Transfection: The uptake of naked or purified DNA by CELLS, usually meaning the process as it occurs in eukaryotic cells. It is analogous to bacterial transformation (TRANSFORMATION, BACTERIAL) and both are routinely employed in GENE TRANSFER TECHNIQUES.Cell Line: Established cell cultures that have the potential to propagate indefinitely.Base Sequence: The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.Plasmids: Extrachromosomal, usually CIRCULAR DNA molecules that are self-replicating and transferable from one organism to another. They are found in a variety of bacterial, archaeal, fungal, algal, and plant species. They are used in GENETIC ENGINEERING as CLONING VECTORS.Promoter Regions, Genetic: DNA sequences which are recognized (directly or indirectly) and bound by a DNA-dependent RNA polymerase during the initiation of transcription. Highly conserved sequences within the promoter include the Pribnow box in bacteria and the TATA BOX in eukaryotes.Molecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.Polyethyleneimine: Strongly cationic polymer that binds to certain proteins; used as a marker in immunology, to precipitate and purify enzymes and lipids. Synonyms: aziridine polymer; Epamine; Epomine; ethylenimine polymer; Montrek; PEI; Polymin(e).DNA: A deoxyribonucleotide polymer that is the primary genetic material of all cells. Eukaryotic and prokaryotic organisms normally contain DNA in a double-stranded state, yet several important biological processes transiently involve single-stranded regions. DNA, which consists of a polysugar-phosphate backbone possessing projections of purines (adenine and guanine) and pyrimidines (thymine and cytosine), forms a double helix that is held together by hydrogen bonds between these purines and pyrimidines (adenine to thymine and guanine to cytosine).Genetic Vectors: DNA molecules capable of autonomous replication within a host cell and into which other DNA sequences can be inserted and thus amplified. Many are derived from PLASMIDS; BACTERIOPHAGES; or VIRUSES. They are used for transporting foreign genes into recipient cells. Genetic vectors possess a functional replicator site and contain GENETIC MARKERS to facilitate their selective recognition.Tumor Cells, Cultured: Cells grown in vitro from neoplastic tissue. If they can be established as a TUMOR CELL LINE, they can be propagated in cell culture indefinitely.Transcription, Genetic: The biosynthesis of RNA carried out on a template of DNA. The biosynthesis of DNA from an RNA template is called REVERSE TRANSCRIPTION.Luciferases: Enzymes that oxidize certain LUMINESCENT AGENTS to emit light (PHYSICAL LUMINESCENCE). The luciferases from different organisms have evolved differently so have different structures and substrates.RNA, Messenger: RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.Gene Transfer Techniques: The introduction of functional (usually cloned) GENES into cells. A variety of techniques and naturally occurring processes are used for the gene transfer such as cell hybridization, LIPOSOMES or microcell-mediated gene transfer, ELECTROPORATION, chromosome-mediated gene transfer, TRANSFECTION, and GENETIC TRANSDUCTION. Gene transfer may result in genetically transformed cells and individual organisms.Cells, Cultured: Cells propagated in vitro in special media conducive to their growth. Cultured cells are used to study developmental, morphologic, metabolic, physiologic, and genetic processes, among others.Gene Expression Regulation: Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control (induction or repression) of gene action at the level of transcription or translation.Genes, Reporter: Genes whose expression is easily detectable and therefore used to study promoter activity at many positions in a target genome. In recombinant DNA technology, these genes may be attached to a promoter region of interest.Electroporation: A technique in which electric pulses of intensity in kilovolts per centimeter and of microsecond-to-millisecond duration cause a temporary loss of the semipermeability of CELL MEMBRANES, thus leading to ion leakage, escape of metabolites, and increased uptake by cells of drugs, molecular probes, and DNA.RNA, Small Interfering: Small double-stranded, non-protein coding RNAs (21-31 nucleotides) involved in GENE SILENCING functions, especially RNA INTERFERENCE (RNAi). Endogenously, siRNAs are generated from dsRNAs (RNA, DOUBLE-STRANDED) by the same ribonuclease, Dicer, that generates miRNAs (MICRORNAS). The perfect match of the siRNAs' antisense strand to their target RNAs mediates RNAi by siRNA-guided RNA cleavage. siRNAs fall into different classes including trans-acting siRNA (tasiRNA), repeat-associated RNA (rasiRNA), small-scan RNA (scnRNA), and Piwi protein-interacting RNA (piRNA) and have different specific gene silencing functions.Cell Line, Tumor: A cell line derived from cultured tumor cells.Genetic Therapy: Techniques and strategies which include the use of coding sequences and other conventional or radical means to transform or modify cells for the purpose of treating or reversing disease conditions.Liposomes: Artificial, single or multilaminar vesicles (made from lecithins or other lipids) that are used for the delivery of a variety of biological molecules or molecular complexes to cells, for example, drug delivery and gene transfer. They are also used to study membranes and membrane proteins.Gene Expression: The phenotypic manifestation of a gene or genes by the processes of GENETIC TRANSCRIPTION and GENETIC TRANSLATION.DNA-Binding Proteins: Proteins which bind to DNA. The family includes proteins which bind to both double- and single-stranded DNA and also includes specific DNA binding proteins in serum which can be used as markers for malignant diseases.Transcription Factors: Endogenous substances, usually proteins, which are effective in the initiation, stimulation, or termination of the genetic transcription process.Cloning, Molecular: The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.Chloramphenicol O-Acetyltransferase: An enzyme that catalyzes the acetylation of chloramphenicol to yield chloramphenicol 3-acetate. Since chloramphenicol 3-acetate does not bind to bacterial ribosomes and is not an inhibitor of peptidyltransferase, the enzyme is responsible for the naturally occurring chloramphenicol resistance in bacteria. The enzyme, for which variants are known, is found in both gram-negative and gram-positive bacteria. EC 2.3.1.28.DNA, Complementary: Single-stranded complementary DNA synthesized from an RNA template by the action of RNA-dependent DNA polymerase. cDNA (i.e., complementary DNA, not circular DNA, not C-DNA) is used in a variety of molecular cloning experiments as well as serving as a specific hybridization probe.HeLa Cells: The first continuously cultured human malignant CELL LINE, derived from the cervical carcinoma of Henrietta Lacks. These cells are used for VIRUS CULTIVATION and antitumor drug screening assays.Green Fluorescent Proteins: Protein analogs and derivatives of the Aequorea victoria green fluorescent protein that emit light (FLUORESCENCE) when excited with ULTRAVIOLET RAYS. They are used in REPORTER GENES in doing GENETIC TECHNIQUES. Numerous mutants have been made to emit other colors or be sensitive to pH.Amino Acid Sequence: The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.Cations: Positively charged atoms, radicals or groups of atoms which travel to the cathode or negative pole during electrolysis.COS Cells: CELL LINES derived from the CV-1 cell line by transformation with a replication origin defective mutant of SV40 VIRUS, which codes for wild type large T antigen (ANTIGENS, POLYOMAVIRUS TRANSFORMING). They are used for transfection and cloning. (The CV-1 cell line was derived from the kidney of an adult male African green monkey (CERCOPITHECUS AETHIOPS).)Transcriptional Activation: Processes that stimulate the GENETIC TRANSCRIPTION of a gene or set of genes.Cricetinae: A subfamily in the family MURIDAE, comprising the hamsters. Four of the more common genera are Cricetus, CRICETULUS; MESOCRICETUS; and PHODOPUS.Recombinant Fusion Proteins: Recombinant proteins produced by the GENETIC TRANSLATION of fused genes formed by the combination of NUCLEIC ACID REGULATORY SEQUENCES of one or more genes with the protein coding sequences of one or more genes.Blotting, Western: Identification of proteins or peptides that have been electrophoretically separated by blot transferring from the electrophoresis gel to strips of nitrocellulose paper, followed by labeling with antibody probes.Mutation: Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.Recombinant Proteins: Proteins prepared by recombinant DNA technology.Signal Transduction: The intracellular transfer of information (biological activation/inhibition) through a signal pathway. In each signal transduction system, an activation/inhibition signal from a biologically active molecule (hormone, neurotransmitter) is mediated via the coupling of a receptor/enzyme to a second messenger system or to an ion channel. Signal transduction plays an important role in activating cellular functions, cell differentiation, and cell proliferation. Examples of signal transduction systems are the GAMMA-AMINOBUTYRIC ACID-postsynaptic receptor-calcium ion channel system, the receptor-mediated T-cell activation pathway, and the receptor-mediated activation of phospholipases. Those coupled to membrane depolarization or intracellular release of calcium include the receptor-mediated activation of cytotoxic functions in granulocytes and the synaptic potentiation of protein kinase activation. Some signal transduction pathways may be part of larger signal transduction pathways; for example, protein kinase activation is part of the platelet activation signal pathway.Reverse Transcriptase Polymerase Chain Reaction: A variation of the PCR technique in which cDNA is made from RNA via reverse transcription. The resultant cDNA is then amplified using standard PCR protocols.Cell Survival: The span of viability of a cell characterized by the capacity to perform certain functions such as metabolism, growth, reproduction, some form of responsiveness, and adaptability.Apoptosis: One of the mechanisms by which CELL DEATH occurs (compare with NECROSIS and AUTOPHAGOCYTOSIS). Apoptosis is the mechanism responsible for the physiological deletion of cells and appears to be intrinsically programmed. It is characterized by distinctive morphologic changes in the nucleus and cytoplasm, chromatin cleavage at regularly spaced sites, and the endonucleolytic cleavage of genomic DNA; (DNA FRAGMENTATION); at internucleosomal sites. This mode of cell death serves as a balance to mitosis in regulating the size of animal tissues and in mediating pathologic processes associated with tumor growth.Polylysine: A peptide which is a homopolymer of lysine.DNA Primers: Short sequences (generally about 10 base pairs) of DNA that are complementary to sequences of messenger RNA and allow reverse transcriptases to start copying the adjacent sequences of mRNA. Primers are used extensively in genetic and molecular biology techniques.Cation Exchange Resins: High molecular weight insoluble polymers which contain functional anionic groups that are capable of undergoing exchange reactions with cations.Binding Sites: The parts of a macromolecule that directly participate in its specific combination with another molecule.Quaternary Ammonium Compounds: Derivatives of ammonium compounds, NH4+ Y-, in which all four of the hydrogens bonded to nitrogen have been replaced with hydrocarbyl groups. These are distinguished from IMINES which are RN=CR2.Cercopithecus aethiops: A species of CERCOPITHECUS containing three subspecies: C. tantalus, C. pygerythrus, and C. sabeus. They are found in the forests and savannah of Africa. The African green monkey (C. pygerythrus) is the natural host of SIMIAN IMMUNODEFICIENCY VIRUS and is used in AIDS research.Down-Regulation: A negative regulatory effect on physiological processes at the molecular, cellular, or systemic level. At the molecular level, the major regulatory sites include membrane receptors, genes (GENE EXPRESSION REGULATION), mRNAs (RNA, MESSENGER), and proteins.Nuclear Proteins: Proteins found in the nucleus of a cell. Do not confuse with NUCLEOPROTEINS which are proteins conjugated with nucleic acids, that are not necessarily present in the nucleus.CHO Cells: CELL LINE derived from the ovary of the Chinese hamster, Cricetulus griseus (CRICETULUS). The species is a favorite for cytogenetic studies because of its small chromosome number. The cell line has provided model systems for the study of genetic alterations in cultured mammalian cells.DNA, Antisense: DNA that is complementary to the sense strand. (The sense strand has the same sequence as the mRNA transcript. The antisense strand is the template for mRNA synthesis.) Synthetic antisense DNAs are used to hybridize to complementary sequences in target RNAs or DNAs to effect the functioning of specific genes for investigative or therapeutic purposes.Gene Expression Regulation, Enzymologic: Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action in enzyme synthesis.3T3 Cells: Cell lines whose original growing procedure consisted being transferred (T) every 3 days and plated at 300,000 cells per plate (J Cell Biol 17:299-313, 1963). Lines have been developed using several different strains of mice. Tissues are usually fibroblasts derived from mouse embryos but other types and sources have been developed as well. The 3T3 lines are valuable in vitro host systems for oncogenic virus transformation studies, since 3T3 cells possess a high sensitivity to CONTACT INHIBITION.DNA, Viral: Deoxyribonucleic acid that makes up the genetic material of viruses.Protein Binding: The process in which substances, either endogenous or exogenous, bind to proteins, peptides, enzymes, protein precursors, or allied compounds. Specific protein-binding measures are often used as assays in diagnostic assessments.Fibroblasts: Connective tissue cells which secrete an extracellular matrix rich in collagen and other macromolecules.Trans-Activators: Diffusible gene products that act on homologous or heterologous molecules of viral or cellular DNA to regulate the expression of proteins.Cell Division: The fission of a CELL. It includes CYTOKINESIS, when the CYTOPLASM of a cell is divided, and CELL NUCLEUS DIVISION.beta-Galactosidase: A group of enzymes that catalyzes the hydrolysis of terminal, non-reducing beta-D-galactose residues in beta-galactosides. Deficiency of beta-Galactosidase A1 may cause GANGLIOSIDOSIS, GM1.Cell Nucleus: Within a eukaryotic cell, a membrane-limited body which contains chromosomes and one or more nucleoli (CELL NUCLEOLUS). The nuclear membrane consists of a double unit-type membrane which is perforated by a number of pores; the outermost membrane is continuous with the ENDOPLASMIC RETICULUM. A cell may contain more than one nucleus. (From Singleton & Sainsbury, Dictionary of Microbiology and Molecular Biology, 2d ed)Phosphatidylethanolamines: Derivatives of phosphatidic acids in which the phosphoric acid is bound in ester linkage to an ethanolamine moiety. Complete hydrolysis yields 1 mole of glycerol, phosphoric acid and ethanolamine and 2 moles of fatty acids.Cell Line, Transformed: Eukaryotic cell line obtained in a quiescent or stationary phase which undergoes conversion to a state of unregulated growth in culture, resembling an in vitro tumor. It occurs spontaneously or through interaction with viruses, oncogenes, radiation, or drugs/chemicals.Gene Expression Regulation, Neoplastic: Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action in neoplastic tissue.Sp1 Transcription Factor: Promoter-specific RNA polymerase II transcription factor that binds to the GC box, one of the upstream promoter elements, in mammalian cells. The binding of Sp1 is necessary for the initiation of transcription in the promoters of a variety of cellular and viral GENES.RNA Interference: A gene silencing phenomenon whereby specific dsRNAs (RNA, DOUBLE-STRANDED) trigger the degradation of homologous mRNA (RNA, MESSENGER). The specific dsRNAs are processed into SMALL INTERFERING RNA (siRNA) which serves as a guide for cleavage of the homologous mRNA in the RNA-INDUCED SILENCING COMPLEX. DNA METHYLATION may also be triggered during this process.Biolistics: Techniques where DNA is delivered directly into organelles at high speed using projectiles coated with nucleic acid, shot from a helium-powered gun (gene gun). One of these techniques involves immunization by DNA VACCINES, which delivers DNA-coated gold beads to the epidermis.Regulatory Sequences, Nucleic Acid: Nucleic acid sequences involved in regulating the expression of genes.Oligonucleotides, Antisense: Short fragments of DNA or RNA that are used to alter the function of target RNAs or DNAs to which they hybridize.Enhancer Elements, Genetic: Cis-acting DNA sequences which can increase transcription of genes. Enhancers can usually function in either orientation and at various distances from a promoter.Luminescent Proteins: Proteins which are involved in the phenomenon of light emission in living systems. Included are the "enzymatic" and "non-enzymatic" types of system with or without the presence of oxygen or co-factors.Phosphorylation: The introduction of a phosphoryl group into a compound through the formation of an ester bond between the compound and a phosphorus moiety.Cell Proliferation: All of the processes involved in increasing CELL NUMBER including CELL DIVISION.Up-Regulation: A positive regulatory effect on physiological processes at the molecular, cellular, or systemic level. At the molecular level, the major regulatory sites include membrane receptors, genes (GENE EXPRESSION REGULATION), mRNAs (RNA, MESSENGER), and proteins.Mutagenesis, Site-Directed: Genetically engineered MUTAGENESIS at a specific site in the DNA molecule that introduces a base substitution, or an insertion or deletion.Blotting, Northern: Detection of RNA that has been electrophoretically separated and immobilized by blotting on nitrocellulose or other type of paper or nylon membrane followed by hybridization with labeled NUCLEIC ACID PROBES.Virus Replication: The process of intracellular viral multiplication, consisting of the synthesis of PROTEINS; NUCLEIC ACIDS; and sometimes LIPIDS, and their assembly into a new infectious particle.Particle Size: Relating to the size of solids.Transgenes: Genes that are introduced into an organism using GENE TRANSFER TECHNIQUES.Flow Cytometry: Technique using an instrument system for making, processing, and displaying one or more measurements on individual cells obtained from a cell suspension. Cells are usually stained with one or more fluorescent dyes specific to cell components of interest, e.g., DNA, and fluorescence of each cell is measured as it rapidly transverses the excitation beam (laser or mercury arc lamp). Fluorescence provides a quantitative measure of various biochemical and biophysical properties of the cell, as well as a basis for cell sorting. Other measurable optical parameters include light absorption and light scattering, the latter being applicable to the measurement of cell size, shape, density, granularity, and stain uptake.Proto-Oncogene Proteins: Products of proto-oncogenes. Normally they do not have oncogenic or transforming properties, but are involved in the regulation or differentiation of cell growth. They often have protein kinase activity.Adenoviridae: A family of non-enveloped viruses infecting mammals (MASTADENOVIRUS) and birds (AVIADENOVIRUS) or both (ATADENOVIRUS). Infections may be asymptomatic or result in a variety of diseases.NF-kappa B: Ubiquitous, inducible, nuclear transcriptional activator that binds to enhancer elements in many different cell types and is activated by pathogenic stimuli. The NF-kappa B complex is a heterodimer composed of two DNA-binding subunits: NF-kappa B1 and relA.Nanoparticles: Nanometer-sized particles that are nanoscale in three dimensions. They include nanocrystaline materials; NANOCAPSULES; METAL NANOPARTICLES; DENDRIMERS, and QUANTUM DOTS. The uses of nanoparticles include DRUG DELIVERY SYSTEMS and cancer targeting and imaging.Response Elements: Nucleotide sequences, usually upstream, which are recognized by specific regulatory transcription factors, thereby causing gene response to various regulatory agents. These elements may be found in both promoter and enhancer regions.Fatty Acids, Monounsaturated: Fatty acids which are unsaturated in only one position.Mice, Nude: Mutant mice homozygous for the recessive gene "nude" which fail to develop a thymus. They are useful in tumor studies and studies on immune responses.Restriction Mapping: Use of restriction endonucleases to analyze and generate a physical map of genomes, genes, or other segments of DNA.Polymerase Chain Reaction: In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships.Gene Silencing: Interruption or suppression of the expression of a gene at transcriptional or translational levels.Cell Transformation, Neoplastic: Cell changes manifested by escape from control mechanisms, increased growth potential, alterations in the cell surface, karyotypic abnormalities, morphological and biochemical deviations from the norm, and other attributes conferring the ability to invade, metastasize, and kill.Sequence Deletion: Deletion of sequences of nucleic acids from the genetic material of an individual.Drug Carriers: Forms to which substances are incorporated to improve the delivery and the effectiveness of drugs. Drug carriers are used in drug-delivery systems such as the controlled-release technology to prolong in vivo drug actions, decrease drug metabolism, and reduce drug toxicity. Carriers are also used in designs to increase the effectiveness of drug delivery to the target sites of pharmacological actions. Liposomes, albumin microspheres, soluble synthetic polymers, DNA complexes, protein-drug conjugates, and carrier erythrocytes among others have been employed as biodegradable drug carriers.Cell Differentiation: Progressive restriction of the developmental potential and increasing specialization of function that leads to the formation of specialized cells, tissues, and organs.Carrier Proteins: Transport proteins that carry specific substances in the blood or across cell membranes.Microscopy, Fluorescence: Microscopy of specimens stained with fluorescent dye (usually fluorescein isothiocyanate) or of naturally fluorescent materials, which emit light when exposed to ultraviolet or blue light. Immunofluorescence microscopy utilizes antibodies that are labeled with fluorescent dye.Electrophoretic Mobility Shift Assay: An electrophoretic technique for assaying the binding of one compound to another. Typically one compound is labeled to follow its mobility during electrophoresis. If the labeled compound is bound by the other compound, then the mobility of the labeled compound through the electrophoretic medium will be retarded.Time Factors: Elements of limited time intervals, contributing to particular results or situations.Genes, Viral: The functional hereditary units of VIRUSES.Polymers: Compounds formed by the joining of smaller, usually repeating, units linked by covalent bonds. These compounds often form large macromolecules (e.g., BIOPOLYMERS; PLASTICS).Gene Expression Regulation, Viral: Any of the processes by which cytoplasmic factors influence the differential control of gene action in viruses.DNA, Recombinant: Biologically active DNA which has been formed by the in vitro joining of segments of DNA from different sources. It includes the recombination joint or edge of a heteroduplex region where two recombining DNA molecules are connected.Membrane Proteins: Proteins which are found in membranes including cellular and intracellular membranes. They consist of two types, peripheral and integral proteins. They include most membrane-associated enzymes, antigenic proteins, transport proteins, and drug, hormone, and lectin receptors.Enzyme Activation: Conversion of an inactive form of an enzyme to one possessing metabolic activity. It includes 1, activation by ions (activators); 2, activation by cofactors (coenzymes); and 3, conversion of an enzyme precursor (proenzyme or zymogen) to an active enzyme.Oligodeoxyribonucleotides: A group of deoxyribonucleotides (up to 12) in which the phosphate residues of each deoxyribonucleotide act as bridges in forming diester linkages between the deoxyribose moieties.MicroRNAs: Small double-stranded, non-protein coding RNAs, 21-25 nucleotides in length generated from single-stranded microRNA gene transcripts by the same RIBONUCLEASE III, Dicer, that produces small interfering RNAs (RNA, SMALL INTERFERING). They become part of the RNA-INDUCED SILENCING COMPLEX and repress the translation (TRANSLATION, GENETIC) of target RNA by binding to homologous 3'UTR region as an imperfect match. The small temporal RNAs (stRNAs), let-7 and lin-4, from C. elegans, are the first 2 miRNAs discovered, and are from a class of miRNAs involved in developmental timing.Oncogenes: Genes whose gain-of-function alterations lead to NEOPLASTIC CELL TRANSFORMATION. They include, for example, genes for activators or stimulators of CELL PROLIFERATION such as growth factors, growth factor receptors, protein kinases, signal transducers, nuclear phosphoproteins, and transcription factors. A prefix of "v-" before oncogene symbols indicates oncogenes captured and transmitted by RETROVIRUSES; the prefix "c-" before the gene symbol of an oncogene indicates it is the cellular homolog (PROTO-ONCOGENES) of a v-oncogene.Genes: A category of nucleic acid sequences that function as units of heredity and which code for the basic instructions for the development, reproduction, and maintenance of organisms.NIH 3T3 Cells: A continuous cell line of high contact-inhibition established from NIH Swiss mouse embryo cultures. The cells are useful for DNA transfection and transformation studies. (From ATCC [Internet]. Virginia: American Type Culture Collection; c2002 [cited 2002 Sept 26]. Available from http://www.atcc.org/)Lipids: A generic term for fats and lipoids, the alcohol-ether-soluble constituents of protoplasm, which are insoluble in water. They comprise the fats, fatty oils, essential oils, waxes, phospholipids, glycolipids, sulfolipids, aminolipids, chromolipids (lipochromes), and fatty acids. (Grant & Hackh's Chemical Dictionary, 5th ed)Viral Proteins: Proteins found in any species of virus.Epithelial Cells: Cells that line the inner and outer surfaces of the body by forming cellular layers (EPITHELIUM) or masses. Epithelial cells lining the SKIN; the MOUTH; the NOSE; and the ANAL CANAL derive from ectoderm; those lining the RESPIRATORY SYSTEM and the DIGESTIVE SYSTEM derive from endoderm; others (CARDIOVASCULAR SYSTEM and LYMPHATIC SYSTEM) derive from mesoderm. Epithelial cells can be classified mainly by cell shape and function into squamous, glandular and transitional epithelial cells.Neoplasm Proteins: Proteins whose abnormal expression (gain or loss) are associated with the development, growth, or progression of NEOPLASMS. Some neoplasm proteins are tumor antigens (ANTIGENS, NEOPLASM), i.e. they induce an immune reaction to their tumor. Many neoplasm proteins have been characterized and are used as tumor markers (BIOMARKERS, TUMOR) when they are detectable in cells and body fluids as monitors for the presence or growth of tumors. Abnormal expression of ONCOGENE PROTEINS is involved in neoplastic transformation, whereas the loss of expression of TUMOR SUPPRESSOR PROTEINS is involved with the loss of growth control and progression of the neoplasm.Genes, ras: Family of retrovirus-associated DNA sequences (ras) originally isolated from Harvey (H-ras, Ha-ras, rasH) and Kirsten (K-ras, Ki-ras, rasK) murine sarcoma viruses. Ras genes are widely conserved among animal species and sequences corresponding to both H-ras and K-ras genes have been detected in human, avian, murine, and non-vertebrate genomes. The closely related N-ras gene has been detected in human neuroblastoma and sarcoma cell lines. All genes of the family have a similar exon-intron structure and each encodes a p21 protein.Cricetulus: A genus of the family Muridae consisting of eleven species. C. migratorius, the grey or Armenian hamster, and C. griseus, the Chinese hamster, are the two species used in biomedical research.Microscopy, Confocal: A light microscopic technique in which only a small spot is illuminated and observed at a time. An image is constructed through point-by-point scanning of the field in this manner. Light sources may be conventional or laser, and fluorescence or transmitted observations are possible.DEAE-Dextran: Used as a support for ion-exchange chromatography.Enzyme Inhibitors: Compounds or agents that combine with an enzyme in such a manner as to prevent the normal substrate-enzyme combination and the catalytic reaction.Carcinoma, Hepatocellular: A primary malignant neoplasm of epithelial liver cells. It ranges from a well-differentiated tumor with EPITHELIAL CELLS indistinguishable from normal HEPATOCYTES to a poorly differentiated neoplasm. The cells may be uniform or markedly pleomorphic, or form GIANT CELLS. Several classification schemes have been suggested.Repressor Proteins: Proteins which maintain the transcriptional quiescence of specific GENES or OPERONS. Classical repressor proteins are DNA-binding proteins that are normally bound to the OPERATOR REGION of an operon, or the ENHANCER SEQUENCES of a gene until a signal occurs that causes their release.Ultrasonics: A subfield of acoustics dealing in the radio frequency range higher than acoustic SOUND waves (approximately above 20 kilohertz). Ultrasonic radiation is used therapeutically (DIATHERMY and ULTRASONIC THERAPY) to generate HEAT and to selectively destroy tissues. It is also used in diagnostics, for example, ULTRASONOGRAPHY; ECHOENCEPHALOGRAPHY; and ECHOCARDIOGRAPHY, to visually display echoes received from irradiated tissues.Exons: The parts of a transcript of a split GENE remaining after the INTRONS are removed. They are spliced together to become a MESSENGER RNA or other functional RNA.HEK293 Cells: A cell line generated from human embryonic kidney cells that were transformed with human adenovirus type 5.Transformation, Genetic: Change brought about to an organisms genetic composition by unidirectional transfer (TRANSFECTION; TRANSDUCTION, GENETIC; CONJUGATION, GENETIC, etc.) and incorporation of foreign DNA into prokaryotic or eukaryotic cells by recombination of part or all of that DNA into the cell's genome.Sequence Homology, Nucleic Acid: The sequential correspondence of nucleotides in one nucleic acid molecule with those of another nucleic acid molecule. Sequence homology is an indication of the genetic relatedness of different organisms and gene function.Immunohistochemistry: Histochemical localization of immunoreactive substances using labeled antibodies as reagents.Cell Movement: The movement of cells from one location to another. Distinguish from CYTOKINESIS which is the process of dividing the CYTOPLASM of a cell.Phenotype: The outward appearance of the individual. It is the product of interactions between genes, and between the GENOTYPE and the environment.Kinetics: The rate dynamics in chemical or physical systems.Immediate-Early Proteins: Proteins that are coded by immediate-early genes, in the absence of de novo protein synthesis. The term was originally used exclusively for viral regulatory proteins that were synthesized just after viral integration into the host cell. It is also used to describe cellular proteins which are synthesized immediately after the resting cell is stimulated by extracellular signals.Protein-Serine-Threonine Kinases: A group of enzymes that catalyzes the phosphorylation of serine or threonine residues in proteins, with ATP or other nucleotides as phosphate donors.RNA, Viral: Ribonucleic acid that makes up the genetic material of viruses.Simian virus 40: A species of POLYOMAVIRUS originally isolated from Rhesus monkey kidney tissue. It produces malignancy in human and newborn hamster kidney cell cultures.Chitosan: Deacetylated CHITIN, a linear polysaccharide of deacetylated beta-1,4-D-glucosamine. It is used in HYDROGEL and to treat WOUNDS.Cell Adhesion: Adherence of cells to surfaces or to other cells.Rats, Sprague-Dawley: A strain of albino rat used widely for experimental purposes because of its calmness and ease of handling. It was developed by the Sprague-Dawley Animal Company.Transcription Factor AP-1: A multiprotein complex composed of the products of c-jun and c-fos proto-oncogenes. These proteins must dimerize in order to bind to the AP-1 recognition site, also known as the TPA-responsive element (TRE). AP-1 controls both basal and inducible transcription of several genes.Protein Biosynthesis: The biosynthesis of PEPTIDES and PROTEINS on RIBOSOMES, directed by MESSENGER RNA, via TRANSFER RNA that is charged with standard proteinogenic AMINO ACIDS.Blotting, Southern: A method (first developed by E.M. Southern) for detection of DNA that has been electrophoretically separated and immobilized by blotting on nitrocellulose or other type of paper or nylon membrane followed by hybridization with labeled NUCLEIC ACID PROBES.Oligodeoxyribonucleotides, Antisense: Short fragments of DNA that are used to alter the function of target RNAs or DNAs to which they hybridize.Sequence Homology, Amino Acid: The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.Fluorescent Antibody Technique: Test for tissue antigen using either a direct method, by conjugation of antibody with fluorescent dye (FLUORESCENT ANTIBODY TECHNIQUE, DIRECT) or an indirect method, by formation of antigen-antibody complex which is then labeled with fluorescein-conjugated anti-immunoglobulin antibody (FLUORESCENT ANTIBODY TECHNIQUE, INDIRECT). The tissue is then examined by fluorescence microscopy.Mice, Inbred BALB CRNA: A polynucleotide consisting essentially of chains with a repeating backbone of phosphate and ribose units to which nitrogenous bases are attached. RNA is unique among biological macromolecules in that it can encode genetic information, serve as an abundant structural component of cells, and also possesses catalytic activity. (Rieger et al., Glossary of Genetics: Classical and Molecular, 5th ed)L Cells (Cell Line): A cultured line of C3H mouse FIBROBLASTS that do not adhere to one another and do not express CADHERINS.Membrane Glycoproteins: Glycoproteins found on the membrane or surface of cells.Cell Transformation, Viral: An inheritable change in cells manifested by changes in cell division and growth and alterations in cell surface properties. It is induced by infection with a transforming virus.Cell Cycle: The complex series of phenomena, occurring between the end of one CELL DIVISION and the end of the next, by which cellular material is duplicated and then divided between two daughter cells. The cell cycle includes INTERPHASE, which includes G0 PHASE; G1 PHASE; S PHASE; and G2 PHASE, and CELL DIVISION PHASE.Deoxyribonuclease I: An enzyme capable of hydrolyzing highly polymerized DNA by splitting phosphodiester linkages, preferentially adjacent to a pyrimidine nucleotide. This catalyzes endonucleolytic cleavage of DNA yielding 5'-phosphodi- and oligonucleotide end-products. The enzyme has a preference for double-stranded DNA.Polyethylene Glycols: Polymers of ETHYLENE OXIDE and water, and their ethers. They vary in consistency from liquid to solid depending on the molecular weight indicated by a number following the name. They are used as SURFACTANTS, dispersing agents, solvents, ointment and suppository bases, vehicles, and tablet excipients. Some specific groups are NONOXYNOLS, OCTOXYNOLS, and POLOXAMERS.Immunoblotting: Immunologic method used for detecting or quantifying immunoreactive substances. The substance is identified by first immobilizing it by blotting onto a membrane and then tagging it with labeled antibodies.Dose-Response Relationship, Drug: The relationship between the dose of an administered drug and the response of the organism to the drug.Microbubbles: Small encapsulated gas bubbles (diameters of micrometers) that can be used as CONTRAST MEDIA, and in other diagnostic and therapeutic applications. Upon exposure to sufficiently intense ultrasound, microbubbles will cavitate, rupture, disappear, release gas content. Such characteristics of the microbubbles can be used to enhance diagnostic tests, dissolve blood clots, and deliver drugs or genes for therapy.Liver: A large lobed glandular organ in the abdomen of vertebrates that is responsible for detoxification, metabolism, synthesis and storage of various substances.RNA, Antisense: RNA molecules which hybridize to complementary sequences in either RNA or DNA altering the function of the latter. Endogenous antisense RNAs function as regulators of gene expression by a variety of mechanisms. Synthetic antisense RNAs are used to effect the functioning of specific genes for investigative or therapeutic purposes.Proteins: Linear POLYPEPTIDES that are synthesized on RIBOSOMES and may be further modified, crosslinked, cleaved, or assembled into complex proteins with several subunits. The specific sequence of AMINO ACIDS determines the shape the polypeptide will take, during PROTEIN FOLDING, and the function of the protein.3' Untranslated Regions: The sequence at the 3' end of messenger RNA that does not code for product. This region contains transcription and translation regulating sequences.Precipitin Tests: Serologic tests in which a positive reaction manifested by visible CHEMICAL PRECIPITATION occurs when a soluble ANTIGEN reacts with its precipitins, i.e., ANTIBODIES that can form a precipitate.Introns: Sequences of DNA in the genes that are located between the EXONS. They are transcribed along with the exons but are removed from the primary gene transcript by RNA SPLICING to leave mature RNA. Some introns code for separate genes.Cytoplasm: The part of a cell that contains the CYTOSOL and small structures excluding the CELL NUCLEUS; MITOCHONDRIA; and large VACUOLES. (Glick, Glossary of Biochemistry and Molecular Biology, 1990)Mice, Inbred C57BLBacteriophages: Viruses whose hosts are bacterial cells.Gene Knockdown Techniques: The artificial induction of GENE SILENCING by the use of RNA INTERFERENCE to reduce the expression of a specific gene. It includes the use of DOUBLE-STRANDED RNA, such as SMALL INTERFERING RNA and RNA containing HAIRPIN LOOP SEQUENCE, and ANTI-SENSE OLIGONUCLEOTIDES.Liver Neoplasms: Tumors or cancer of the LIVER.Mutagenesis: Process of generating a genetic MUTATION. It may occur spontaneously or be induced by MUTAGENS.Oligonucleotides: Polymers made up of a few (2-20) nucleotides. In molecular genetics, they refer to a short sequence synthesized to match a region where a mutation is known to occur, and then used as a probe (OLIGONUCLEOTIDE PROBES). (Dorland, 28th ed)PhosphoproteinsProtein Isoforms: Different forms of a protein that may be produced from different GENES, or from the same gene by ALTERNATIVE SPLICING.Mitogen-Activated Protein Kinases: A superfamily of PROTEIN-SERINE-THREONINE KINASES that are activated by diverse stimuli via protein kinase cascades. They are the final components of the cascades, activated by phosphorylation by MITOGEN-ACTIVATED PROTEIN KINASE KINASES, which in turn are activated by mitogen-activated protein kinase kinase kinases (MAP KINASE KINASE KINASES).Neoplasm Transplantation: Experimental transplantation of neoplasms in laboratory animals for research purposes.5' Flanking Region: The region of DNA which borders the 5' end of a transcription unit and where a variety of regulatory sequences are located.Protein Structure, Tertiary: The level of protein structure in which combinations of secondary protein structures (alpha helices, beta sheets, loop regions, and motifs) pack together to form folded shapes called domains. Disulfide bridges between cysteines in two different parts of the polypeptide chain along with other interactions between the chains play a role in the formation and stabilization of tertiary structure. Small proteins usually consist of only one domain but larger proteins may contain a number of domains connected by segments of polypeptide chain which lack regular secondary structure.Kidney: Body organ that filters blood for the secretion of URINE and that regulates ion concentrations.Thymidine Kinase: An enzyme that catalyzes the conversion of ATP and thymidine to ADP and thymidine 5'-phosphate. Deoxyuridine can also act as an acceptor and dGTP as a donor. (From Enzyme Nomenclature, 1992) EC 2.7.1.21.Point Mutation: A mutation caused by the substitution of one nucleotide for another. This results in the DNA molecule having a change in a single base pair.Homeodomain Proteins: Proteins encoded by homeobox genes (GENES, HOMEOBOX) that exhibit structural similarity to certain prokaryotic and eukaryotic DNA-binding proteins. Homeodomain proteins are involved in the control of gene expression during morphogenesis and development (GENE EXPRESSION REGULATION, DEVELOPMENTAL).Cattle: Domesticated bovine animals of the genus Bos, usually kept on a farm or ranch and used for the production of meat or dairy products or for heavy labor.Proto-Oncogene Proteins c-akt: A protein-serine-threonine kinase that is activated by PHOSPHORYLATION in response to GROWTH FACTORS or INSULIN. It plays a major role in cell metabolism, growth, and survival as a core component of SIGNAL TRANSDUCTION. Three isoforms have been described in mammalian cells.PolyaminesTumor Suppressor Protein p53: Nuclear phosphoprotein encoded by the p53 gene (GENES, P53) whose normal function is to control CELL PROLIFERATION and APOPTOSIS. A mutant or absent p53 protein has been found in LEUKEMIA; OSTEOSARCOMA; LUNG CANCER; and COLORECTAL CANCER.DNA Footprinting: A method for determining the sequence specificity of DNA-binding proteins. DNA footprinting utilizes a DNA damaging agent (either a chemical reagent or a nuclease) which cleaves DNA at every base pair. DNA cleavage is inhibited where the ligand binds to DNA. (from Rieger et al., Glossary of Genetics: Classical and Molecular, 5th ed)Genome, Viral: The complete genetic complement contained in a DNA or RNA molecule in a virus.Jurkat Cells: A CELL LINE derived from human T-CELL LEUKEMIA and used to determine the mechanism of differential susceptibility to anti-cancer drugs and radiation.Isoenzymes: Structurally related forms of an enzyme. Each isoenzyme has the same mechanism and classification, but differs in its chemical, physical, or immunological characteristics.Protein Transport: The process of moving proteins from one cellular compartment (including extracellular) to another by various sorting and transport mechanisms such as gated transport, protein translocation, and vesicular transport.Alternative Splicing: A process whereby multiple RNA transcripts are generated from a single gene. Alternative splicing involves the splicing together of other possible sets of EXONS during the processing of some, but not all, transcripts of the gene. Thus a particular exon may be connected to any one of several alternative exons to form a mature RNA. The alternative forms of mature MESSENGER RNA produce PROTEIN ISOFORMS in which one part of the isoforms is common while the other parts are different.Genes, Dominant: Genes that influence the PHENOTYPE both in the homozygous and the heterozygous state.Consensus Sequence: A theoretical representative nucleotide or amino acid sequence in which each nucleotide or amino acid is the one which occurs most frequently at that site in the different sequences which occur in nature. The phrase also refers to an actual sequence which approximates the theoretical consensus. A known CONSERVED SEQUENCE set is represented by a consensus sequence. Commonly observed supersecondary protein structures (AMINO ACID MOTIFS) are often formed by conserved sequences.Repetitive Sequences, Nucleic Acid: Sequences of DNA or RNA that occur in multiple copies. There are several types: INTERSPERSED REPETITIVE SEQUENCES are copies of transposable elements (DNA TRANSPOSABLE ELEMENTS or RETROELEMENTS) dispersed throughout the genome. TERMINAL REPEAT SEQUENCES flank both ends of another sequence, for example, the long terminal repeats (LTRs) on RETROVIRUSES. Variations may be direct repeats, those occurring in the same direction, or inverted repeats, those opposite to each other in direction. TANDEM REPEAT SEQUENCES are copies which lie adjacent to each other, direct or inverted (INVERTED REPEAT SEQUENCES).Protamines: A group of simple proteins that yield basic amino acids on hydrolysis and that occur combined with nucleic acid in the sperm of fish. Protamines contain very few kinds of amino acids. Protamine sulfate combines with heparin to form a stable inactive complex; it is used to neutralize the anticoagulant action of heparin in the treatment of heparin overdose. (From Merck Index, 11th ed; Martindale, The Extra Pharmacopoeia, 30th ed, p692)Cell Membrane: The lipid- and protein-containing, selectively permeable membrane that surrounds the cytoplasm in prokaryotic and eukaryotic cells.Retroviridae: Family of RNA viruses that infects birds and mammals and encodes the enzyme reverse transcriptase. The family contains seven genera: DELTARETROVIRUS; LENTIVIRUS; RETROVIRUSES TYPE B, MAMMALIAN; ALPHARETROVIRUS; GAMMARETROVIRUS; RETROVIRUSES TYPE D; and SPUMAVIRUS. A key feature of retrovirus biology is the synthesis of a DNA copy of the genome which is integrated into cellular DNA. After integration it is sometimes not expressed but maintained in a latent state (PROVIRUSES).Receptors, Cytoplasmic and Nuclear: Intracellular receptors that can be found in the cytoplasm or in the nucleus. They bind to extracellular signaling molecules that migrate through or are transported across the CELL MEMBRANE. Many members of this class of receptors occur in the cytoplasm and are transported to the CELL NUCLEUS upon ligand-binding where they signal via DNA-binding and transcription regulation. Also included in this category are receptors found on INTRACELLULAR MEMBRANES that act via mechanisms similar to CELL SURFACE RECEPTORS.Luminescent Agents: Compound such as LUMINESCENT PROTEINS that cause or emit light (PHYSICAL LUMINESCENCE).Organ Specificity: Characteristic restricted to a particular organ of the body, such as a cell type, metabolic response or expression of a particular protein or antigen.Rabbits: The species Oryctolagus cuniculus, in the family Leporidae, order LAGOMORPHA. Rabbits are born in burrows, furless, and with eyes and ears closed. In contrast with HARES, rabbits have 22 chromosome pairs.Proto-Oncogene Proteins c-jun: Cellular DNA-binding proteins encoded by the c-jun genes (GENES, JUN). They are involved in growth-related transcriptional control. There appear to be three distinct functions: dimerization (with c-fos), DNA-binding, and transcriptional activation. Oncogenic transformation can take place by constitutive expression of c-jun.Hep G2 Cells: A human liver tumor cell line used to study a variety of liver-specific metabolic functions.CCAAT-Enhancer-Binding Proteins: A class of proteins that were originally identified by their ability to bind the DNA sequence CCAAT. The typical CCAAT-enhancer binding protein forms dimers and consists of an activation domain, a DNA-binding basic region, and a leucine-rich dimerization domain (LEUCINE ZIPPERS). CCAAT-BINDING FACTOR is structurally distinct type of CCAAT-enhancer binding protein consisting of a trimer of three different subunits.DNA Mutational Analysis: Biochemical identification of mutational changes in a nucleotide sequence.

11q23.1 and 11q25-qter YACs suppress tumour growth in vivo. (1/63574)

Frequent allelic deletion at chromosome 11q22-q23.1 has been described in breast cancer and a number of other malignancies, suggesting putative tumour suppressor gene(s) within the approximately 8 Mb deleted region. In addition, we recently described another locus, at the 11q25-qter region, frequently deleted in breast cancer, suggesting additional tumour suppressor gene(s) in this approximately 2 Mb deleted region. An 11q YAC contig was accessed and three YACs, one containing the candidate gene ATM at 11q23.1, and two contiguous YACs (overlapping for approximately 400-600 kb) overlying most of the 11q25 deleted region, were retrofitted with a G418 resistance marker and transfected into murine A9 fibrosarcoma cells. Selected A9 transfectant clones (and control untransfected and 'irrelevant' alphoid YAC transfectant A9 clones) were assayed for in vivo tumorigenicity in athymic female Balb c-nu/nu mice. All the 11q YAC transfectant clones demonstrated significant tumour suppression compared to the control untransfected and 'irrelevant' YAC transfected A9 cells. These results define two discrete tumour suppressor loci on chromosome 11q by functional complementation, one to a approximately 1.2 Mb region on 11q23.1 (containing the ATM locus) and another to a approximately 400-600 kb subterminal region on 11q25-qter.  (+info)

TIF1gamma, a novel member of the transcriptional intermediary factor 1 family. (2/63574)

We report the cloning and characterization of a novel member of the Transcriptional Intermediary Factor 1 (TIF1) gene family, human TIF1gamma. Similar to TIF1alpha and TIF1beta, the structure of TIF1beta is characterized by multiple domains: RING finger, B boxes, Coiled coil, PHD/TTC, and bromodomain. Although structurally related to TIF1alpha and TIF1beta, TIF1gamma presents several functional differences. In contrast to TIF1alpha, but like TIF1beta, TIF1 does not interact with nuclear receptors in yeast two-hybrid or GST pull-down assays and does not interfere with retinoic acid response in transfected mammalian cells. Whereas TIF1alpha and TIF1beta were previously found to interact with the KRAB silencing domain of KOX1 and with the HP1alpha, MODI (HP1beta) and MOD2 (HP1gamma) heterochromatinic proteins, suggesting that they may participate in a complex involved in heterochromatin-induced gene repression, TIF1gamma does not interact with either the KRAB domain of KOX1 or the HP1 proteins. Nevertheless, TIF1gamma, like TIF1alpha and TIF1beta, exhibits a strong silencing activity when tethered to a promoter. Since deletion of a novel motif unique to the three TIF1 proteins, called TIF1 signature sequence (TSS), abrogates transcriptional repression by TIF1gamma, this motif likely participates in TIF1 dependent repression.  (+info)

Expression of the naturally occurring truncated trkB neurotrophin receptor induces outgrowth of filopodia and processes in neuroblastoma cells. (3/63574)

We have investigated the effects of the truncated trkB receptor isoform T1 (trkB.T1) by transient transfection into mouse N2a neuroblastoma cells. We observed that expression of trkB.T1 leads to a striking change in cell morphology characterized by outgrowth of filopodia and processes. A similar morphological response was also observed in SH-SY5Y human neuroblastoma cells and NIH3T3 fibroblasts transfected with trkB.T1. N2a cells lack endogenous expression of trkB isoforms, but express barely detectable amounts of its ligands, brain-derived neurotrophic factor (BDNF) and neurotrophin-4 (NT-4). The morphological change was ligand-independent, since addition of exogenous BDNF or NT-4 or blockade of endogenous trkB ligands did not influence this response. Filopodia and process outgrowth was significantly suppressed when full-length trkB.TK+ was cotransfected together with trkB.T1 and this inhibitory effect was blocked by tyrosine kinase inhibitor K252a. Transfection of trkB.T1 deletion mutants showed that the morphological response is dependent on the extracellular, but not the intracellular domain of the receptor. Our results suggest a novel ligand-independent role for truncated trkB in the regulation of cellular morphology.  (+info)

B-MYB transactivates its own promoter through SP1-binding sites. (4/63574)

B-MYB is an ubiquitous protein required for mammalian cell growth. In this report we show that B-MYB transactivates its own promoter through a 120 bp segment proximal to the transcription start site. The B-MYB-responsive element does not contain myb-binding sites and gel-shift analysis shows that SP1, but not B-MYB, protein contained in SAOS2 cell extracts binds to the 120 bp B-myb promoter fragment. B-MYB-dependent transactivation is cooperatively increased in the presence of SP1, but not SP3 overexpression. When the SP1 elements of the B-myb promoter are transferred in front of a heterologous promoter, an increased response to B-MYB results. In contrast, c-MYB, the prototype member of the Myb family, is not able to activate the luciferase construct containing the SP1 elements. With the use of an SP1-GAL4 fusion protein, we have determined that the cooperative activation occurs through the domain A of SP1. These observations suggest that B-MYB functions as a coactivator of SP1, and that diverse combinations of myb and SP1 sites may dictate the responsiveness of myb-target genes to the various members of the myb family.  (+info)

Arrestin function in G protein-coupled receptor endocytosis requires phosphoinositide binding. (5/63574)

Internalization of agonist-activated G protein-coupled receptors is mediated by non-visual arrestins, which also bind to clathrin and are therefore thought to act as adaptors in the endocytosis process. Phosphoinositides have been implicated in the regulation of intracellular receptor trafficking, and are known to bind to other coat components including AP-2, AP180 and COPI coatomer. Given these observations, we explored the possibility that phosphoinositides play a role in arrestin's function as an adaptor. High-affinity binding sites for phosphoinositides in beta-arrestin (arrestin2) and arrestin3 (beta-arrestin2) were identified, and dissimilar effects of phosphoinositide and inositol phosphate on arrestin interactions with clathrin and receptor were characterized. Alteration of three basic residues in arrestin3 abolished phosphoinositide binding with complete retention of clathrin and receptor binding. Unlike native protein, upon agonist activation, this mutant arrestin3 expressed in COS1 cells neither supported beta2-adrenergic receptor internalization nor did it concentrate in coated pits, although it was recruited to the plasma membrane. These findings indicate that phosphoinositide binding plays a critical regulatory role in delivery of the receptor-arrestin complex to coated pits, perhaps by providing, with activated receptor, a multi-point attachment of arrestin to the plasma membrane.  (+info)

The MAP kinase ERK2 inhibits the cyclic AMP-specific phosphodiesterase HSPDE4D3 by phosphorylating it at Ser579. (6/63574)

The extracellular receptor stimulated kinase ERK2 (p42(MAPK))-phosphorylated human cAMP-specific phosphodiesterase PDE4D3 at Ser579 and profoundly reduced ( approximately 75%) its activity. These effects could be reversed by the action of protein phosphatase PP1. The inhibitory state of PDE4D3, engendered by ERK2 phosphorylation, was mimicked by the Ser579-->Asp mutant form of PDE4D3. In COS1 cells transfected to express PDE4D3, challenge with epidermal growth factor (EGF) caused the phosphorylation and inhibition of PDE4D3. This effect was blocked by the MEK inhibitor PD98059 and was not apparent using the Ser579-->Ala mutant form of PDE4D3. Challenge of HEK293 and F442A cells with EGF led to the PD98059-ablatable inhibition of endogenous PDE4D3 and PDE4D5 activities. EGF challenge of COS1 cells transfected to express PDE4D3 increased cAMP levels through a process ablated by PD98059. The activity of the Ser579-->Asp mutant form of PDE4D3 was increased by PKA phosphorylation. The transient form of the EGF-induced inhibition of PDE4D3 is thus suggested to be due to feedback regulation by PKA causing the ablation of the ERK2-induced inhibition of PDE4D3. We identify a novel means of cross-talk between the cAMP and ERK signalling pathways whereby cell stimuli that lead to ERK2 activation may modulate cAMP signalling.  (+info)

Coupling of the cell cycle and myogenesis through the cyclin D1-dependent interaction of MyoD with cdk4. (7/63574)

Proliferating myoblasts express the muscle determination factor, MyoD, throughout the cell cycle in the absence of differentiation. Here we show that a mitogen-sensitive mechanism, involving the direct interaction between MyoD and cdk4, restricts myoblast differentiation to cells that have entered into the G0 phase of the cell cycle under mitogen withdrawal. Interaction between MyoD and cdk4 disrupts MyoD DNA-binding, muscle-specific gene activation and myogenic conversion of 10T1/2 cells independently of cyclin D1 and the CAK activation of cdk4. Forced induction of cyclin D1 in myotubes results in the cytoplasmic to nuclear translocation of cdk4. The specific MyoD-cdk4 interaction in dividing myoblasts, coupled with the cyclin D1-dependent nuclear targeting of cdk4, suggests a mitogen-sensitive mechanism whereby cyclin D1 can regulate MyoD function and the onset of myogenesis by controlling the cellular location of cdk4 rather than the phosphorylation status of MyoD.  (+info)

Assembly requirements of PU.1-Pip (IRF-4) activator complexes: inhibiting function in vivo using fused dimers. (8/63574)

Gene expression in higher eukaryotes appears to be regulated by specific combinations of transcription factors binding to regulatory sequences. The Ets factor PU.1 and the IRF protein Pip (IRF-4) represent a pair of interacting transcription factors implicated in regulating B cell-specific gene expression. Pip is recruited to its binding site on DNA by phosphorylated PU.1. PU.1-Pip interaction is shown to be template directed and involves two distinct protein-protein interaction surfaces: (i) the ets and IRF DNA-binding domains; and (ii) the phosphorylated PEST region of PU.1 and a lysine-requiring putative alpha-helix in Pip. Thus, a coordinated set of protein-protein and protein-DNA contacts are essential for PU.1-Pip ternary complex assembly. To analyze the function of these factors in vivo, we engineered chimeric repressors containing the ets and IRF DNA-binding domains connected by a flexible POU domain linker. When stably expressed, the wild-type fused dimer strongly repressed the expression of a rearranged immunoglobulin lambda gene, thereby establishing the functional importance of PU.1-Pip complexes in B cell gene expression. Comparative analysis of the wild-type dimer with a series of mutant dimers distinguished a gene regulated by PU.1 and Pip from one regulated by PU.1 alone. This strategy should prove generally useful in analyzing the function of interacting transcription factors in vivo, and for identifying novel genes regulated by such complexes.  (+info)

Altogen Biosystems provides in vivo transfection reagents, over 100 pre-optimized in vitro transfection kits for cell lines and primary cells, and electroporation delivery products. Transfection reagents are highly efficient for DNA and siRNA transfection in vivo and in vitro. Altogen CRO offers in vivo RNAi services, tumor xenograft models, toxicology testing, stable cell line generation, and cell banking cryopreservation services
The choice of a transfection reagent often depends more upon the particular cell line than the substance being delivered into the cells. We have available four different lipid-based transfection reagents that have been specially formulated for delivery of siRNAs into cells. These DharmaFECT reagents are very mild yet have very high transfection rates into a wide variety of cell lines. You can find a list of cells weve tested with DharmaFECT here: http: //dharmacon. horizondiscovery. com/transfection/dharmafect-cell-type-guide/Another recommendation is to use a reagent that has been previously used in the cells of interest. Further optimization for siRNA delivery may be necessary. If no established protocol for the cells is available, a PubMed or HighWire search may help identify if a published protocol for the specific cell line or a similar cell line has been reported. In all instances, we recommend following the protocol provided by the manufacturer of the transfection reagent ...
Low transfection efficiency and low cell viability are the most frequent causes of unsuccessful gene silencing experiments. Through careful optimization--e.g. choosing the right transfection agent and transfection method--high levels of transfection efficiency can be achieved ,Optimizing,siRNA,Transfection,for,RNAi,biological,advanced biology technology,biology laboratory technology,biology device technology,latest biology technology
Altogen Biosystems provides in vivo transfection reagents, over 100 pre-optimized in vitro transfection kits for cell lines and primary cells, and electroporation delivery products. Transfection reagents are highly efficient for DNA and siRNA transfection in vivo and in vitro. Altogen CRO offers in vivo RNAi services, tumor xenograft models, toxicology testing, stable cell line generation, and cell banking cryopreservation services
Images: Ret receptor knockdown using small interference RNA (siRNA) in podocytes. (A) Transfection efficiency: mouse podocytes were transfected with 100 nM concentrations of Ret siRNA or vehicle alone. (a) When podocytes were exposed to i-Fect alone, there was no toxicity. (a and b) A transfection efficiency of nearly 100% was achieved with 100 nM concentration of Ret siRNA (b). Co-transfection with a fluorescently tagged control siRNA was used to determine the transfection efficiency, and fluorescence microscopy revealed a perinuclear localization of the tagged RNA (b, arrowhead). (B) Western blot analysis of Ret after transfection: Ret immunoblotting (top) of WCL 2, 3, or 4 d after transfection revealed that Ret was downregulated within 2 d after transfection with 100 nM Ret siRNA. Transfection of control siRNA at day 4 served as a negative control, and the maximal knockdown of Ret was observed 4 d after transfection. GAPDH immunoblotting confirmed equal protein loading (bottom). ...
G-FECT™ DNA Transfection reagents are a series of powerful DNA transfection reagents with high efficiency DNA delivery and low cell toxicity into mammalian cells. G-FECT™ can be used for plasmid transfection, genome editing, virus production and more.
Forward transfection is a widely used method that works well for adherent cell types; however, if one is using suspension cells or a high-throughput format, reverse transfection, where cells are added to the plated transfection reagent complex, is a more appropriate approach. This method can be used to increase the throughput and reproducibility of a CRISPR-Cas9 screen by optimizing gene editing efficiency as demonstrated in our recently published application note: "Optimization of reverse transfection of Dharmacon Edit-R synthetic crRNA and tracrRNA components with DharmaFECT transfection reagent in a Cas9-expressing cell line.". An un-cleavable ubiquitin moiety fused to EGFP allows constitutive degradation of the EGFP protein, while disruption of the proteasome components by functional protein knockout leads to accumulation of EGFP and detectable fluorescence. This functional knockout data shows that determining optimal transfection conditions prior to arrayed screening leads to high gene ...
siPORT NeoFX Transfection Agent 1 ml from Ambion,Gene silencing experiments often call for critical, but time-consuming optimization experiments. siPORT NeoFX Transfection Agent refines siRNA transfection protocols resulting in less optimization. siPORT NeoFXs lipid-based formulation can be used to efficiently transfect adherent cells as they are,biological,biology supply,biology supplies,biology product
Best transfection method/reagent for HeLa cells? - posted in Cell Biology: Im planning to do some transient transfection of HeLa cells. Aim is to do some CoIP and localization studies. I asked different fellows, some say Fugene is the best, some proposed TFX while other said, this is all crap, use Lipofectamine. Now im a little bit puzzled, which one i should buy... Which transfection method / reagent would you recommend?
Lipofectamine 2000 Transfection Reagent is a versatile transfection reagent that has been shown to effectively transfect the widest variety of adherent and suspension cell lines. Researchers use Lipofectamine 2000 Reagent for siRNA- and shRNA-based gene knockdown experiments, as well as for gene exp
GeneJuice® Transfection Reagent Non-lipid based chemical transfection reagent optimized for maximum transfection efficiency, ease-of-use, and minimal cytotoxicity on a wide variety of mammallian cells. - Find MSDS or SDS, a COA, data sheets and more information.
Ive done this, its no problem at all! (cells Ive done this on: U87 already transfected with 2 extra (selected) proteins and Hela cells already transfected with 2 proteins and 2 other sequences, thus a total of 4 different pieces of separate DNA integrated stably ...
Yes, antibiotics can be used during transfection with any of the Life Technologies lipid based reagents. However, the critical steps of the protocol need to be performed with the recommended OptiMEM Media and not culture media that contains any serum or antibiotics. The transfection protocol involves a two tube protocol and It is important to add the lipid reagent to OptiMEM in one tube and the DNA or RNA to OptiMEM in another tube and mix each tube thoroughly. Then, equal amounts from each tube should be mixed to form the transfection complex and incubated for five minutes at room temperature. The lipid-DNA or lipid-RNA complex can then be added directly to cells in complete culture media. Analysis of transfection results can be performed 24-48 hours post transfection. ...
InvivoGen provides LyoVec, a lyophilized cationic lipid-based transfection reagent made of phosphonolipid DTCPTA coupled with DiPPE, a neutral lipid that helps destabilizing membrane bilayers, therefore increasing the in vitro transfection efficiency of LyoVec.
The global transfection reagent & equipment market is expected to reach USD 1,086.02 million by 2022, according to a new report by Grand View Research, Inc. This anticipated growth in demand can be attributed to growing need for protein production, biopharmaceutical development, and vaccine research and development; all of which rely heavily on cytological R&D and transfection.. Complete Report Available @ http://www.radiantinsights.com/research/transfection-reagent-amp-equipment-market. Larger market entities are also involved in efforts to expand their market presence in the Asia Pacific region and tap the high potential for growth available. Expected growth of genomic and proteomic research is also a strong factor which will positively impact the growth in demand for transfection.. Further key findings from the study suggest:. ...
* This reagent has two solutions: Solution A - 0.5 ml, Solution B - 1.0 ml The TransPass™ R2 Transfection Reagent is a two component non-liposomal reagent combination developed specifically for efficient transfection of siRNA in a variety of mammalian cell lines that include “difficult to transfect cells such as primary cells
줄기세포를 이용한 치료법은 광범위한 세포, 조직, 심지어 장기의 치료에까지 적용될 수 있다. 지방유래 줄기 세포는 다량 추출이 가능하다는 점과 치료 적용시 자가지방을 이용하게 됨으로써 면역반응을 줄일 수 있고, 다양한 세포로 분화가 가능하다. 하지만 충분한 양을 획득하기 위해 생체 밖에서 계대배양을 해야하는데, 이를 지속할 경우 줄기세포의 노화로 인해 줄기세포능을 잃는 어려움이 있다. 이러한 어려움을 개선시키기 위한 방안으로, 세포노화에 관여하는 것으로 알려진 Akt를 저해하는 PTEN 유전자를 선정하였다. PTEN 유전자를 지방 유래 성체줄기세포에 유전자치료는 지속적인 단백질 방출이 가능하기 때문에 한 번의 투여로 지속적인 치료효과를 얻을 수 있다는 장점이 있다. 줄기세포의 노화를 방지하면서 이러한 효과를 지속적으로 유지시켜줄 ...
Sigmas Universal Transfection Reagent is a unique formulation of a proprietary polymer blend used for transient and stable transfection of nucleic acids into various eukaryotic cell lines and hard-to-transfect primary cells. Fast and easy protocol is compatible with serum, serum-free medium and antibiotics
ATCC® Transfection reagents may be used for the transfer of nucleic acids for a variety of applications, including protein expression and the overexpression of mutant genes. Our transfection reagents are cationic lipid-based; due to their positive charge, these transfection reagents interact with the negatively charged backbone of nucleic acids and cell membranes. This effect, coupled with the hydrophobic nature of the associated lipids, allows the cationic lipid-DNA complex to be transported into eukaryotic cells. ATCC offers:. ...
Our i-FectTM Transfection Kit is used to study Epigenetics and pain. Heres yet another example: M. Leinders, b, N. Üçeyler, R.A. Pritchard, C. Sommer, L.S. Sorkin. Increased miR-132-3p expression is associated with chronic neuropathic pain. Experimental Neurology. Volume 283, Part A, September 2016, Pages 276-286...The inhibitor and mimetic were administered to awake rats via the it catheters. Prior to injection, active or mismatch inhibitors were mixed with (1:5 w/v) i-Fect™ in vivo transfection reagent(Neuromics, Edina, USA) to final doses of 5, 2 and 1 μg in 10 μl ...
Looking for a powerful and versatile DNA and siRNA transfection reagent? Try jetPRIME to obtain efficient and reliable scientific results! Request your jetPRIME sample immediately!
GeneX Plus Transfection Reagent is a high-performance, animal-origin free, broad spectrum reagent that provides exceptional transfection of plasmid DNA into mammalian cells.
Photoporation is a rapidly expanding technique for the introduction of macromolecules into single cells. However, there remains no study into the true efficiency of this procedure. Here, we present a detailed analysis of transfection efficiency and cell viability for femtosecond optical transfection using a titanium sapphire laser at 800 nm. Photoporation of 4000 Chinese Hamster ovary cells was performed, representing the largest optical transfection study reported to date. We have investigated a range of laser fluences at the cell membrane and, at 1.2 μJ/cm2, have found an average transfection efficiency of 50 ± 10%. Contrary to recent literature, in which 100% efficiency is claimed, our measure of efficiency accounts for all irradiated cells, including those lost as a result of laser treatment, thereby providing a true biological measure of the technique.. ©2006 Optical Society of America. Full Article , PDF Article ...
Transfection is the process of inserting genetic material, such as DNA and double stranded RNA, into mammalian cells. The insertion of DNA into a cell...
METAFECTENE EASY + Fast, easy and effective transfection reagent for mammalian cells For ordering information, MSDS, publications and application notes see Description Cat. No. Size METAFECTENE
Dear flow cytometry people, A problem with the viability of sorted cells was detected in our lab. We have been asked to sort a fibroblast cell line, IOT 1/2. Cells have been transfected using fugene, and GFP expressing cells (about 15%)and non-expressing cells were sorted into 15-ml falcon tubes filled with medium (5 ml) and maintained in ice. Cells before sorting had a clear FS/SS pattern, and viability using PI was about 95-98%. The instrument used was a MoFlo; laser is a Coherent Enterprise operated at 150 mW at 488nm. In the first attempts, a 90-micron tip at 20 PSI was used. A commercial PBS from DakoCytomation was used as sheath fluid. The problem was detected with sorted cells: both positive and negative tubes showed few cells with a low FS signal when reanalysed, and viability using PI was lower than 15-20%. Then we changed to a 200-micron tip at 5 PSI, but number and viability of sorted cells remained very low. Non-transfected cells showed the same behaviour when sorted. I wonder if it ...
Gentaur molecular products has all kinds of products like :search , Neuromi \ n-Blast Transfection Reagent, .75 ml. \ NB30075 for more molecular products just contact us
Gentaur molecular products has all kinds of products like :search , Neuromi \ DNA-Fect, Transfection Reagent, 1 ml. \ DF37100-1 for more molecular products just contact us
... at Biomol ► Life Science Shop for Research Scientists and Procurement Managers ► For Universities, Research Institutes, and Biotech Companies.
AMSBIO offers transfection reagents including GeneSilencer® with a unique cationic lipid formulation for efficient transfection of siRNA into mammalian cells.
Synthego is a leading provider of genome engineering solutions. Our flagship product, CRISPRevolution, is a portfolio of synthetic guide RNA designed for CRISPR genome editing and research. Synthegos vision is to bring precision and automation to genome engineering, enabling rapid and cost-effective research with consistent results for every scientist.. ...
The MaxCyte STX Scalable Transfection System provides an ideal solution for rapidly expressing a large number of antibodies or proteins in the quantities needed for use in screening and other pre-clinical drug development applications. The MaxCyte STX uses flow electroporation to reproducibly transfect an array of cell types, including CHO cells and other cells commonly used for protein production.
Transfection of primary cells, stem cells and difficult-to-transfect cell lines and their use in cellular screening assays will be featured by MaxCyte. They will also present the use of the MaxCyte® STX™ Scalable Transfection System for large-scale transient transfection.
Hi everyone , , Ive been trying to transfect alpha T-3 cells with a luciferase , construct using the calsium phosphate method of transfection. The DNA I , used for this transfection was isolated with Promegas Wizard , Maxipreps. To date, all my transfections were unsuccessfull. Does , anybody have any ideas why the transfections wont work? , , Thanks , Rentia I have used Promegas Wizard minipreps and maxipreps to prepare plasmid DNA that was suitable for transfection. The cell lines that I transfected were Daudi and Owl Monkey 531H. I transfected by electro- poration. I dont know what might be wrong with your preparations. -- Rainforest laid low. Wake up and smell the ozone, Says man with chainsaw. - John Ladasky ...
|p|Transfection — the delivery of DNA or RNA into eukaryotic cells — is a powerful tool used to study and control gene expression. Cloned genes can be transfected into cells for biochemical characterization, mutational analyses, investigation of the effects of gene expression on cell growth, investigation of gene regulatory elements, and to produce a specific protein. Transfection of RNA can be used either to induce protein expression, or to repress it using antisense or RNA interference (RNAi) procedures.|/p| |p|There are two types of transfection — transient and stable — suited to different experimental applications, and with different vector requirements.|/p|
Polyplus Transfection Licenses Kempbio For Mammalian Transient Transfection Technology - read this article along with other careers information, tips and advice on BioSpace
The COP9 signalosome is a highly conserved protein complex composed of eight subunits. In this study a novel, regulatory mechanism of CSN biogenesis was identified. We used stable transfected siCSN1 cells in which the protein and the mRNA expression of CSN subuntis were downregulated. Transfection of His-CSN1 in those siCSN1 cells led to the induction of the de novo Synthesis of the whole CSN complex. In addition the expression of the transcription factors STAT1 and c-Myc was elevated. The cells were treated with IFN alpha or IFN gamma, respectively. This resulted in the induction of the CSN de novo synthesis. Moreover, the siRNA-mediated inhibition of STAT1, c-Myc, Lin28B as well as treatment with the pharmacological inhibitors AG9 or AG490 led to a reduced protein expression of the analysed CSN subunits. We found that in all experiments there was a significant change on protein level in contrast to a marginal change on the RNA level. Based on our study we hypothesized that the CSN biogenesis ...
The mouse myoblast C2C12 cell line transfected singly with cDNA for Pax-3, PAX3-FKHR, or insulin-like growth factor (IGF) II or cotransfected with IGF-II plus Pax-3 or with IGF-II plus PAX3-FKHR genes showed an altered morphology, a lack of differentiation, and higher proliferation rates in vitro. On s.c. injection into nude mice, tumors grew from transfected cell lines but not from cells transfected with the empty vector. Tumors derived from IGF-II/PAX3-FKHR- and IGF-II-transfected cells grew most rapidly. Cotransfection of IGF-II plus Pax-3 induced tumors comprised highly differentiated striated muscle cells; Pax-3, PAX3-FKHR, or IGF-II transfection produced tumors at varying stages of differentiation. Tumors derived from IGF-II plus PAX3-FKHR-cotransfected cells were composed of undifferentiated cells. This was the only tumor type to infiltrate the underlying muscle. The most angiogenesis and the least apoptosis were observed in the latter tumors. These results support the hypothesis that ...
Sigma-Aldrich offers abstracts and full-text articles by [Liwen Chen, Shihe Guan, Qiang Zhou, Shouqin Sheng, Fei Zhong, Qin Wang].
Hi Ricky, unless you use very sensititve or special cells (eg. primary) endotoxins dont matter much. Standard cell lines like CHO, HeLa, COS, HEK293, HepG2 etc. trnasfect easily and well with CaPO4 or liposomes using plasmids prepped with normal Qiagen or Promega or other protocols (ie not their endofree variants) . However purity matters generally, as well as degradation (eg. exposing the DNA too long to the first lysis buffer that generally contain NaOH). Another concern is losing a plasmid by recombination or contamination... Bruno Ricky Leung ,b883732 at logic.itsc.cuhk.edu.hk, wrote in message news:9t8hsl$1ml$1 at justice.csc.cuhk.edu.hk... , Hi everyone, , , Ive a problem during transfection. I tried to transfect pcDNA-lacZ to , mammalian cells using lipofectamine plus. When I used stock pcDNA-lacZ for , transfection, everything worked fine and b-gal was obviously detected by , western blot analysis. However, when I used pcDNA-lacZ which was prepared , from Concert miniprep kit, no ...
LASP1 expression was suppressed by miR-218 transfection of prostate cancer (PCa) cells. (a) LASP1 mRNA expression 72 h after transfection with miR-218. GUSB exp
Do you want an optimized Cas9 protein to increase your genome editing efficiency with jetCRISPR RNP transfection reagent? Visit our website to know how this SpCas9 Nuclease!
We are pleased to feature the following product for our scientist members. To see more products, please click the following link ...
We are pleased to feature the following product for our scientist members. To see more products, please click the following link ...
For an RNAi or antisense experiment, the actual level of target gene knockdown is related to the transfection efficiency. A positive control such as HPRT DsiRNA should be used in each experiment to assess transfection efficiency. In addition, IDT recommends using a dose-response curve of 0.1, 1, and 10 nM to determine maximum response ...
With the Cellometer Vision CBA, just 20 microliter of sample is added to the Cellometer Counting Chamber. Imaging and analysis of GFP expression is completed in less than 60 seconds.
The primary purpose of this website is to help encourage this by directing viewers to resources that are available for different cell types.
Buy our TLR4 293T transfected lysate (positive control). ab94063 has been validated in western blot. Abcam now offers a 12-month guarantee.
Buy our Dlx1 293T transfected lysate (positive control). ab94117 has been validated in western blot. Abcam now offers a 12-month guarantee.
To date, methods for large-scale transient gene expression (TGE) in cultivated mammalian cells have focused on two transfection vehicles: polyethylenimine (PEI) and calcium phosphate (CaPi). Both have been shown to result in high transfection efficiencies at scales beyond 10 L. Unfortunately, both approaches yield higher levels of recombinant protein (r-protein) in the presence of serum than in its absence. Since serum is a major cost factor and an obstacle to protein purification, our goal was to develop a large-scale TGE process for Chinese hamster ovary (CHO) cells in the absence of serum. CHO-DG44 cells were cultivated and transfected in a chemically defined medium using linear 25 kDa PEI as a transfection vehicle. Parameters that were optimized included the DNA amount, the DNA-to-PEI ratio, the timing and solution conditions for complex formation, the transfection medium, and the cell density at the time of transfection. The highest levels of r-protein expression were observed when cultures ...
In this paper, Beckman Coulter Life Sciences how can the transfection efficiency be improved by using the Biomek i7 Automated Workstation.
The TGEX™-eGFP vector is a green fluorescent reporter designed to monitor transfection efficiency during transient gene expression in mammalian cell suspensions culture. TGEX™-eGFP vector can be used as a single component during transfection to analyze transfection efficiency or at a lower level, between 5% and 10% of the total DNA, to measure efficiency during transient gene expression.. ...
(EMAILWIRE.COM, May 22, 2017 ) Browse 134 market data tables and 43 figures spread through 209 pages and in-depth TOC on Transfection Reagents and Equipment Market http://www.marketsandmarkets.com/Market-Reports/transfection-reagents-equipment-market-139141146.html Early buyers will receive 10%...
ExoFectin® Plasmid DNA-into-Exosome Kit (DNA transfection kit for exosome) is a unique blend of polymers designed for the delivery of plasmid DNA into exosomes. This transfection reagent provides highly efficient transfection of plasmid DNA into exosomes, allowing modified exosomes to carry and deliver plasmid DNA into target cells. This kit provides the following advantages:. ...
In 2015, the reagents segment is expected to account for the largest share of the transfection reagents and equipment market, by product; the biochemical method segment is expected to account for the largest share of the global transfection reagents and equipment market, by method; while the biomedical research segment is expected to account for the largest share of the transfection reagents and equipment market, by application.. In 2015, North America is expected to account for the largest share of the global transfection reagents and equipment market, followed by Europe, Asia-Pacific, and rest of the world (RoW). In future, the transfection reagents and equipment market is expected to witness the highest growth rate in the Asia-Pacific region, with emphasis on India, China, and Japan. High growth in these countries can be attributed to the increase in research activities conducted in these regions, rapid expansion of the biotechnology and pharmaceutical industry, government as well as private ...
MACSfectin™ Reagent is applicable for plasmid DNA, mRNA, and siRNA transfection. For enrichment of transfected cells, the MACSelect™ System, which is based on the renowned MACS® Technology, helps to tackle low transfection efficiencies. It is uses the transiently expressed truncated human CD4, the truncated mouse MHC class I H-2Kk, and truncated human LNGFR as surface markers to select transfected cells. Transduction of cells with only low-titer preparations can be achieved by using MACSductin™ Reagent. It consists of polycationic, magnetic beads that help to efficiently transduce primary cells and cell lines using adeno- or retro-/lentiviral vectors ...
Vacic download tristes P technologies are for Differentiating random-coil people. acid of risk into dirged proposals may affect transduced by solitary proteins, doubt research, DEAE-dextran or acetylation. Promega comes download theories spoken on several siblings( TransFast™ Transfection Reagent and ViaFect™ Transfection Reagent), good lessons( FuGENE® 6 invention Reagent and FuGENE® HD Transfection Reagent) and accordance interaction( ProFection® Mammalian Transfection System).
The role of PTEN in cell spreading was also examined in transiently transfected primary human fibroblasts and DBTRG-05MG cells, a glioblastoma cell line with a 204-base pair deletion inPTEN (1). Cells expressing the various constructs were detected by using green fluorescent protein (GFP) as a marker (10). Again, PTEN inhibited cell spreading on FN (Fig. 2, B and C). In human fibroblasts, the effect was maximal at 20 to 30 min, with only 22 ± 8% of PTEN-overexpressing cells spread at 30 min compared with 60 ± 8% of nontransfected cells or cells with control GFP-plasmid (P , 0.001 to 0.005) (Fig. 2C). The majority of cells had spread by 2 hours, however, indicating that PTEN overexpression delayed but did not prevent spreading. Nevertheless, the surface area covered byPTEN-expressing cells remained less than that of controls (see below). In DBTRG-05MG cells, exogenous expression ofPTEN also delayed spreading; even after 18 hours, only 64% of the cells had spread, and the extent of spreading of ...
* found in: Convoy™ Transfection Reagent, Penetratin 1 Peptide, GeneTran™ III Tranfection Reagent, ConvoyTM is new generation cationic polymer gene..
WE ARE A DISTRIBUTING PARTNER OF ScreenFect - InCella ScreenFect® transfection reagents can efficiently transfect a variety of cells with minimal cytoxicit...
Middle East and Africa Transfection Reagents and Equipment market size was around USD 28.62 million in 2016. It is expected to grow at a CAGR of 5.6 % to reach USD 37.61 million by 2021. It has the lowest market share of 4%.
Plasmid DNA Transfection - http://www.dnatransfection.com/. Information on DNA transfection including plasmid transfection, transient transfection and stable transfection. Includes protocols and articles related to DNA transfection. ...
The MaxCyte® STX™ Scalable Transfection System uses a proprietary flow electroporation technology that can transfect up to 1E10 cells with target, reporter and protein expression plasmids, as well as other molecules, in less than 30 minutes. Transfected cells can be assayed immediately or cryopreserved for future use. Here we demonstrate the use of the MaxCyte STX system in coordination with Cornings ® HYPERFlask® Cell Culture Vessel to provide an efficient and economical solution for culturing large numbers of adherent CHO cells before and after transfection. The HYPERFlask Cell Culture Vessel features Cornings HYPER (High Yield PERformance) technology, which utilizes a gas permeable film to provide gas exchange between the internal culture environment and the external atmospheric environment. The unique, space-saving, 10-layer film design results in 1720 cm2 cell growth surface area, which is approximately 10 times that of a normal T-175 flask. We also show that cells transfected with a ...
Previous studies have implicated Cx-mediated cell-to-cell coupling inβ -cell function (Bosco et al., 1995; Calabrese et al., 2001; Cao et al., 1997; Vozzi et al., 1995) and have suggested that adequate levels of specific Cx isoforms is required for the control of insulin secretion of permanent cell lines (Calabrese et al., 2001; Cao et al., 1997; Vozzi et al., 1995). As yet, however, it has not proved feasible to test this hypothesis directly in normal pancreatic β-cells, mostly because these highly differentiated cells proliferate poorly (Nielsen et al., 1989) and hence are not amenable to the stable expression of exogenous cDNAs by standard transfection procedures. Alternative approaches, which take advantage of viral vectors that can infect pancreatic islets, have been shown to be an effective solution to this problem (Curran et al., 2002; Gallichan et al., 1998; Leibowitz et al., 1999; Salmon et al., 2000). However, these approaches are still limited by the poor viability of β-cells ...
article{9e981584-ee0b-4f80-867b-a0b6814c78bd, author = {Belting, Mattias and Petersson, Per}, language = {eng}, pages = {281--286}, series = {Biochem. J.}, title = {Protective role for proteoglycans against cationic lipid cytotoxicity allowing optimal transfection efficiency in vitro}, year = {1999 ...
The optimization of the lab intern standard protocols was one of our fields on investigation. Besides optimizing the handling of our different cell lines and working steps, the transfection protocol was examined. One of the most remarkable lessons after several transfection performed was the crucial handling of the AAV293 cells. Once over approximately 80 % confluence the cells are no longer competent for transfection. Another achievement in method development was the determination of the optimal plasmid amounts. The best results were performed using 3.3 µg per plasmid and therefore this parameter was modified in our standard protocol. After transfecting the AAV293 we were able to detect the Ca2+-DNA conglomerates in the medium. The toxic side effects of these conglomerates were also confirmed. Not only the medium had to be changed, but also washing with PBS was essential to keep the cells alive. The most critical steps in transfection is the exact pH of the 2x Hepes buffered-saline (HBS) ...
The optimization of the lab intern standard protocols was one of our fields on investigation. Besides optimizing the handling of our different cell lines and working steps, the transfection protocol was examined. One of the most remarkable lessons after several transfection performed was the crucial handling of the AAV293 cells. Once over approximately 80 % confluence the cells are no longer competent for transfection. Another achievement in method development was the determination of the optimal plasmid amounts. The best results were performed using 3.3 µg per plasmid and therefore this parameter was modified in our standard protocol. After transfecting the AAV293 we were able to detect the Ca2+-DNA conglomerates in the medium. The toxic side effects of these conglomerates were also confirmed. Not only the medium had to be changed, but also washing with PBS was essential to keep the cells alive. The most critical steps in transfection is the exact pH of the 2x Hepes buffered-saline (HBS) ...
MACSfectin™ Reagent enables optimized transfection of plasmid DNA for a wide range of adherent and suspension cells in immunology, cancer, stem cell, and neuroscience research. Additionally, MACSfectin Reagent supports tranfection with RNA such as mRNA or siRNA. This unique transfection reagent is based on a novel class of cationic lipopolyamines designed to optimize nucleic acid condensation and augment the cytoplasmic release of the nucleic acid cargo. Additionally, good transgene expression with high cell viability is achieved due to MACSfectin Reagents excellent biodegradation characteristics. - Belgique
Based on an aqueous formulation of cationic and neutral lipids, FlyFectin has been developed exclusively to transfect insect cells.
Browse the product groups below to find reporter assays, a comprehensive range of reporter vectors, luciferase-expressing cell lines and low-toxicity transfection reagents to ensure successful delivery of vectors to the cell line of your choice.
Principal Investigator:NAKANISHI Mamoru, Project Period (FY):1995 - 1997, Research Category:Grant-in-Aid for Scientific Research (A), Section:展開研究, Research Field:Biophysics
Gymnosis combines specifically modified antisense oligos with a cells normal growth properties to achieve sequence-specific target knockdown without the need for transfection reagents or serum additives, according to its developers.
Transfections were performed in six-well culture plates (Corning Inc., Corning, NY). Each well has approximately 10-cm2 surface for cell culture growth. Cells in each well were transfected with 2 μg of total plasmid DNA. To test the transactivating activity of wild-type and mutant hPXRs, the cells were transfected with 50 ng of pcDNA3, wild-type or mutant hPXR, and 1950 ng of pGL3-CYP3A4-luc plasmids. To examine the protein expression and localization, the cells were transfected with 2 μg of pcDNA3 and wild-type or mutant hPXR plasmids. For the rapamycin experiments, the cells were transfected with 50 ng of pcDNA3 or hPXR and 1950 ng of pGL3-CYP3A4-luc plasmids. In p70 S6K overexpression experiments, the cells were transfected with 100 ng of FLAG-pcDNA3, pcDNA3-FLAG-hPXR, or pcDNA3-FLAG-hPXRT57A; 500 ng of constitutively active p70 S6K; and 1000 ng of pGL3-CYP3A4-luc and 100 ng of pGL4-hRluc; FLAG-pcDNA3 was used to make up the total plasmid DNA to 2 μg in each transfection. In mammalian ...
Your feedback on the specific cell lines and conditions used in your lab will provide other researchers with valuable information. Visit the Transfection Cell Database to view transfection data for a range of cell types and transfection reagents. In appreciation of your feedback, you will receive a free gift.. ...
摘要 本研究旨在克隆从江香猪FoxO 4基因编码区序列,对FoxO 4基因功能进行初步探究。采用qRT-PCR技术对从江香猪(6月龄)不同组织中FoxO 4基因的相对表达量进行检测;PCR扩增FoxO 4基因CDS区,构建真核表达载体pEGFP-N3-FoxO4;利用脂质体法将重组质粒pEGFP-N3-FoxO4瞬时转染从江香猪皮下脂肪前体细胞,通过qRT-PCR方法,检测FoxO 4、PPARγ、LPL、FAS、ACC、ATGL、HSL的表达水平。结果显示:FoxO 4基因在从江香猪脂肪组织中表达量最高;构建的重组真核表达载体pEGFP-N3-FoxO4在从江香猪皮下脂肪前体细胞中成功表达,与对照组相比,LPL、FAS、ACC、ATGL、HSL基因的表达均显著上调。综上表明,FoxO 4对脂质代谢具有一定的调控作用,可能是影响从江香猪猪肉品质的重要候选基因,为进一步了解从江香猪脂肪沉积机制提供理论基础。. ...
(Qin) Infection of the chANXA2-transfected cells.Geese embryo fibroblasts (GEF) and 293T cells were transfected with chANXA2, and the transfected cells were the
Your German Partner for Transfection, Gene Expression, Fluorescent Probes, IVD Kits, Antibodies, Peptides, Lipidomics, Glycobiology, Lab Supplies, and more.
The experimental introduction of genes or gene fragments directly into cells in the form of isolated DNA. Various methods such as electroporation and the use of reagents such as lipofectamine, are used to facilitate the passage of the DNA across the plasma membrane. ...
Lonza offers laboratory equipment for Nucleic Acid Electrophoresis and for Transfection. FlashGel System, Nucleofector 4D Device, Nucleofector 2b Device.
Vergleichen Sie Nucleofection Kits Produkte von renommierten Herstellern bei SZABO-SCANDIC. Sie finden Produktdetails, Preise, Verfügbarkeit und mehr.
Molecular Cloning, also known as Maniatis, has served as the foundation of technical expertise in labs worldwide for 30 years. No other manual has been so popular, or so influential.
A fusion reagent for rapid and efficient gene silencing in living cells-the improvement of siRNA transfection Exceptionally efficient siRNA transfection, esp...
Video articles in JoVE about dna viral include Purifying the Impure: Sequencing Metagenomes and Metatranscriptomes from Complex Animal-associated Samples, Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells, Optimized Protocol for Efficient Transfection of Dendritic Cells without Cell Maturation.
Abnova KIAA1530 293T Cell Transient Overexpression Lysate (Denatured) 100µL Life Sciences:Protein Biology:Proteins:Lysates:Overexpression Lysates K
Abnova DCI 293T Cell Transient Overexpression Lysate (Denatured) 100µL Life Sciences:Protein Biology:Proteins:Lysates:Overexpression Lysates D
Molecular Cloning, also known as Maniatis, has served as the foundation of technical expertise in labs worldwide for 30 years. No other manual has been so popular, or so influential.
Introduction The amounts below are given for a 12-well plate format. Use Table 1 to adjust the reagent volumes for other plate sizes
DOK1 overexpression lysate, 0.1 mg. Transient overexpression lysate of docking protein 1, 62kDa (downstream of tyrosine kise 1) (DOK1)
Addgene NGS Result GACGGATCGGGAGATCTCCCGATCCCCTATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTT AAGCCAGTATCTGCTCCCTGCTTGTGTGTTGGAGGTCGCTGAGTAGTGCGCGAGCAAAATTTAAGCTACA ACAAGGCAAGGCTTGACCGACAATTGCATGAAGAATCTGCTTAGGGTTAGGCGTTTTGCGCTGCTTCGCG ATGTACGGGCCAGATATACGCGTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTC ATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCG CCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCC ATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCC AAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTA TGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGC AGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAA TGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACG CAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCTCTGGCTAACTAGAGAACCCA CTGCTTACTGGCTTATCGAAATTAATACGACTCACTATAGGGAGACCCAAGCTTGGTACCGAGCTCGGAT ...
0361] Cell Line Specific Transfection Reagents/Kits include, e.g., GenJet® (Ver. II) DNA In Vitro Transfection Reagent for 3LL Cell, TransIT®-3T3 Transfection Kit, GenJet® (Ver. II) DNA In Vitro Transfection Reagent for NIH3T3 Cell, Human B Cell Nucleofector® Kit, GenJet® (Ver. II) DNA In Vitro Transfection Reagent for B16-F10 Cells, GenJet® (Ver. II) DNA In Vitro Transfection Reagent for BHK-21 Cell, GenJet® (Ver. II) DNA In Vitro Transfection Reagent for C6 Cell, GenJet® (Ver. II) DNA In Vitro Transfection Reagent for C6 Cell, GenJet® (Ver. II) DNA In Vitro Transfection Reagent for Ca Ski Cell, GenJet® (Ver. II) DNA In Vitro Transfection Reagent for Caco-2 Cell, DG44 Transfection Kit, TransIT®-CHO Transfection Kit, GenJet® (Ver. II) DNA In Vitro Transfection Reagent for CHO Cell, TransIT®-COS Transfection Kit, TransPass® COS Transfection Reagent, GenJet® (Ver. II) DNA In Vitro Transfection Reagent for COS Cell, Targefect-COS, GenJet® (Ver. II) DNA In Vitro Transfection Reagent ...
Carbon dots (CDs) have attracted great attention in a broad range of applications due to its unique optical properties, high biocompatibility and property adjustability. However, developed CDs can be rarely used as effective gene vectors up to now. In this work, a fluorine-doping strategy was provided to prepare a novel fluorine-doped CDs (F-CDs) using fluorine-containing aromatic compound as fluorine source and using branched polyethyleneimine (PEI) to furnish positive charge sites. The as-synthesized F-CDs achieves dramatic gene transfection efficiency as well as low cytotoxicity in commonly used cell lines at low weight ratio. It is worthy to point out that this F-CDs is superior efficiency and better biocompatibility compared to some widely used commercial reagents such as branched 25k Da PEI and Lipofectamine 2000. At weight ratio (transfection reagent/EGFP plasmid) of 2, the transfection efficiency of F-CDs achieves about 92% in HEK 293T cells, 85% in COS-7 cells, 81% in A549 cells, 73% in ...
SignaGen Laboratories, A Gene Delivery Company Providing Custom AAV Adenovirus Lentivirus Production Services & Manufacturing DNA/siRNA Transfection Reagents... : Product & Service Citations - > In Vitro DNA Transfection Reagents > In Vivo Transfection Reagents > Pre-optimized Transfection Reagents > In Vitro siRNA Transfection Reagents > Transfection Accessories > Pre-made Adenovirus > shRNA/miRNA AAV Service > Adenovirus Production Service > shRNA/miRNA Adenovirus Svc > AAV Production Service > Ready-to-package Adenovirus > Pre-made AAVs > Pre-made Lentivirus > Lentivirus Production Service SignaGen Laboratories, DNA/siRNA Transfection Reagents, Custom Adenovirus Production Service, Custom AAV Production Service, Custom Lentivirus Production Service
SAN FRANCISCO, Aug. 13, 2019 /PRNewswire/ -- Global Transfection Technologies Market is expected to grow at a significant CAGR in the upcoming period as the scope and its applications are rising enormously across the globe. Transfection technology is used to introduce nucleic acids like RNA or DNA into cells. It helps to regulate gene therapy, protein metabolism, and mutation of cancer cells by affecting the nuclear genes.. The factors that are playing a major role in the growth of transfection technologies market are the rise in research and development sector, the rising investment by private manufacturers and by the government, and the growing occurrence of cancer. However, the high cost of instruments may restrain the overall market growth in the years to come. Market of Transfection technologies is segmented based on type, application, and region.. The siRNA delivery, gene delivery, protein delivery, and DNA delivery are the types that could be explored in transfection technologies market ...
In addition to pharmaceutical applications dendrimers have multiple applications as diagnostics, transfection agents and research reagents.. in vitro diagnostic (IVD). Dendrimers can be used to enhance the performance of in vitro diagnostic (IVD) tests. Appropriate use of dendrimers can improve both specificity and sensitivity in ELISA and certain other kinds of diagnostic tests. Starpharma has a licence with Siemens Healthcare for this application.. Transfection and research reagents. Dendrimers have multiple applications as research reagents, including as transfection agents. Read more on transfection reagents. Contact Us to investigate the potential of dendrimers to enhance your commercial life science applications.. ...
Cell lines and culture conditions. HCT-116 human colon cancer cell line and its sublines were maintained in IMDM (Cambrex) supplemented with 1% glutamine (Cambrex) and 10% fetal bovine serum (Sigma). The clone 379.2 (p53−/−), kindly obtained by Prof. Vogelstein, derives from HCT-116 cell line where p53 gene has been disrupted by homologous recombination (25).. Clones stably transfected with pcDNA6/TR plasmid (Invitrogen) coding for tetracycline repressor were obtained in our laboratory from HCT-116wt and HCT116 p53-/- cells and were maintained in medium supplemented with 5 μg/mL blasticidin (InvivoGen). Clones overexpressing the pSuperior siRNA against Chk1 were maintained in medium containing 5 μg/mL blasticidin and 0.17 μg/mL puromycin (Sigma).. Plasmids and stable transfections. To get cellular clones inducibly expressing the siRNAs against Chk1, the pSuperior plasmid (Oligoengine) was used. Briefly, the target siRNA sequences against Chk1, 5′-GGGAUAACCUCAAAAUCUCUU-3′ (24) and ...
GenePORTER 2 Citations - Cell Line Cell Type Source Genlantis Product Citation 3T3-L1 Embryo Swiss Mouse GenePORTER 2 Transfection Reagent Sekimoto, H., Eipper-Mains, J., Pond-Tor, S. and Boney, C.M. (2005) αvβ3 Integrins and Pyk2 Mediate Insulin-Like Growth Factor I Activation of Src and Mitogen-Activated Protein Kinase in 3T3-L1 Cells. Mol. Endocrinol. 19: 1859 - 1867. A549 Lung Carcinoma Human GenePORTER 2 Transfection Reagent Alcorn, M.J., Booth, J.L., Coggeshall, K.M., Metcalf, J.P. (2001) Adenovirus Type 7 Induces Interleukin-8 Production via Activation of Extracellular Regulated Kinase 1/2. J.Virology 75: 6450-59. AD293 Embryonic Kidney Human GenePORTER 2 Transfection Reagent Zhong, M., Murtazina, D.A., Phillips, J., Ku, C-Y and Sanborn, B.M. (2008) Multiple Signals Regulate Phospholipase CBeta3 in Human Myometrial Cells. Biol Reprod. 78: 1007 - 1017 alpha-T3 Pituitary Mouse GenePORTER 2 Transfection Reagent Feng, J., Lawson, M.A. and Melamed, P. (2008) A
B163 We previously demonstrated that Bcl-2 overexpression enhances the resistance of PC-3 human prostate cancer cells to radiation by inhibiting apoptosis, increasing proliferation and inhibiting angiogenesis. To further elucidate the relationship between Bcl-2 expression and the angiogenic potential of the PC-3-Bcl-2 cell line, we evaluated whether Bcl-2 could be involved in not only tumorigenicity but angiogenesis as well. Bcl-2 overexpressing clone and a control transfected clone were used for in vitro and in vivo experiments. Bcl-2 overexpression enhanced the tumorigenic ability of prostate cancer xenografts, enhanced the expression and secretion of key angiogenic factors which stimulated synthesis of neovasculature (as evident by CD31 immunohistochemical staining). Specifically, the increased angiogenic potential was correlated with increased serum levels of bFGF, IL-8, and MMP-9. In vitro analysis demonstrated Bcl-2 expressing tumors to be resistant to rapamycin induced apoptosis and to ...
Transfection of DNA into cells is an indispensible protocol in molecular biology. While plenty of lipid-based transfection reagents are commercially available nowadays, a quick, simple, efficient and inexpensive method is to transfect eukaryotic cells via calcium phosphate co-precipitation with DNA (Graham and van der Eb, 1973). The insoluble calcium phosphate precipitate with the attached DNA adheres to the cell surface and is brought into the cells by endocytosis. Calcium phosphate transfection has been optimized and widely used with many adherent and nonadherent cell lines (Jordan et al., 1996). Calcium phosphate transfection can result in transient expression of the delivered DNA in the target cell, or establishment of stable cell lines (the latter requires a drug selection process). This protocol is also widely used for co-expression of plasmids for packaging viruses. Efficiency of transfection can be close to 100% depending on the cell lines used. Here, a calcium phosphate transfection protocol is
BioAssay record AID 41661 submitted by ChEMBL: Beta-3 agonist efficacy in an adenylate cyclase assay performed on chinese hamster ovary cells transfected with human Beta-3 adrenergic receptor; Inactive.
The role of hepatitis B virus (HBV) X protein (HBx) in the regulation of HBV replication remains controversial. In the present study, the role of HBx in regulating HBV replication was initially investigated in both HepG2 and Huh7 in vitro cell lines with a transient transfection system. Next, the regions of HBx responsible for transcriptional transactivation and promotion of HBV replication were mapped in an HBV replication mouse model by in vivo transfection of a series of HBx expression plasmids. In an in vitro setting, HBx deficiency had little effect on HBV replication in Huh7 cells, but impaired HBV replication in HepG2 cells. In an in vivo setting, HBx had a strong enhancing effect on HBV transcription and replication. For the C-terminal two-thirds of the protein (amino acids [aa] 51 to 154) was required for this function of HBx, and the regions spanning aa 52 to 72 and 88 to 154 were found to be important for the stimulatory function of HBx on HBV replication. In conclusion, the role of HBx in
Dendritic cells (DC) generated from human umbilical cord blood might replace patients' DC in attempts to elicit tumor-specific immune response in cancer patients. We studied the efficiency of transfection of human cord blood DC with plasmid DNA carrying the enhanced version of green fluorescent protein (EGFP) as a reporter gene, to test if nonviral gene transfer would be a method to load DC with protein antigens for immunotherapy purposes. Cord blood mononuclear cells were cultured in serum-free medium in the presence of granulocyte-monocyte colony stimulating factor (GM-CSF), stem cell factor (SCF) and Flt-3 ligand (FL), to generate DC from their precursors, and thereafter transfected by electroporation. Maturation of DC was induced by stimulation with GM-CSF, SCF, FL and phorbol myristate acetate (PMA). Transfected DC strongly expressed EGFP, but transfection efficiency of DC, defined as HLA-DR+ cells lacking lineage-specific markers, did not exceed 2.5%. Expression of the reporter gene ...
Global Transfection Reagents Market Research Report 2016 is a market research report available at US $2900 for a Single User PDF License from RnR Market Research Reports Library.
Adipose tissue-derived stem cells are a powerful tool for in vitro study of adult stem cell biology. So far, they have not been extensively used for gain or loss of function studies since they are resistant to most common transfection methods. Herein, we tested several classic transfection methods on human multipotent adipose tissue-derived stem (hMADS) cells. Our results showed that lipofectants and calcium phosphate were poorly efficient for transgene delivery in hMADS cells. In contrast, nucleofection, an electroporation-based method that is assumed to target plasmid DNA directly to the cell nucleus, led to a significant transient transgene expression in hMADS cells (up to 76% enhanced green fluorescent protein [EGFP]-positive cells were detected). Furthermore, after selection of hMADS cells that were nucleofected with a selectable plasmid coding for EGFP, stable EGFP expressing clones could be propagated in culture and efficiently induced to differentiate into EGFP-positive adipocytes and ...
TY - JOUR. T1 - PTH-related protein enhances LoVo colon cancer cell proliferation, adhesion, and integrin expression. AU - Shen, Xiaoli. AU - Falzon, Miriam. PY - 2005/2/15. Y1 - 2005/2/15. N2 - Parathyroid hormone-related protein (PTHrP) has been localized in human colon cancer tissue and cell lines. Tumor cell adhesion to extracellular matrix (ECM) proteins plays a major role in the invasion and metastasis of tumor cells, and is mediated via integrin subunits. The LoVo human colon cancer cell line was used as a model system to study the effects of PTHrP on cell proliferation and adhesion to ECM proteins found in normal liver. Clones of LoVo cells engineered to overexpress PTHrP by stable transfection with a PTHrP cDNA showed enhanced cell proliferation vs. control (empty vector-transfected) cells. PTHrP-overexpressing cells also showed significantly higher adhesion to collagen type I, fibronectin, and laminin, and enhanced expression of the ∀2, ∀5, ∀6, ∃1 and ∃4 integrin subunits. ...
Transfection[edit]. Bacterial spheroplasts, with suitable recombinant DNA inserted into it, can be used to transfect animal ...
... Transfection and Selection Data for HeLa Cells. *Rebecca Skloot, The Immortal Life of Henrietta Lacks book website with ...
Moleleki, N.; van Heerden, S. W.; Wingfield, M. J.; Wingfield, B. D.; Preisig, O. (2003). "Transfection of Diaporthe perjuncta ... to several fungal species that are closely related to Cryphonectria parasitica using in vitro virus transfection techniques. ...
"Production of high-titer helper-free retroviruses by transient transfection". Proc. Natl. Acad. Sci. USA. 90 (18): 8392-8396. ...
"Lentiviral transfection with the PDGF-B gene improves diabetic wound healing". Plast. Reconstr. Surg. 116 (2): 532-8. doi ...
... has proven efficient for use on tissues in vivo, for in utero applications as well as in ovo transfection. ... The process of introducing foreign DNA into eukaryotic cells is known as transfection. Electroporation is highly effective for ... Bioelectrochemistry 74, 124-129 (2008). Potter, Huntington; Heller, Richard (2003-05-01). "Transfection by Electroporation". ... providing researchers with an alternative to trypsinizing their cells prior to transfection. One downside to electroporation, ...
Ghule, Ajinkya (9 October 2017). "Global Transfection Technologies Market 2017- Bio-Rad, Polyplus Transfection, MaxCyte". ... Altogen Biosystems began as a company focusing on non-viral methods of transfection. The company began to experiment with a ... Altogen Biosystems has been named as one of the principal players in the transfection technology market by QY Research. Altogen ... Roberts, Josh P. (12 August 2014). "Primary Cells Pose No Problem with These Transfection Tools". BioCompare. Retrieved 29 ...
This method of transfection was invented by Dr. Yongliang Chu at Life Technologies, Inc. Lipofection Transfection Vectors in ... It is used to increase the transfection efficiency of RNA (including mRNA and siRNA) or plasmid DNA into in vitro cell cultures ... But also in non-dividing cells, research has shown that Lipofectamine improves the efficiency of transfection, which suggests ... Lipofectamine or Lipofectamine 2000 is a common transfection reagent, produced and sold by Invitrogen, used in molecular and ...
The most common commercial reagents for transfection of siRNA are Lipofectamine and Neon Transfection. However it is not ... Gene knockdown by transfection of exogenous siRNA is often unsatisfactory because the effect is only transient, especially in ... siRNAs can also be introduced into cells by transfection. Since in principle any gene can be knocked down by a synthetic siRNA ... Once the siRNA is configured against the gene it has to be effectively delivered through a transfection protocol. Delivery is ...
"Polybrene Infection / Transfection Reagent , TR-1003-G". www.emdmillipore.com. Retrieved 2016-12-02. ...
Transfection How It Works. SQZ Biotech. Retrieved on 2014-05-18. Sharei, Armon; Zoldan, Janet; Adamo, Andrea; Sim, Woo Young; ...
It is added to solution containing DNA meant for transfection. It binds and interacts with negatively charged DNA molecules and ... Gulick, Tod (2003). "Transfection Using DEAE-Dextran". doi:10.1002/0471143030.cb2004s19. Ninfa, Alexander (2010). Fundamental ... This procedure is highly suited for transient transfection used for various molecular biology studies. DEAE-Sepharose, DEAE-650 ...
Membrane activity and transfection ability of amphipathic polycations as a function of alkyl group size. Bioconjug Chem. 2005 ... These innovations also served as the basis for the company's transfection formulations and nucleic acid labeling and ... Mirus Bio (formerly Mirus Bio Corporation), develops and manufactures transfection reagents and related products for life ... new chemistries for transfection [9]; development of a non-viral vector providing sustained liver-specific transgene expression ...
Current transfection efficiency remains poor. One example of the successful use of L. monocytogenes in in vitro transfer ...
Another big advantage is that results can be obtained within 48 hours after transfection.[5] ...
Lassar, AB; Paterson, BM; Weintraub, H (1986). "Transfection of a DNA locus that mediates the conversion of 10T1/2 fibroblasts ...
This enables transfection of molecular cargo attached to the CNT walls or encapsulated by CNTs. For example, the cancer drug ...
The second technique uses the transfection process. Stem cells obtained from the embryo during the blastocysts stage are ...
Transfection - means of inserting DNA into a cell. Transformation (genetics) - means of inserting DNA into a cell. Viral vector ... This plasmid is inserted (usually by transfection) into a producer cell together with other plasmids (DNA constructs) that ... so that simultaneous transfection of multiple plasmids is required to get infectious virions. Moreover, only the plasmid ...
The term can also be understood as DNA transfection using a viral vector. Viral transformation can occur both naturally and ... Transduction Transfection Transgenesis Baron, ed. by Samuel (1996). Medical microbiology (4. ed.). Galveston, Texas: Univ. of ...
This could result in a PAMAM-DNA complex, which would make DNA transfection more efficient due to neutralization of the charges ... As with drug delivery applications, specific targeting of the transfection complex is ideal and must be explored as well. ... Although viral vectors can offer highly specific, high-efficiency transfection, the generation of such viruses is costly and ... Indeed, several reports have confirmed PAMAM dendrimers as effective DNA transfection agents. When the charge balance between ...
It is shown that transfection of miR-181a and miR-181b triggers growth inhibition, apoptosis and inhibits invasion. In addition ...
Rosser MP, Xia W, Hartsell S, McCaman M, Zhu Y, Wang S, Harvey S, Bringmann P, Cobb RR (April 2005). "Transient transfection of ...
H. diminuta has an effective mechanism for interspecies transfection. Beetles prefer to ingest rat droppings infected with ...
Johnston SA, Tang DC (1994). "Gene gun transfection of animal cells and genetic immunization". Methods in Cell Biology. 43 Pt A ...
Poly(ethylenimine) was the second polymeric transfection agent discovered, after poly-l-lysine. PEI condenses DNA into ... Akinc, A; Thomas, M; Klibanov, AM; Langer, R (2004). "Exploring polyethylenimine-mediated DNA transfection and the proton ... http://www.polyplus-transfection.com/transfection-reagents/high-throughput-screening-jetpei/ http://www.wipo.int/pctdb/en/wo. ... 2003). "Synthesis of Linear Polyethylenimine Derivatives for DNA Transfection". Bioconjugate Chemistry. 14: 581-587. doi: ...
Neuronal transfection in brain slices using particle-mediated gene transfer.. Lo DC1, McAllister AK, Katz LC. ... Conventional transfection techniques have been of limited effectiveness, particularly in intact neural tissues. Viral vectors ... Difficulties in neuronal transfection continue to restrict the applicability of molecular approaches to neurobiology. ... We describe here an alternative strategy using particle-mediated gene transfer for the transfection of neurons and glia in ...
Electroporation System is an easy-to-use and cost-effective electroporation system for high-efficiency transfection of ... products/transfection/. electropora.... or contact us at: [email protected] About MoBiTec GmbH. MoBiTec GmbH (Goettingen, ... TransIT-VirusGEN® SELECT Transfection Reagent for Large Scale Virus Production. And Yet Another Ion Indicator for the Specific ... Products include DNA vectors for cloning and expression, cell transfection reagents and cell culture tools, magnetic beads for ...
The unit can be used for applications such as mammalian cell transfections/gene therapy and cell protein/drug ...
Strategies for the Preparation of Synthetic Transfection Vec ... DNA Synthetic Transfection Vectors Targeted siRNA Transfection ... Strategies for the Preparation of Synthetic Transfection Vectors, by Asier Unciti-Broceta, Matthew N. Bacon, and Mark Bradley. ... Hyperbranched Polyamines for Transfection, by Wiebke Fischer, Marcelo Calderon, and Rainer Haag. * ... Chemically Programmed Polymers for Targeted DNA and siRNA Transfection, by Eveline Edith Salcher and Ernst Wagner. * ...
"Nanoparticle Based Transfection Reagents". Biology Transfection Research Resource. Transfection.ws. Graham FL, van der Eb AJ ( ... Other methods of transfection include nucleofection, which has proved very efficient in transfection of the THP-1 cell line, ... Magnetofection, or magnet-assisted transfection, is a transfection method that uses magnetic force to deliver DNA into target ... Transfection at the US National Library of Medicine Medical Subject Headings (MeSH) "Transfection". Protocols and Applications ...
GeneXPlus Transfection Reagent. GeneXPlus Transfection Reagent is designed to efficiently transfect a broad spectrum of cell ... TransfeX™ Transfection Reagent. TransfeX™ Transfection Reagent has been optimized for use on a wide range of cell types, ... Our transfection reagents are cationic lipid-based; due to their positive charge, these transfection reagents interact with the ... ATCC® Transfection reagents may be used for the transfer of nucleic acids for a variety of applications, including protein ...
... and merge transfection and expression steps in bioprocessing. ... New transfection technologies abound. They are making it ... Transformative Times for Transfection. No Longer Mere Methodology, Transfection Is Being Integrated into New Applications ... "The biggest challenge is to try to optimize transfection on microcarriers," notes Dr. Rancourt. Transfection in the stirred- ... "But when a transfection experiment is performed, the phenotype is a spectrum that depends on where the gene may integrate into ...
... storage without apparent loss of transfection efficiency. The disadvantages of reverse transfection are: Reverse transfection ... The advantages of reverse transfection (over conventional transfection) are: The addition and attachment of target cells to the ... Second, 200ul of transfection mix is pipetted into one of the HybriWell ports; the mixture will distribute evenly over the ... Third, the transfection mix is pipetted away and the HybriWell removed with a thin-tipped forceps. Fourth, the printed slide ...
To date, all my transfections were unsuccessfull. Does , anybody have any ideas why the transfections wont work? , , Thanks , ... Transfection problems. John Ladasky jladasky at pmgm.Stanford.EDU Thu Jan 29 18:50:09 EST 1998 *Previous message: Transfection ... construct using the calsium phosphate method of transfection. The DNA I , used for this transfection was isolated with ... Rentia I have used Promegas Wizard minipreps and maxipreps to prepare plasmid DNA that was suitable for transfection. The cell ...
... Vladimir Svetlov svetlov at oncology.wisc.edu Tue Aug 26 14:36:02 EST 1997 *Previous message: ... Good luck with transfection with DNA ligated in presence of EtBr. Yours, Pointless peasant Baldrick. *Previous message: ...
... using various stock images to create a transfection vision)and Layout Design for the New Thermo Scientific Transfection Product ... Thermo Scientific Transfection Brochure & Cover Imagery. Created Cover Imagery (using various stock images to create a ... transfection vision)and Layout Design for the New Thermo Scientific Transfection Pr Read more. 7 ...
... luciferase-expressing cell lines and low-toxicity transfection reagents to ensure successful delivery of vectors to the cell ... Transfection Reagents. Proven, well-cited transfection solutions for a range of cell types, including primary cells and iPSCs. ... Reporter Assays and Transfection. Browse the product groups below to find reporter assays, a comprehensive range of reporter ... vectors, luciferase-expressing cell lines and low-toxicity transfection reagents to ensure successful delivery of vectors to ...
Transfection,Reagent,Handbook,biological,advanced biology technology,biology laboratory technology,biology device technology, ... For transfection of eukaryotic cells with RNA and siRNA Contents Kit Contents Storage and Stability Quality Control a href #Te, ... Optimizing siRNA Transfection. Guidelines for Transfection of siRNA Duplexes Using TransMessenger Transfection Reagent. ... TransMessenger Transfection Reagent. 2. Efficient DNA transfection of primary CNS neurons using TransMessenger Transfection ...
Transfection of RNA can be used either to induce protein expression, or to repress it using antisense or RNA interference (RNAi ... procedures.,/p, ,p,There are two types of transfection - transient and stable - suited to different experimental applications, ... p,Transfection - the delivery of DNA or RNA into eukaryotic cells - is a powerful tool used to study and control gene ... Guidelines for transfection of DNA. Guidelines for transfection of RNA. Guidelines for transfection of siRNA. Performing ...
... a catheter arrangement with various embodiments for applying heat to a patients cells in vivo in order to improve transfection ... SMC transfection was performed using DNA coprecipitated with CaPO4. SMCs were immediately heated for up to 1 hour at 42 to 45 ... One technique for transfection of cells has used laser poration. This approach has been performed in vitro using a laser beam ... Other approaches to transfection of cells have included chemical methods or electrical poration used in a cell culture, but ...
Using LipofectAMINE, a widely used transfection reagent, we transfected 293T cells with a plasmid harboring... ... A high efficiency transfection protocol employing a common polycationic lipid is described. ... Lipid Gene Transfer 293T Cell Transfection Efficiency Transfection Reagent These keywords were added by machine and not by the ... The transfection efficiency was determined by direct staining for X-gal. The conventional transfection protocol achieved an ...
To protect your privacy, your account will be locked after 6 failed attempts. After that, you will need to contact Customer Service to unlock your account.. You have 4 remaining attempts.. You have 3 remaining attempts.. You have 2 remaining attempts.. You have 1 remaining attempt.. Contact Customer Service ...
R2 Transfection Reagent is a two component non-liposomal reagent combination developed specifically for efficient transfection ... siRNA Transfection Guidelines: *The transfection of siRNA must be optimal in order to obtain maximum silencing of a target gene ... The transfection efficiency of plasmic DNA varies from cell line to cell line. For efficient DNA transfection we recommend the ... In order to easily estimate the efficiency of transfection of particular cell lines use Fluorescein-siRNA Transfection Control ...
Transfection is the process of introducing certain nucleic acids into a eukaryotic cell by means other than a virus. While the ... Two main types of transfection exist: transient transfection and stable transfection. In transient transfection, the DNA is ... In stable transfections, the new DNA becomes part of the cells original DNA by either adding on to it or replacing a piece of ... Transfection is the process of introducing certain nucleic acids into a eukaryotic cell by means other than through a virus. ...
Or does it only matter at transfection? How do I know that my cells are in the mid log phase? How do i... ... confluent and preferably not in colonies for optimal transfection. I usually split my cells 24 hours before transfection. ... Should I always split my cells at their mid log phase? Or does it only matter at transfection? How do I know that my cells are ... Its all rough estimates, 80-100% means usually a full dish of cells, depending on the transfection methods and the cell lines ...
... Leif Søndergaard lsunicph at biobase.dk Thu Sep 20 08:16:17 EST 2001 *Previous message: Want More Money? ... efficiency of transfection, cell death etc. Has anyone used this ,method and got it to work consistently well? Alternatively, ...
Efficient expression of tetracycline-responsive gene following transfection of dentate gyrus neurons in vitro. ...
Reverse transfection method. US6951757 *. Mar 4, 2003. Oct 4, 2005. Whitehead Institute For Biomedical Research. Transfection ... in order to promote co-transfection of the host cells with at least two different target sequences. Co-transfection refers to ... the yeast may be of any species which are cultivable and in the transfection array can be maintained upon transfection. ... For instance, the transfection array can provide a library of secreted peptides, and the ability of a given peptide to induce ...
Transfection of Plasmodium falciparum within human red blood cells. Y Wu, C D Sifri, H H Lei, X Z Su, and T E Wellems ... Transfection of Plasmodium falciparum within human red blood cells Message Subject (Your Name) has sent you a message from PNAS ... Transfection signals from native CAT-encoding DNA compared well with those from a synthetic DNA sequence adapted to the P. ... The transfection of erythrocyte-stage P. falciparum parasites advances our ability to pursue genetic analysis of this major ...
It is a unique cationic lipid that has been specifically optimized for the transfection of neuronal cells. ... NeuroPORTER Transfection Kit is the latest innovation in DNA transfection. ... NeuroPORTER Transfection Kit is a unique cationic lipid that has been specifically optimized for the transfection of neuronal ... Life Science > Molecular Biology > Cloning & Expression > Transfection Reagents > NeuroPORTER™ Transfection Kit Data ...
  • Neuronal transfection in brain slices using particle-mediated gene transfer. (nih.gov)
  • Difficulties in neuronal transfection continue to restrict the applicability of molecular approaches to neurobiology. (nih.gov)
  • We describe here an alternative strategy using particle-mediated gene transfer for the transfection of neurons and glia in intact brain slices. (nih.gov)
  • Conventional transfection techniques have been of limited effectiveness, particularly in intact neural tissues. (nih.gov)
  • Browse our X-tremeGENE™ Transfection Database to easily find the best reagent for your specific applications, cell types, references and published protocols. (sigmaaldrich.com)
  • Transfection protocols can be established in smaller scale using the 4D-Nucleofector™ X Unit and smoothly transferred to larger scale without the need for re-optimization. (lonza.com)
  • By combining a Nucleofector™ Device with Lonza's easy-to-use Nucleofector™ Kits and the company's range of cell-type specific protocols, high transfection efficiencies can be reproducibly achieved with excellent cell viability. (lonza.com)
  • Successful transfection of THP-1 monocytes with subsequent phorbol 12-myristate 13-acetate (PMA)-induced differentiation into macrophages is not a trivial matter, because according to previous transfection protocols, cell viability is lost almost completely within 24 h of PMA treatment following transfection. (biomedsearch.com)
  • MATra can also be adapted to high-throughput transfection assays using robotic stations and adapted protocols. (promocell.com)
  • We have tried a number of transfection protocols. (ncifcrf.gov)
  • As long as the individual transfection protocols are compatible, this method ensures uptake of all nucleic acids by the cell simultaneously. (mirusbio.com)
  • 80% cell viability) at the optimal transfection concentration by MTT assay. (rsc.org)
  • Here we demonstrate how a Design of Experiment (DOE) approach can be quickly automated on the Biomek i7 Automated Workstation (Figure 1) to identify optimal transfection conditions for a variety of cell lines. (beckman.com)
  • Several cell densities and lipid volumes were investigated to determine optimal transfection conditions, shown by the shaded boxes. (horizondiscovery.com)
  • NeuroPORTER provides a fast, simple, and reliable system for DNA transfections and assures high efficiency, high viability results every time! (sigmaaldrich.com)
  • Low transfection efficiency and low cell viability are the most frequent causes of unsuccessful gene silencing experiments. (bio-medicine.org)
  • The goal of transfection optimization is to determine the conditions that will provide maximum gene knockdown while maintaining an acceptable level of viability for the particular cell type (see sidebar, Two-Step Optimization Protocol ). (bio-medicine.org)
  • It delivers exceptional transfection efficiency into the widest range of difficult-to-transfect and common cell types with improved cell viability. (thermofisher.com)
  • Parameters that were optimized included the DNA amount, the DNA-to-PEI ratio, the timing and solution conditions for complex formation, the transfection medium, and the cell density at the time of transfection. (epfl.ch)
  • Since the reagent is composed of animal-origin free components and is serum compatible, there is no need for any culture medium change after transfection. (atcc.org)
  • Furthermore, the F-CDs shows excellent efficient transfection even at low pDNA dose, low F-CDs transfection reagent dose and high serum concentration, indicating potential clinical applications. (rsc.org)
  • For ease of use, plasmid transfections can be carried out entirely in the presence of serum . (clontech.com)
  • Promote transfection using lipofection and support growth of HEK 293 cultures with GE Healthcare HyClone SFM4Transfx-293 media, a serum-free, animal-derived component free (ADCF) media. (thomassci.com)
  • MATra transfections can be performed in the presence or absence of serum and/or antibiotics. (promocell.com)
  • Transfection of RNA can be used either to induce protein expression, or to repress it using antisense or RNA interference (RNAi) procedures. (qiagen.com)
  • The first set of slides demonstrates the efficient transfection of a plasmid expressing GFP (green fluorescent protein) into a primary culture of rat cortical neurons. (sigmaaldrich.com)
  • We are truly delighted to sign this license agreement with Kempbio, a company offering quality cell culture and protein expression services," said Mark Bloomfield, CEO of Polyplus-transfection. (biospace.com)
  • Protein/antibody delivery using PULSin may be superior to transfection in some applications. (bio-medicine.org)
  • Virus-mediated transfection, also known as transduction, offers a means to reach hard-to-transfect cell types for protein overexpression or knockdown, and it is the most commonly used method in clinical research (Glover et al. (thermofisher.com)
  • What is the Xfect Protein Transfection Reagent and how does it work? (clontech.com)
  • Xfect Protein Transfection Reagent is a modified peptide with cell-penetrating activity whose amino acid composition enables it to interact with a protein cargo and transport this protein across a cell membrane barrier. (clontech.com)
  • Protein transfection is extremely rapid compared to traditional gene expression studies using transfected DNA (1-2 hours compared to 18-48 hours), because it bypasses cellular processes such as transcription and translation. (clontech.com)
  • What are the advantages of Xfect Transfection Reagent compared to other protein delivery technologies? (clontech.com)
  • With recessive dystrophic epidermolysis bullosa keratinocytes (RDEBK-TA4), the DSP exhibited high transfection efficacy with both Gaussia luciferase marker DNA and the full length COL7A1 transcript encoding the therapeutic type VII collagen protein (C7). (rsc.org)
  • Cell transfection promotes the rapid advancement of our knowledge of genetic regulation and protein function. (promocell.com)
  • This is not (usually) a problem if the vector carries a gene for a nontoxic protein and the vector stock has been freshly prepared by transfection. (ncifcrf.gov)
  • Transfection technology application market is further segmented as biomedical research, therapeutic delivery and protein production. (sbwire.com)
  • Rising prevalence of various cancers (prostate, breast and lung), cardiovascular diseases (arrhythmias, ischemic heart disease) and growing mass protein production further accentuates the global transfection technology market. (sbwire.com)
  • Transfection technologies are widely used in cell research, recombinant protein production, drug discovery, gene therapy and therapeutics. (sbwire.com)
  • The data from the four transfection experiments were combined for gene expression profiling data analysis, as previously described . (bionity.com)
  • Polyplus-transfection SA is a biotechnology company researching, developing, manufacturing and marketing innovative solutions for scientists working in molecular and cell biology. (biospace.com)
  • Polyplus-transfection recently extended its product offering to molecular biologists with the launch and commercialization of ZNA (TM) modified oligonucleotides. (biospace.com)
  • Successful transfection is influenced by many factors. (qiagen.com)
  • Apart from the cell type, successful transfection also depends on the culture's age and density at transfection, the vector used, the purity of the nucleic acids, and the experimental conditions. (promocell.com)
  • Step by step, using this technology, researchers have been able to bring more functionality to cell types that were considered to be refractory to transfection, such as primary neurons," states Dr. Berger. (genengnews.com)
  • We describe here an alternative strategy using particle-mediated gene transfer for the transfection of neurons and glia in intact brain slices. (nih.gov)
  • transfection of nucleic acids into primary neurons and cultured neuronal cell lines. (thomassci.com)
  • The findings have been published in ( ACS Applied Materials & Interfaces , 'Effect of PEGylated Magnetic PLGA-PEI Nanoparticles on Primary Hippocampal Neurons: Reduced Nanoneurotoxicity and Enhanced Transfection Efficiency with Magnetofection' ). (nanowerk.com)
  • Furthermore, they found increased gene transfection efficiency in primary hippocampal neurons using PEGylated MNP-PLGA-PEI nanoparticles under an external magnetic field. (nanowerk.com)
  • there is a growing demand for new transfection technologies to address unmet needs for therapeutic delivery which is driving the transfection market. (marketsandmarkets.com)
  • Growth in gene therapy is also driving the transfection market. (sbwire.com)
  • Transfection signals from native CAT-encoding DNA compared well with those from a synthetic DNA sequence adapted to the P. falciparum major codon bias, demonstrating effective expression of the bacterial sequence despite its use of rare P. falciparum codons. (pnas.org)
  • High levels of dystrophin cDNA expression, and an efficient distant transfection effect with preferential intranuclei inclusion of MF-2 vehicle, are very encouraging for the development of a new constructive strategy in gene therapy trials of DMD. (nature.com)
  • Stable expression can be influenced by two factors: The transfection method used and the vector containing the shRNA of interest. (openwetware.org)
  • The generation of high-titer, helper-free retroviruses by transient transfection has been achieved by using the highly transfectable 293T cell line into which are stably introduced constructs that express retroviral packaging functions. (pnas.org)
  • Effectene Reagent is used in conjunction with the enhancer and the DNA condensation buffer (Buffer EC) to achieve high transfection efficiency. (wikipedia.org)
  • In this webinar, we discuss the key steps and protocol considerations for performing high-quality transfections on a consistent basis, taking into consideration variables such as cell type, culture conditions, reagent concentrations, and other critical parameters. (sciencemag.org)
  • Rentia I have used Promega's Wizard minipreps and maxipreps to prepare plasmid DNA that was suitable for transfection. (bio.net)
  • Explore the resources provided below to easily identify which X-tremeGENE™ transfection reagent is suitable for your specific cell line and application needs. (sigmaaldrich.com)
  • It is also suitable for assaying tissue sections after in vivo transfection. (activemotif.com)
  • This is true for most of the reagent based transfection reactions. (marketsandmarkets.com)
  • Reagent based transfection technology market is experiencing significant growth owing to cost effectiveness and less complicated methods involved during transfection. (yahoo.com)
  • Experiments involving large constructs have typically been carried out using electroporation, as reagent-based transfection yielded poor results. (thermofisher.com)
  • Market Research Report Search Engine Added 'Transfection Technology Market (Reagent-based method, Instrument-based method and Virus-based method) - Global Industry Analysis, Size, Share, Growth, Trends and Forecast, 2013 - 2019' to its database. (sbwire.com)
  • There are few upcoming transfection technologies like nucleofection and magnetofection which are an off-shoot of electroporation, which have the potential to address these challenges but are currently cost prohibitive due to which the technologies may have a much slower uptake in the developing world. (marketsandmarkets.com)