAR/BPS Guide to PHARMACOLOGYTubulins | Other protein targets | IUPHAR/BPS Guide to PHARMACOLOGY
Tubulins in the IUPHAR/BPS Guide to PHARMACOLOGY. ... TUBA3 , tubulin, alpha 1a , tubulin, alpha 1A , tubulin Genes. ... tubulin beta class I Previous and unofficial names. beta1-tubulin , TUBB5 , tubulin, beta class I , tubulin, beta 5 class I , ... These are thought to act primarily through β-tubulin, thereby interfering with the normal processes of tubulin polymer ... Tubulins C. Unless otherwise stated all data on this page refer to the human proteins. Gene information is provided for human ( ...
https://www.guidetopharmacology.org/GRAC/FamilyDisplayForward?familyId=858
Abstract 5096: ALIBI: a novel, truncated tubulin isotype in AML and stem cells | Citedby Results | Cancer Research | American...Abstract 5096: ALIBI: a novel, truncated tubulin isotype in AML and stem cells | Citedby Results | Cancer Research | American...
... with β-1 tubulin (TUBB1) restricted to hematopoietic tissues. Using the TCGA database, we found that ... Abstract 5096: ALIBI: a novel, truncated tubulin isotype in AML and stem cells. Cancer Res (2015) 75 (15_Supplement): 5096. ...
https://aacrjournals.org/cancerres/crossref-citedby/604342
ENZYME - 3.4.17.24 tubulin-glutamate carboxypeptidaseENZYME - 3.4.17.24 tubulin-glutamate carboxypeptidase
C-terminal L-alpha-aminoacyl-L-glutamyl-L-glutamyl-[tubulin] + H2O <=> C-terminal L-alpha-aminoacyl-L-glutamyl-[tubulin] + L- ... C-terminal L-alpha-aminoacyl-L-glutamyl-[tubulin] + H2O <=> C-terminal L-alpha-aminoacyl-[tubulin] + L-glutamate ... In addition, the enzyme removes two glutamate residues from the C-terminus of beta-tubulin and detyrosinated alpha-tubulin ( ... The latter is cleaved to Delta2-tubulin and further to Delta3- tubulin. ...
https://enzyme.expasy.org/EC/3.4.17.24
EN (en)EN (en)
The generation of different tubulin variants in yeast now demonstrates how single amino-acid differences or post-translational ... Genetically encoded and post-translationally generated variations of tubulin C-terminal tails give rise to extensive ...
https://research.pasteur.fr/en/publication/towards-elucidating-the-tubulin-code/
γ-Tubulin stands up to be counted | Journal of Cell Biology | Rockefeller University Pressγ-Tubulin stands up to be counted | Journal of Cell Biology | Rockefeller University Press
count the number of γ-tubulin complexes that assemble together to nucleate microtubules in S. cerevisiae. ... An extended γ-tubulin ring functions as a stable platform in microtubule nucleation. How γ-tubulin nucleates microtubules in ... In vitro, γ-TuSCs form a spiral with 13 γ-tubulin molecules per turn, which could serve as a template for the 13 tubulin ... γ-Tubulin (green) localizes to the minus end of a single microtubule (red) that has been detached from the spindle pole body. ...
https://rupress.org/jcb/article/197/1/2/36811/Tubulin-stands-up-to-be-counted
Kinesin-5-Tubulin Complex with AMPPNP | NIH 3D Print ExchangeKinesin-5-Tubulin Complex with AMPPNP | NIH 3D Print Exchange
EG5, KLP61F, kinesin, Tubulin, mitosis, KINESIN-5, GTP-binding, motor protein, cell division, CELL CYCLE ...
https://3dprint.nih.gov/discover/3DPX-007940

No FAQ available that match "tubulin"

No images available that match "tubulin"