AnatomyOrganismsDiseasesChemicals and DrugsAnalytical, Diagnostic and Therapeutic Techniques and EquipmentPhenomena and ProcessesDisciplines and OccupationsAnthropology, Education, Sociology and Social PhenomenaHumanitiesInformation ScienceHealth CareGeographicals
RNA, GuideRNARNA, Small InterferingRNA, ViralRNA EditingRNA SplicingRNA, RibosomalRNA InterferenceRNA, MessengerRNA, BacterialTranscription FactorsDNA-Directed RNA PolymerasesRNA VirusesRNA, Double-StrandedBase SequenceRNA Polymerase IIGene Expression RegulationMolecular Sequence DataRNA, CatalyticPromoter Regions, GeneticTranscription, GeneticRNA FoldingRNA StabilityRNA, FungalRNA, AntisenseRNA Processing, Post-TranscriptionalPubMedPeriodicals as TopicBooksGenetic EngineeringPublishingMEDLINENobel PrizeEncyclopedias as TopicRNA-Induced Silencing ComplexGenomicsArgonaute ProteinsClustered Regularly Interspaced Short Palindromic RepeatsCRISPR-Associated ProteinsPennsylvaniaInverted Repeat SequencesCRISPR-Cas SystemsNeoplasmsTreatment OutcomePrecursor T-Cell Lymphoblastic Leukemia-LymphomaGenes, mybPrecursor Cell Lymphoblastic Leukemia-LymphomaLeukemia-Lymphoma, Adult T-CellInduced Pluripotent Stem CellsFraudPluripotent Stem CellsNuclear ReprogrammingEmbryonic Stem CellsCell DifferentiationStem Cells
RNA, Guide: Small kinetoplastid mitochondrial RNA that plays a major role in RNA EDITING. These molecules form perfect hybrids with edited mRNA sequences and possess nucleotide sequences at their 5'-ends that are complementary to the sequences of the mRNA's immediately downstream of the pre-edited regions.RNA: A polynucleotide consisting essentially of chains with a repeating backbone of phosphate and ribose units to which nitrogenous bases are attached. RNA is unique among biological macromolecules in that it can encode genetic information, serve as an abundant structural component of cells, and also possesses catalytic activity. (Rieger et al., Glossary of Genetics: Classical and Molecular, 5th ed)RNA, Small Interfering: Small double-stranded, non-protein coding RNAs (21-31 nucleotides) involved in GENE SILENCING functions, especially RNA INTERFERENCE (RNAi). Endogenously, siRNAs are generated from dsRNAs (RNA, DOUBLE-STRANDED) by the same ribonuclease, Dicer, that generates miRNAs (MICRORNAS). The perfect match of the siRNAs' antisense strand to their target RNAs mediates RNAi by siRNA-guided RNA cleavage. siRNAs fall into different classes including trans-acting siRNA (tasiRNA), repeat-associated RNA (rasiRNA), small-scan RNA (scnRNA), and Piwi protein-interacting RNA (piRNA) and have different specific gene silencing functions.RNA, Viral: Ribonucleic acid that makes up the genetic material of viruses.RNA Editing: A process that changes the nucleotide sequence of mRNA from that of the DNA template encoding it. Some major classes of RNA editing are as follows: 1, the conversion of cytosine to uracil in mRNA; 2, the addition of variable number of guanines at pre-determined sites; and 3, the addition and deletion of uracils, templated by guide-RNAs (RNA, GUIDE).RNA Splicing: The ultimate exclusion of nonsense sequences or intervening sequences (introns) before the final RNA transcript is sent to the cytoplasm.RNA, Ribosomal: The most abundant form of RNA. Together with proteins, it forms the ribosomes, playing a structural role and also a role in ribosomal binding of mRNA and tRNAs. Individual chains are conventionally designated by their sedimentation coefficients. In eukaryotes, four large chains exist, synthesized in the nucleolus and constituting about 50% of the ribosome. (Dorland, 28th ed)RNA Interference: A gene silencing phenomenon whereby specific dsRNAs (RNA, DOUBLE-STRANDED) trigger the degradation of homologous mRNA (RNA, MESSENGER). The specific dsRNAs are processed into SMALL INTERFERING RNA (siRNA) which serves as a guide for cleavage of the homologous mRNA in the RNA-INDUCED SILENCING COMPLEX. DNA METHYLATION may also be triggered during this process.RNA, Messenger: RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.RNA, Bacterial: Ribonucleic acid in bacteria having regulatory and catalytic roles as well as involvement in protein synthesis.Transcription Factors: Endogenous substances, usually proteins, which are effective in the initiation, stimulation, or termination of the genetic transcription process.DNA-Directed RNA Polymerases: Enzymes that catalyze DNA template-directed extension of the 3'-end of an RNA strand one nucleotide at a time. They can initiate a chain de novo. In eukaryotes, three forms of the enzyme have been distinguished on the basis of sensitivity to alpha-amanitin, and the type of RNA synthesized. (From Enzyme Nomenclature, 1992).RNA Viruses: Viruses whose genetic material is RNA.RNA, Double-Stranded: RNA consisting of two strands as opposed to the more prevalent single-stranded RNA. Most of the double-stranded segments are formed from transcription of DNA by intramolecular base-pairing of inverted complementary sequences separated by a single-stranded loop. Some double-stranded segments of RNA are normal in all organisms.Base Sequence: The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.RNA Polymerase II: A DNA-dependent RNA polymerase present in bacterial, plant, and animal cells. It functions in the nucleoplasmic structure and transcribes DNA into RNA. It has different requirements for cations and salt than RNA polymerase I and is strongly inhibited by alpha-amanitin. EC 2.7.7.6.Gene Expression Regulation: Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control (induction or repression) of gene action at the level of transcription or translation.Molecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.RNA, Catalytic: RNA that has catalytic activity. The catalytic RNA sequence folds to form a complex surface that can function as an enzyme in reactions with itself and other molecules. It may function even in the absence of protein. There are numerous examples of RNA species that are acted upon by catalytic RNA, however the scope of this enzyme class is not limited to a particular type of substrate.Promoter Regions, Genetic: DNA sequences which are recognized (directly or indirectly) and bound by a DNA-dependent RNA polymerase during the initiation of transcription. Highly conserved sequences within the promoter include the Pribnow box in bacteria and the TATA BOX in eukaryotes.Transcription, Genetic: The biosynthesis of RNA carried out on a template of DNA. The biosynthesis of DNA from an RNA template is called REVERSE TRANSCRIPTION.RNA Folding: The processes of RNA tertiary structure formation.RNA Stability: The extent to which an RNA molecule retains its structural integrity and resists degradation by RNASE, and base-catalyzed HYDROLYSIS, under changing in vivo or in vitro conditions.RNA, Fungal: Ribonucleic acid in fungi having regulatory and catalytic roles as well as involvement in protein synthesis.RNA, Antisense: RNA molecules which hybridize to complementary sequences in either RNA or DNA altering the function of the latter. Endogenous antisense RNAs function as regulators of gene expression by a variety of mechanisms. Synthetic antisense RNAs are used to effect the functioning of specific genes for investigative or therapeutic purposes.RNA Processing, Post-Transcriptional: Post-transcriptional biological modification of messenger, transfer, or ribosomal RNAs or their precursors. It includes cleavage, methylation, thiolation, isopentenylation, pseudouridine formation, conformational changes, and association with ribosomal protein.PubMed: A bibliographic database that includes MEDLINE as its primary subset. It is produced by the National Center for Biotechnology Information (NCBI), part of the NATIONAL LIBRARY OF MEDICINE. PubMed, which is searchable through NLM's Web site, also includes access to additional citations to selected life sciences journals not in MEDLINE, and links to other resources such as the full-text of articles at participating publishers' Web sites, NCBI's molecular biology databases, and PubMed Central.Periodicals as Topic: A publication issued at stated, more or less regular, intervals.BooksGenetic Engineering: Directed modification of the gene complement of a living organism by such techniques as altering the DNA, substituting genetic material by means of a virus, transplanting whole nuclei, transplanting cell hybrids, etc.Publishing: "The business or profession of the commercial production and issuance of literature" (Webster's 3d). It includes the publisher, publication processes, editing and editors. Production may be by conventional printing methods or by electronic publishing.MEDLINE: The premier bibliographic database of the NATIONAL LIBRARY OF MEDICINE. MEDLINE® (MEDLARS Online) is the primary subset of PUBMED and can be searched on NLM's Web site in PubMed or the NLM Gateway. MEDLINE references are indexed with MEDICAL SUBJECT HEADINGS (MeSH).Nobel PrizeEncyclopedias as Topic: Works containing information articles on subjects in every field of knowledge, usually arranged in alphabetical order, or a similar work limited to a special field or subject. (From The ALA Glossary of Library and Information Science, 1983)RNA-Induced Silencing Complex: A multicomponent, ribonucleoprotein complex comprised of one of the family of ARGONAUTE PROTEINS and the "guide strand" of the one of the 20- to 30-nucleotide small RNAs. RISC cleaves specific RNAs, which are targeted for degradation by homology to these small RNAs. Functions in regulating gene expression are determined by the specific argonaute protein and small RNA including siRNA (RNA, SMALL INTERFERING), miRNA (MICRORNA), or piRNA (PIWI-INTERACTING RNA).Genomics: The systematic study of the complete DNA sequences (GENOME) of organisms.Argonaute Proteins: A family of RNA-binding proteins that has specificity for MICRORNAS and SMALL INTERFERING RNA molecules. The proteins take part in RNA processing events as core components of RNA-induced silencing complex.Clustered Regularly Interspaced Short Palindromic Repeats: Repetitive nucleic acid sequences that are principal components of the archaeal and bacterial CRISPR-CAS SYSTEMS, which function as adaptive antiviral defense systems.CRISPR-Associated Proteins: Protein components of the CRISPR-CAS SYSTEMS for anti-viral defense in ARCHAEA and BACTERIA. These are proteins that carry out a variety of functions during the creation and expansion of the CRISPR ARRAYS, the capture of new CRISPR SPACERS, biogenesis of SMALL INTERFERING RNA (CRISPR or crRNAs), and the targeting and silencing of invading viruses and plasmids. They include DNA HELICASES; RNA-BINDING PROTEINS; ENDONUCLEASES; and RNA and DNA POLYMERASES.PennsylvaniaInverted Repeat Sequences: Copies of nucleic acid sequence that are arranged in opposing orientation. They may lie adjacent to each other (tandem) or be separated by some sequence that is not part of the repeat (hyphenated). They may be true palindromic repeats, i.e. read the same backwards as forward, or complementary which reads as the base complement in the opposite orientation. Complementary inverted repeats have the potential to form hairpin loop or stem-loop structures which results in cruciform structures (such as CRUCIFORM DNA) when the complementary inverted repeats occur in double stranded regions.CRISPR-Cas Systems: Adaptive antiviral defense mechanisms, in archaea and bacteria, based on DNA repeat arrays called CLUSTERED REGULARLY INTERSPACED SHORT PALINDROMIC REPEATS (CRISPR elements) that function in conjunction with CRISPR-ASSOCIATED PROTEINS (Cas proteins). Several types have been distinguished, including Type I, Type II, and Type III, based on signature motifs of CRISPR-ASSOCIATED PROTEINS.Neoplasms: New abnormal growth of tissue. Malignant neoplasms show a greater degree of anaplasia and have the properties of invasion and metastasis, compared to benign neoplasms.Treatment Outcome: Evaluation undertaken to assess the results or consequences of management and procedures used in combating disease in order to determine the efficacy, effectiveness, safety, and practicability of these interventions in individual cases or series.Precursor T-Cell Lymphoblastic Leukemia-Lymphoma: A leukemia/lymphoma found predominately in children and young adults and characterized LYMPHADENOPATHY and THYMUS GLAND involvement. It most frequently presents as a lymphoma, but a leukemic progression in the bone marrow is common.Genes, myb: Retrovirus-associated DNA sequences (v-myb) originally isolated from the avian myeloblastosis and E26 leukemia viruses. The proto-oncogene c-myb codes for a nuclear protein involved in transcriptional regulation and appears to be essential for hematopoietic cell proliferation. The human myb gene is located at 6q22-23 on the short arm of chromosome 6. This is the point of break in translocations involved in T-cell acute lymphatic leukemia and in some ovarian cancers and melanomas. (From Ibelgaufts, Dictionary of Cytokines, 1995).Precursor Cell Lymphoblastic Leukemia-Lymphoma: A neoplasm characterized by abnormalities of the lymphoid cell precursors leading to excessive lymphoblasts in the marrow and other organs. It is the most common cancer in children and accounts for the vast majority of all childhood leukemias.Leukemia-Lymphoma, Adult T-Cell: Aggressive T-Cell malignancy with adult onset, caused by HUMAN T-LYMPHOTROPIC VIRUS 1. It is endemic in Japan, the Caribbean basin, Southeastern United States, Hawaii, and parts of Central and South America and sub-Saharan Africa.Induced Pluripotent Stem Cells: Cells from adult organisms that have been reprogrammed into a pluripotential state similar to that of EMBRYONIC STEM CELLS.Fraud: Exploitation through misrepresentation of the facts or concealment of the purposes of the exploiter.Pluripotent Stem Cells: Cells that can give rise to cells of the three different GERM LAYERS.Nuclear Reprogramming: The process that reverts CELL NUCLEI of fully differentiated somatic cells to a pluripotent or totipotent state. This process can be achieved to a certain extent by NUCLEAR TRANSFER TECHNIQUES, such as fusing somatic cell nuclei with enucleated pluripotent embryonic stem cells or enucleated totipotent oocytes. GENE EXPRESSION PROFILING of the fused hybrid cells is used to determine the degree of reprogramming. Dramatic results of nuclear reprogramming include the generation of cloned mammals, such as Dolly the sheep in 1997.Embryonic Stem Cells: Cells derived from the BLASTOCYST INNER CELL MASS which forms before implantation in the uterine wall. They retain the ability to divide, proliferate and provide progenitor cells that can differentiate into specialized cells.Cell Differentiation: Progressive restriction of the developmental potential and increasing specialization of function that leads to the formation of specialized cells, tissues, and organs.Stem Cells: Relatively undifferentiated cells that retain the ability to divide and proliferate throughout postnatal life to provide progenitor cells that can differentiate into specialized cells.
AnatomyOrganismsDiseasesChemicals and DrugsAnalytical, Diagnostic and Therapeutic Techniques and EquipmentPhenomena and ProcessesDisciplines and OccupationsAnthropology, Education, Sociology and Social PhenomenaHumanitiesInformation ScienceHealth CareGeographicals
RNA, GuideRNARNA, Small InterferingRNA, ViralRNA EditingRNA SplicingRNA, RibosomalRNA InterferenceRNA, MessengerRNA, BacterialTranscription FactorsDNA-Directed RNA PolymerasesRNA VirusesRNA, Double-StrandedBase SequenceRNA Polymerase IIGene Expression RegulationMolecular Sequence DataRNA, CatalyticPromoter Regions, GeneticTranscription, GeneticRNA FoldingRNA StabilityRNA, FungalRNA, AntisenseRNA Processing, Post-TranscriptionalPubMedPeriodicals as TopicBooksGenetic EngineeringPublishingMEDLINENobel PrizeEncyclopedias as TopicRNA-Induced Silencing ComplexGenomicsArgonaute ProteinsClustered Regularly Interspaced Short Palindromic RepeatsCRISPR-Associated ProteinsPennsylvaniaInverted Repeat SequencesCRISPR-Cas SystemsNeoplasmsTreatment OutcomePrecursor T-Cell Lymphoblastic Leukemia-LymphomaGenes, mybPrecursor Cell Lymphoblastic Leukemia-LymphomaLeukemia-Lymphoma, Adult T-CellInduced Pluripotent Stem CellsFraudPluripotent Stem CellsNuclear ReprogrammingEmbryonic Stem CellsCell DifferentiationStem Cells
EIF2C2EIF2C2
2003). "Single-stranded antisense siRNAs guide target RNA cleavage in RNAi". Cell. 110 (5): 563-74. doi:10.1016/S0092-8674(02) ... This gene encodes a member of the Argonaute family of proteins which play a role in RNA interference. The encoded protein is ... Doi N, Zenno S, Ueda R, Ohki-Hamazaki H, Ui-Tei K, Saigo K (January 2003). "Short-interfering-RNA-mediated gene silencing in ... It may interact with Dicer1 and play a role in short-interfering-RNA-mediated gene silencing. EIF2C2 has been shown to interact ...
CRISPR/Cpf1CRISPR/Cpf1
Cpf1 genes are associated with the CRISPR locus, coding for an endonuclease that use a guide RNA to find and cleave viral DNA. ... Multiple aspects influence target efficiency and specificity when using CRISPR, including guide RNA design. Many design models ... Crystal Structure of Cpf1 in Complex with Guide RNA and Target DNA. Cell 2016, 165 (4), 949-962 DOI: 10.1016/j.cell.2016.04.003 ... Eugene V.; Zhang, Feng (October 2015). "Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System". Cell. 163 (3 ...
Protospacer adjacent motifProtospacer adjacent motif
CRISPR/C2c2 from the bacterium Leptotrichia shahii is RNA-guided CRISPR that targets RNA rather than DNA. PAM is not relevant ... Guide RNAs (gRNAs) can transport Cas9 to anywhere in the genome for gene editing, but no editing can occur at any site other ... Esvelt KM, Mali P, Braff JL, Moosburner M, Yaung SJ, Church GM (2013). "Orthogonal Cas9 proteins for RNA-guided gene regulation ... A technology called GUIDE-Seq has been devised to assay off-target cleavages produced by such gene editing. The PAM requirement ...
EIF2C1EIF2C1
Martinez J, Patkaniowska A, Urlaub H, Lührmann R, Tuschl T (Sep 2002). "Single-stranded antisense siRNAs guide target RNA ... It may interact with dicer1 and play a role in short-interfering-RNA-mediated gene silencing. This gene is located on ... This gene encodes a member of the Argonaute family of proteins which play a role in RNA interference. The encoded protein is ... Doi N, Zenno S, Ueda R, Ohki-Hamazaki H, Ui-Tei K, Saigo K (Jan 2003). "Short-interfering-RNA-mediated gene silencing in ...
CRISPRCRISPR
Its guide RNA targets regulatory DNA sequences called promoters that immediately precede the target gene. Cas9 was used to ... "single-guide RNA" that, when combined with Cas9, could find and cut the DNA target specified by the guide RNA. By manipulating ... CRISPR/Cas-based "RNA-guided nucleases" can be used to target virulence factors, genes encoding antibiotic resistance and other ... "RNA-guided RNA cleavage by a CRISPR RNA-Cas protein complex". Cell. 139 (5): 945-56. doi:10.1016/j.cell.2009.07.040. PMC ...
CRISPR/Cas ToolsCRISPR/Cas Tools
2016). "Evaluation of off-target and on-target scoring algorithms and integration into the guide RNA selection tool CRISPOR". ... "Desktop Genetics Announces the Launch of DeskGen Gene Editing Platform". American Laboratory. 2015. O'Brien, Aidan; Bailey, ... Naito Y, Hino K, Bono H, Ui-Tei K (2015). "CRISPRdirect: software for designing CRISPR/Cas guide RNA with reduced off-target ... Zhu LJ, Holmes BR, Aronin N, Brodsky MH (2014). "CRISPRseek: A Bioconductor Package to Identify Target-Specific Guide RNAs for ...
Epigenetics of human developmentEpigenetics of human development
In Hox genes, long non-coding RNAs allow for communication between different Hox genes and different sets of Hox genes in order ... and represses HoxD genes. HOTAIR acts by attaching to Suz12 in the PRC2 complex, and then guides this complex to the genes to ... and activates HoxA genes. Loops within the chromosome bring HOTTIP closer to its targets; this allows HOTTIP to bind to WDR5/ ... Some imprinted genes code for regulatory RNA elements such as lncRNA, small nucleolar RNA, and micro RNA, so the expression of ...
Germline mutationGermline mutation
... using a guide RNA and effector protein Cas9 to break the DNA backbones at specific target sequences.[27] This system has shown ... "CFTR gene". Genetics Home Reference. Retrieved 2017-11-30.. *^ "Prenatal Diagnosis". Johns Hopkins Cystic Fibrosis Center. ... "About Human Germline Gene Editing , Center for Genetics and Society". www.geneticsandsociety.org. Retrieved 2017-12-01.. ... Mutations in tumour suppressor genes or proto-oncogenes can predispose an individual to developing tumours.[15] It is estimated ...
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome EditingNo-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing
... called single guide RNA (sgRNA). After expression is induced, Cas9 is able to identify the target DNA sequence of the cellular ... While this successfully removes the selective marker from the genome, it leaves FRT scars in place of the target gene. The λ- ... One crucial aspect is that the target gene must be in close proximity upstream of the PAM sequence. Fortunately, the PAM NGG ... Therefore, to avoid cell death, a transfer messenger RNA (ssrA) tag was included in the plasmid downstream of the cas9 gene. In ...
Stable nucleic acid lipid particleStable nucleic acid lipid particle
... which effectively silence expression of a targeted gene. RNAi activates the RNA-induced silencing complex(RISC) containing ... The siRNA guides the RISC complex to a specific sequence on the mRNA that is cleaved by RISC and, consequently, silences those ... A polymerase (L) gene-specific siRNAs delivery system was imposed upon four genes associated with the viral genomic RNA in the ... RNA interference(RNAi) is a process that occurs naturally within the cytoplasm inhibiting gene expression at specific sequences ...
ArgonauteArgonaute
... and Piwi-interacting RNAs (piRNAs). Small RNAs guide Argonaute proteins to their specific targets through sequence ... The small interfering RNAs produced by Dicer cause sequence specific, post-transcriptional gene silencing by guiding an ... But only one of the two single-stranded RNA here will be utilized to base pair with target mRNA. It is known as the guide ... RNA interference (RNAi) is a biological process in which the RNA molecules inhibit gene expression. The method of inhibition is ...
Small nucleolar SNORD12/SNORD106Small nucleolar SNORD12/SNORD106
However, these targets do not appear to be methylated and U106 might function as an RNA chaperone during rRNA folding. A ... "Identification of 13 novel human modification guide RNAs". Nucleic Acids Research. 31 (22): 6543-6551. doi:10.1093/nar/gkg849. ... In humans both HB11-99 and U106 snoRNAs share the same host gene. Most of the members of the box C/D family function in ... "SNORD-host RNA Zfas1 is a regulator of mammary development and a potential marker for breast cancer". RNA. 17 (5): 878-891. doi ...
RNA interferenceRNA interference
... but double-stranded RNA successfully silenced the targeted gene. As a result of this work, they coined the term RNAi. This ... the passenger strand and the guide strand. The passenger strand is degraded and the guide strand is incorporated into the RNA- ... RNAs are the direct products of genes, and these small RNAs can direct enzyme complexes to degrade messenger RNA (mRNA) ... Gene expression in prokaryotes is influenced by an RNA-based system similar in some respects to RNAi. Here, RNA-encoding genes ...
RNA worldRNA world
... where an enzyme-associated guide RNA targets specific mRNA for selective destruction. Likewise, in eukaryotes the maintenance ... viable daughter cells to be produced would require an extra replication of the intact RNA gene homologous to any RNA gene that ... the processing of pre-mRNA and RNA editing take place at sites determined by the base pairing between the target RNA and RNA ... Atkins JF, Gesteland RF, Cech T (2006). The RNA world: the nature of modern RNA suggests a prebiotic RNA world. Plainview, N.Y ...
Selfish genetic elementSelfish genetic element
... where the construct produces guide RNAs that cut the target gene, and homologous flanking sequences then allow insertion of the ... same construct harboring the Cas9 gene and the guide RNAs. Such gene drives ought to have the ability to rapidly spread in a ... "Concerning RNA-guided gene drives for the alteration of wild populations". eLife. 3. doi:10.7554/eLife.03401. PMC 4117217. PMID ... The offspring is normal sized when both genes are present, or both genes are absent. When the maternally expressed gene (Igf2r ...
Trans-acting siRNATrans-acting siRNA
... which means that the genes they target for cleavage and repression do not have much resemblance to the genes from which the ... Like other siRNAs, the ta-siRNAs are incorporated into RNA-induced silencing complexes (RISCs), where they guide the complex to ... TAS gene family numbers do not generally indicate orthology, e.g. the moss TAS1 gene family does not share an ancestor gene ... ta-siRNAs can be loaded into AGO1 complexes to guide target mRNA cleavage. In addition to being present in A. thaliana, ...
Synthetic immunologySynthetic immunology
Techniques include viral gene delivery, inducible gene expression, RNA-guided genome editing, and site-specific recombinases ... Another example is a T cell that targets only cells that display two separate markers. In 2016 John Lin, head of Pfizer's San ... Such engineered organisms have the potential be as safe and as inexpensive as probiotics but precise in carrying out targeted ... Functions include using specific cell markers to target cells for destruction and or interfering with immune reactions. US Food ...
Breast cancer classificationBreast cancer classification
Expression of genes that regulate tubulin may help predict the activity of taxanes. Various molecular pathway targets and DNA ... The 70-Gene Signature (MammaPrint) as a Guide for the Management of Early Stage Breast Cancer. California Technology Assessment ... Understanding the specific details of a particular breast cancer may include looking at the cancer cell DNA or RNA by several ... These co-expressing clusters have included hormone receptor-related genes, HER2-related genes, a group of basal-like genes, and ...
DCas9 activation systemDCas9 activation system
Researchers have used multiple guide RNAs to target dCas9 activation system to multiple genes in a specific mouse strain in ... See: Guide RNA, CRISPR A small guide RNA (sgRNA), or gRNA is an RNA with around 20 nucleotides used to direct Cas9 or dCas9 to ... In order for a protein to be made from the gene that encodes it, RNA polymerase must make RNA from the DNA template of the gene ... In order to guide the dCas9 protein to its target gene, the dCas9 SunTag system uses sgRNA. Tanenbaum et al.(2014) are credited ...
CRISPR interferenceCRISPR interference
... lacking endonuclease activity to regulate genes in an RNA-guided manner. When designing a synthetic sgRNA, only the 20 nt base- ... CRISPRi can influence genes that are in close proximity to the target gene. This is especially important when targeting genes ... "Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression". Cell. 152 (5): 1173-83. doi: ... protein lacking endonuclease activity to regulate genes in an RNA-guided manner. Targeting specificity is determined by ...
Cas9Cas9
Because the target specificity of Cas9 stems from the guide RNA:DNA complementarity and not modifications to the protein itself ... Additionally, dCas9 has been employed in genome wide screens of gene repression. By employing large libraries of guide RNAs ... While native Cas9 requires a guide RNA composed of two disparate RNAs that associate to make the guide - the CRISPR RNA (crRNA ... Cas9 undergoes distinct conformational changes between the apo, guide RNA bound, and guide RNA:DNA bound states, which are ...
RNA interferenceRNA interference
The reverse experiment, in which short sequences of plant genes were introduced into viruses, showed that the targeted gene was ... the passenger strand and the guide strand. The passenger strand is degraded and the guide strand is incorporated into the RNA- ... RNAs are the direct products of genes, and these small RNAs can bind to other specific messenger RNA (mRNA) molecules and ... Gene expression in prokaryotes is influenced by an RNA-based system similar in some respects to RNAi. Here, RNA-encoding genes ...
RNA activationRNA activation
... (RNAa) is a small RNA-guided and Argonaute (Ago)-dependent gene regulation phenomenon in which promoter-targeted ... Li, Long-Cheng (2008). "Small RNA-mediated gene activation". In Morris, Kevin V. RNA and the Regulation of Gene Expression: A ... Such promoter targeted dsRNAs have been termed antigene RNA (agRNAs) or small activating RNA (saRNA). Similar gene activation ... first loaded and processed by an Ago protein to form an Ago-RNA complex which is then guided by the RNA to its promoter target ...
Gene knockdownGene knockdown
Esvelt KM, Mali P, Braff JL, Moosburner M, Yaung SJ, Church GM (November 2013). "Orthogonal Cas9 proteins for RNA-guided gene ... and the RISC uses the siRNA as a template for locating the target mRNA. After the RISC localizes to the target mRNA, the RNA is ... RNA interference (RNAi) is a means of silencing genes by way of mRNA degradation. Gene knockdown by this method is achieved by ... Jiang W, Bikard D, Cox D, Zhang F, Marraffini LA (March 2013). "RNA-guided editing of bacterial genomes using CRISPR-Cas ...
Gene driveGene drive
... either a homing endonuclease or a RNA-guided endonuclease (e.g., Cas9 or Cpf1) and its guide RNA, that cuts the target sequence ... RNA-guided gene drives could be designed with other RNA-guided endonuclease such as CRISPR/Cpf1. One possible application is to ... The approach involves expressing the RNA-guided Cas9 endonuclease along with guide RNAs directing it to a particular sequence ... Dicarlo, J. E.; Chavez, A.; Dietz, S. L.; Esvelt, K. M.; Church, G. M. (2015). "RNA-guided gene drives can efficiently and ...
EbolaEbola
... ability to bind to and infect targeted cells.[51] The viral RNA polymerase, encoded by the L gene, partially uncoats the ... Simpson DI (1977). Marburg and Ebola virus infections: a guide for their diagnosis, management, and control. World Health ... Ebolaviruses contain single-stranded, non-infectious RNA genomes.[46] Ebolavirus genomes contain seven genes including 3'-UTR- ... Finding the virus, viral RNA, or antibodies in blood[1]. Differential diagnosis. Malaria, cholera, typhoid fever, meningitis, ...
AnatomyOrganismsDiseasesChemicals and DrugsAnalytical, Diagnostic and Therapeutic Techniques and EquipmentPhenomena and ProcessesDisciplines and OccupationsAnthropology, Education, Sociology and Social PhenomenaHumanitiesInformation ScienceHealth CareGeographicals
RNA, GuideRNARNA, Small InterferingRNA, ViralRNA EditingRNA SplicingRNA, RibosomalRNA InterferenceRNA, MessengerRNA, BacterialTranscription FactorsDNA-Directed RNA PolymerasesRNA VirusesRNA, Double-StrandedBase SequenceRNA Polymerase IIGene Expression RegulationMolecular Sequence DataRNA, CatalyticPromoter Regions, GeneticTranscription, GeneticRNA FoldingRNA StabilityRNA, FungalRNA, AntisenseRNA Processing, Post-TranscriptionalPubMedPeriodicals as TopicBooksGenetic EngineeringPublishingMEDLINENobel PrizeEncyclopedias as TopicRNA-Induced Silencing ComplexGenomicsArgonaute ProteinsClustered Regularly Interspaced Short Palindromic RepeatsCRISPR-Associated ProteinsPennsylvaniaInverted Repeat SequencesCRISPR-Cas SystemsNeoplasmsTreatment OutcomePrecursor T-Cell Lymphoblastic Leukemia-LymphomaGenes, mybPrecursor Cell Lymphoblastic Leukemia-LymphomaLeukemia-Lymphoma, Adult T-CellInduced Pluripotent Stem CellsFraudPluripotent Stem CellsNuclear ReprogrammingEmbryonic Stem CellsCell DifferentiationStem Cells
Targeted Mutagenesis, Precise Gene Editing, and Site-Specific Gene Insertion in Maize Using Cas9 and Guide RNA | Plant...Targeted Mutagenesis, Precise Gene Editing, and Site-Specific Gene Insertion in Maize Using Cas9 and Guide RNA | Plant...
Targeted Mutagenesis, Precise Gene Editing, and Site-Specific Gene Insertion in Maize Using Cas9 and Guide RNA. Sergei ... Targeted Mutagenesis, Precise Gene Editing, and Site-Specific Gene Insertion in Maize Using Cas9 and Guide RNA ... Targeted Mutagenesis, Precise Gene Editing, and Site-Specific Gene Insertion in Maize Using Cas9 and Guide RNA ... Targeted Mutagenesis, Precise Gene Editing, and Site-Specific Gene Insertion in Maize Using Cas9 and Guide RNA ...
plantphysiol.org
Stem cell tracking system promises more targeted regenerative therapies : Spoonful of MedicineStem cell tracking system promises more targeted regenerative therapies : Spoonful of Medicine
Bundled RNA balls silence brain cancer gene expression. *. I greatly appreciate the work done by each actor involve in the ... Gambhir and his team started with a type of nanoparticle already used in clinical trials to guide cancer drug delivery. They ... Stem cell tracking system promises more targeted regenerative therapies. 20 Mar 2013 , 14:05 EST. , Posted by Kevin Jiang , ... Real-time tissue analysis could guide brain tumor surgery. *. Great work. Nanomedicine is the furture hope for the curative ...
blogs.nature.com
Highly Efficient, Rapid and Co-CRISPR-Independent Genome Editing in Caenorhabditis elegans | G3: Genes | Genomes | GeneticsHighly Efficient, Rapid and Co-CRISPR-Independent Genome Editing in Caenorhabditis elegans | G3: Genes | Genomes | Genetics
Single guide RNA target selection. sgRNA target sequences (,15 bp from the desired edit) were selected using two freely ... 2016 Evaluation of off-target and on-target scoring algorithms and integration into the guide RNA selection tool CRISPOR. ... a CRISPR RNA (crRNA) that is complementary to the target sequence, and a transactivating CRISPR RNA (tracrRNA), which duplexes ... Thus, we sought to develop a method that precludes co-CRISPR, requires only one targeting single guide RNA (sgRNA), and is ...
g3journal.org
Targeted genome engineering in human cells with the Cas9 RNA-guided endonuclease. - PubMed - NCBITargeted genome engineering in human cells with the Cas9 RNA-guided endonuclease. - PubMed - NCBI
Gene. *Gene Expression Omnibus (GEO) Database *Gene Expression Omnibus (GEO) Datasets. *Gene Expression Omnibus (GEO) Profiles ... Targeted genome engineering in human cells with the Cas9 RNA-guided endonuclease.. Cho SW1, Kim S, Kim JM, Kim JS. ... We employ the CRISPR-Cas system of Streptococcus pyogenes as programmable RNA-guided endonucleases (RGENs) to cleave DNA in a ... targeted manner for genome editing in human cells. We show that complexes of the Cas9 protein and artificial chimeric RNAs ...
ncbi.nlm.nih.gov
Targeted genome engineering in human cells with the Cas9 RNA-guided endonucleaseTargeted genome engineering in human cells with the Cas9 RNA-guided endonuclease
We show that complexes of the Cas9 protein and artificial chimeric RNAs efficiently cleave two genomic sites and induce ind … ... to cleave DNA in a targeted manner for genome editing in human cells. ... We employ the CRISPR-Cas system of Streptococcus pyogenes as programmable RNA-guided endonucleases (RGENs) ... Targeted genome engineering in human cells with the Cas9 RNA-guided endonuclease Nat Biotechnol. 2013 Mar;31(3):230-2. doi: ...
pubmed.ncbi.nlm.nih.gov
Is CRISPR Gene Editing Doomed, Even As Gene Therapy Enters the Clinic? | DNA Science BlogIs CRISPR Gene Editing Doomed, Even As Gene Therapy Enters the Clinic? | DNA Science Blog
Strategies can use different repair mechanisms; delivery routes; cell types; target genes; molecular scissors; and guide RNAs. ... "guide RNAs" deliver an enzyme to a desired gene, amending or obliterating it. When the enzyme snips across the double helix, ... Is CRISPR Gene Editing Doomed, Even As Gene Therapy Enters the Clinic? Posted August 9, 2018 by Ricki Lewis, PhD in ... If conventional gene therapy delivers a package to a building, then gene editing would deliver it to a specific drawer in a ...
blogs.plos.org
CMS Seoul May 2017 McCauley v5 by Raymond McCauley on PreziCMS Seoul May 2017 McCauley v5 by Raymond McCauley on Prezi
IGF-1, targeted muscle mass increase. RNA-Guided Human Genome Engineering via Cas9. Prashant Mali, Luhan Yang, Kevin M. Esvelt ... MAOA gene & aggression. last to implement. poorly understood. Therapeutics, then. Enhancement. Gene Expression. gene doping ... MAOA gene & aggression. last to implement. poorly understood. Therapeutics, then. Enhancement. Gene Expression. gene doping ... RNA control of gene expression. CAR-T. phage engineering. DNA origami. DNA drives. Biology Now. Follows Moores Law. Moores ...
prezi.com
Target specificity of the CRISPR-Cas9 system | SpringerLinkTarget specificity of the CRISPR-Cas9 system | SpringerLink
... has been repurposed as an RNA-guided DNA targeting platform. It has been widely used for genome editing and transcriptome... ... 2013) RNA-guided gene activation by CRISPRCas9-based transcription factors. Nat. Methods, 10, 973-976PubMedCentralPubMed ... CRISPR/Cas9 systems have off-target activity with insertions or deletions between target DNA and guide RNA sequences. Nucleic ... Crystal structure of Cas9 in complex with guide RNA and target DNA. Cell, 156, 935-949PubMedCrossRefGoogle Scholar ...
link.springer.com
Targeted in vivo epigenome editing of H3K27me3 | SpringerLinkTargeted in vivo epigenome editing of H3K27me3 | SpringerLink
CRISPR RNA-guided activation of endogenous human genes. Nat Methods. 2013;10:977-9. https://doi.org/10.1038/nmeth.2598.CrossRef ... single guide RNA (sgRNA) guides modifying enzymes or domains fused to dCas9 to the targeted genomic locus, which alters the ... RNA-guided gene activation by CRISPR-Cas9-based transcription factors. Nat Methods. 2013;10:973-6. https://doi.org/10.1038/ ... 3a, b, g, h). Then, we found that the expressions of the two target genes, Arhgap35 and Kita, were significantly lower in dCas9 ...
link.springer.com
Researchers use Modified CRISPR Systems to Modulate Gene Expression on a Genomic Scale - National Cancer InstituteResearchers use Modified CRISPR Systems to Modulate Gene Expression on a Genomic Scale - National Cancer Institute
... developed a CRISPR system that can regulate both gene repression and activation with fewer off-target effects. ... Cancer Target Discovery and Development Network (CTD2) researchers at the University of California, San Francisco, ... with the addition of gene-specific small-guide RNAs (sgRNAs). They identified the optimal TSS target region for these sgRNAs by ... Crystal structure of Cas9 in complex with guide RNA and target DNA. Image adapted from work by Hiroshi Nishimasu, F. Ann Ran, ...
cancer.gov
Verification of CRISPR Gene Editing Efficiency | Thermo Fisher Scientific - USVerification of CRISPR Gene Editing Efficiency | Thermo Fisher Scientific - US
... assay and Sanger sequencing analysis for gene editing efficiency determination. ... TrueGuide Synthetic Guide RNA Controls*. Primers for the GeneArt Cleavage Detection (GCD) Assay. ... Before proceeding with downstream applications, verify the gene editing efficiency of the control target and select the ... Target-specific crRNA sequence. Forward GCD primer. Reverse GCD primer. Human AAVS1**. 5-GCCAGUAGCCAGCCCCGUCC-3 5- ...
thermofisher.com
CLP1 Gene - GeneCards | CLP1 Protein | CLP1 AntibodyCLP1 Gene - GeneCards | CLP1 Protein | CLP1 Antibody
Complete information for CLP1 gene (Protein Coding), Cleavage And Polyadenylation Factor I Subunit 1, including: function, ... GenScript: Design CRISPR guide RNA sequences for CLP1 miRNA Products. * GeneCopoeia miRNA 3UTR Target clone products for CLP1 ... No data available for DME Specific Peptides for CLP1 Gene Domains & Families for CLP1 Gene Gene Families for CLP1 Gene. Human ... Summaries for CLP1 Gene Entrez Gene Summary for CLP1 Gene. * This gene encodes a member of the Clp1 family. The encoded protein ...
genecards.org
INPP5E Gene - GeneCards | INP5E Protein | INP5E AntibodyINPP5E Gene - GeneCards | INP5E Protein | INP5E Antibody
Complete information for INPP5E gene (Protein Coding), Inositol Polyphosphate-5-Phosphatase E, including: function, proteins, ... GenScript: Design CRISPR guide RNA sequences for INPP5E miRNA Products. * GeneCopoeia miRNA 3UTR Target clone products for ... No data available for DME Specific Peptides for INPP5E Gene Domains & Families for INPP5E Gene Gene Families for INPP5E Gene. ... Summaries for INPP5E Gene Entrez Gene Summary for INPP5E Gene. * The protein encoded by this gene is an inositol 1,4,5- ...
genecards.org
CYSLTR2 Gene - GeneCards | CLTR2 Protein | CLTR2 AntibodyCYSLTR2 Gene - GeneCards | CLTR2 Protein | CLTR2 Antibody
Complete information for CYSLTR2 gene (Protein Coding), Cysteinyl Leukotriene Receptor 2, including: function, proteins, ... GenScript: Design CRISPR guide RNA sequences for CYSLTR2 miRNA Products. * GeneCopoeia miRNA 3UTR Target clone products for ... No data available for DME Specific Peptides for CYSLTR2 Gene Domains & Families for CYSLTR2 Gene Gene Families for CYSLTR2 Gene ... Evolution for CYSLTR2 Gene. ENSEMBL:. Gene Tree for CYSLTR2 (if available). TreeFam:. Gene Tree for CYSLTR2 (if available). ...
genecards.org
CRISPR/Cas9/sgRNA-mediated targeted gene modification confirms the cause-effect relationship between gyrA mutation and...CRISPR/Cas9/sgRNA-mediated targeted gene modification confirms the cause-effect relationship between gyrA mutation and...
Guide RNA Design for CRISPR/Cas9-Mediated Potato Genome Editing.. The activity of the pool of sgRNA molecules designed for ... Targeted Gene Repair. A technique which uses synthetic oligonucleotides to direct the cells inherent DNA repair system to ... Home » Topics » Bioinformatics » Research » CRISPR/Cas9/sgRNA-mediated targeted gene modification confirms the cause-effect ... Summary of "CRISPR/Cas9/sgRNA-mediated targeted gene modification confirms the cause-effect relationship between gyrA mutation ...
bioportfolio.com
RNA-induced silencing complex - WikipediaRNA-induced silencing complex - Wikipedia
Martinez J, Patkaniowska A, Urlaub H, Luhrmann R, Tuschl T (2002). "Single-stranded antisense siRNAs guide target RNA cleavage ... RNAi can target endogenous genes. In addition, cyclin E dsRNA only diminished cyclin E RNA - a similar result was also shown ... This process is called RNA interference (RNAi) and it is found in many eukaryotes; it is a key process in gene silencing and ... There are eight family members in human Argonautes of which only Argonaute 2 is exclusively involved in targeted RNA cleavage ...
en.wikipedia.org
CRISPR-edited immune cells for fighting cancer passed a safety test | Science NewsCRISPR-edited immune cells for fighting cancer passed a safety test | Science News
For instance, the sloppiest guide RNA caused 7,778 on-target edits and only 38 off-target edits. In seven of these off-target ... Most (93.5 percent to 100 percent) of the cuts were right on target, but the gene editor made some cuts the researchers didnt ... One part, a snippet of genetic material called a guide RNA, leads the DNA-cutting enzyme Cas9 to specific spots in DNA where ... but the gene editor has since been improved to increase efficiency and decrease off-target cutting. So future trials might have ...
sciencenews.org
Xconomy: CRISPR Update Could Make Gene Edits Easier, Discoverers SayXconomy: CRISPR Update Could Make Gene Edits Easier, Discoverers Say
The popular gene-editing system known as CRISPR/Cas9 has become an indispensable biological research tool, and it also holds ... Cpf1 only uses one strand of RNA as a guide to reach its target gene. Cas9 uses two strands. A single-strand system might lead ... The enzyme and its guide, which is made from RNA, need to do two difficult things: enter a cells nucleus and cut the cells ... Scientists say using Cas9 to replace an old gene with a new one has proven far more difficult than simply cutting out a gene. ...
xconomy.com
High-Definition Analysis of Host Protein Stability during Human Cytomegalovirus Infection Reveals Antiviral Factors and Viral...High-Definition Analysis of Host Protein Stability during Human Cytomegalovirus Infection Reveals Antiviral Factors and Viral...
Each employed integrated guide RNAs (gRNAs) with different target sequences within a given gene. Control cells expressing non- ... UL145 RNA was detected by RNA-seq from 24 hr post infection, the earliest time point studied in the RNA/protein screen ().. (G ... A Proteomic Screen of Viral Block Deletion Mutants Revealed that the UL/b′ gene UL145 Targets HLTF. (A) Regulation of ,250 ... A final screen employed a comprehensive panel of viral mutants to predict viral genes that target ,250 human proteins. This ...
ncbi.nlm.nih.gov
Dietary lipids fuel GPX4-restricted enteritis resembling Crohns disease | Nature CommunicationsDietary lipids fuel GPX4-restricted enteritis resembling Crohn's disease | Nature Communications
Target genes were disrupted in MODE-K IECs using the CRISPR/Cas9 system26. For each gene three guide RNAs (gRNA) targeting ... The guide RNA sequence used for studies in Gpx4-/- IECs was CGTGTGCATCGTCACCAACG, which targeted exon 1. The guide RNA sequence ... RNA extraction and qRT-PCR. RNA was isolated from 6-well plates, epithelial scrapings or human intestinal biopsies using an ... Gene-microbiota interactions contribute to the pathogenesis of inflammatory bowel disease. Science 352, 1116-1120 (2016). ...
nature.com
EIF2C2 - WikipediaEIF2C2 - Wikipedia
2003). "Single-stranded antisense siRNAs guide target RNA cleavage in RNAi". Cell. 110 (5): 563-74. doi:10.1016/S0092-8674(02) ... This gene encodes a member of the Argonaute family of proteins which play a role in RNA interference. The encoded protein is ... Doi N, Zenno S, Ueda R, Ohki-Hamazaki H, Ui-Tei K, Saigo K (January 2003). "Short-interfering-RNA-mediated gene silencing in ... It may interact with Dicer1 and play a role in short-interfering-RNA-mediated gene silencing. EIF2C2 has been shown to interact ...
en.wikipedia.org
Modification of CRISPR guide RNA structure prevents immune response in target cells | EurekAlert! Science NewsModification of CRISPR guide RNA structure prevents immune response in target cells | EurekAlert! Science News
Preassembled Cas9 ribonucleoproteins (RNPs) composed of the recombinant Cas9 protein and in vitrotranscribed (IVT) guide RNA ... complexes can be delivered into cells without risk of foreign DNA integration into the host genome and with fewer off-target ... The journal also features exciting gene discoveries and reports of cutting-edge computational biology and high-throughput ... Modification of CRISPR guide RNA structure prevents immune response in target cells. Cold Spring Harbor Laboratory Press ...
eurekalert.org
Nucleic Acid Delivery : Center for Bioactive Delivery : UMass AmherstNucleic Acid Delivery : Center for Bioactive Delivery : UMass Amherst
An example involves the delivery of Cas9 coupled to guide RNA to target DNA modification of specific genes. ... The aim here is to develop toolkits that impact gene expression, gene knockdown and genome editing. ... An example involves the delivery of Cas9 coupled to guide RNA to target DNA modification of specific genes. ... The aim here is to develop toolkits that impact gene expression, gene knockdown and genome editing. ...
umass.edu
Gene Knock-Ins in Drosophila Using Homology-Independent Insertion of Universal Donor Plasmids | GeneticsGene Knock-Ins in Drosophila Using Homology-Independent Insertion of Universal Donor Plasmids | Genetics
... were cloned by ligating annealed oligos encoding single guide RNAs (sgRNAs) that target the CRISPaint target site (Schmid-Burgk ... We next determined if any of our 20 RFP+ lines expressed Gal4 from the target gene. Since the T2A-Gal4 reporter gene in ... Using primers that are specific to the target gene and mNeonGreen sequence, we successfully amplified sense-orientation gene- ... we targeted 11 genes using pCRISPaint-T2A-Gal4-3xP3-RFP (Table S3). These genes were selected based on their known loss-of- ...
genetics.org
Epigenome editing by a CRISPR-Cas9-based acetyltransferase activates genes from promoters and enhancers | Nature BiotechnologyEpigenome editing by a CRISPR-Cas9-based acetyltransferase activates genes from promoters and enhancers | Nature Biotechnology
RNA-guided epigenome editing with Cas9 fused to an acetyltransferase domain activates gene expression through modification of ... RNA-guided gene activation by CRISPR-Cas9-based transcription factors. . Nat. Methods 10, 973-976 (2013). ... and/or RNA isolations. The gene encoding the ICAM1-targeted zinc finger protein was provided by C. Barbas, III. This work was ... Multiplexed activation of endogenous genes by CRISPR-on, an RNA-guided transcriptional activator system. . Cell Res. 23, 1163- ...
nature.com
AnatomyOrganismsDiseasesChemicals and DrugsAnalytical, Diagnostic and Therapeutic Techniques and EquipmentPhenomena and ProcessesDisciplines and OccupationsAnthropology, Education, Sociology and Social PhenomenaHumanitiesInformation ScienceHealth CareGeographicals
RNA, GuideRNARNA, Small InterferingRNA, ViralRNA EditingRNA SplicingRNA, RibosomalRNA InterferenceRNA, MessengerRNA, BacterialTranscription FactorsDNA-Directed RNA PolymerasesRNA VirusesRNA, Double-StrandedBase SequenceRNA Polymerase IIGene Expression RegulationMolecular Sequence DataRNA, CatalyticPromoter Regions, GeneticTranscription, GeneticRNA FoldingRNA StabilityRNA, FungalRNA, AntisenseRNA Processing, Post-TranscriptionalPubMedPeriodicals as TopicBooksGenetic EngineeringPublishingMEDLINENobel PrizeEncyclopedias as TopicRNA-Induced Silencing ComplexGenomicsArgonaute ProteinsClustered Regularly Interspaced Short Palindromic RepeatsCRISPR-Associated ProteinsPennsylvaniaInverted Repeat SequencesCRISPR-Cas SystemsNeoplasmsTreatment OutcomePrecursor T-Cell Lymphoblastic Leukemia-LymphomaGenes, mybPrecursor Cell Lymphoblastic Leukemia-LymphomaLeukemia-Lymphoma, Adult T-CellInduced Pluripotent Stem CellsFraudPluripotent Stem CellsNuclear ReprogrammingEmbryonic Stem CellsCell DifferentiationStem Cells
GenomeProteinsSequencesInterferenceNucleaseRNAiEndonucleaseSgRNAMoleculesMutationsGRNAGenomicSiRNAsGeneticNucleasesGenomesComplementaryStrandMicroRNAsDsRNAScientistsEnzymeMultiple genesMiRNAsRepressRegulate geneSpecificityTranscribed-CRISPR guideTrans-activSgRNAsResearchersArgonauteEndogenous genesPromotersViralProtospacer Adjacent MotifMoleculeCleavageStrandsEmbryosSyntheticRISCMolecularMutagenesisSiRNATranscriptsHomologousPlasmidsDrosophilaProtein-codinProgrammableGeneticsMRNA degradationPlasmidRepressionMethodsNucleicTranscriptionMutationTherapeuticEditingSpecificBindEffectorSingle guideSilenceBound
Genome66
  • The examples reported in this study demonstrate the utility of Cas9-guide RNA technology as a plant genome editing tool to enhance plant breeding and crop research needed to meet growing agriculture demands of the future. (plantphysiol.org)
  • The most common methods of DNA delivery, particle bombardment and Agrobacterium -mediated transformation, lead to random gene insertions throughout the genome. (plantphysiol.org)
  • Several methods currently exist for engineering the C. elegans genome using CRISPR-Cas9, but the majority of these methods rely on specific genetic backgrounds or co-CRISPR strategies in which screening for the successful edit of one marker gene enriches for the genome edit of interest ( Dickinson and Goldstein 2016 ). (g3journal.org)
  • The method we present not only reduces the complexity and concentration of CRISPR-Cas9-ribonucleoprotein (RNP) delivery, but also surpasses existing plasmid and RNA-based CRISPR-Cas9 genome editing efficiencies in C. elegans . (g3journal.org)
  • Targeted genome engineering in human cells with the Cas9 RNA-guided endonuclease. (nih.gov)
  • We employ the CRISPR-Cas system of Streptococcus pyogenes as programmable RNA-guided endonucleases (RGENs) to cleave DNA in a targeted manner for genome editing in human cells. (nih.gov)
  • The "clustered regularly interspaced short palindromic repeats" are simple DNA sequences that serve as landing strips in a genome where engineered "guide RNAs" deliver an enzyme to a desired gene, amending or obliterating it. (plos.org)
  • While several studies using next-generation sequencing have revealed genome-wide associations between epigenetic modifications and transcriptional states, a direct causal relationship at specific genomic loci has not been fully demonstrated, due to a lack of technology for targeted manipulation of epigenetic modifications. (springer.com)
  • With this knowledge, they designed and mass-produced sgRNAs to target the TSS of every protein-encoding gene in the genome. (cancer.gov)
  • Guide RNA Design for CRISPR/Cas9-Mediated Potato Genome Editing. (bioportfolio.com)
  • Preassembled Cas9 ribonucleoproteins (RNPs) composed of the recombinant Cas9 protein and in vitrotranscribed (IVT) guide RNA complexes can be delivered into cells without risk of foreign DNA integration into the host genome and with fewer off-target effects. (eurekalert.org)
  • The aim here is to develop toolkits that impact gene expression, gene knockdown and genome editing. (umass.edu)
  • INSERTION of DNA into the animal genome is a powerful method to study gene function. (genetics.org)
  • Furthermore, the ability to insert large DNA elements such as promoters, protein-coding sequences, or entire genes into the genome offers researchers endless options for genome modification. (genetics.org)
  • Gene activation by the targeted acetyltransferase was highly specific across the genome. (nature.com)
  • This length-sensing property allows the cell to detect the strands of RNA that are often part of a viral genome or a byproduct of infection. (yalescientific.org)
  • Finally, these mutations occur in the same intron as retroviral integration sites in gene therapy-induced T-ALL, suggesting that such events occur at preferential sites in the noncoding genome. (bloodjournal.org)
  • The other consists of RNA, the molecule most often used to transmit biological information throughout the genome. (newyorker.com)
  • Targeted genome editing advancements could spell the end of a multitude of human diseases. (inquisitr.com)
  • Basically, we used the modified guide RNA to bring a transcriptional activator to work together with the Cas9 and delivered that complex to the region of the genome we were interested in," co-first author Hsin-Kai Liao explained. (inquisitr.com)
  • Scientists at the Center for Genome Engineering, within the Institute for Basic Science (IBS), in collaboration with KIM Eunji (ToolGen Inc.) and KIM Jeong Hun (Seoul National University) have engineered the smallest CRISPR-Cas9 to date, delivered it to the muscle cells and in the eyes of mice via adeno-associated viruses (AAV) and used it to modify a gene causing blindness. (eurekalert.org)
  • AAV is an efficient and safe vector to express a gene of interest in vivo and has been used widely in gene therapy," explains KIM Jin-Soo, director of the IBS Center for Genome Engineering and corresponding author of the study. (eurekalert.org)
  • CjCas9 is highly specific and does not cause off-target mutations in the genome," explains KIM Jin-Soo. (eurekalert.org)
  • By paving the way to the application of CjCas9 against 'undruggable' genes or non-coding sequences, this technology can broaden the range of therapeutic targets, making the entire human genome potentially druggable. (eurekalert.org)
  • Our study reveals a family of endonucleases that use dual-RNAs for site-specific DNA cleavage and highlights the potential to exploit the system for RNA-programmable genome editing. (sciencemag.org)
  • CRISPR/Cas systems are composed of cas genes organized in operon(s) and CRISPR array(s) consisting of genome-targeting sequences (called spacers) interspersed with identical repeats ( 1 - 3 ). (sciencemag.org)
  • By simply altering the sequence of the single-guide RNA (sgRNA), one can reprogram Cas9 to target different sites in the genome with relative ease, but the on-target activity and off-target effects of individual sgRNAs can vary widely. (nih.gov)
  • We incorporate these findings from large-scale, empirical data to improve our computational design rules and create optimized sgRNA libraries that maximize on-target activity and minimize off-target effects to enable more effective and efficient genetic screens and genome engineering. (nih.gov)
  • Some RISCs are able to directly target the genome by recruiting histone methyltransferases to form heterochromatin at the gene locus and thereby, silencing the gene. (wikipedia.org)
  • The success of the CRISPR/Cas9 genome editing technique depends on the choice of the guide RNA sequence, which is facilitated by various websites. (biomedcentral.com)
  • To make these guidelines easily accessible to anyone planning a CRISPR genome editing experiment, we built a new website ( http://crispor.org ) that predicts off-targets and helps select and clone efficient guide sequences for more than 120 genomes using different Cas9 proteins and the eight efficiency scoring systems evaluated here. (biomedcentral.com)
  • thus, current genome editing protocols recommend [ 9 ] that researchers select guides carefully to minimize potential off-target effects and test several to optimize on-target activity. (biomedcentral.com)
  • We developed a novel web-based tool, CRISPOR ( http://crispor.org ), to assist with guide selection in 120 genomes, including plants and many emerging model organisms, and pre-calculated results for all human coding exons as a UCSC Genome Browser track. (biomedcentral.com)
  • During the past 12 years, there has been rapid development of genome-editing strategies that make it possible to directly target regions of genes in a DNA sequence-specific manner. (plantphysiol.org)
  • The STOP-IN cassette also contains an exogenous Cas9 target site that allows further genome editing and provides a unique sequence that simplifies the identification of successful insertion events via PCR. (g3journal.org)
  • We recommend using 2 or more unique gRNA for each gene you wish to target, in order to increase the likelihood of successful genome editing without off-target effects. (genscript.com)
  • We have identified five Argonaute-like genes encoded in the Drosophila genome. (pnas.org)
  • For comparison, the C. elegans genome encodes 23 Argonaute-like genes. (pnas.org)
  • CRISPR-Cas9 is a gene editing tool that is used to remove, edit, or add parts of the DNA within a genome. (news-medical.net)
  • The gRNA guides Cpf1 to a specific position in the genome where Cpf1 subsequently cuts the double stranded DNA. (news-medical.net)
  • The infant macaques show that targeted genome editing is feasible in primates-a potential boon for scientists studying complex diseases, including neurological ones, and an advance that suggests that the method could one day work in humans. (technologyreview.com)
  • The faint ladder-rung patterns in an image of a DNA gel show that genome editing successfully modified a gene in two macaque infants (central columns), but not in an untreated animal (right column). (technologyreview.com)
  • The Chinese researchers injected single-cell macaque embryos with RNAs to guide the genome-editing process. (technologyreview.com)
  • The researchers found that the genome-editing tools created multiple changes in their target genes at different stages of embryonic development. (technologyreview.com)
  • The virus delivered a disease-version of the human Huntington's gene into a random location in the monkey's genome. (technologyreview.com)
  • Genome editing stands for targeted engineering by using specifically designed nucleases. (eppendorf.com)
  • The team of Jong-Jin Park of Oak Ridge National Laboratory developed a CRISPR-Cas9 genome editing system in switchgrass to target 4-Coumarate:coenzyme A ligase (4CL), a key enzyme involved in the early steps of the synthesis of monolignol, a component of lignin. (isaaa.org)
  • The efficiency of genome editing with CRISPR-Cas9 can vary widely at different targets and in different cells. (pnas.org)
  • At multiple target sequences in two promoters in the yeast genome, we find that Cas9 cleavage is strongly inhibited when the DNA target is within a nucleosome. (pnas.org)
  • These results have implications for the choice of specific targets for genome editing, both in research and in clinical and other practical applications. (pnas.org)
  • Genome editing describes the ability to introduce DNA sequence alterations at specific targets in complex genomes. (pnas.org)
  • and the modest cost and complexity of this platform have made targeted genome modifications readily accessible to researchers around the world. (pnas.org)
  • RNA-guided genome editing via Cas9. (elifesciences.org)
  • Clockwise from lower left: The targeting flexibility of Cas9 permits the exclusive selection of target sequences with few potential off-targets in the genome. (elifesciences.org)
  • There, they targeted the end parts of the virus's gene and snipped out all 9,709 nucleotides that made up its genome. (engadget.com)
  • For me, this was a little like sitting down with Bono and Bruce Springsteen, but the women were wonderfully down-to-earth, and a little stunned at all the attention since they published their key paper in 2012 on the technique that is speeding gene editing and making genome editing possible. (plos.org)
  • And with all the genome-wide association studies and human genome sequencing since 2000, we've built up an appreciation for the kinds of mutations that cause disease and the desire to be able to manipulate genes beyond systems like yeast and worms. (plos.org)
  • Nonetheless, they have evolved to perform different biochemical functions, mediating either transcriptional or posttranscriptional silencing important for numerous endogenous gene-regulatory programs as well as viral resistance, transposon suppression, centromere function, and programmed genome rearrangement. (keystonesymposia.org)
  • However, non-viral vectors do not lead to DNA integration of the gene of interest into the host genome. (bioscirep.org)
  • This workflow guide will assist you in selecting the best Edit-R genome engineering tools for your application. (horizondiscovery.com)
  • A guide on how to use CRISPR RNP for targeted genome editing. (genscript.com)
  • The system includes a DNA-cutting enzyme, Cas9, bound to a short RNA guide strand that is programmed to bind to a specific genome sequence, telling Cas9 where to make its cut," Niles explained. (indiavision.com)
  • In zebrafish, this low frequency is in part explained by compensation by genes of redundant or similar function, often resulting from the additional round of teleost-specific whole genome duplication within vertebrates. (plos.org)
  • Since the completion of the Human Genome Project, which identified nearly 20,000 protein-coding genes, scientists have been trying to decipher the roles of those genes. (healthcanal.com)
  • In two new papers, the researchers showed that they could study all the genes in the genome by deleting a different gene in each of a huge population of cells, then observing which cells proliferated under different conditions. (healthcanal.com)
  • Indeed, they have optimized CRISPR genome editing protocols for zebrafish that allow disruption of gene function at nearly 100% efficiency and even demonstrate deletion of genomic DNA more than 50 kb in length. (idtdna.com)
Proteins28
Sequences26
Interference17
Nuclease19
RNAi12
  • Hannon and his colleagues attempted to identify the RNAi mechanisms involved in gene silencing, by dsRNAs, in Drosophila cells. (wikipedia.org)
  • Therefore, RNAi can target endogenous genes. (wikipedia.org)
  • RNAi is characterized by the conversion of long dsRNA into ≈21-25-nt small interfering RNAs (siRNA) that guide the degradation of homologous mRNA. (pnas.org)
  • Notably, members of the Argonaute- like gene family from Arabidopsis , Caenorhabditis elegans , Drosophila , and Neurospora have been genetically and/or biochemically identified as components of the RNAi/cosuppression pathway. (pnas.org)
  • We show here that mutations in the Drosophila Argonaute1 ( AGO1 ) gene suppress RNAi in embryos. (pnas.org)
  • RNAi acts as a cellular defense against parasitic nucleic acids and provides a fortuitous technique for biologists to reduce or eliminate a gene activity ( 3 ). (pnas.org)
  • RNAi-like mechanisms are also involved in the production of small noncoding RNAs that control developmental timing ( 4 , 5 ). (pnas.org)
  • The other two genes, Argonaute1 ( AGO1 ) and AGO2 , are expressed broadly throughout embryonic development and are better candidates to function in RNAi in embryos. (pnas.org)
  • In RNAi, double-stranded RNA is cut in pieces that are 19-21 nucleotides in length by an enzyme called Dicer. (shmoop.com)
  • We show that CRISPR-mediated gene knockout of the Tribolium E-cadherin gene causes defects in dorsal closure, which is consistent with RNAi-induced phenotypes. (biologists.org)
  • The shift from antisense-based knockdown (morpholinos, RNAi) to mutant generation (gene targeting/TILLING methods) resulted in discrepancies in phenotypes, leading researchers to question the specificity and mechanisms of anti-sense technologies and also the methods by which mutants are generated [ 3 ]. (plos.org)
  • RNAi works by delivering short RNA strands known as shRNA that destroy messenger RNA (mRNA), which carries DNA's instructions to the rest of the cell. (healthcanal.com)
Endonuclease16
SgRNA5
Molecules9
Mutations24
  • Mutations were subsequently identified at all sites targeted, and plants containing biallelic multiplex mutations at LIG1 , Ms26 , and Ms45 were recovered. (plantphysiol.org)
  • Progeny showed expected Mendelian segregation of mutations, edits, and targeted gene insertions. (plantphysiol.org)
  • The damage reverberated from the target, triggering chromosomal chaos, while single-base mutations (SNPs) popped up too, even beyond the cut sites. (plos.org)
  • Mutations in this gene are associated with pontocerebellar hypoplasia type 10 (PCH10). (genecards.org)
  • Scientists worry that editing mistakes, deletions and rearrangements may inactivate genes that restrict cell growth or create cancer-promoting mutations. (sciencenews.org)
  • Mutations in the genes encoding presenilins PSEN1 and PSEN2 and the amyloid-β precursor protein ( APP ) are associated with early-onset AD whereas mutation in the gene encoding apolipoprotein E ε4 ( APOE ε 4 ) is associated with late-onset AD. (frontiersin.org)
  • Researchers have used this system to introduce mutations in targeted genes using gRNA. (inquisitr.com)
  • The team claims that similar techniques could be used to activate any gene without the risk of causing unexpected genetic mutations while reversing the course of disease. (inquisitr.com)
  • It is already being used to construct gene drives that could be used to spread desirable mutations through populations in super-Mendelian fashion. (genengnews.com)
  • Genetic studies have shown that small missing pieces of chromosome (deletions, which remove many genes) and changes to the lettering of genes (which stop the gene from working, mutations) can cause intellectual disability or obesity. (plos.org)
  • Here we identified 9 children with intellectual disability and obesity who have mutations in a gene called MYT1L . (plos.org)
  • We have identified a new genetic condition caused by MYT1L mutations, further study of this gene will help us understand, and treat, intellectual disability and obesity. (plos.org)
  • While these mutants allow us to infer the nature of a gene's normal function and to place genes into genetic networks using epistasis analyses, many of them may also contain background mutations that can confound the interpretation of the functional importance of the gene of interest. (g3journal.org)
  • p>Describes annotations that are concluded from looking at variations or changes in a gene product such as mutations or abnormal levels and includes techniques such as knockouts, overexpression, anti-sense experiments and use of specific protein inhibitors. (uniprot.org)
  • The lab is now working on identifying the molecular mechanisms underlying induced lineage fate changes, the phenotypic consequences of disease-causing mutations in human neurons and other neural lineages as well as the development of novel therapeutic gene targeting and cell transplantation-based strategies for a variety of monogenetic diseases. (stanford.edu)
  • CRISPR/Cas9-mediated gene editing is a powerful technique that allows you to create knock-in/out mutations in any gene and any cell. (genscript.com)
  • Toon and I had a set of projects in which we had to construct many mutations and guide RNAs for different genes in the bacterium E. coli . (bcm.edu)
  • We analyzed mRNA processing in seven zebrafish lines with mutations expected to disrupt gene function, generated by CRISPR/Cas9 or ENU mutagenesis methods. (plos.org)
  • The recent rise of reverse genetic, gene targeting methods has allowed researchers to readily generate mutations in any gene of interest with relative ease. (plos.org)
  • By understanding the ways that cells avoid the deleterious consequences of mutations, researchers can better design reverse genetic strategies to increase the likelihood of gene disruption. (plos.org)
  • Recent communications recount numerous cases of generated mutations in genes of interest lacking an expected effect on phenotypes [ 1 , 2 ]. (plos.org)
  • Argonautes' gene-silencing functions also help cells cope with rogue genetic activity from invading viruses or cancer-promoting DNA mutations. (healthcanal.com)
  • The guide RNAs were designed to target specific genomic sites, which were afterwards analyzed for mutations. (idtdna.com)
  • The researchers tested the capacity of this approach to create null mutations with known phenotypes and to delete an entire gene or large genomic segment. (idtdna.com)
GRNA4
Genomic13
SiRNAs5
Genetic27
  • The genetic engineering system, clustered regularly interspaced short palindromic repeats (CRISPR), has conventionally been used to inactivate genes by making targeted double stranded cuts in DNA. (cancer.gov)
  • One part, a snippet of genetic material called a guide RNA, leads the DNA-cutting enzyme Cas9 to specific spots in DNA where researchers want to make a change. (sciencenews.org)
  • The burden of generating unique donor DNAs for HDR makes this method inefficient for targeting many genes in parallel, such as hits from a genetic or proteomic screen, or the same gene in divergent species. (genetics.org)
  • They just increased genetic expression that was on the same pathway as the mutated, disease-causing gene. (inquisitr.com)
  • we consider what impact these invasion-loss cycles have on the genetic diversity of the host gene. (genetics.org)
  • 0.01) representing 45 unique SNPs from Pto-MIR475b and its four targets for 10 traits, revealing that genetic interactions between Pto-MIR475b and its targets influence quantitative traits of perennial plants. (frontiersin.org)
  • Last week, the Sun Yat-Sen University research team said it attempted to cure a gene defect that causes beta-thalassemia (a genetic blood disorder that could lead to severe anemia, poor growth, skeletal abnormalities and even death) by editing the germ line. (rt.com)
  • Some experts say the gene editing could help defeat genetic diseases even before birth. (rt.com)
  • A number of geneticists were studying homing endonucleases as a potential basis for targeted gene therapy, a still-experimental approach to treat or prevent particular genetic diseases in humans. (nap.edu)
  • Some of these chemicals can be used as fuel additives or polymerized into compounds such as rubber.We used a kit of standardized genetic parts to build a gene deletion system based on CRISPR-Cas9 to delete several genes in one single step. (diva-portal.org)
  • DALLAS July 6 2008 Tiny strands of genetic material called RNA a c. (bio-medicine.org)
  • DALLAS July 6, 2008 Tiny strands of genetic material called RNA a chemical cousin of DNA are emerging as major players in gene regulation, the process inside cells that drives all biology and that scientists seek to control in order to fight disease. (bio-medicine.org)
  • We expect that the knock-in method using the STOP-IN cassette will facilitate the generation of new null mutants to understand gene function in C. elegans and other genetic model organisms. (g3journal.org)
  • When people refer to Crispr, they're probably talking about Crispr-Cas9, a complex of enzymes and genetic guides that together finds and edits DNA. (wired.com)
  • the important thing is that they helped file away genetic code from viral invaders past, far away from more essential genes. (wired.com)
  • The first step is designing a guide RNA that can sniff out a particular block of code in any living cell-say, a genetic defect, or an undesirable plant trait. (wired.com)
  • Genetic engineering terms the targeted modifications of genetic information of living organisms/cells. (eppendorf.com)
  • In basic research CRISPR is mainly used in cell line engineering and animal genetic engineering (e.g. of disease models) to investigate gene function. (eppendorf.com)
  • Physicians and chemists from Jena, Munich (both Germany) and the USA have now succeeded in producing nano-transporters for this genetic material which are able to specifically and efficiently target selected cell types and release their active payload there. (innovations-report.com)
  • Co-first authors Nicholas Kramer and Michael Haney used the gene-editing tool to perform the first-ever screen for genetic modifiers of DPR toxicity in mammalian cells. (alzforum.org)
  • Viral vectors are most commonly used for clinical gene therapy resulting in the marketing authorization approval for several products to treat genetic diseases and cancer [ 1 , 2 ]. (bioscirep.org)
  • The sequence we targeted is found in many genetic collections of medically important bacteria and is even in some fruit fly collections ," Marciano said. (bcm.edu)
  • The TSRI discovery means multiple genetic targets in a cell may be hit by each CRISPR-Cpf1 complex. (labmanager.com)
  • Over the last five years, the CRISPR gene editing system has revolutionized microbiology and renewed hopes that genetic engineering might eventually become a useful treatment for disease. (labmanager.com)
  • For one, gene therapy currently requires using a viral shell to serve as the delivery package for the therapeutic genetic material. (labmanager.com)
  • The data generated by this effort will contribute to the disaggregation of the molecular machinery underlying mental disorders by integrating sequence specific modulators of post-transcriptional gene expression into a theoretical framework of disease pathophysiology, with the aim of rapid, widespread sharing of the resulting data to accelerate genetic analysis of human diseases. (nih.gov)
  • This will greatly aid efforts to understand the function of both protein-coding genes as well as noncoding genetic elements," says David Sabatini, a member of the Whitehead Institute, MIT professor of biology, and a senior author of one of the papers, both of which appear in this week's online edition of Science . (healthcanal.com)
Nucleases5
Genomes5
Complementary8
Strand12
MicroRNAs7
DsRNA5
Scientists15
Enzyme9
Multiple genes5
  • Additionally, partial complementarity usually comprises a wide range of possible target genes which means that a single miRNA could regulate multiple genes. (mdpi.com)
  • To achieve maximal flux channelling toward target products, the regulation of expression of multiple genes is desirable, which is labor intensive and time consuming in most cases. (biomedcentral.com)
  • We show here that fPrdm16 was critical for HSC maintenance, induced multiple genes involved in GTPase signaling, and repressed inflammation, while sPrdm16 supported B cell development biased toward marginal zone B cells and induced an inflammatory signature. (jci.org)
  • These maps allow conditions that are due to multiple genes to be more easily identified. (shmoop.com)
  • This system simplifies and significantly improves the efficiency of simultaneous editing of multiple genes, or multiple sites of a single gene," Zhong said. (labmanager.com)
MiRNAs14
  • Our study provided a feasible strategy to study population genetics in forest trees and enhanced our understanding of miRNAs by dissecting the allelic interactions between this miRNA and its targets in P. tomentosa . (frontiersin.org)
  • MiRNAs function by cleaving the transcripts or suppressing the translation of their target genes through near-perfect sequence complementation ( Chen, 2005 ). (frontiersin.org)
  • It is significantly important to predict the targets of miRNAs by computational approaches to understand their effects on the regulation of gene expression. (mdpi.com)
  • The first identifications of the endogenous short regulatory RNAs in Caenorhabditis elegans [ 1 ] and the 7-8 nucleotide-long motifs in the 3' untranslated regions (3' UTRs) of Drosophila melanogaster miRNAs [ 2 ] revealed that expression of genes are under control of small noncoding RNAs (sncRNAs) which bind to mRNAs and repress their expression post-transcriptionally. (mdpi.com)
  • Furthermore, miRNAs are being used by industrial companies both as targets and therapeutic agents in order to generate new treatment methods for diseases [ 7 ]. (mdpi.com)
  • Transcription factors, the key regulators of plant growth and development, are the targets of the miRNAs families. (intechopen.com)
  • The combinatorial regulation of transcription factors and miRNAs guides the appropriate implementation of biological events and developmental processes. (intechopen.com)
  • Post-transcriptional gene regulation involving small non-coding RNAs called miRNAs has also been discovered a few decades ago. (intechopen.com)
  • These miRNAs are involved in the regulation of various genes in animal and plant system by upregulating and downregulating mRNAs [ 4 ]. (intechopen.com)
  • With the escalating gene regulating complexity, it is fascinating to monitor and recognize a vibrant connection among small non-coding RNAs (miRNAs), transcription factors (TFs) and messenger RNAs (mRNAs). (intechopen.com)
  • Some viruses, for example, produce decoy target RNAs that virtually nullify the activity of the corresponding miRNAs, seemingly by destabilizing the miRNA-Argonaute pairing. (healthcanal.com)
  • In this respect, they match the miRNAs much better than the natural gene transcripts that the miRNAs evolved to target. (healthcanal.com)
  • De confirmed that decoy RNAs designed to match miRNAs this way can greatly hasten the miRNAs' "unloading" from Argonautes, thus effectively dialing down these miRNAs' normal gene-silencing activities. (healthcanal.com)
  • Targets with 5'-end mismatches are actually better at unloading miRNAs from Argonaute," she said. (healthcanal.com)
Repress1
Regulate gene4
Specificity2
Transcribed-CRISPR guide1
Trans-activ3
SgRNAs6
  • Co-injection of dCas9-olEzh2 mRNA with single guide RNAs (sgRNAs) into one-cell-stage embryos induced specific H3K27me3 accumulation at the targeted loci and induced downregulation of gene expression. (springer.com)
  • The researchers found CRISPRi/a can be targeted to specific transcriptional start sites (TSS) with the addition of gene-specific small-guide RNAs (sgRNAs). (cancer.gov)
  • They identified the optimal TSS target region for these sgRNAs by testing the ability of the CRISPRi/a systems to modulate gene expression in a Ricin challenge experiment, a commonly used validation test. (cancer.gov)
  • Additionally, we profile the off-target activity of thousands of sgRNAs and develop a metric to predict off-target sites. (nih.gov)
  • For the DPR screen, the researchers transduced the cells with a library of 10 sgRNAs per each of 20,500 genes, as well as 10,000 negative control sgRNAs. (alzforum.org)
  • GenScript CRISPR single-guide RNAs (sgRNAs) are 97-103 nt, fully customizable RNA oligonucleotides, allowing for greater flexibility in your CRISPR experiential design. (genscript.com)
Researchers26
Argonaute8
Endogenous genes1
  • Two commonly used methods in Drosophila to insert DNA into endogenous genes are transposable DNA elements and homology-directed repair (HDR). (genetics.org)
Promoters3
Viral11
  • Bacteria use them in the wild to defend themselves against invading viruses, cutting up the viral RNA and storing the pieces in a kind of immune system memory bank. (xconomy.com)
  • This approach revealed that helicase-like transcription factor (HLTF), a DNA helicase important in DNA repair, potently inhibits early viral gene expression but is rapidly degraded during infection. (nih.gov)
  • MDA5 is a cytosolic protein that detects viral RNA upon infection by a virus. (yalescientific.org)
  • However, the exact mechanism by which MDA5 recognizes segments of viral RNA has long been unclear. (yalescientific.org)
  • it is a key process in gene silencing and defense against viral infections. (wikipedia.org)
  • Non-viral transfection methods are typically preferred to deliver the transposon components into the target cells. (bioscirep.org)
  • In addition, the maximum cargo size of viral vectors is restricted, hampering gene transfer of larger therapeutic genes. (bioscirep.org)
  • Typically, non-viral transfection requires the introduction of plasmids harboring the transgene expression cassettes into the desired target cells, in the absence of any viral elements. (bioscirep.org)
  • A variety of non-viral gene delivery methods have been developed to improve the efficacy of gene transfer. (bioscirep.org)
  • The next time the viral sequence is encountered by the microbe, it's recognized immediately and cut up for disposal with the help of two types of RNA. (labmanager.com)
  • The CRISPR molecule is simply too large to fit with multiple guide RNAs into the most popular and useful viral packaging system. (labmanager.com)
Protospacer Adjacent Motif2
Molecule4
  • Thus, the Cpf1 system needs only one RNA molecule to cut DNA instead of two. (news-medical.net)
  • Selection of the site to be cut is done by a 'guide RNA' molecule bound to the Cas9 protein. (eurekalert.org)
  • In March 2020, astronomer Tomonori Totani presented a statistical approach for explaining how an initial active RNA molecule might have been produced randomly in the universe sometime since the Big Bang . (wikipedia.org)
  • One version of the hypothesis is that a different type of nucleic acid , termed pre-RNA , was the first one to emerge as a self-reproducing molecule, to be replaced by RNA only later. (wikipedia.org)
Cleavage5
Strands4
Embryos3
  • For that purpose they used a gene-editing technique based on injecting non-viable embryos with a complex, which consists of a protective DNA element obtained from bacteria and a specific protein. (rt.com)
  • However, NIH will not fund any use of gene-editing technologies in human embryos. (rt.com)
  • It demonstrates that with CRISPR Alt-R RNP methods, gene deletion functional studies can be performed on developing fish embryos injected with CRISPR reagents at the zygote stage. (idtdna.com)
Synthetic1
  • To test whether their observation of decreased mRNA levels was a result of mRNA being targeted directly (as suggested by data from other systems), Drosophila S2 cells were transfected with either Drosophila cyclin E dsRNAs or lacZ dsRNAs and then incubated with synthetic mRNAs for cyclin E or lacZ. (wikipedia.org)
RISC3
  • The most understood function of RISC is degrading target mRNA which reduces the levels of transcript available to be translated by ribosomes. (wikipedia.org)
  • These siRNA are then incorporated into a protein complex, called RNA-induced silencing complex (RISC), which degrades homologous mRNA ( 8 , 12 ). (pnas.org)
  • The interaction of Dicer and Argonaut2 may facilitate the incorporation of the ~21- to 23-nucleotide RNA fragments generated by Dicer into RISC. (sciencemag.org)
Molecular15
  • Circular plasmids are commonly used as donor DNA for HDR because they can carry a large DNA insert (≤ 10 kb) and homology arms corresponding to the target locus are added by molecular cloning. (genetics.org)
  • These findings provide a platform for multiple therapeutic applications, especially for nervous system diseases, using successive application of designer CRISPR RNA drugs," said senior author Don Cleveland, PhD, Distinguished Professor and Chair of the Department of Cellular and Molecular Medicine at UC San Diego School of Medicine and head of Ludwig Cancer Research's Laboratory for Cell Biology. (innovations-report.com)
  • In the 1960s Craig, Hamilton, Curtis and the other early pioneers did not yet have the molecular tools to engineer "desirable" genes or to molecularly tie them to a biased mechanism of inheritance. (nap.edu)
  • Kidwell and Ribeiro (1992) and Burt (2003) , in combination with advanced knowledge about genetics and more modern molecular tools, bolstered the field of inquiry into so-called gene drives . (nap.edu)
  • In a new study available online today and in a future issue of Nature Structural and Molecular Biology , RNA experts at UT Southwestern Medical Center found that, contrary to established theories, RNA can interact with a non-gene region of DNA called a promoter region, a sequence of DNA occurring spatially in front of an actual gene. (bio-medicine.org)
  • Molecular structure - RNA in red, DNA in yellow. (news-medical.net)
  • 1 In 1990, Rich Jorgensen, a molecular geneticist was trying to create a vibrant purple petunia by inserting an extra copy of the gene that codes for the purple color. (shmoop.com)
  • Guide RNAs are short nucleic acid strings that lead the CRISPR molecular scissors to their intended gene targets. (labmanager.com)
  • Two types of these molecular scissors are now being widely used for gene editing purposes: Cas9 and Cpf1. (labmanager.com)
  • Less obvious is the extent to which the unique properties of Cas9 are well-suited to overcoming other molecular and evolutionary challenges inherent to the construction of safe and functional gene drives. (elifesciences.org)
  • Learning to control natural gene silencing processes will allow an entirely new approach to treating human disease," said Ian J. MacRae, assistant professor in TSRI's Department of Integrative Structural and Computational Biology and principal investigator for the study, which appears as the cover story in the May 9, 2013 issue of the journal Molecular Cell . (healthcanal.com)
  • QIAseq Targeted RNA Panels use a digital sequencing method, whereby a unique 12-base random molecular barcode incorporated into the gene-specific primers (GSP1) is used in the first extension step (after mRNA is converted to cDNA). (qiagen.com)
  • Thus, every extension event yields a unique combination of molecular barcode and target sequence. (qiagen.com)
  • At the end of sequencing, the relative amount of each mRNA target is determined by the number of unique molecular barcode-target combinations that were sequenced, thereby eliminating PCR duplicates and amplification bias, resulting in more accurate, unbiased gene expression analysis. (qiagen.com)
  • The panels use molecular barcodes and a two-stage PCR-based integrated library preparation to overcome the challenge of PCR duplicates and amplification bias to deliver unbiased, accurate and reproducible gene expression results. (qiagen.com)
Mutagenesis2
SiRNA5
Transcripts4
  • Analysis of 5′-capped RNA transcripts in mutant cell lines identified the usage of an intermediate promoter site, with consequential monoallelic LMO2 overexpression. (bloodjournal.org)
  • Among the three 4CL genes identified in switchgrass, the Pv4CL1 transcripts were the most abundant. (isaaa.org)
  • This study reveals that mRNA processing in the mutant background often produces transcripts that escape nonsense-mediated decay, thereby potentially preserving gene function. (plos.org)
  • RNA analysis showed that at least 7 NBEAL2 mRNA transcripts are expressed in hematopoietic cells, including megakaryocytes and platelets. (genome.gov)
Homologous5
  • When the cell repairs the break using homologous recombination, it must use the gene drive chromosome as a repair template, thereby copying the drive onto the wild-type chromosome. (elifesciences.org)
  • Otherwise, the break will be repaired by non-homologous end-joining, resulting in gene disruption. (elifesciences.org)
  • By choosing target sites within an essential gene, any non-homologous end-joining event that deletes all of the target sites will cause lethality rather than creating a drive-resistant allele, further increasing the evolutionary robustness of the RNA-guided gene drive. (elifesciences.org)
  • Specifically, homologous recombination was used to replace the first exon and promoter region of the IRBP gene with a phosphoglycerate kinase-promoted neomycin-resistant gene. (jneurosci.org)
  • These genes bias inheritance by cutting the homologous chromosome, inducing the cell to copy them when it repairs the break. (elifesciences.org)
Plasmids4
Drosophila3
  • Drosophila S2 cells were transfected with a lacZ expression vector to quantify gene expression with β-galactosidase activity. (wikipedia.org)
  • Three of the Drosophila genes are maternally expressed, but zygotic expression in the embryo is limited to the presumptive gonad. (pnas.org)
  • In Drosophila , after several failed efforts, efficient gene targeting was developed using a method that required bringing together three different transgenes ( Rong and Golic, 2000 ). (biologists.org)
Protein-codin2
  • Self-splicing introns populate several highly conserved protein-coding genes in fungal and plant mitochondria. (genetics.org)
  • We mapped the locus for GPS to a 9.4Mb interval on 3p21.1-22.1 that included 197 protein-coding genes. (genome.gov)
Programmable1
Genetics3
  • In CRISPR gene-drive technologies, probably the biggest challenge is making sure that we understand the environmental consequences and the unintended consequences, if any," George M. Church, Ph.D., professor of genetics at Harvard Medical School and MIT, tells GEN . Several years ago, Dr. Church's group was the first to create a gene drive in the budding yeast Saccharomyces cerevisiae . (genengnews.com)
  • An essential goal of genetics is to understand gene function. (g3journal.org)
  • Gene-editing techniques are revolutionizing the way we conduct genetics in many organisms. (biologists.org)
MRNA degradation1
  • Strong alleles of slago7 thus produce lower levels of transacting short interfering RNAs and reduced ARF mRNA degradation, resulting in the first leaves of mutant plants having leaflets without petioles and later-formed leaves lacking laminae ( Fig. 1C ). (plantphysiol.org)
Plasmid3
Repression5
Methods4
  • And although "off-target" effects are well known and small problems with CRISPR have been fixed - safer enzymes, delivery methods, and detection tools - earlier studies may have interrogated the molehills, while missing the mountains. (plos.org)
  • We also review the opportunities and limitations of modern methods of gene therapy based on the CRISPR editing system. (frontiersin.org)
  • That makes the process faster, easier and more specific compared to other gene editing methods. (eppendorf.com)
  • Various computational methods have been generated for miRNA target prediction but the resulting lists of candidate target genes from different algorithms often do not overlap. (mdpi.com)
Nucleic1
Transcription3
  • One gene is a common therapeutic target for ADM, called Vascular endothelial growth factor A (VEGF A), the other one is a transcription factor that activates the transcripction of VEGF A and it is known as HIF-1a. (eurekalert.org)
  • So-called'undruggable'genes, such as transcription factors in general, cannot be targeted directly by antibodies and other biological or chemical drugs. (eurekalert.org)
  • Additionally, this CRISPRi system has been shown to have a potential use in transcriptional up-regulation through the attachment of transcription activators, such as VP16, to investigate the roles of increased gene expression in a disease. (news-medical.net)
Mutation7
  • Jettisoning a gene to a site next to an oncogene could create a first mutational "hit" that becomes cancer later in life when a second mutation occurs. (plos.org)
  • We identify problems in one implementation but found that sequence-based off-target predictions are very reliable, identifying most off-targets with mutation rates superior to 0.1 %, while the number of false positives can be largely reduced with a cutoff on the off-target score. (biomedcentral.com)
  • Our cells have two copies of most genes, but a mutation in just one copy can sometimes cause disease. (newscientist.com)
  • Twenty-seven of 29 patients with Proteus syndrome were found to have the identical mutation in this gene, but it was not present in >20 cell lines and tissues from persons with unrelated disorders. (genome.gov)
  • Patient-derived cell lines with the mutation showed evidence of activation of this gene product using anti-phosphoprotein antibodies and western blot analyses. (genome.gov)
  • We conclude that a somatic mosaic activating mutation in this gene causes Proteus syndrome, validating the Happle mosaicism hypothesis. (genome.gov)
  • The author confirms that the gene and mutation will be disclosed at the ICHG meeting, should the abstract be selected). (genome.gov)
Therapeutic6
  • The popular gene-editing system known as CRISPR/Cas9 has become an indispensable biological research tool, and it also holds profound therapeutic, environmental, ethical, and business implications. (xconomy.com)
  • Furthermore, the search for possible therapeutic targets is mostly unsuccessful and the products of several pharmaceutical giants developed for AD treatment failed in clinical trials. (frontiersin.org)
  • Published on Nature Communications , this CRISPR-Cas9 system, originated from Campylobacter jejuni (CjCas9), is expected to become a useful therapeutic tool against common and "undruggable" disease targets. (eurekalert.org)
  • The beauty of their approach is that it immediately provides a target for drug screening, and a therapeutic avenue toward the clinic," he added. (alzforum.org)
  • Non-coding RNAs Enabling Prognostic Stratification and Prediction of Therapeutic Response in Colorectal Cancer Patients. (amedeo.com)
  • Further, these results provide a therapeutic target for this severe and progressive disorder. (genome.gov)
Editing36
Specific15
Bind1
Effector1
Single guide2
  • In this arrangement, the single-guide RNA-only gene drive is unable to spread in wild organisms, which lack Cas9. (genengnews.com)
  • Many model organisms, besides E. coli , have collections of gene replacements or insertions that could be targeted by a single guide RNA in a similar manner," Swings said. (bcm.edu)
Silence1
Bound4
  • The whole complex then bound to the promoter region, an action that could then either activate or inhibit gene expression. (bio-medicine.org)
  • In this report, we demonstrate that targets bound by nucleosomes are cut much less efficiently than targets from which nucleosomes are absent or have been depleted. (pnas.org)
  • Depending on the bound dye the particles are guided to the liver or to the kidney and deliver their payload of active ingredients directly to the targeted tissue. (innovations-report.com)
  • Ribonucleotide moieties in many coenzymes, such as Acetyl-CoA , NADH , FADH and F420 , may be surviving remnants of covalently bound coenzymes in an RNA world. (wikipedia.org)