AnatomyOrganismsChemicals and DrugsPhenomena and ProcessesTechnology, Industry, Agriculture
SoybeansSoybean ProteinsSoybean OilTrypsin Inhibitor, Kunitz SoybeanVegetable ProteinsTrypsin Inhibitor, Bowman-Birk SoybeanBradyrhizobiumAnimal FeedSeed Storage ProteinsSeedsPlant ProteinsDigestionLeghemoglobinPterocarpansTrypsin Inhibitorsbeta-AmylaseDietary ProteinsPlant Root NodulationGenes, PlantIsoflavonesLipoxygenasePlant RootsPhytophthoraGene Expression Regulation, Plant
Soybeans
An annual legume. The SEEDS of this plant are edible and used to produce a variety of SOY FOODS.
Soybean Proteins
Proteins which are present in or isolated from SOYBEANS.
Soybean Oil
Oil from soybean or soybean plant.
Trypsin Inhibitor, Kunitz Soybean
A high-molecular-weight protein (approximately 22,500) containing 198 amino acid residues. It is a strong inhibitor of trypsin and human plasmin.
Vegetable Proteins
Proteins which are present in or isolated from vegetables or vegetable products used as food. The concept is distinguished from PLANT PROTEINS which refers to non-dietary proteins from plants.
Trypsin Inhibitor, Bowman-Birk Soybean
A low-molecular-weight protein (minimum molecular weight 8000) which has the ability to inhibit trypsin as well as chymotrypsin at independent binding sites. It is characterized by a high cystine content and the absence of glycine.
Bradyrhizobium
A genus of gram-negative, aerobic, rod-shaped bacteria usually containing granules of poly-beta-hydroxybutyrate. They characteristically invade the root hairs of leguminous plants and act as intracellular symbionts.
Animal Feed
Foodstuff used especially for domestic and laboratory animals, or livestock.
Seed Storage Proteins
One or more types of plant seed proteins providing the large amounts of AMINO ACIDS utilized in GERMINATION and SEEDLING growth. As seeds are the major food source from AGRICULTURAL CROPS, seed storage proteins are a major source of DIETARY PROTEINS.
Seeds
The encapsulated embryos of flowering plants. They are used as is or for animal feed because of the high content of concentrated nutrients like starches, proteins, and fats. Rapeseed, cottonseed, and sunflower seed are also produced for the oils (fats) they yield.
Plant Proteins
Proteins found in plants (flowers, herbs, shrubs, trees, etc.). The concept does not include proteins found in vegetables for which VEGETABLE PROTEINS is available.
Digestion
The process of breakdown of food for metabolism and use by the body.
Leghemoglobin
A hemoglobin-like oxygen-binding hemeprotein present in the nitrogen-fixing root nodules of leguminous plants. The red pigment has a molecular weight approximately 1/4 that of hemoglobin and has been suggested to act as an oxido-reduction catalyst in symbiotic nitrogen fixation.
Pterocarpans
A group of compounds which can be described as benzo-pyrano-furano-benzenes which can be formed from ISOFLAVONES by internal coupling of the B ring to the 4-ketone position. Members include medicarpin, phaseolin, and pisatin which are found in FABACEAE.
Trypsin Inhibitors
Serine proteinase inhibitors which inhibit trypsin. They may be endogenous or exogenous compounds.
beta-Amylase
An enzyme that catalyzes the hydrolysis of 1,4-alpha-glycosidic linkages in starch, glycogen, and related polysaccharides and oligosaccharides so as to remove successive beta-maltose units from the non-reducing ends of the chains. EC 3.2.1.2.
Dietary Proteins
Proteins obtained from foods. They are the main source of the ESSENTIAL AMINO ACIDS.
Plant Root Nodulation
The formation of a nitrogen-fixing cell mass on PLANT ROOTS following symbiotic infection by nitrogen-fixing bacteria such as RHIZOBIUM or FRANKIA.
Genes, Plant
The functional hereditary units of PLANTS.
Isoflavones
3-Phenylchromones. Isomeric form of FLAVONOIDS in which the benzene group is attached to the 3 position of the benzopyran ring instead of the 2 position.
Lipoxygenase
An enzyme of the oxidoreductase class primarily found in PLANTS. It catalyzes reactions between linoleate and other fatty acids and oxygen to form hydroperoxy-fatty acid derivatives.
Plant Roots
The usually underground portions of a plant that serve as support, store food, and through which water and mineral nutrients enter the plant. (From American Heritage Dictionary, 1982; Concise Dictionary of Biology, 1990)
Phytophthora
A genus of destructive parasitic OOMYCETES in the family Peronosporaceae, order Peronosporales, affecting numerous fruit, vegetable, and other crops. Differentiation of zoospores usually takes place in the sporangium and no vesicle is formed. It was previously considered a fungus.
Gene Expression Regulation, Plant
Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action in plants.

Asthma visits to emergency rooms and soybean unloading in the harbors of Valencia and A Coruna, Spain. (1/3573)

Soybean unloading in the harbor of Barcelona, Spain, has been associated with large increases in the numbers of asthma patients treated in emergency departments between 1981 and 1987. In this study, the association between asthma and soybean unloading in two other Spanish cities, Valencia and A Coruna, was assessed. Asthma admissions were retrospectively identified for the period 1993-1995, and harbor activities were investigated in each location. Two approaches were used to assess the association between asthma and soybean unloading: One used unusual asthma days (days with an unusually high number of emergency room asthma visits) as an effect measure, and the other estimated the relative increase in the daily number of emergency room visits by autoregressive Poisson regression, adjusted for meteorologic variables, seasonality, and influenza incidence. No association between unusual asthma days and soya unloading was observed in either Valencia or A Coruna, except for one particular dock in Valencia. When the association between unloaded products and the daily number of emergency asthma visits was studied, a statistically significant association was observed for unloading of soya husk (relative risk = 1.50, 95% confidence interval 1.16-1.94) and soybeans (relative risk = 1.31, 95% confidence interval 1.08-1.59) in A Coruna. In Valencia, a statistical association was found only for the unloading of soybeans at two particular docks. Although these findings support the notion that asthma outbreaks are not a common hidden condition in most harbors where soybeans are unloaded, the weak associations reported are likely to be causal. Therefore, appropriate control measures should be implemented to avoid soybean dust emissions, particularly in harbors with populations living in the vicinity.  (+info)

Mutation in GDP-fucose synthesis genes of Sinorhizobium fredii alters Nod factors and significantly decreases competitiveness to nodulate soybeans. (2/3573)

We mutagenized Sinorhizobium fredii HH103-1 with Tn5-B20 and screened about 2,000 colonies for increased beta-galactosidase activity in the presence of the flavonoid naringenin. One mutant, designated SVQ287, produces lipochitooligosaccharide Nod factors (LCOs) that differ from those of the parental strain. The nonreducing N-acetylglucosamine residues of all of the LCOs of mutant SVQ287 lack fucose and 2-O-methylfucose substituents. In addition, SVQ287 synthesizes an LCO with an unusually long, C20:1 fatty acyl side chain. The transposon insertion of mutant SVQ287 lies within a 1.1-kb HindIII fragment. This and an adjacent 2.4-kb HindIII fragment were sequenced. The sequence contains the 3' end of noeK, nodZ, and noeL (the gene interrupted by Tn5-B20), and the 5' end of nolK, all in the same orientation. Although each of these genes has a similarly oriented counterpart on the symbiosis plasmid of the broad-host-range Rhizobium sp. strain NGR234, there are significant differences in the noeK/nodZ intergenic region. Based on amino acid sequence homology, noeL encodes GDP-D-mannose dehydratase, an enzyme involved in the synthesis of GDP-L-fucose, and nolK encodes a NAD-dependent nucleotide sugar epimerase/dehydrogenase. We show that expression of the noeL gene is under the control of NodD1 in S. fredii and is most probably mediated by the nod box that precedes nodZ. Transposon insertion into neoL has two impacts on symbiosis with Williams soybean: nodulation rate is reduced slightly and competitiveness for nodulation is decreased significantly. Mutant SVQ287 retains its ability to form nitrogen-fixing nodules on other legumes, but final nodule number is attenuated on Cajanus cajan.  (+info)

A novel 53-kDa nodulin of the symbiosome membrane of soybean nodules, controlled by Bradyrhizobium japonicum. (3/3573)

A nodule-specific 53-kDa protein (GmNOD53b) of the symbiosome membrane from soybean was isolated and its LysC digestion products were microsequenced. cDNA clones of this novel nodulin, obtained from cDNA library screening with an RT-PCR (reverse-transcriptase polymerase chain reaction)-generated hybridization probe exhibited no homology to proteins identified so far. The expression of GmNOD53b coincides with the onset of nitrogen fixation. Therefore, it is a late nodulin. Among other changes, the GmNOD53b is significantly reduced in nodules infected with the Bradyrhizobium japonicum mutant 184 on the protein level as well as on the level of mRNA expression, compared with the wild-type infected nodules. The reduction of GmNOD53b mRNA is related to an inactivation of the sipF gene in B. japonicum 184, coding for a functionally active signal peptidase.  (+info)

A multisubunit acetyl coenzyme A carboxylase from soybean. (4/3573)

A multisubunit form of acetyl coenzyme A (CoA) carboxylase (ACCase) from soybean (Glycine max) was characterized. The enzyme catalyzes the formation of malonyl CoA from acetyl CoA, a rate-limiting step in fatty acid biosynthesis. The four known components that constitute plastid ACCase are biotin carboxylase (BC), biotin carboxyl carrier protein (BCCP), and the alpha- and beta-subunits of carboxyltransferase (alpha- and beta-CT). At least three different cDNAs were isolated from germinating soybean seeds that encode BC, two that encode BCCP, and four that encode alpha-CT. Whereas BC, BCCP, and alpha-CT are products of nuclear genes, the DNA that encodes soybean beta-CT is located in chloroplasts. Translation products from cDNAs for BC, BCCP, and alpha-CT were imported into isolated pea (Pisum sativum) chloroplasts and became integrated into ACCase. Edman microsequence analysis of the subunits after import permitted the identification of the amino-terminal sequence of the mature protein after removal of the transit sequences. Antibodies specific for each of the chloroplast ACCase subunits were generated against products from the cDNAs expressed in bacteria. The antibodies permitted components of ACCase to be followed during fractionation of the chloroplast stroma. Even in the presence of 0.5 M KCl, a complex that contained BC plus BCCP emerged from Sephacryl 400 with an apparent molecular mass greater than about 800 kD. A second complex, which contained alpha- and beta-CT, was also recovered from the column, and it had an apparent molecular mass of greater than about 600 kD. By mixing the two complexes together at appropriate ratios, ACCase enzymatic activity was restored. Even higher ACCase activities were recovered by mixing complexes from pea and soybean. The results demonstrate that the active form of ACCase can be reassembled and that it could form a high-molecular-mass complex.  (+info)

Further studies of the role of cyclic beta-glucans in symbiosis. An NdvC mutant of Bradyrhizobium japonicum synthesizes cyclodecakis-(1-->3)-beta-glucosyl. (5/3573)

The cyclic beta-(1-->3),beta-(1-->6)-D-glucan synthesis locus of Bradyrhizobium japonicum is composed of at least two genes, ndvB and ndvC. Mutation in either gene affects glucan synthesis, as well as the ability of the bacterium to establish a successful symbiotic interaction with the legume host soybean (Glycine max). B. japonicum strain AB-14 (ndvB::Tn5) does not synthesize beta-glucans, and strain AB-1 (ndvC::Tn5) synthesizes a cyclic beta-glucan lacking beta-(1-->6)-glycosidic bonds. We determined that the structure of the glucan synthesized by strain AB-1 is cyclodecakis-(1-->3)-beta-D-glucosyl, a cyclic beta-(1-->3)-linked decasaccharide in which one of the residues is substituted in the 6 position with beta-laminaribiose. Cyclodecakis-(1-->3)-beta-D-glucosyl did not suppress the fungal beta-glucan-induced plant defense response in soybean cotyledons and had much lower affinity for the putative membrane receptor protein than cyclic beta-(1-->3),beta-(1-->6)-glucans produced by wild-type B. japonicum. This is consistent with the hypothesis presented previously that the wild-type cyclic beta-glucans may function as suppressors of a host defense response.  (+info)

The involvement of cysteine proteases and protease inhibitor genes in the regulation of programmed cell death in plants. (6/3573)

Programmed cell death (PCD) is a process by which cells in many organisms die. The basic morphological and biochemical features of PCD are conserved between the animal and plant kingdoms. Cysteine proteases have emerged as key enzymes in the regulation of animal PCD. Here, we show that in soybean cells, PCD-activating oxidative stress induced a set of cysteine proteases. The activation of one or more of the cysteine proteases was instrumental in the PCD of soybean cells. Inhibition of the cysteine proteases by ectopic expression of cystatin, an endogenous cysteine protease inhibitor gene, inhibited induced cysteine protease activity and blocked PCD triggered either by an avirulent strain of Pseudomonas syringae pv glycinea or directly by oxidative stress. Similar expression of serine protease inhibitors was ineffective. A glutathione S-transferase-cystatin fusion protein was used to purify and characterize the induced proteases. Taken together, our results suggest that plant PCD can be regulated by activity poised between the cysteine proteases and the cysteine protease inhibitors. We also propose a new role for proteinase inhibitor genes as modulators of PCD in plants.  (+info)

Dietary soybeans intake and bone mineral density among 995 middle-aged women in Yokohama. (7/3573)

To investigate relationship of dietary factors, especially source of calcium intake, to bone mineral density (BMD) among Japanese middle-aged women, a total of 995 healthy women age of 40 to 49 (mean +/- SD, 45 +/- 3), who lives in Yokohama-city, were recruited through convenience sampling by the municipal information paper and health announcement at each 18 public health center in 18 wards for the three-day course on prevention of osteoporosis from October 1996 to March 1998. The BMD of the 2nd metacarpal bone was measured using Computed X-ray Densitometry (CXD) method, by a trained radiologist. Dietary intake of calcium was assessed by self-reporting food frequency questionnaire on calcium dietary sources such as milk, dairy products, small fish, vegetables, and soybeans and carefully checked by trained dietician. An independent gradient of non-adjusted and adjusted BMD for age and weekly calcium intake, through soybeans intake frequency (p = 0.03) was noted. This study suggest soybeans, through possible beneficial effects of vitamin-K, soyprotein, and isoflavonoid, may affect BMD of middle aged women.  (+info)

Degradation of two protein sources at three solids retention times in continuous culture. (8/3573)

Effects of solids retention times (SRT) of 10, 20, and 30 h on protein degradation and microbial metabolism were studied in continuous cultures of ruminal contents. Liquid dilution rate was constant across all retention times at .12 h(-1) (8.3 h mean retention time). Two semipurified diets that contained either soybean meal (SBM) or alfalfa hay (ALFH) as the sole nitrogen source were provided in amounts that decreased as SRT was increased. Digestion coefficients for DM, NDF, and ADF increased with increasing SRT. Digestion coefficients for nonstructural carbohydrates were higher in the SBM diet than in the ALFH diet but were not affected by SRT. Protein degradation in the ALFH diet averaged 51% and was unaffected by retention time. In the SBM diet, digestion of protein was 77, 78, and 96% at 10-, 20-, and 30-h retention times, respectively. Microbial efficiency decreased with increasing SRT and was greater for the SBM than for the ALFH diet. Efficiencies ranged from 30.6 to 35.7 and 20.8 to 29.2 g of N/kg of digested DM for the SBM and ALFH diets, respectively, as SRT decreased from 30 to 10 h. The diaminopimelic acid content of the microbes increased as SRT increased, indicating that changes in microbial species occurred owing to passage rates. From these results, we concluded that the digestibility decreases associated with increased ruminal turnover rates may be less for nonstructural carbohydrates and protein than for the fiber fractions.  (+info)

Genetic interactions regulating seed phytate and oligosaccharides in soybean (Glycine max L.)Genetic interactions regulating seed phytate and oligosaccharides in soybean (Glycine max L.)
Two low-phytate soybean (Glycine max(L.) Merr.) mutant lines- V99-5089 (mipsmutation on chromosome 11) and CX-1834 (mrp-landmrp-nmutations on chromosomes 19 and 3, respectively) have proven to be valuable resources for breeding of low-phytate, high-sucrose, and low-raffinosaccharide soybeans, traits that are highly desirable from a nutritional and environmental standpoint. A recombinant inbred population derived from the cross CX1834 x V99-5089 provides an opportunity to study the effect of different combinations of these three mutations on soybean phytate and oligosaccharides levels. Of the 173 recombinant inbred lines tested, 163 lines were homozygous for various combinations of MIPS and two MRP loci alleles. These individuals were grouped into eight genotypic classes based on the combination of SNP alleles at the three mutant loci. The two genotypic classes that were homozygousmrp-l/mrp-nand either homozygous wild-type or mutant at themipslocus (MIPS/mrp-l/mrp-normips/mrp-l/mrp-n) displayed ...
http://vtechworks.lib.vt.edu/handle/10919/99457
Comportamiento de seis cultivares de frijol soya (Glycine max L. Merr.), en el sistema maíz (Zea mays L.) + frijol soya, con...Comportamiento de seis cultivares de frijol soya (Glycine max L. Merr.), en el sistema maíz (Zea mays L.) + frijol soya, con...
Comportamiento de seis cultivares de frijol soya (Glycine max L. Merr.), en el sistema maíz (Zea mays L.) + frijol soya, con sombra de maíz ...
https://repositorioslatinoamericanos.uchile.cl/handle/2250/2805122
Phosphorylation of Soybean (Glycine max L.) Nodule Phosphoenolpyruvate Carboxylase in Vitro Decreases Sensitivity to Inhibition...Phosphorylation of Soybean (Glycine max L.) Nodule Phosphoenolpyruvate Carboxylase in Vitro Decreases Sensitivity to Inhibition...
Phosphoenolpyruvate carboxylase (PEPC) from soybean (Glycine max L.Merr.) nodules was purified 187-fold to a final specific activity of 56 units mg-1 of protein. Sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis (PAGE) revealed one major polypeptide band, with a molecular mass of 110 kD, after the final purification step. Two-dimensional PAGE resolved four isoelectric forms of the purified enzyme. Antibodies raised against the purified enzyme immunoprecipitated PEPC activity from a desalted nodule extract. Two cross-reacting bands were obtained when protein immunoblots of crude nodule extracts subjected to SDS-PAGE were probed with the antiserum. One of these corresponded to the 110-kD subunit of PEPC, and the other had a molecular mass of about 60 kD. PEPC was shown to be activated in a time-dependent manner when desalted soybean nodule extracts were preincubated with Mg.ATP in vitro. Activation was observed when PEPC was assayed at pH 7 in the absence of glycerol but not at pH 8 ...
http://www.plantphysiol.org/content/101/4/1267?ijkey=bd68298b83fc7a87bd4f6314e6a91e6dc76765f3&keytype2=tf_ipsecsha
Analysis of embryo, cytoplasm and maternal effects on fatty acid components in soybean (Glycine max Merill.)Analysis of embryo, cytoplasm and maternal effects on fatty acid components in soybean (Glycine max Merill.)
Abstract The quality of oil determined by the constituents and proportion of fatty acid components, and the understanding of heredity of fatty acid components are of importance to breeding good quality soybean varieties. Embryo, cytoplasmic and maternal effects and genotype × environment interaction effects for quality traits of soybean [Glycine max (L.) Merrill.] seeds were analyzed using a general genetic model for quantitative traits of seeds with parents, F1 and F2, of 20 crosses from a diallel mating design of five parents planted in the field in 2003 and 2004 in Harbin, China. The interaction effects of palmitic, stearic, and linoleic acid contents were larger than the genetic main effects, while the genetic main effects were equal to interaction effects for linolenic and oleic acid content. Among all kinds of genetic main effects, the embryo effects were the largest for palmitic, stearic, and linoleic acids, while the cytoplasm effects were the largest for oleic and linolenic acids. ...
http://academic.hep.com.cn/fag/EN/10.1007/s11703-007-0047-2
Soybean cultivar 1486018 - Patent # 7282628 - PatentGenius
A soybean cultivar designated 1486018 is disclosed. The invention relates to the seeds of soybean cultivar 1486018, to the plants of soybean 1486018, to plant parts of soybean cultivar 1486018 and to methods for producing a soybean plant produced by crossing soybean cultivar 1486018 with itself or with another soybean variety. The invention also relates to methods for producing a soybean plant containing in its genetic material one or more transgenes and to the transgenic soybean plants and plant parts produced by those methods. This invention also relates to soybean cultivars or breeding cultivars and plant parts derived from soybean variety 1486018, to methods for producing other soybean cultivars, lines or plant parts derived from soybean cultivar 1486018 and to the soybean plants, varieties, and their parts derived from use of those methods. The invention further relates to hybrid soybean seeds, plants and plant parts produced by crossing the
http://www.patentgenius.com/patent/7282628.html
Soybean cultivar S090130 - Patent # 8546653 - PatentGenius
A soybean cultivar designated S090130 is disclosed. The invention relates to the seeds of soybean cultivar S090130, to the plants of soybean S090130, to plant parts of soybean cultivar S090130, and to methods for producing a soybean plant produced by crossing soybean cultivar S090130 with itself or with another soybean variety. The invention also relates to methods for producing a soybean plant containing in its genetic material one or more transgenes and to the transgenic soybean plants and plant parts produced by those methods. This invention also relates to soybean cultivars, or breeding cultivars, and plant parts derived from soybean variety S090130, to methods for producing other soybean cultivars, lines or plant parts derived from soybean cultivar S090130, and to the soybean plants, varieties, and their parts derived from use of those methods. The invention further relates to hybrid soybean seeds, plants, and plant parts produced by crossing the
http://www.patentgenius.com/patent/8546653.html
Isoflavone content of soybean [ Glycine max (L). Merr.] cultivars with different nitrogen sources and growing season under...
Isoflavone content of soybean [ Glycine max (L). Merr.] cultivars with different nitrogen sources and growing season under dry land conditions
http://www.iao.florence.it/JAEID/index.php/JAEID/article/view/216/139
The Use of DNA Microsatellite Markers for Genetic Diversity Identification of Soybean (Glycine max (L) Meriil.) as a...The Use of DNA Microsatellite Markers for Genetic Diversity Identification of Soybean (Glycine max (L) Meriil.) as a...
The Use of DNA Microsatellite Markers for Genetic Diversity Identification of Soybean (Glycine max (L) Meriil.) as a Supplementary Method in Reference Collections Management
https://jurnal.ugm.ac.id/ijbiotech/article/view/9306
Pathogenesis of Alfalfa mosaic virus in Soybean (Glycine max) and Expression of Chimeric Rabies Peptide in Virus-Infected...Pathogenesis of Alfalfa mosaic virus in Soybean (Glycine max) and Expression of Chimeric Rabies Peptide in Virus-Infected...
Phytopathology 91:941-947...Phytopathology 91:941-947...Pathogenesis of Alfalfa mosaic virus in Soybean (Glycine max) and Expression of Chimeric Rabies Peptide in Virus-Infected Soybean Plants...Nina Fleysh , Deepali Deka , Maria Drath , Hilary Koprowski , and Vidadi Yusibov...
https://www.apsnet.org/publications/phytopathology/2001/October/Pages/91_10_941.aspx
Characterization of aluminium-induced citrate secretion in aluminium-tolerant soybean (Glycine max) plants - Yang - 2001 -...Characterization of aluminium-induced citrate secretion in aluminium-tolerant soybean (Glycine max) plants - Yang - 2001 -...
Recently, we showed that secretion of citrate in an aluminium (Al) tolerant cultivar soybean (Glycine max) (cv. Suzunari) is a specific response to Al stress [Yang et al. (2000) Physiol Plant 110: 72-77]. Here we investigated the intrinsic mechanisms behind the secretion of citrate induced by Al. The amount of citrate secreted during the 24-h Al treatment period increased with increasing concentration of Al (0-70 μM). We analysed citrate secretion basically under 3 conditions: (1) by varying light-exposure, (2) with intact or excised shoots and (3) by using a divided chamber technique. Further, the content of organic acids in the tissue and the activity of enzymes involved in organic acid metabolism were analysed and evaluated. The results indicate that high rate of citrate secretion in soybean requires a 4-h induction period. Al had a continuous effect on the citrate secretion when Al was removed from the treatment solution. Citrate secretion increased steadily under exposure to continuous ...
http://onlinelibrary.wiley.com/doi/10.1034/j.1399-3054.2001.1130109.x/full
Somaclonal variations of Soybeans Glycine Max. L. Merr stimulated by drought stress based on random amplified polymorphic DNAs...
Somaclonal variations of Soybeans Glycine Max. L. Merr stimulated by drought stress based on random amplified polymorphic DNAs RAPDs. . Biblioteca virtual para leer y descargar libros, documentos, trabajos y tesis universitarias en PDF. Material universiario, documentación y tareas realizadas por universitarios en nuestra biblioteca. Para descargar gratis y para leer online.
http://libros.duhnnae.com/2017/jun7/149807565186-Somaclonal-variations-of-Soybeans-Glycine-Max-L-Merr-stimulated-by-drought-stress-based-on-random-amplified-polymorphic-DNAs-RAPDs.php
Get PDF - Monoclonal antibodies directed against protoplasts of soybean glycine max cells generation of hybridomas and...Get PDF - Monoclonal antibodies directed against protoplasts of soybean glycine max cells generation of hybridomas and...
Villanueva, M.A.; Metcalf, T.N.IIi; Wang, J.L., 1986: Monoclonal antibodies directed against protoplasts of soybean glycine max cells generation of hybridomas and characterization of a monoclonal antibody reactive with the cell surface
https://eurekamag.com/research/005/923/005923616.php
Glycine Soja (Soybean) Seed Extract - Bellatorra skin careGlycine Soja (Soybean) Seed Extract - Bellatorra skin care
Glycine Soja, also known as Soybean Seed Extract, is a plant-derived ingredient that is found in skin care products. Soybean Seed Extract functions to add moisture to products. In addition to its moisturizing benefits, it has also been found to deliver amino acids, proteins, vitamins, and minerals into the body.. The Soybean is rich in Vitamin E and the ingredient may be found in hair care products, skin care products, soaps, and lotions. Soybeans have been found to offer several other benefits including reduced cholesterol and improved skin. The ingredient, when included in anti-aging products has been found to reduce the appearance of lines and wrinkles while stimulating collagen production.. Soy extract is a powerful antioxidant that is derived from the phytochemical. The soy extract is naturally able to combat free radicals while improving the appearance of the skin. Research indicates that soy extract is effective in reducing the damaging effects of UVB on the skin cells.. Glycine Soja ...
http://bellatorra.com/glycine-soja-soybean-seed-extract/
Frontiers | Organ-Specific Differential NMR-Based Metabonomic Analysis of Soybean [Glycine max (L.) Merr.] Fruit Reveals the...Frontiers | Organ-Specific Differential NMR-Based Metabonomic Analysis of Soybean [Glycine max (L.) Merr.] Fruit Reveals the...
Prolonged, continuous rainfall is the main climatic characteristic of autumn in Southwest China, and it has been found to cause mildew outbreaks in pre-harvest soybean fields. Low temperature and humidity (LTH) stress during soybean maturation in the field promotes pre-harvest mildew, resulting in damage to different organs of soybean fruits to different extents, but relatively little information on the resistance mechanisms in these fruits is available. Therefore, to understand the metabolic responses of soybean fruits to field mold (FM), the metabonomic variations induced by LTH were characterized using proton nuclear magnetic resonance spectroscopy (1H-NMR), and the primary metabolites from the pod, seed coat and cotyledon of pre-harvest soybean were quantified. Analysis of FM-damaged soybean germplasms with different degrees of resistance to FM showed that extracts were dominated by 66 primary metabolites, including amino acids, organic acids and sugars. Each tissue had a characteristic metabolic
https://www.frontiersin.org/articles/10.3389/fpls.2017.00508/full
Fine-mapping of QTLs for individual and total isoflavone content in soybean ( Glycine max L.) using a high-density genetic map ...Fine-mapping of QTLs for individual and total isoflavone content in soybean ( Glycine max L.) using a high-density genetic map ...
Key message Fifteen stable QTLs were identified using a high-density soybean genetic map across multiple environments. One major QTL, qIF5- 1, contributing to total isoflavone content explained...
https://link.springer.com/article/10.1007/s00122-017-3018-x
Polyamines as potential regulators of nutrient exchange across the peribacteroid membrane in soybean root nodules<...
TY - JOUR. T1 - Polyamines as potential regulators of nutrient exchange across the peribacteroid membrane in soybean root nodules. AU - Whitehead, Lynne F.. AU - Tyerman, Stephen D.. AU - Day, David A.. PY - 2001. Y1 - 2001. N2 - The effect of cytoplasmic polyamines on peribacteroid membrane transport processes in soybean (Glycine max L.) was investigated. The concentration of free polyamines in soybean nodule cytoplasm has been estimated by others to be in the micromolar range. The H+-ATPase was inhibited by 37 and 54% by 200 μM spermidine and putrescine, respectively. Spermine applied to the cytoplasmic face of the peribacteroid membrane was found to inhibit both inward and outward currents through a non-selective cation channel permeable to ammonium (Kd 2.1 μM at - 100 mV). Malate transport into intact symbiosomes was reduced by 15-30% by 15 mM spermidine, cadaverine and putrescine. A non-specific stimulation of malate transport by polycations was found to occur at concentrations in the ...
https://researchnow.flinders.edu.au/en/publications/polyamines-as-potential-regulators-of-nutrient-exchange-across-th
Genotypic variations in Soybean genotypes towards salinity, 978-3-659-57708-6, 3659577081 ,9783659577086 by ...Genotypic variations in Soybean genotypes towards salinity, 978-3-659-57708-6, 3659577081 ,9783659577086 by ...
Genotypic variations in Soybean genotypes towards salinity, 978-3-659-57708-6, Since salinization of soil is an important worldwide problem, identification of salt tolerant plants and their underlying mechanism for salt tolerance is an important phenomenon in distinguishing plant salinity relation. The biochemical and molecular study showed that there is variability in salt tolerance behaviour in soybean genotypes. There is clear indication of role of antioxidant defence system in conferring slat-tolerance and sensitiveness in soybean genotypes. Moreover our data suggest that RAPD markers are suitable to assess genetic diversity between different local populations and to examine genetic relationships. Therefore, the present study may aid breeders interested in selecting genetically diverse source for salt tolerant and sensitiveness for broadening the genetic base as well as for development of mapping population of soybean genotypes.
https://www.morebooks.shop/store/gb/book/genotypic-variations-in-soybean-genotypes-towards-salinity/isbn/978-3-659-57708-6.html
Glycine soya milkGlycine soya milk
Made from soybeans. I looked in all my books, including The International Cosmetic Ingredient Dictionary and Handbook, and this is not in there. However, they have many pages of Glycine soja in different forms, such as Glycine soja extract (extract from the soybean plant), Glycine soja fiber (the fiber from the soybean) and Glycine soja oil (the oil from soybeans). So Im going to say, until I can find otherwise, but based on the pattern Im seeing in Gottshalck, that his is the milk made from soybeans, or soymilk --T ...
http://www.tightlycurly.com/ingredients/glycine_soya_milk
Physiological responses of three soybean species (Glycine soja, G. gracilis, andG. maxcv. Melrose) to salinity stress |...Physiological responses of three soybean species (Glycine soja, G. gracilis, andG. maxcv. Melrose) to salinity stress |...
Understanding the mechanism for salt tolerance in wild soybean (Glycine soja) can help researchers improve that trait in cultivated soybean lines. We analyzed the effects of excess NaCl on the growth,
https://link.springer.com/article/10.1007/s10265-017-0929-1
Comprehensive characterization and RNA-Seq profiling of the HD-Zip transcription factor family in soybean ( Glycine max )...Comprehensive characterization and RNA-Seq profiling of the HD-Zip transcription factor family in soybean ( Glycine max )...
The homeodomain leucine zipper (HD-Zip) transcription factor family is one of the largest plant specific superfamilies, and includes genes with roles in modulation of plant growth and response to environmental stresses. Many HD-Zip genes are characterized in Arabidopsis (Arabidopsis thaliana), and members of the family are being investigated for abiotic stress responses in rice (Oryza sativa), maize (Zea mays), poplar (Populus trichocarpa) and cucumber (Cucmis sativus). Findings in these species suggest HD-Zip genes as high priority candidates for crop improvement. In this study we have identified members of the HD-Zip gene family in soybean cv. Williams 82, and characterized their expression under dehydration and salt stress. Homology searches with BLASTP and Hidden Markov Model guided sequence alignments identified 101 HD-Zip genes in the soybean genome. Phylogeny reconstruction coupled with domain and gene structure analyses using soybean, Arabidopsis, rice, grape (Vitis vinifera), and Medicago
https://bmcgenomics.biomedcentral.com/articles/10.1186/1471-2164-15-950/tables/2
Expression profiles of GsCML27 in Glycine soja.A. Tissu | Open-iExpression profiles of GsCML27 in Glycine soja.A. Tissu | Open-i
Expression profiles of GsCML27 in Glycine soja.A. Tissue specific expression of GsCML27 in Glycine soja. Total RNA was extracted from root, young stem, old stem
https://openi.nlm.nih.gov/detailedresult.php?img=PMC4638360_pone.0141888.g003&req=4
The effects of dietary soybean hulls, wheat, crystalline amino acids and high protein corn dried distillers grains on nursery...The effects of dietary soybean hulls, wheat, crystalline amino acids and high protein corn dried distillers grains on nursery...
Six experiments using 3,659 nursery and finishing pigs were conducted to evaluate the effects of dietary soybean hulls and ingredient processing in corn-soybean meal or corn-soybean meal-DDGS diets on nursery and finishing performance. Experiment 1 tested increasing soybean hulls (0, 5, 10, 15, and 20%) and increasing soybean hulls decreased ADG and G:F. Experiment 2 evaluated increasing soybean hulls (0, 10, and 20%) in diets balanced or not for NE and showed reduced performance with increasing soybean hulls. Balancing for NE resulted in G:F similar to pigs fed the control. Experiments 3 and 4 evaluated increasing dietary soybean hulls in corn-soybean meal and corn-soybean meal-DDGS diets. Soybean hulls in either diet worsened G:F and improved caloric efficiency, suggesting current INRA (2004) values for soybean hulls underestimate their energy value. Experiment 5 evaluated 10 and 20% ground or unground soybean hulls in meal and pelleted diets. Caloric efficiency improved with high levels of ...
http://krex.k-state.edu/dspace/handle/2097/15878
SOY006 - Disease Resistance in Selected Soybean Varieties
Soybean cyst nematode (SCN) is the most serious soybean pathogen in North Carolina. Since its discovery in North Carolina (and the United States) in 1954, it has spread to all counties in the Coastal Plain, Tidewater, and some Piedmont counties with large soybean acreages. Severe yield loss caused by this pest is especially common in sandy coastal plain soils. SCN, however, is not restricted to any soil type and often causes significant soybean yield losses which may go unnoticed. Races of Soybean Cyst Nematode Field populations of SCN are characterized as races (numbered 1 through 16). A race designation of cyst nematode is an indication of a field populations ability to reproduce on each of several soybean varieties or lines. Knowing the race of cyst nematode in a given field can assist the grower in making decisions about which resistant varieties should be used. For example, if a field has race 1 or 3, then selection of a variety resistant to these races would be the appropriate choice. ...
https://yancey.ces.ncsu.edu/depts/pp/notes/Soybean/soy006/soy006a.htm
Genetic variants in root architecture-related genes in a Glycine soja accession, a potential resource to improve cultivated...Genetic variants in root architecture-related genes in a Glycine soja accession, a potential resource to improve cultivated...
Root system architecture is important for water acquisition and nutrient acquisition for all crops. In soybean breeding programs, wild soybean alleles have been used successfully to enhance yield and seed composition traits, but have never been investigated to improve root system architecture. Therefore, in this study, high-density single-feature polymorphic markers and simple sequence repeats were used to map quantitative trait loci (QTLs) governing root system architecture in an inter-specific soybean mapping population developed from a cross between Glycine max and Glycine soja. Wild and cultivated soybean both contributed alleles towards significant additive large effect QTLs on chromosome 6 and 7 for a longer total root length and root distribution, respectively. Epistatic effect QTLs were also identified for taproot length, average diameter, and root distribution. These root traits will influence the water and nutrient uptake in soybean. Two cell division-related genes (D type
https://bmcgenomics.biomedcentral.com/articles/10.1186/s12864-015-1334-6
Occurrences of Soybean Viruses, Fungal Diseases, and Pests in Illinois Soybean Rust Sentinel Plots
After soybean rust, caused by Phakopsora pachyrhizi, was confirmed in the USA in 2004 in soybean (Glycine max) (4), sentinel plots were established in 2005 in 26 soybean-producing states to monitor its spread. Funding for establishing, sampling, and monitoring the plots came from the USDA, national, regional, and state soybean commodity boards, and state departments of agriculture, extension services, and universities. Sentinel plots were a minimum of 8 m × 16 m in size, planted as early as possible for a particular area, and represented either separate plots or marked areas in commercial fields that were monitored regularly by scouts primarily from state universities and extension services for soybean rust.. The presence of sentinel plots for soybean rust monitoring provided the potential for reducing the time and expense of extensive statewide travel for collection of soybean leaf samples for monitoring the incidence of other foliar diseases of soybean in Illinois. In many Midwestern states, ...
http://www.plantmanagementnetwork.org/pub/php/brief/2010/sentinel/
J Integr Plant Biol
In order to exploit the genetic resources of wild soybean (Glycine soja) which is the progenitor of cultivated soybean (Glycine max), the genic frequencies of Ti (coding trypsin inhibitors) and Sp1 (coding β-amylase isozymes) for 13 populations of wild soybean in Beijing region were determined. There are 2 alleles (Tia and Tib) in Ti locus of Beijing populations. Calculation of heterozygosity indicates Sp1 is polymorphic, while this monomorphic within a population. Based on the vatiation (from 0 to 50%) for heterozygosity of Sp1 among populations, with special reference to the values of genetic distances among populatious, and no heterozygote has been found in 1300 plants which would be heterozygotes if they were outbreeder, we suggested that wild soybean in natural populations is absolute inbreeder. The frequencies of Ti and Sp1 alleles vary from place to place extremely, however, no correlation exists between allozyme frequencies and ecological factors. Field investigation has shown that ...
https://www.jipb.net/EN/abstract/abstract26210.shtml
Esterase polymorphisms for analysis of genetic diversity and structure of soybean (Glycine max) cultivars | GMR | Genetics and...Esterase polymorphisms for analysis of genetic diversity and structure of soybean (Glycine max) cultivars | GMR | Genetics and...
We used native polyacrylamide gel electrophoresis to identify polymorphism levels in a- and b-esterase loci from leaf tissues of Brazilian soybean cultivars for the analysis of population genetic diversity and structure, and to investigate relationships between conventional and genetically modified cultivars. The cultivars included lines developed by a soybean-grower cooperative (CD), by EMBRAPA (BR), and “Roundup Ready” (RR) cultivars. Esterase isozymes recorded with α-naphthyl acetate and β-naphthyl acetate were produced from 14 loci. Two to three allelic variants were detected in leaves from 420 plants of 21 CD, BR, and RR cultivars at Est-1, Est-2, Est-3, Est-5, and Est-14 loci. The estimated proportion of polymorphic loci in CD cultivars was 21.4%, and in BR and RR cultivars it was 28.6%. High and low HO and HE values were observed within CD and BR cultivars and a very high cultivar differentiation level was evident in the plants of the 21 CD, BR, and RR cultivars (FST = 0
https://geneticsmr.com/articles/1307
Effects of Bacteria and Vermicompost on Morphological Characteristics and Yield of Soybean (Glycine max L.) in Sustainable...Effects of Bacteria and Vermicompost on Morphological Characteristics and Yield of Soybean (Glycine max L.) in Sustainable...
Objective:Investigating the microbes and interactions of the beneficial symbiotic relationships between the components of the system ecology in the food chains and life cycles is one of the modern sustainable agriculture topics. In this regard, to evaluate the effects of bacteria and vermicompost on morphological characteristics and yield of soybean an experiment was conducted as split plot in a completely randomized block design with three replications. Methods: Main plots of experiment were at two levels including the non-use and the use of bacteria and the subplots were at three levels including the non-use of vermicompost (control), the use of 5 tons of vermicompost per acre and the use of 10 tons of vermicompost per acre. Results: The results of mean comparison showed that the treatment including 10 tons of vermicompost had the highest amount of oil content (11%) and the lowest amount was obtained from the treatment including use of 5 tons with the amount of 9.77%. Increasing the seed growing and
http://www.ijabbr.com/article_9117.html
中国科学院地理科学与资源研究所机构知识库(IGSNRR OpenIR): Clustering Analysis of Soybean Production to Understand its Spatiotemporal Dynamics in the...
The production gap of soybean (Glycine maxL. Merr.) has been expanding in China recently, due to the increasing demand and decreasing production. Identifying soybean production dynamics is contributable to appropriate adjustment of crop rotation system and efficient use of agricultural resources-and thus to ensure food security. Taking the North China plain (NCP) as a case area, this study first analyzed the spatiotemporal dynamics of soybean production during 1998-2015 based on the spatial autocorrelation method, and then calculated contributions to the total production by yield and sown area using the factor decomposition method. The results indicated that total soybean production in the NCP decreased dramatically from 1998 to 2015 and showed a decreasing trend in 80.4% (263) of the counties, mainly (83.9%) contributed by the shrinkage of sown area, largely caused by decreasing benefit. Two regions were found with significantly spatial clustering degree of soybean production. In the south part ...
http://ir.igsnrr.ac.cn/handle/311030/158069?mode=full&submit_simple=Show+full+item+record
Data from: Fine mapping of the soybean aphid-resistance genes Rag6 and Rag3c from Glycine soja 85-32 | Ag Data CommonsData from: Fine mapping of the soybean aphid-resistance genes Rag6 and Rag3c from Glycine soja 85-32 | Ag Data Commons
Rag6 and Rag3c were delimited to a 49-kb interval on chromosome 8 and a 150-kb interval on chromosome 16, respectively. Structural variants in the exons of candidate genes were identified.. The soybean aphid, an invasive species, has significantly threatened soybean production in North America since 2000. Host-plant resistance is known as an ideal management strategy for aphids. Two novel aphid-resistance loci, Rag6 and Rag3c, from Glycine soja 85-32, were previously detected in a 10.5-cM interval on chromosome 8 and a 7.5-cM interval on chromosome 16, respectively. Defining the exact genomic position of these two genes is critical for improving the effectiveness of marker-assisted selection for aphid resistance and for identification of the functional genes. To pinpoint the locations of Rag6 and Rag3c, four populations segregating for Rag6 and Rag3c were used to fine map these two genes. The availability of the Illumina Infinium SoySNP50K/8K iSelect BeadChip, combined with single-nucleotide ...
https://data.nal.usda.gov/dataset/data-fine-mapping-soybean-aphid-resistance-genes-rag6-and-rag3c-glycine-soja-85-32
A Fluorescence in Situ Hybridization System for Karyotyping Soybean | GeneticsA Fluorescence in Situ Hybridization System for Karyotyping Soybean | Genetics
The development of a universal soybean (Glycine max [L.] Merr.) cytogenetic map that associates classical genetic linkage groups, molecular linkage groups, and a sequence-based physical map with the karyotype has been impeded due to the soybean chromosomes themselves, which are small and morphologically homogeneous. To overcome this obstacle, we screened soybean repetitive DNA to develop a cocktail of fluorescent in situ hybridization (FISH) probes that could differentially label mitotic chromosomes in root tip preparations. We used genetically anchored BAC clones both to identify individual chromosomes in metaphase spreads and to complete a FISH-based karyotyping cocktail that permitted simultaneous identification of all 20 chromosome pairs. We applied these karyotyping tools to wild soybean, G. soja Sieb. and Zucc., which represents a large gene pool of potentially agronomically valuable traits. These studies led to the identification and characterization of a reciprocal chromosome ...
http://www.genetics.org/content/185/3/727.short
Evaluation of Soybean Aphid-resistant Soybean Lines by Michael T. McCarville, Matthew E. ONeal et al.Evaluation of Soybean Aphid-resistant Soybean Lines by Michael T. McCarville, Matthew E. ONeal et al.
The soybean aphid, Aphis glycines (Hemiptera: Aphididae), is a consistent pest of soybean in Iowa. Current management is heavily reliant on the use of insecticides, which can be expensive and time consuming to apply. Soybean varieties resistant to the aphid are available. These varieties primarily include one resistance gene (Rag1) for soybean aphid control. Varieties incorporating two genes (Rag1 + Rag2) have recently become available. We sought to compare soybean lines susceptible to the soybean aphid with lines carrying a single resistance gene (Rag1 or Rag2) and a line carrying two resistance genes (Rag1 + Rag2). We evaluated the lines based on aphid control and yield protection.
https://lib.dr.iastate.edu/farms_reports/2034/
Inheritance of resistance to the Soybean aphid in Soybean PI 200538 on Environmental XPRTInheritance of resistance to the Soybean aphid in Soybean PI 200538 on Environmental XPRT
Article Inheritance of resistance to the Soybean aphid in Soybean PI 200538. The soybean aphid (Aphis glycines Matsumura) is a major soybean [Glycine max (L.) Merr.] insect pest. Soybean plant introduction (PI) 200538 has strong resistance to the aph...
https://www.environmental-expert.com/articles/inheritance-of-resistance-to-the-soybean-aphid-in-soybean-pi-200538-58524
Coupling Soybean Cyst Nematode Damage to CROPGRO-Soybean by J. Fallick, W. D. Batchelor et al.Coupling Soybean Cyst Nematode Damage to CROPGRO-Soybean by J. Fallick, W. D. Batchelor et al.
The soybean cyst nematode (SCN) Heterodera glycines Ichinohe is responsible for substantial economic losses in soybean (Glycine max L. Merr.) production throughout the U.S. Results from past efforts to quantify the severity of crop damage resulting from SCN are often subject to variable experimental conditions resulting from differences in weather, soil type, and cultivar. Because of the difficulty in accounting for these variables, a process-oriented crop growth simulation model was chosen as a platform for studying the dynamics of SCN damage and for transferring knowledge between crop production scenarios. The objective of this study was to develop and evaluate hypotheses for coupling SCN damage to the process-oriented crop growth model CROPGRO-Soybean. A monomolecular function was used to relate daily SCN damage to initial population density of SCN eggs. The equation was incorporated into the crop model in order to test two hypotheses of how SCN damage occurs. The first hypothesis was that SCN reduce
https://lib.dr.iastate.edu/plantpath_pubs/127/
soybean sesame soybean oil expeller iran trend in nigeria
Soybean Expeller, Soybean Expeller Suppliers There are 13,279 soybean expeller suppliers, mainly located in Asia. The top supplying countries or regions are China, India, and Turkey, which supply 92%, 7%, and 1% of soybean expeller respectively. Soybean expeller products are most popular in Africa, Domestic Market, and Southeast Asia.. soybean in iran, soybean in iran Suppliers and Manufacturers. Oilpress offers 206 soybean in iran products. About 0% of these are Soybeans, 2% are Soybean Oil, and 0% are Fish Meal. A wide variety of soybean in iran options are available to you, such as use, packaging, and cultivation type.. soybean sesame oil press production line sweden. soybean expeller pressing machine sweden Best Oil Expeller China Automatic Oil Screw Press Machine of 6yl Type for screw oil press machine seed oil press best selling heavy duty oil press machine screw oil Coconut Oil Expeller,Oil Expeller China Oil Press (6YL-80, 100) China Oil Press, Oil Expeller 6YL-68 Best Seller Factory ...
http://leschosesalenvers.be/process/5953-soybean-sesame-soybean-oil-expeller-iran-trend-in-nigeria.html
Histological investigation of the effect of soybean (Glycine max) extracts on the collagen layer and estrogen receptors in the...Histological investigation of the effect of soybean (Glycine max) extracts on the collagen layer and estrogen receptors in the...
OBJECTIVES: The purpose of this study was to analyze the effects of soybean extracts obtained using different extraction methods on the skin of female rats. ...
https://avesis.cumhuriyet.edu.tr/yayin/33782f7d-9848-4b12-a530-5b1063475e58/histological-investigation-of-the-effect-of-soybean-glycine-max-extracts-on-the-collagen-layer-and-estrogen-receptors-in-the-skin-of-female-rats
Year, region, and temperature effects on the quality of Minnesotas soybean crop<...Year, region, and temperature effects on the quality of Minnesotas soybean crop<...
TY - JOUR. T1 - Year, region, and temperature effects on the quality of Minnesotas soybean crop. AU - Naeve, Seth L.. AU - Huerd, Sheri C.. PY - 2008/5/1. Y1 - 2008/5/1. N2 - Bulk commodity soybean [Glycine max (L.) Merr.] can now be sourced with great specificity through rail and container purchases. The objective of this study was to determine whether analyses of farmer-grown soybean seed samples could detect significant regional differences in soybean quality traits. Through analysis of 2706 farmer volunteered soybean samples representing harvests from 2003-2005, we found significant year and region effects on seed quality. An independent variable, temperature during seed filling (Tsf) was created for each soybean sample by kriging local daily mean air temperatures from 135 weather stations. A region x year interaction was noted for protein and the sum of protein and oil concentrations, but using Tsf as a covariate eliminated this interaction. The variable Tsf correlated with average ...
https://experts.umn.edu/en/publications/year-region-and-temperature-effects-on-the-quality-of-minnesotas-
Global Soybean Phospholipid Enzyme Hydrolysate Market: By Key Players, Application, Type, Region and Forecast to 2022 -...
The Market.Biz research report on Soybean Phospholipid Enzyme Hydrolysate offers a detailed study of Soybean Phospholipid Enzyme Hydrolysate industry worldwide concentrating on key regions like North America, Europe, and Asia. Various factors which influence the growth of Soybean Phospholipid Enzyme Hydrolysate market has been covered at depth in this report. Initially, the report states the product definition, description, range of applications, supply and demand analysis of Soybean Phospholipid Enzyme Hydrolysate industry.. The major regions present in the continents like United States, Germany, Japan and China and their contribution to global Soybean Phospholipid Enzyme Hydrolysate market is elaborated in this research document. In next section, the report discusses industry policies and plans, cost structures, the outline of Soybean Phospholipid Enzyme Hydrolysate market globally, manufacturing processes. The growth rate exhibited by Soybean Phospholipid Enzyme Hydrolysate market based on ...
http://timegazette.com/2017/06/global-soybean-phospholipid-enzyme-hydrolysate-market-by-key-players-application-type-region-and-forecast-to-2022/
Evaluation of Soybean Genotypes for Resistance to Charcoal Rot
Identifying Soybean Genotypes with High Charcoal Rot Resistance. Experimental field plots. Field plots were established from 2006 to 2008 at the West Tennessee Research and Education Center at University of Tennessee in Jackson, TN. The soil was a Dexter fine-silty loam (mixed, active, thermicultic hapludalfs). Soybean genotypes in MG III through V including six plant introductions were selected based on their commercial use, high yield in state variety trials, and performance in breeding trials. A total of 149 soybean genotypes consisting of 27 MG III, 29 Early MG IV, 34 Late MG IV, and 59 MG V were evaluated for reaction to M. phaseolina infection. Seeds were treated with 0.8 ml/kg of mefenoxam + fludioxinal + molybeenum (Apron Maxx + Moly, Syngenta, Greensboro, NC) prior to planting. The experiments were conducted in the same area each year and genotypes were planted in four 6.1-m rows spaced 0.7 m using an Almaco 4-row cone planter (model #AJ4RP2, Almaco, Nevada, IA). Within each MG the ...
http://www.plantmanagementnetwork.org/pub/php/research/2011/charcoal/
Master of Life | Rakuten Global Market: Black soybean diet black soybean soybean milk anthocyanin supplement supplement ◆ black...Master of Life | Rakuten Global Market: Black soybean diet black soybean soybean milk anthocyanin supplement supplement ◆ black...
Master of Life: Black soybean diet black soybean soybean milk anthocyanin supplement supplement ◆ black soybean 180 ◆ (for approximately three months) for business use [product] - Purchase now to accumulate reedemable points! | Rakuten Global Market
https://global.rakuten.com/en/store/lmaster/item/rbs06103sub01/?s-id=borderless_recommend_item_en
Master of Life | Rakuten Global Market: Black soybean diet black soybean soybean milk anthocyanin supplement supplement ◆ black...Master of Life | Rakuten Global Market: Black soybean diet black soybean soybean milk anthocyanin supplement supplement ◆ black...
Master of Life: Black soybean diet black soybean soybean milk anthocyanin supplement supplement ◆ black soybean 60 ◆ (for approximately one month) for business use [product] - Purchase now to accumulate reedemable points! | Rakuten Global Market
https://global.rakuten.com/en/store/lmaster/item/rbs06191/?s-id=borderless_recommend_item_en
First Report of Sudden Death Syndrome of Soybean Caused by <i>Fusarium by A. D. Ziems, L. J. Giesler...First Report of Sudden Death Syndrome of Soybean Caused by <i>Fusarium by A. D. Ziems, L. J. Giesler...
During August of 2004, soybean (Glycine max (L.) Merr.) plants exhibiting symptoms typical of sudden death syndrome (SDS) caused by Fusarium solani (Mart.) Sacc. f. sp. glycines (= Fusarium virguliforme Akoi, ODonnell, Homma, & Lattanzi) (1) were observed in Nemaha and Pierce counties in eastern Nebraska. Leaf symptoms ranged from small chlorotic spots to prominent interveinal necrosis on plants at R5-R6 growth stages. Taproots of symptomatic plants were plated on potato dextrose agar (PDA) amended with hymexazol, ampicillin, and rifampicin (HAR). Resulting fungal isolates grew slowly and developed masses of blue macroconidia, characteristic of F. solani f. sp. glycines. Sorghum seed infested with the isolates were placed 1.5 cm below soybean seeds of the susceptible cv. Sloan planted in clay pots (3). Noninfested sorghum seed and sorghum seed infested with F. oxysporum were controls.
https://digitalcommons.unl.edu/plantpathpapers/336/
Seed Dreams: BEAN, SOYBEAN Glycine maxSeed Dreams: BEAN, SOYBEAN Glycine max
All Seed Dreams seeds are grown the old-fashioned way without the use of pesticides or chemicals, and through the hard work and dedication of California farmer Shane Murphy, and Seed Curator and farmer at our Port Townsend farm, Tessa Gowans, as well as the time and love of generous volunteers ...
http://seeddreams.blogspot.com/2008/09/bean-soybean-glycine-max.html
Flavonoid and Isoflavonoid Distribution in Developing Soybean Seedling Tissues and in Seed and Root Exudates | Plant PhysiologyFlavonoid and Isoflavonoid Distribution in Developing Soybean Seedling Tissues and in Seed and Root Exudates | Plant Physiology
The distribution of flavonoids, isoflavonoids, and their conjugates in developing soybean (Glycine max L.) seedling organs and in root and seed exudates has been examined. Conjugates of the isoflavones daidzein and genistein are major metabolites in all embryonic organs within the dry seed and in seedling roots, hypocotyl, and cotyledon tissues at all times after germination. Primary leaf tissues undergo a programmed shift from isoflavonoid to flavonoid metabolism 3 days after germination and become largely predominated by glycosides of the flavonols kampferol, quercetin, and isorhamnetin by 5 days. Cotyledons contain relatively constant and very high levels of conjugates of both daidzein and genistein. Hypocotyl tissues contain a third unidentified compound, P19.3, also present in multiple conjugated forms. Conjugates of daidzein, genistein, and P19.3 are at their highest levels in the hypocotyl hook and fall off progressively down the hypocotyl. These isoflavones also undergo a programmed and ...
http://www.plantphysiol.org/content/95/2/594?ijkey=08e1611e4b6ff0c7077297fe798dafb1fad1e364&keytype2=tf_ipsecsha
Soybean (Glycine max) PHYTOCHROME-INTERACTION FACTOR 1 induced skotomorphogenesis and de-etiolation in ArabidopsisSoybean (Glycine max) PHYTOCHROME-INTERACTION FACTOR 1 induced skotomorphogenesis and de-etiolation in Arabidopsis
Soybean (Glycine max)
TC218173 TC218173 AGCCGGCGAACGGAAGAGAGGAACCATTAAACCATGTTGAAGCAGAGAGACAGAGGAGGG AGAAGCTGAACCAGAGATTCTACGCGCTTCGTGCTGTGGTTCCCAACGTGTCAAAGATGG ACNNNGCGTCGCTTCTGGGCGACGCGATATCTTACATCACCGAGCTGAAGTCCAAGCTTC AGACCCTCGAATCTGATAAAGATGTATTGCATAAGCAGCTTGAAGGAGTGAAGAAGGAAC TCGAGAAAACAACTTATAACGTTTCTTCTAATCACGCGTGTAATAATAACAATAACAACA AGTTGTCGTCGAATCAGCCGGCGTTAATTGACTTGGTTGAGATGGACGTGAAGATCATTG GGTGGGACGCGATGATAACGATCACATGCAGCAAGAAGAACCACCCCGCGGCGACGTTGA TGACGGCATTGATGGAGTTGGACTTGGACGTGCACTACGCCACCGTAACGTTGGTCAACG ATTTGATGATCCAACAAGCAACGGTGAAGATGGGAAGTAGATTTTACACGCAGGAGCAGC TTCGAGCGGTGCTGTCGGCTAAGGTTGGGGATGTACGATGATGTTGGCACTTTGCGGCAG CGTTGAGATTATAAGTGTGTGTTTGTGTCATGTTATTAGCTAGCTATCTCTTTCTAAGTT GTGTGCTGCTCTGGGGTATTTTAAGCCTTCCCGGTAGCTGTTTCTGTAAAATTTTAAGAT TTTATTTTTCTTTATTGGGCAGCTTAGTATTGAATTTTGAGGTAATCAAGCTGGGAAGCT CCATGGAGTAGTAGTATAACTAGCTAGGGACAGTTTNAANNNAATCTGTGGTGGAGTGAA ATAGGGGTAATTTTATCTGTTTAGGTA ...
http://marker.kazusa.or.jp/Soybean/sequence/GMES3754
Study on the Optimum Control of Soybean AphidStudy on the Optimum Control of Soybean Aphid
Based on the optimum control theory (1) , integrative effect of 11 controllable factors of soybean field on soybean aphid (Aphis glycines Matsumura), natural enemies and summer soybean yield was studied systematically by the approaching optimum point and Orthogonal design L27 (3)13 from 1993 to 1996. According to the criterion of not only good control of the pest and increase of soybean yield but also protection of natural enemies, the controllable factors were evaluated synthetically and optimum system control of soybean aphid was suggested as follows: soybean sown in the same maize hole (4 soybean plants to 1 maize plant) or soybean interplanted in maize field (9 rows of soybeans to 2 rows of maize), cultivar Lusoybean 4, sowing time about 10 June, dressing seeds with trace fertilizer at 1800 g/ha, dosage of fertilizer N, P2O5 and K2O application at 45, 60 and 150 kg/ha, dosage of solid manure application at 22500 kg/ha, control soybean aphid with Pirmicarb at 60 g/ha. The technologies of ...
http://krex.k-state.edu/dspace/handle/2097/35655
TILLING to detect induced mutations in soybeanTILLING to detect induced mutations in soybean
Abstract Background Soybean (Glycine max L. Merr.) is an important nitrogen-fixing crop that provides much of the worlds protein and oil. However, the available tools for investigation of soybean gene function are limited. Nevertheless, chemical mutagenesis can be applied to soybean followed by screening for mutations in a target of interest using a strategy known as Targeting Induced Local Lesions IN Genomes (TILLING). We have applied TILLING to four mutagenized soybean populations, three of which were treated with ethyl methanesulfonate (EMS) and one with N-nitroso-N-methylurea (NMU). Results We screened seven targets in each population and discovered a total of 116 induced mutations. The NMU-treated population and one EMS mutagenized population had similar mutation density (~1/140 kb), while another EMS population had a mutation density of ~1/250 kb. The remaining population had a mutation density of ~1/550 kb. Because of soybeans polyploid history, PCR amplification of multiple targets ...
https://mospace.umsystem.edu/xmlui/handle/10355/15036
Geographic distribution of soybean aphid biotypes in the United States and Canada during 2008-2010. - Agriculture and Agri-Food...Geographic distribution of soybean aphid biotypes in the United States and Canada during 2008-2010. - Agriculture and Agri-Food...
Soybean aphid (Aphis glycines Matsumura) is a native pest of soybean [Glycine max (L.) Merr.] in eastern Asia and was detected on soybeans in North America in 2000. In 2004, the soybean cultivar Dowling was described to be resistant to soybean aphids with the Rag1 gene for resistance. In 2006, a virulent biotype of soybean aphid in Ohio was reported to proliferate on soybeans with the Rag1 gene. The objective was to survey the occurrence of virulent aphid populations on soybean indicator lines across geographies and years. Nine soybean lines were identified on the basis of their degree of aphid resistance and their importance in breeding programs. Naturally occurring soybean aphid populations were collected in 10 states (Kansas, Illinois, Indiana, Iowa, Michigan, Minnesota, North Dakota, Ohio, South Dakota, and Wisconsin) and the Canadian province of Ontario. The reproductive capacity of field-collected soybean aphid populations was tested on soybean lines; growth rates were compared in ...
http://www.agr.gc.ca/eng/abstract/publication?id=36218000000289
Using planting date to manage bean pod mottle virus in soybean
Summary:Delayed planting has been suggested to reduce density of the bean leaf beetle Cerotoma trifurcata (Förster), the principal vector of Bean pod mottle virus. Therefore, planting date was explored to determine if it might impact damage caused by the virus. Four planting dates, ranging from mid-March to mid-June, and two soybean Glycine max (L.) cultivars were examined for their effect on the relative damage caused by the virus in central Iowa for the years 2000-2002. Damage was assessed in terms of ...
https://www.ent.iastate.edu/soybeaninsects/print/106
The Development of an Efficient Multipurpose Bean Pod Mottle Virus Vir by Chunquan Zhang, Jeffrey Bradshaw et al.The Development of an Efficient Multipurpose Bean Pod Mottle Virus Vir by Chunquan Zhang, Jeffrey Bradshaw et al.
Plant viral vectors are valuable tools for heterologous gene expression, and because of virus-induced gene silencing (VIGS), they also have important applications as reverse genetics tools for gene function studies. Viral vectors are especially useful for plants such as soybean (Glycine max) that are recalcitrant to transformation. Previously, two generations of bean pod mottle virus (BPMV; genus Comovirus) vectors have been developed for overexpressing and silencing genes in soybean. However, the design of the previous vectors imposes constraints that limit their utility. For example, VIGS target sequences must be expressed as fusion proteins in the same reading frame as the viral polyprotein. This requirement limits the design of VIGS target sequences to open reading frames. Furthermore, expression of multiple genes or simultaneous silencing of one gene and expression of another was not possible. To overcome these and other issues, a new BPMV-based vector system was developed to facilitate a variety
https://digitalcommons.unl.edu/panhandleresext/45/
High-Fiber Soybean Products and Process for the Preparation Thereof - Patent applicationHigh-Fiber Soybean Products and Process for the Preparation Thereof - Patent application
0022]More specifically, the inventive process for preparing a whole soybean milk comprises the steps of mechanically milling feed soybeans, e.g., by a mill such as a crusher; micronizing the resulting crude-milled soybeans by a means selected from the group consisting of an enzymatic degradation reaction, mechanical micronization using a rotating micronizer, or a combination thereof; and homogenizing the resulting micronized milled soybean. Optionally, the crude-milled soybeans may be filtered to separate the initially generated soybean milk (first soybean milk) and a solid portion containing curd refuse and soybean peels; the micronization and homogenization of the solid portion is carried out to obtain a second batch of soybean milk (second soybean milk); and the second soybean milk is combined with the first soybean milk to obtain the whole soybean milk. In the optional process, the micronized solid portion may be combined with the first soybean milk, followed by homogenizing the resulting ...
http://www.patentsencyclopedia.com/app/20080268098
A Phytophthora sojae Glycoside Hydrolase 12 Protein Is a Major Virulence Factor during Soybean Infection and Is Recognized as a...
We identified a glycoside hydrolase family 12 (GH12) protein, XEG1, produced by the soybean pathogen Phytophthora sojae that exhibits xyloglucanase and β-glucanase activity. It acts as an important virulence factor during P. sojae infection but also acts as a pathogen-associated molecular pattern (PAMP) in soybean (Glycine max) and solanaceous species, where it can trigger defense responses including cell death. GH12 proteins occur widely across microbial taxa, and many of these GH12 proteins induce cell death in Nicotiana benthamiana. The PAMP activity of XEG1 is independent of its xyloglucanase activity. XEG1 can induce plant defense responses in a BAK1-dependent manner. The perception of XEG1 occurs independently of the perception of ethylene-inducing xylanase. XEG1 is strongly induced in P. sojae within 30 min of infection of soybean and then slowly declines. Both silencing and overexpression of XEG1 in P. sojae severely reduced virulence. Many P. sojae RXLR effectors could suppress defense ...
https://ir.library.oregonstate.edu/concern/articles/73666641d
Acidification and starch behaviour during co-fermentation of cassava (Manihot esculenta Crantz) and soybean (Glycine max Merr)...Acidification and starch behaviour during co-fermentation of cassava (Manihot esculenta Crantz) and soybean (Glycine max Merr)...
Changes in acidification and starch behaviour were investigated during co-fermentation of cassava and soybean into gari, an African fermented product. Non-volatile acidity, pH and starch content were evaluated using standard analytical methods. Starch breakdown and pasting characteristics were also analysed using a Brabender viscoamylograph. Fermentation caused significant variations in the pH, non-volatile acidity and starch concentration. The pH decreased with concomitant increases in non-volatile acidity during co-fermentation of the cassava dough. Soy fortification up to 20% caused only minimal effects on the pH, titratable acidity and starch content during the fermentation period. Starch content decreased from 69.8% to 60.4% within the 48 h fermentation time in the unfortified sample, with similar trends noted at all levels of fortification. Starch pasting characteristics showed varied trends in pasting temperature, peak viscosity, viscosity at 95_C and at 50_C-hold with increasing ...
http://ugspace.ug.edu.gh/handle/123456789/2522
Dynamics of Soybean Rust Epidemics in Sequential Plantings of Soybean Cultivars in NigeriaDynamics of Soybean Rust Epidemics in Sequential Plantings of Soybean Cultivars in Nigeria
Soybean rust, caused by Phakopsora pachyrhizi, is an important foliar disease of soybean. Disease severity is dependent on several environmental factors, although the precise nature of most of these factors under field conditions is not known. To help understand the environmental factors that affect disease development, soybean rust epidemics were studied in Nigeria by sequentially planting an early-maturing, highly susceptible cultivar, TGx 1485-1D, and a late-maturing, moderately susceptible cultivar, TGx 1448-2E, at 30- to 45-day intervals from August 2004 to September 2006. Within each planting date, disease onset occurred earlier on TGx 1485-1D than on TGx 1448-2E, and rust onset was at least 20 days earlier on soybean planted between August and October than on soybean planted between November and April. The logistic model provided a better description of the temporal increase in rust severity than the Gompertz model. Based on the logistic model, the highest absolute rates of disease ...
http://www.apsnet.org/publications/plantdisease/2011/January/Pages/95_1_43.aspx
soybean oil machine manufacurers in south african
South Africa Soybean Oil Press Machine, South African Soybean. Soybean and corn oil, provides healthy cooking oil to south african households. It contains the goodness of natural soybean in light and tasty edib.... Soya Oil , Manufacturers & Suppliers Johannesburg South. At Irwing Soya, we are the leading manufacturers and suppliers of soyabean oil in South Africa. As a result of our highly effective extraction process, our yield has the finest nutritional profile with a long shelf life that is well suited for a wide range of food manufacturing purposes.. Soybean Oil In Africa Wholesale, Soybean Suppliers. There are 1,496 soybean oil in africa suppliers, mainly located in Asia. The top supplying countries or regions are China, South Africa, and United Kingdom, which supply 60%, 35%, and 1% of soybean oil in africa respectively. Soybean oil in africa products are most popular in Africa, Southeast Asia, and Mid East.. South Africa Soybean Oil, South Africa Soybean Oil Manufacturers. South Africa ...
http://leschosesalenvers.be/plant/11944-soybean-oil-machine-manufacurers-in-south-african.html
Bean pod mottle virus : Crop Diseases : University of Minnesota ExtensionBean pod mottle virus : Crop Diseases : University of Minnesota Extension
Bean pod mottle virus causes green to yellow mottling of young leaves. In severe infections, leaves may become distorted. Seeds from infected plants may be mottled or discolored, but other factors can also cause mottled seed. Symptoms may not be apparent at high temperatures or after pod set. Pod formation may be reduced when infected plants are under moisture stress. BPMV can interact with the soybean mosaic virus to create severe symptoms in plants infected by both viruses. BPMV may also be related to the development of green stem syndrome, in which plants retain green stems and leaves after pods and most nearby plants have matured.. ...
https://www.extension.umn.edu/Agriculture/crop-diseases/soybean/beanpodmottle.html
Role of insecticidal seed treatments and refuge for managing soybean aphid virulence | Graduate Education
Aphid-resistant soybean varieties with Rag (Resistance to Aphis glycines) genes are promising tools for the management of soybean aphid. Intriguingly, there are soybean aphid populations that can overcome such genetic resistance (i.e. virulent aphids) and cause yield losses. Previous research suggests refuge with aphid-susceptible soybean has the potential to control virulent aphid populations, but it is not clear whether it can reverse the proliferation of virulent aphid populations. Seed treatment has shown improvement of soybean aphid control on Rag soybean. To date, however, it is unknown whether refuge strategy and seed treatment combined could improve soybean aphid virulence management. Therefore we evaluated aphid virulence management by planting refuge soybean in a 1:3 aphid-susceptible:Rag-soybean ratio. Seed treatment was applied to either the aphid-susceptible and/or Rag-soybean. All soybean plants were infested with both avirulent (i.e. biotype 1) and virulent (i.e. biotype 4) ...
https://grad.cfaes.ohio-state.edu/research-projects/carlos-j-esquivel
MINERAL PROFILE OF INFANT-FED COMPOSITE COMPLEMENTARY FOOD PREPARED FROM MIAZE (Zea mays), SOYBEAN (Glycine max) AND Moringa...MINERAL PROFILE OF INFANT-FED COMPOSITE COMPLEMENTARY FOOD PREPARED FROM MIAZE (Zea mays), SOYBEAN (Glycine max) AND Moringa...
free project topics, download complete project material, hire a writer, research topics in nigeria, kenya, ghana, south africa, undergraduate, postgraduate, final year students, free research project, business administration topics, mass communication, accounting, computer science, economics, statistics, education
https://www.projectreserve.com/2018/10/mineral-profile-of-infant-fed-composite.html
Malvick Provides Brief Review of Soybean Seedling Diseases | Department of Plant PathologyMalvick Provides Brief Review of Soybean Seedling Diseases | Department of Plant Pathology
Conditions are favorable for soybean seedling disease in many areas. Wet soil, slow emergence, and delayed planting have been favorable for seedling diseases in many areas of southern and central Minnesota. Learn more about soybean seedling diseases from Dean Malvick in Minnesota Crop News.
https://plpa.cfans.umn.edu/about-us/news-events/plpa-news/soybean-seedling-diseases
Isoliquiritigenin, a strong nod gene- and glyceollin resistance-inducing flavonoid from soybean root exudate. | Applied and...Isoliquiritigenin, a strong nod gene- and glyceollin resistance-inducing flavonoid from soybean root exudate. | Applied and...
Isoflavonoid signal molecules from soybean (Glycine max (L.) Merr.) seed and root exudate induce the transcription of nodulation (nod) genes in Bradyrhizobium japonicum. In this study, a new compound with symbiotic activity was isolated from soybean root exudate. The isolated 2,4,4-trihydroxychalcone (isoliquiritigenin) is characterized by its strong inducing activity for the nod genes of B. japonicum. These genes are already induced at concentrations 1 order of magnitude below those required of the previously described isoflavonoid inducers genistein and daidzein. Isoliquiritigenin is also a potent inducer of glyceollin resistance in B. japonicum, which renders this bacterium insensitive to potentially bactericidal concentrations of glyceollin, the phytoalexin of G. max. No chemotactic effect of isoliquiritigenin was observed. The highly efficient induction of nod genes and glyceollin resistance by isoliquiritigenin suggests the ecological significance of this compound, although it is not a ...
https://aem.asm.org/content/58/5/1705
soybean oil price index
Thursday, as DTNs index of national cash soybean prices closed at $10.06 a bushel, I cant help but think about the old fable of The Dog and His … Amid several bearish concerns for soybeans in 2020, one bright spot is soybean oil. This page contains data on US Soybean Oil. Cofeed provides China soybean oil price today, soybean oil production, soybean oil import and export volume, soybean oil inventory and soybean oil futures price trend. Comprehensive information about the Bloomberg Soybean Oil index. FAO price indices for oilseeds, vegetable oils and oilmeals Last updated in November 2020. Soybean futures and options are an easy, liquid tool for speculating or hedging against price movements for one of the worlds most widely grown crops. More information can be found in other sections, such as historical data, charts and technical analysis. The total business generated in soybean oil category is 254294 USD last month. Palm oil prices rose about 2 1/2 percent (December contract +83 ringgit ...
http://boudewijndegroot.nl/ot44chn/6e6968-soybean-oil-price-index
Portfolio | JEECON FOODS PRIVATE LIMITED, INDIAPortfolio | JEECON FOODS PRIVATE LIMITED, INDIA
soya flour manufacturers , soya flour toasted , high protein soya flour , sonic biochem , soya flour for biscuits ,soya lecithin , soya chunks , soya granules , soya proteins , jeecon , soya flour supplier , soya flour wholesaler , soya flour distributor, soya tvp, soya meal exporters , rich soyabari , mahakali , prestige , vippy industries ...
http://jeecon.com/portfolio-item/
Genome-wide transcriptional analysis of two soybean genotypes under dehydration and rehydration conditions | Read by QxMDGenome-wide transcriptional analysis of two soybean genotypes under dehydration and rehydration conditions | Read by QxMD
BACKGROUND: Soybean is an important crop that provides valuable proteins and oils for human use. Because soybean growth and development is extremely sensitive to water deficit, quality and crop yields are severely impacted by drought stress. In the face of limited water resources, drought-responsive genes are therefore of interest. Identification and analysis of dehydration- and rehydration-inducible differentially expressed genes (DEGs) would not only aid elucidation of molecular mechanisms of stress response, but also enable improvement of crop stress tolerance via gene transfer. Using Digital Gene Expression Tag profiling (DGE), a new technique based on Illumina sequencing, we analyzed expression profiles between two soybean genotypes to identify drought-responsive genes.. RESULTS: Two soybean genotypes - drought-tolerant Jindou21 and drought-sensitive Zhongdou33 - were subjected to dehydration and rehydration conditions. For analysis of DEGs under dehydration conditions, 20 cDNA libraries ...
https://read.qxmd.com/read/24093224/genome-wide-transcriptional-analysis-of-two-soybean-genotypes-under-dehydration-and-rehydration-conditions
Bean Pod Mottle Virus - WISCONSIN FIELD CROPS PATHOLOGY
Bean pod mottle virus (BPMV) is a virus disease spread primarily by the bean leaf beetle, Cerotoma trifurcata. Seed transmission is al
https://fyi.uwex.edu/fieldcroppathology/soybean_pests_diseases/bean_pod_mottle_virus/
Soybean Cyst Nematode Field Guide
Soybean cyst nematode is the most economically significant pest of soybeans in Iowa and has been found in 98 of the 99 Iowa counties. Infested soybean plants often show no symptoms other than reduced yield. The 62-page field guide is designed as a resource for agronomists and farmers to manage soybean cyst nematode. ...
https://store.extension.iastate.edu/Product/soybean-cyst-nematode-field-guide
soybean lecithin soft gel - china soybean lecithin soft gel manufacturers and supplierssoybean lecithin soft gel - china soybean lecithin soft gel manufacturers and suppliers
soybean lecithin soft gel manufacturers soybean lecithin soft gel suppliers Directory - Browse soybean lecithin soft gel products,Choose Quality soybean lecithin soft gel manufacturers, suppliers, factory at B2BAGE
http://www.b2bage.com/the-soybean-lecithin-soft-gel/
Soybean Cyst Nematode Management in 2013: Take the Test: Beat the Pest - Blogs - The Rolla Daily News - Rolla, MO - Rolla, MO
Here is the situation: Soybean cyst nematode (SCN) is the worst pest of soybeans in the U. S. A. including Missouri.Fortunately, this pest can be managed, but farmers must take steps before planting soybean this year to protect against soybean cyst nematode.The first step is to test the soil for SCN.
http://www.therolladailynews.com/article/20130311/blogs/130319804/0/BLOGS
Soybean Cyst Nematode Management in 2013: Take the Test: Beat the Pest - Blogs - Moberly Monitor-Index - Moberly, MO - Moberly,...
Here is the situation: Soybean cyst nematode (SCN) is the worst pest of soybeans in the U. S. A. including Missouri.Fortunately, this pest can be managed, but farmers must take steps before planting soybean this year to protect against soybean cyst nematode.The first step is to test the soil for SCN.
http://www.moberlymonitor.com/article/20130311/blogs/130319804/0/blogs01
Biological and molecular characterization of an isolate of Tobacco streak virus obtained from soybeans in BrazilBiological and molecular characterization of an isolate of Tobacco streak virus obtained from soybeans in Brazil
INTRODUCTION A recent outbreak of soybean [Glycine max (L.) Merril] bud blight in Wenscelau Braz County, State of Paraná, Brazil, may be an indication of the occurrence of a virus disease. The outbreak occurred in an area close to a region where the presence of Tobacco streak virus (TSV), family Bromoviridae, genus Ilarvirus, is historical. Preliminary evaluations using electron microscopy of infected leaves showed the presence of spherical particles. Additional studies proved that TSV was responsible for the problem. Although no resistance to this virus has been found in the soybean germplasm the disease has been controlled by delaying the sowing date (Almeida & Corso, 1991; Almeida et al., 1994). The TSV was identified in tobacco (Nicotiana tabaccum L.) plants in Brazil in 1940 (Costa, 1945), and it is currently known to infect several cash crops such as cotton (Gossypium hirsutum L.), tomato (Lycopersicon esculentum Mill.), tobacco (Nicotiana tabacum L.), soybean, peanut (Arachis hypogaea ...
http://www.scielo.br/scielo.php?script=sci_arttext&pid=S0100-41582005000400005
Feeding Edible Beans and Soybeans to Cattle | Manitoba Agriculture | Province of ManitobaFeeding Edible Beans and Soybeans to Cattle | Manitoba Agriculture | Province of Manitoba
Producers are currently reporting that this years soybeans are very immature and have a high level of sclerotinia. Reports indicate that very green samples (80-90% green) have a nutrient content similar to mature soybeans - about 41% crude protein and 18% fat. Due to the high fat content, the amount of soybeans in the diet needs to be limited to keep the total fat content in the ration to less than 5%. Higher levels of fat can decrease fibre digestion in the rumen. In dairy diets, raw soybeans should be limited to about 4 lbs/day. Roasting soybeans increases the bypass value of the protein and decreases anti-nutritional factors. Roasted soybeans can be fed to dairy cows at a higher rate - up to 6 lbs/day. Raw soybeans can be fed to beef cattle at 10 % of the diet - approximately 1.5 lbs/day for 600 lb growing cattle and 3 lbs/day for bred cows. Soybeans can be fed whole or just broken into halves or quarters. Avoid fine grinding. Sclerotinia is not associated with health problems in cattle ...
http://gov.mb.ca/agriculture/livestock/production/beef/feeding-edible-beans-and-soybeans-to-cattle.html
Genomic insights into plant growth promoting rhizobia capable of enhancing soybean germination under drought stress | BMC...Genomic insights into plant growth promoting rhizobia capable of enhancing soybean germination under drought stress | BMC...
The role of soil microorganisms in plant growth, nutrient utilization, drought tolerance as well as biocontrol activity cannot be over-emphasized, especially in this era when food crisis is a global challenge. This research was therefore designed to gain genomic insights into plant growth promoting (PGP) Rhizobium species capable of enhancing soybean (Glycine max L.) seeds germination under drought condition. Rhizobium sp. strain R1, Rhizobium tropici strain R2, Rhizobium cellulosilyticum strain R3, Rhizobium taibaishanense strain R4 and Ensifer meliloti strain R5 were found to possess the entire PGP traits tested. Specifically, these rhizobial strains were able to solubilize phosphate, produce exopolysaccharide (EPS), 1-aminocyclopropane-1-carboxylate (ACC), siderophore and indole-acetic-acid (IAA). These strains also survived and grew at a temperature of 45 °C and in an acidic condition with a pH 4. Consequently, all the Rhizobium strains enhanced the germination of soybean seeds (PAN 1532 R) under
https://bmcmicrobiol.biomedcentral.com/articles/10.1186/s12866-019-1536-1
Longan Professional Soybean Oil Processing Plant
Soybean Oil Production LineSoyoil Solvent Extracting Plant Professional Soybean Oil Manufacturing Process oilmillplant Oil Mill Plant Manufacture with Soybean YouTube Professional Process of Soybean Oil Production Oil mill Professional Soybean Oil Extraction Process oilmillplant High Quality Factory Price Professional Soybean Oil 12 Best Cooking oil refining machine images in 2019 56 Best Palm oil processing machine images Palm fruit oil Soybean Processing Crown Iron Works Successfully Installed Soybean Oil Processing Plant in Nigeria Cooking oil Manufacturers Suppliers, China cooking oil How to set up a soybean oil making factory in the United States Watersaving technologies AOCS ALSO INSIDE: 3MCPD in modified oils Biobased AOCS A Prophecy Misread That Could Have Been: Regulatory MANUFACTURING Staley Museum
https://www.tireoilmachine.com/article/Longan-Professional-Soybean-Oil-Processing-Plant-2399076.html
Fungicide Efficacy for Control of Soybean Seedling Diseases
This publication contains information about how well fungicide seed treatments control soybean seedling diseases in the United States. Information was developed by members of the North Central Regional Committee on Soybean Diseases (NCERA-137). This publication was created by the Crop Protection Network, which includes authors from Land Grant universities across the North Central Region and Ontario. CSI ...
https://store.extension.iastate.edu/Product/15437
Marker Development for Marker Assisted Breeding of Resistance to Phytophthora sojae in SoybeanMarker Development for Marker Assisted Breeding of Resistance to Phytophthora sojae in Soybean
One of the most destructive diseases of soybean is Phytophthora root and stem rot, caused by the oomycete pathogen Phytophthora sojae, which thrives in wet conditions and poorly drained soils. This disease can cause major damage to soybean yields resulting in economic losses. P. sojae has been successfully controlled by genetic resistance in soybean cultivars. Breeding for this resistance is critical to Ohio agriculture and business because of soybeans importance as an export, animal feed, and industrial product. Current methods for breeding for resistance to P. sojae involve time-consuming disease assays requiring a relatively large number of seed. Alternatively, molecular markers can be efficiently applied to an earlier generation of a single plant from large numbers of breeding lines. In addition, molecular markers can be used for the combination of multiple resistance genes that will provide a full spectrum of resistance against virulent P. sojae strains. Designing these markers begin with ...
https://kb.osu.edu/dspace/handle/1811/51957
Leci Impex - sunrise soya lecithin Manufacturer from Indore IndiaLeci Impex - sunrise soya lecithin Manufacturer from Indore India
Send Inquiry to Leci Impex - We are leading Manufacturer of sunrise soya lecithin, soya lecithin ink grade, industrial grade lecithin, sunrise soya lecithin oil, Soya Lecithin Feed Grade from Indore Madhya Pradesh India.
http://www.indianyellowpages.com/leci-impex/
CN202340740U - Automatic soybean milk boiling device - Google Patents
An automatic soybean milk boiling device comprises an electric heating bottle and a filtering screen structure. The electric heating bottle is provided with a bottle body capable of containing a quantitative amount of water. A heating controller is arranged on the bottle body. The filtering screen structure is provided with a filtering screen drum, a quantitative amount of smashed soybean can be loaded in the filtering screen drum, and the filtering screen structure is arranged in the bottle body. When a soybean milk boiling function is operated, a heating mode preset for the crashed soybean and water in the bottle body can be conducted through the heating controller. The heating mode is mainly used for controlling temperature and time for heating the smashed soybean and water so as to remove trypsin of the soybean milk and avoid phenomena that soybean milk foam overflows or the soybean milk is overheated to be burned and the soybean milk has burnt flavor.
https://patents.google.com/patent/CN202340740U/en
Industrial Soya Lecithin Manufacturers, Suppliers & Exporters in IndiaIndustrial Soya Lecithin Manufacturers, Suppliers & Exporters in India
Search Indian Industrial Soya Lecithin Manufacturers and Suppliers Details - Contact to Industrial Soya Lecithin Exporters in India, Industrial Soya Lecithin Wholesalers, Industrial Soya Lecithin Distributors and Traders from India.
http://www.indianyellowpages.com/india/manufacturers/i/industrial-soya-lecithin.htm
Publication : USDA ARSPublication : USDA ARS
Citation: Qi, M., Link, T.I., Muller, M., Hirschburger, D., Pedley, K.F., Braun, E., Voegele, R.T., Baum, T., Whitham, S.A. 2016. A small cysteine-rich protein from the Asian soybean rust fungus, Phakopsora pachyrhizi, suppresses plant immunity. PLoS Pathogens. 12(9): e1005827. doi:10.1371/journal.ppat.1005827. Interpretive Summary: The Asian soybean rust fungus, Phakopsora pachyrhizi, is an obligate pathogen capable of causing explosive disease epidemics that drastically reduce the yield of soybean. Currently, the mechanisms by which P. pachyrhizi and other related fungi cause disease are poorly understood. The genome sequences and other data obtained from these fungi indicate that a variety of small proteins play essential roles that enable them to cause disease. These proteins, called effectors, are released by the pathogen and interfere with a plants ability to fight the disease. Here, we identify an effector protein produced by P. pachyrhizi and demonstrate that it is capable of ...
https://www.ars.usda.gov/research/publications/publication/?seqNo115=318641
Think genetically modified soybean oil is healthy? Scientists have bad news for youThink genetically modified soybean oil is healthy? Scientists have bad news for you
Cooking oils and their health properties have long since been a topic of debate for scientists all over the world. With numerous varieties of oils in the markets, it doesnt come as a surprise that the diet conscious get confused and argue about which oil is healthier. Soybean oil and genetically modified (GM) soybean oil are two such products whose health properties are highly debated, with the latter often getting the upper hand. However, a study has now busted the myth that GM soybean oil is healthier than normal soybean oil, warning that its harmful to liver function. According to University Of California Riverside researchers, while soybean oil induces less obesity and insulin resistance than soybean oil, but its effects on diabetes and fatty liver are similar to those of soybean oil. The team tested Plenish®, a genetically-modified (GM) soybean oil released by DuPont in 2014. Plenish is engineered to have low linoleic acid, resulting in an oil similar in composition to olive oil, the
http://www.journeyline.in/newsdet.aspx?q=139748
best price profession soybean oil press machine ethiopia small | Soybean Oil Extraction Machine | China Manufacturer
ethiopia machines for soybean oil extraction | edible oilethiopia best buy soybean oil closed loop extractor. High quality soybean oil processing machine, soybean oil. Soybean oil press machine in soybean oil processing plant. Soybean oil solvent extraction plant: Solvent extraction is to use N-hexane to extract the oil from the processed oil seeds or cakes.Good […]
http://cyberads.in/reliable/best-price-profession-soybean-oil-press-machine-ethiopia-small.html
Manufacturer, supplier of Complete set of soybean oil making machine, factory price for sale, low investment cost Soybean oil...Manufacturer, supplier of Complete set of soybean oil making machine, factory price for sale, low investment cost Soybean oil...
Complete set of soybean oil making machine for sale, Soybean oil making machine is the main machine to produce soybean oil.The full set of soybean oil making machine mainly includes: soybean oil pretreatment machine, soybean oil extraction machine and soybean oil refinery plant.
https://www.edibleoilextractionmachine.com/seed_oil_extractor/soybean_oil_extraction_machine/soybean_oil_making_machine_64.html
Agronomy Journal Abstract - Effect of the Hydrogenase System in Rhizobium japonicum on the Nitrogen Fixation and Growth of...Agronomy Journal Abstract - Effect of the Hydrogenase System in Rhizobium japonicum on the Nitrogen Fixation and Growth of...
The process of N fixation is energy consuming and inefficient. In most cases 20 to 40% of the energy that is supplied to nitrogenase for the reduction of N2 is utilized for the reduction of protons to H2. Some strains of R. japonicum contain a membrane-bound hydrogenase that is capable of oxidizing all of the H2 that is produced during N2 fixation. This study was conducted to evaluate the effects of inoculation of soybeans [Glycine max (L.) Merr.] with Rhizobium japonicum containing H2 recycling capability on N fixation efficiency and soybean yield at various physiological stages of growth.. In these experiments, a H2-oxidizing strain SR (Hup+) and SR3 (Hup−), a mutant derived from SR which is unable to oxidize H2, were utilized. Soybeans cv. Wilkin were grown under bacteriological conditions utilizing a drip-irrigated nutriculture system. Nodules from plants inoculated with SR evolved no measurable amount of H2, while nodules from plants innoculated with SR3 evolved between 2.7 and 10 ...
https://dl.sciencesocieties.org/publications/aj/abstracts/72/3/AJ0720030555
HM09-W150; Glycine max; Soybean | Corporate Engagement Office, The Ohio State UniversityHM09-W150; Glycine max; Soybean | Corporate Engagement Office, The Ohio State University
HM09-W150 is a type of Soybean (Glycine Max), released by The Ohio State University in late April of 2015. It has a relative maturity of 3.0.
https://ceo.osu.edu/technologies/hm09-w150-glycine-max-soybean
South Carolina SoybeansSouth Carolina Soybeans
The South Carolina Soybean Board (SCSB) collects checkoff dollars when soybean farmers sell their soybeans. Each farmer contributes to the soy checkoff one-half of 1 percent of the price of each bushel at the first point of sale. These funds are used for research, promotional and educational interests as they pertain to soybeans and the soybean industry. The volunteer directors decide how to invest the funds of the soybean checkoff. Half of the soybean checkoff funds are kept in the state where they originated and the other half goes to the United Soybean Board (USB) to invest in projects at the national level.. The SCSB is dedicated to using the checkoff dollars we receive from you each year to keep your operation growing forward. As we move into each year, we conduct in-depth research on the latest cutting-edge technology that can be used to benefit you, the farmer. Checkoff programs allow us to further strengthen the industry in which we work. Year after year, your checkoff dollars are ...
https://scsoybeans.org/checkoff-at-work/
Nebraska Soybeans: Is Nitrogen Limiting High Yields? - AgFaxNebraska Soybeans: Is Nitrogen Limiting High Yields? - AgFax
Soybean response to N is, however, more likely to occur in high-yielding environments (, 80 bu/ac) and in certain conditions such as soil pH , 5.5, organic matter , 1.5 %, or poor nodulation.. When it comes to applications of compost, manure and other specialty products (micronutrients, foliar products, etc.), more research is needed to identify specific environmental conditions and soybean varieties where those applications might be warranted.. Soil pH was found to be the main factor influencing soybean yield and grain protein content. Significant decline in soybean yield and grain protein was observed at pH , 7.5., which is outside the optimal soil pH range (5.5-7.0) for soybean nutrient uptake and biological N-fixation.. Recent advances in on-the-go field mapping for various soil properties and areal/satellite imagery can help farmers identify areas of the field with high soil pH and treat them as site-specific zones.. Improving soybean management when soil is calcareous with pH , 7.5, ...
https://agfax.com/2021/05/03/nebraska-soybeans-is-nitrogen-limiting-high-yields/
Guidance for insecticide rotations for pyrethroid-resistant soybean aphidGuidance for insecticide rotations for pyrethroid-resistant soybean aphid
As folks consider spraying fields for soybean aphid, we want to remind everyone that soybean aphid has developed resistance to pyrethroid (Group 3A) insecticides. Currently, any populations of soybean aphid in Minnesota should be considered potentially resistant to pyrethroids. Insecticide rotations are an important part of insecticide resistance management and may help reduce the chances of further development of insecticide resistance in soybean aphid. If a field needs to be sprayed more than once, it is important to rotate to a different insecticide group for the follow-up spray. On a new webpage, we provide some guidance for insecticide rotations for pyrethroid-resistant soybean aphid ...
https://blog-crop-news.extension.umn.edu/2019/08/guidance-for-insecticide-rotations-for.html
Soybean Aphid Update
Since the most recent issue (No. 17, July 18, 2003) of the Bulletin was printed and mailed, there has been considerable telephone and e-mail traffic regarding soybean aphids in northern Illinois. We have received numerous reports regarding insecticide applications to control the aphids in soybean fields. Although some fields still do not have densities of aphids large enough to warrant control, the densities in a fairly large number of fields have exceeded economic thresholds. In addition, some people are finding very few natural enemies in some fields, so aphid population densities have increased rapidly.. Drs. David Voegtlin (Illinois Natural History Survey) and David Onstad (Department of Natural Resources and Environmental Sciences) recently visited several soybean fields in Kendall County. They have studying soybean aphid populations there since 2001. In fact, one of the first fields of soybeans Dave Voegtlin visited in 2000 was in Kendall County. They have provided an overview of the ...
http://bulletin.ipm.illinois.edu/pastpest/articles/200317i.html
LegumeLegume
Due to the years of research done by Henry Ford, the domestic soybean oil industry was born.[10] Between 1970 and 1976, soybean ... Soybean in tropical and subtropical cropping systems : proceedings of a symposium Tsukuba, Japan, 26 September - 1 October 1983 ... Shanmugasundaram, S (1991). Vegetable soybean : research needs for production and quality improvement ; proceedings of a ... Well-known legumes include beans, soybeans, chickpeas, peanuts, lentils, lupins, mesquite, carob, tamarind, alfalfa, and clover ...
https://en.wikipedia.org/wiki/Pulse_
Direct and Counter-Cyclical ProgramDirect and Counter-Cyclical Program
... soybeans; upland cotton; and wheat. The 2002 Farm Bill replaced production flexibility contract (PFC) payments (which were ...
https://en.wikipedia.org/wiki/Direct_and_Counter-Cyclical_Program
Samuel BowenSamuel Bowen
"Soybeans planted first in Georgia". The Rockmart Journal. Georgia. 31 August 1994. p. 13. Retrieved 25 April 2014. Morse, ... Hymowitz, T.; Harlan, J. R. (1983). "Introduction of soybean to North America by Samuel Bowen in 1765". Economic Botany. 37 (4 ... Chaplin 1996, p. 146-7. Omahen, Sharon (30 August 2006). "Soybeans". New Georgia Encyclopedia. University of Georgia. Retrieved ...
https://en.wikipedia.org/wiki/Samuel_Bowen
Marketing contractMarketing contract
... soybeans, 9.4%; corn, 8%. Production contract This article incorporates public domain material from Jasper Womach. Report for ...
https://en.wikipedia.org/wiki/Marketing_contract
Samay BajiSamay Baji
"Black Soybeans". health.com. Retrieved 21 April 2013. "7 Health Benefits of Mustard Oil". healthdiaries.com. 2 August 2012. ... black soybeans (Bhatamaas), spicy potato salad (Aalu-Wala), finely cut ginger (known as "Palu"), boiled beans mixed with spices ...
https://en.wikipedia.org/wiki/Samay_Baji
CarneirinhoCarneirinho
soybeans: 100 ha. In the health sector there were 08 health clinics and no hospitals. In the educational sector there were 09 ...
https://en.wikipedia.org/wiki/Carneirinho
Santa Rosa de GoiásSanta Rosa de Goiás
... and soybeans. Number of Farms: 253 Total area: 16,757 ha. Area of permanent crops: 12 ha. Area of perennial crops: 2,693 ha. ...
https://en.wikipedia.org/wiki/Santa_Rosa_de_Goiás
FrutalFrutal
soybeans: 27,000 ha. sorghum: 5,000 ha. In the health sector there were 04 hospitals with 133 beds and 10 public health clinics ...
https://en.wikipedia.org/wiki/Frutal
Ouro Verde de GoiásOuro Verde de Goiás
... soybeans, and tomatoes. Production was very modest due to the limited area of the municipality. Farm data in 2006 Number of ...
https://en.wikipedia.org/wiki/Ouro_Verde_de_Goiás
CyhalothrinCyhalothrin
... legumes including soybeans; lettuce; onion; peanuts; fruit including apples and pears; sugarcane; sunflower, and tobacco. The ...
https://en.wikipedia.org/wiki/Cyhalothrin
NanuqueNanuque
... soybeans, and corn. There was an alcohol distilling plant using the sugarcane produced locally. The cattle industry was very ...
https://en.wikipedia.org/wiki/Nanuque
PatrocínioPatrocínio
Soybeans: 10,000 ha. Beans: 1,550 ha. Sorghum: 760 ha. Potatoes: 350 ha. Tomatoes: 276 ha. Manioc: 150 ha. Rice: 100 ha. ... Traditionally this region was used for cattle raising, but in recent years the growing of soybeans has made encroachments ...
https://en.wikipedia.org/wiki/Patrocínio
AraguariAraguari
Soybeans: 17,500 ha. Tomatoes: 423 ha. Wheat: 156 ha. Number of cattle: 79,643 head raised by 1,232 producers Number of poultry ... soybeans, corn (maize), citrus fruits, tomatoes, beans, and manioc are also cultivated. In recent years the region has become ... the last feww years Araguari has been changing rapidly and receiving many important investments as Selecta which produces soy ...
https://en.wikipedia.org/wiki/Araguari
DTN (company)DTN (company)
LaPlante, Alice (18 July 1994). "Soybeans by Satellite". Computerworld. p. 85. Retrieved 2018-04-23. Currently, DTN services ... more for analyses of issues like Asian soybean rust and avian influenza; and energy customers gained access to online exchanges ...
https://en.wikipedia.org/wiki/DTN_(company)
Patos de MinasPatos de Minas
Soybeans: 4,500 ha. Tomatoes: 446 ha. Farm data in 2006 Number of farms: 3,135 Agricultural area: 232,334 ha. Planted area: ...
https://en.wikipedia.org/wiki/Patos_de_Minas
Porto NacionalPorto Nacional
Soybeans: 13,000 ha. Rice: 2,000 ha. Mamona: 680 ha. Corn: 2,083 ha. Sorghum: 8,000 ha. Plantations of coconut, mango, and ... The main economic activities are cattle raising and the growing of crops like soybeans, pineapple, rice, mamona, corn, and ...
https://en.wikipedia.org/wiki/Porto_Nacional
ItumbiaraItumbiara
... is a large producer of corn, soybeans and cotton. The cattle herd is substantial, with almost one hundred and fifty ... Soybeans: 36,500 ha. Sorghum: 5,300 Agribusiness Major agro-industrial industries are: Alca Foods (cereals) Braspelco (leather ... Itumbiara is one of the most prosperous cities in Goiás and is a major producer of soybeans, corn, cattle, and milk. Itumbiara ...
https://en.wikipedia.org/wiki/Itumbiara
Rapeseed oilRapeseed oil
... after soybean oil and palm oil. The oil has many non-food uses and, like soybean oil, is often used interchangeably with non- ... "Soybean oil, salad or cooking, fat composition, 100 g". US National Nutrient Database, Release 28, United States Department of ... It covers a large percentage of that shortage with soybean imports from Brazil, the U.S. and Argentina." There are several ... "Soybean oil, salad or cooking, (partially hydrogenated), fat composition, 100 g". US National Nutrient Database, Release 28, ...
https://en.wikipedia.org/wiki/Rapeseed_oil
Comendador GomesComendador Gomes
soybeans: 700 ha. sorghum: 280 ha. In the health sector there were 02 health clinics and no hospitals. In the educational ...
https://en.wikipedia.org/wiki/Comendador_Gomes
IpiaçuIpiaçu
The crops with a planted area of more than 100 hectares were rice, sugarcane (6,379 ha.), soybeans (4,123 ha.), sorghum (803 ha ...
https://en.wikipedia.org/wiki/Ipiaçu
Campina VerdeCampina Verde
soybeans: 2,500 ha. In the health sector there were 09 health clinics and 01 hospital with 29 beds. In the educational sector ...
https://en.wikipedia.org/wiki/Campina_Verde
UberabaUberaba
Soybeans: 100,000 ha. Sorghum: 1,250 Tomatoes: 240 ha. Wheat: 336 ha. Number of farms: 1,093 Agricultural area: 282,692 ha. ... The top agricultural products are corn, soybean, coffee, cotton, and sugarcane. The city also holds the ''Expozebu'', one of ...
https://en.wikipedia.org/wiki/Uberaba
Várzea da PalmaVárzea da Palma
The main perennial crops were rice, sugarcane, beans, manioc, corn (2,400 ha.), soybeans, and tomatoes. In the health sector ...
https://en.wikipedia.org/wiki/Várzea_da_Palma
Cachoeira DouradaCachoeira Dourada
Soybeans: 4,700 ha. Cotton: 680 ha. (Sepin) Farms: 157 Total area: 31,630 ha. Area of permanent crops: 132 ha. Area of ... Cotton, corn, and soybeans are the most important crops. Retail establishments: 100 in 2007 Industrial establishments: 09 ...
https://en.wikipedia.org/wiki/Cachoeira_Dourada
CaçuCaçu
Soybeans: 700 ha. Infant mortality rate in 2000: 16.89 Hospitals (2007): 01 with 29 beds Literacy rate in 2000: 86.8 Schools: ... The economy is based on cattle raising and soybean growing. The region had 211,000 head of cattle including 15,900 milking cows ...
https://en.wikipedia.org/wiki/Caçu
BuritisBuritis
Soybeans: 55,000 ha. Sorghum: 2,000 ha. Farm data for 2006 Number of farms: 1,342 Area of the farms: 305,085 Planted area: ... Buritis is a large producer of soybeans, beans, and corn. There were some small transformation industries (41 in 2005) and ...
https://en.wikipedia.org/wiki/Buritis
Formoso, Minas GeraisFormoso, Minas Gerais
Soybeans: 18,900 ha. Farm data for 2006 Number of farms: 598 Agricultural area: 106,302 ha. Planted area: 16,600 ha. Area of ... and soybeans. In 2005 there were 5 small transformation industries and 74 commercial retail establishments. Public ...
https://en.wikipedia.org/wiki/Formoso,_Minas_Gerais
Buriti AlegreBuriti Alegre
Soybeans: 2,500 ha. Tomatoes: 46 ha. (Seplan and IBGE) Farm data 2006 Farms: 366 Total area: 130,347 ha. Area of permanent ... soybeans, oranges, and bananas. In the 1950s Buriti had one of the largest herds of zebu cattle in the country, but today the ...
https://en.wikipedia.org/wiki/Buriti_Alegre
JoviâniaJoviânia
Soybeans: 21,600 ha. Modest production of wheat and beans There were 1,324 students in primary schools and 246 students in ...
https://en.wikipedia.org/wiki/Joviânia
InaciolândiaInaciolândia
Soybeans: 11,300 ha. Agricultural establishments: 421 Total agricultural area: 62,157 ha. Area of perennial crops: 1,923 ha. ... Inaciolândia is a large producer of cotton and soybeans. Inaciolândia is located in the Meia Ponte Microregion in the extreme ...
https://en.wikipedia.org/wiki/Inaciolândia
Soybeans Prices | Successful FarmingSoybeans Prices | Successful Farming
Soybeans prices (ZS), including contracts quotes and price charts from the CBOT. Soybeans futures prices and soybeans options ... Soybeans Cash (CBOT) Date. Open. High. Low. Last. Change. Percent. 02/06. 1502.000. 1502.000. 1502.000. 1502.000s. -11.000. - ... Soybeans end day down 18¢ , Wednesday, February 1, 2023. 2/1/2023 2:33 pm ...
https://www.agriculture.com/markets/commodity-prices/CBOT/ZS/ZSY00?symbol=ZSY00&barType=CANDLE&time=1m&width=600&height=500&volume=1&startDate=1654664400&endDate=1670522399&ondemandkey=3f53108728c4e130ff2527e34063ea21&grid=0&shortTitle=0¬itle=0&type=CANDLE
Search | Soybean Research Laboratory
Survey of soybean insect pollinators: community identification and sampling method analysis. Investigators: Dr. Matthew E. ... The Soybean Entomology Lab is a diverse group of field entomologists, and combines research and extension programs from Drs. ... Soybean Research Laboratory. 2001 Advanced Teaching and Research Building (ATRB). Iowa State University. 2313 Pammel Drive. ...
https://www.ent.iastate.edu/soybeanresearch/search/content?f%5B0%5D=im_field_tags%3A14&f%5B1%5D=im_field_tags%3A197&f%5B2%5D=im_field_category%3A194&f%5B3%5D=im_field_tags%3A24&retain-filters=1
Public Resources - United Soybean BoardPublic Resources - United Soybean Board
While the United Soybean Board strives to make the information on this website as timely and accurate as possible, USB makes no ... 2023 United Soybean Board 16305 Swingley Ridge Rd. Suite 150, Chesterfield, MO, 63017 ... except those actions which are specifically provided for in the Soybean Act and Order. ... recommendation or favoring by the United Soybean Board and its directors. ...
https://www.unitedsoybean.org/usb-carbon-toolbox/public-resources/
Breaking News English | Spaces | SoybeansBreaking News English | Spaces | Soybeans
A FREE text reconstruction activity on Soybeans. Comes with more reading, activities, quizzes and a listening. ... Back to the soybeans lesson.. MY e-BOOK. See a sample. This useful resource has hundreds of ideas, activity templates, ...
https://breakingnewsenglish.com/2002/200205-soybeans-separate-0.html
Iowa corn & soybean 8-4-21Iowa corn & soybean 8-4-21
CORN: (basis vs. September futures, 7/28/21)
https://www.iowafarmbureau.com/Article/Iowa-corn-soybean-8421
Signature Events<...Signature Events<...
See the upcoming signature events and webinars the Illinois Soybean Association hosts, funds and takes part in. ... The Illinois Soybean Association (ISA) represents more than 43,000 soybean farmers in Illinois through the state soybean ... Membership and advocacy efforts support Illinois soybean farmer interests in local areas, Springfield and Washington, D.C. ISA ... The checkoff funds market development, soybean production and profitability research, promotion, issues management and analysis ...
https://www.ilsoy.org/newsroom/signature-events/
soybeans | Soybean Research Laboratory
Soybean aphids were first sighted, so too were thistle caterpillars, and Japanese beetles. We are obligated to encourage you to ... Soybean Research Laboratory. 2001 Advanced Teaching and Research Building (ATRB). Iowa State University. 2313 Pammel Drive. ... After summarizing 5 different pests (soybean aphids, Japanese beetles, Thistle caterpillars, gall midge, Armyworms), Matt ...
https://www.ent.iastate.edu/soybeanresearch/tags/soybeans
Topsy-Turvy SoybeansTopsy-Turvy Soybeans
4 soybeans for each student or team of students. (Soybean seeds can be obtained from some local stores in their gardening and ... 4 soybeans for each student or team of students. (Soybean seeds can be obtained from some local stores in their gardening and ... Evenly place four soybeans on the paper towel. Orient the soybeans in at least two different directions (note the direction of ... The soybean or bean is a species of legume native to East Asia, widely grown for its edible bean which has numerous uses. ...
https://agclassroom.org/matrix/lesson/97/
Soybeans Prices | Successful FarmingSoybeans Prices | Successful Farming
Soybeans prices (ZS), including contracts quotes and price charts from the CBOT. Soybeans futures prices and soybeans options ... Soybeans August 2022 (CBOT) Date. Open. High. Low. Last. Change. Percent. 08/12. 1682.500. 1696.000. 1669.250. 1669.250s. - ... Corn and wheat low, soybeans jump at close , Monday, November 21, 2022. 11/21/2022 9:10 am ... Soybeans end day up 10¢ , Friday, November 18, 2022. 11/18/2022 1:47 pm ...
https://www.agriculture.com/markets/commodity-prices/CBOT/ZS/ZSQ22?symbol=ZSQ22&barType=BAR&time=Intraday&width=600&height=500&volume=1&startDate=1644645600&endDate=1660323599&ondemandkey=3f53108728c4e130ff2527e34063ea21&grid=1&shortTitle=0¬itle=0&period=I%3A60&type=LINE
USDA APHIS | Soybean Aphid Environmental Assessments
Field Release of Aphelinus glycinis (Hymenoptera: Aphelinidae) for Biological Control of the Soybean Aphid, Aphis glycines ( ... Field Release of Aphelinus rhamni (Hymenoptera: Aphelinidae) for Biological Control of the Soybean Aphid, Aphis glycines ( ...
https://www.aphis.usda.gov/aphis/ourfocus/planthealth/plant-pest-and-disease-programs/ea/CT_Soybean_aphid/
Search | Soybean Research Laboratory
Soybean - Applications and TechnologySoybean - Applications and Technology
... This is a free, online textbook offered by Intech Open. "Soybean is an agricultural crop ... "Soybean is an agricultural crop of tremendous economic importance. Soybean and food items derived from it form dietary ... Soybean and food items derived from it form dietary components of numerous people, especially those living in the Orient. The ... You just viewed Soybean - Applications and Technology. Please take a moment to rate this material. ...
https://www.merlot.org/merlot/viewMaterial.htm?id=557414
China to exempt U.S. pork, soybeans from additional tariffs: Xinhua | ReutersChina to exempt U.S. pork, soybeans from additional tariffs: Xinhua | Reuters
... including pork and soybeans, Chinas official Xinhua News Agency said Friday, in the latest sign of easing Sino-U.S. tensions ... U.S. farm groups cheered the goodwill gesture by the worlds largest pork consumer and top soybean buyer - though they hoped ... China is also expected to step up purchases of soybeans, historically the most valuable U.S. farm export, which China has ... The U.S. Department of Agriculture on Friday said private exporters had sold 204,000 tonnes of U.S. soybeans to China, ...
https://www.reuters.com/article/us-usa-trade-china-tariffs/china-to-exempt-u-s-pork-soybeans-from-additional-tariffs-xinhua-idUSKCN1VY0TX
Grain futures regain strength on bargain buying; Soybeans, corn rise | NasdaqGrain futures regain strength on bargain buying; Soybeans, corn rise | Nasdaq
... with soybean and corn prices bouncing off multi-month lows as investors returned to. ... China accounts for roughly 60% of world soybean imports and its purchases have a big impact on prices. Soybeans are used as a ... Corn prices, like soybeans, entered a bear market slump earlier in the month. Prices of the grain are down almost 24% since ... Investing.com - U.S. grain futures regained strength on Monday, with soybean and corn prices bouncing off multi-month lows as ...
https://www.nasdaq.com/articles/grain-futures-regain-strength-bargain-buying-soybeans-corn-rise-2013-04-08
soybeans - HoweStreetsoybeans - HoweStreet
The Source for Market Opinions
https://www.howestreet.com/tag/soybeans/
Soybeans Hit Main Street | The Scientist Magazine®Soybeans Hit Main Street | The Scientist Magazine®
From supermarkets to health food boutiques, diet-conscious Americans are buying soybeans, not just as tofu but in infant ... Soybeans Hit Main Street. Once a favorite of Chinese emperors, tofu is now big time. From supermarkets to health food boutiques ... From supermarkets to health food boutiques, diet-conscious Americans are buying soybeans, not just as tofu but in infant ... diet-conscious Americans are buying soybeans, not just as tofu but in infant formula, soy milk, and soy burgers. Soy even has ...
https://www.the-scientist.com/news/soybeans-hit-main-street-56107
Soybean Futures Rally | FuturesSoybean Futures Rally | Futures
Soybeans futures closed at the highs of the week, unlike corn and wheat, as its certainly pricing in a much smaller 2020 crop ... Soybean futures Soybeans futures closed at the highs of the week, unlike corn and wheat, as its certainly pricing in a much ... Soybeans could be at a high at this time, but support will be significant on setbacks into the 920-940 range with the Chinese ... This means the crop isnt a disaster from August heat like it was in 2012 and 2003.This means the soybean crop is likely to ...
http://www.futuresmag.com/2020/09/08/soybean-futures-rally
PDF) Farmers Guide to Soybean Production in Northern NigeriaPDF) Farmers' Guide to Soybean Production in Northern Nigeria
Soybean is among the major industrial and food crops grown in every continent. The crop can be successfully grown in many ... Soybean is considered as one of the major industrial and food crops grown in every continent. The market for soybean in Nigeria ... increased demand for soybean meal in Nigeria. It is believed that soybean production will increase as more farmers become aware ... soybean production. This handbook outlines crop production practices that farmers may use to grow soybean protably in Nigeria. ...
https://www.researchgate.net/publication/262451217_Farmers
Soybeans | Farms.comSoybeans | Farms.com
Soybean Futures Prices Rally. (May 28, 2014) Soybeans. » Soybeans Can Overcome Thin Stands To Yield Well. (May 28, 2014) ... Corn & Soybean Futures Prices Down on Weather. (Jun 03, 2014) Soybeans. » Corn, Soybean Planting Nearly Done; Winter Wheat ... Three Soybean-Management Methods That Hold Water. (Jun 03, 2014) Soybeans. » Early Season Soybean Damage- Frost, PPO, Or ... China Stocks Up On U.S. Soybeans.. (May 23, 2014) Soybeans. » Second Day of Gains for Soybean Futures Prices. (May 22, 2014) ...
https://www.farms.com/farmspages/enews/shownews/tabid/124/default.aspx?catid=29&numrow=114&country=9&general=0&international=-1&commentary=0&pg=114&strtitle=soybeans
Bean Leaf Beetle Management in Soybeans | Pioneer SeedsBean Leaf Beetle Management in Soybeans | Pioneer Seeds
Bean leaf beetle is a fairly common soybean insect found in many areas where soybeans are grown in the U.S. Adults can also ... Bean Leaf Beetle Feeding on Soybeans. Bean leaf beetles possess chewing mouth parts and feed on soybean plants at all stages of ... When soybeans emerge, these overwintered beetles may move to soybean fields to feed and lay eggs. Females lay 130-200 eggs and ... Bean leaf beetle is a pest of soybean in most soybean growing regions of the United States. There may be 3 generations in the ...
https://www.pioneer.com/us/agronomy/bean-leaf-beetle-soybeans.html
Farmers plant soybeans amid uncertainty over tariffs - MarketplaceFarmers plant soybeans amid uncertainty over tariffs - Marketplace
... the Chinese government threatened to target soybeans, an important ... As farmers got ready to plant their fields, they didnt have much choice but to stick to planting soybeans and hope for the ... Farmers plant soybeans amid uncertainty over tariffs Jahd Khalil May 2, 2018 ... Farmers plant soybeans amid uncertainty over tariffs Jahd Khalil May 2, 2018 ...
https://www.marketplace.org/2018/05/02/farmers-plant-soybeans-amid-uncertainty-over-tariffs/
soybean oil Archives - The Globalistsoybean oil Archives - The Globalist
How the world hangs together. What countries, societies and economies can learn from each other. ...
https://www.theglobalist.com/tag/soybean-oil/
Corn, soybeans in home stretch | Feedstuffs
For soybeans, the difference between the average trade guess and the USDA August forecast exceeded 50 million bu. in 11 of the ... For soybeans, the yield difference exceeded 1.5 bu. in nine of the 20 years and exceeded 3 bu. in five years. ... "For soybeans, it appears that exports during the current marketing year may exceed the current (U.S. Department of Agriculture ... The final month of the 2015-16 corn and soybean marketing years is underway, with use during the next four weeks to determine ...
https://www.feedstuffs.com/story-corn-soybeans-home-stretch-45-144764
Understanding 120-bushel soybeans | Farm ProgressUnderstanding 120-bushel soybeans | Farm Progress
Soil conditions, soybean cultivars, and weather are all important factors in achieving record soybean yields. But an Iowa State ... If more nitrogen is available to the soybean plant, it doesnt have to expend energy fixing it and perhaps this energy can be ... "But we cant make that happen, so we need to find other ways to help soybeans intercept more sunlight and become more efficient ... "There isnt any evidence that root growth limits soybean yields. What we need to shoot for is more light interception and ...
https://www.farmprogress.com/soybean/understanding-120-bushel-soybeans
US corn and soybean production down from SeptemberUS corn and soybean production down from September
... WASHINGTON, Oct. 12, 2022 - Corn and soybean production is down from ... 1, soybean yields are expected to average 49.8 bushels per acre, down 0.7 bushel from the previous forecast and down 1.9 ... 1. The objective yield surveys for corn, cotton, and soybeans were conducted in the major producing states that usually account ... soybean growers are expected to decrease their production 3% from 2021, forecast at 4.31 billion bushels. ...
https://www.nass.usda.gov/Newsroom/2022/10-12-2022.php
Soybean Burritos Recipe - Easy Recipes at WomansDay.comSoybean Burritos Recipe - Easy Recipes at WomansDay.com
Prepare this healthy Soybean Burrito recipe found at Womans Day Magazine. ...
https://www.womansday.com/food-recipes/food-drinks/recipes/a8784/soybean-burritos-121060/
US Soybean Exports Continue Multi-Year Surge | The Cattle Site US Soybean Exports Continue Multi-Year Surge | The Cattle Site
Soybean checkoff-funded international marketing efforts assist US soybean farmers and the US soy industry in reaching these ... The US exported nearly 320 million bushels of US soybean meal, and exports of US soybean oil totaled nearly 900,000 metric tons ... Mexico imported the most US soybean meal at 56 million bushels and the second-highest amount of US soybeans with 113 million ... India imported the most US soybean oil, totaling 172,600 metric tons. US soybean exports to Japan dropped slightly at 88 ...
https://www.thecattlesite.com/news/29114/us-soybean-exports-continue-multi-year-surge
Xconomy: From Ultracapacitors to Soybeans to Sludge: University Teams Pitch Local VCsXconomy: From Ultracapacitors to Soybeans to Sludge: University Teams Pitch Local VCs
Soybeans are used to make soy oil and other food products, and their hulls, which have a high protein content, are usually used ... Making Ethanol from Soybean Hulls-Without Destroying the Protein. Jonathan Mielenz of Oak Ridge National Laboratory in ... But Mielenz said his group has come up with a simple way to ferment the sugars in soybean hulls without destroying the protein ... One response to "From Ultracapacitors to Soybeans to Sludge: University Teams Pitch Local VCs". ...
https://xconomy.com/boston/2009/04/15/from-ultracapacitors-to-soybeans-to-sludge-university-teams-pitch-local-vcs/?single_page=true
Argentinas Soybeans Help Feed the World But Might Be Making Locals SickArgentina's Soybeans Help Feed the World But Might Be Making Locals Sick
... concerned by a growing list of health problems that some attribute to the ubiquitous use of agrochemicals sprayed on soybean ... Because Argentina is the world's biggest soybean exporter, selling significantly more soybean to foreign markets than ... Tagged:agricultureagrobusinessagrochemicalsargentinaCórdobaEnvironmentglyphosateGMOsmalvinasmonsantoroundupSoySoybeanVICE News ... Monsanto-produced soybean seeds grown in Argentina are modified to be resistant to Roundup, the company's flagship ...
https://www.vice.com/en/article/yw4837/argentinas-soybeans-help-feed-the-world-but-might-be-making-locals-sick
How Trumps Soybean Tariffs Are Affecting Iowas Secretary of Agriculture RaceHow Trump's Soybean Tariffs Are Affecting Iowa's Secretary of Agriculture Race
About 40 percent of Chinas soybean imports come from the U.S. Tariffs could slash U.S. soybean exports to China by about 65 ... In retaliation, China slapped a retaliatory tariff on soybeans. One-third of Iowas soybean crop, valued at $14 billion, ... Soybeans are among hundreds of U.S. products China has singled out for tariffs. The U.S. has an equally long list that includes ... U.S. soybean prices have fallen about 12 percent since March, when the U.S.-China trade dispute began.. Grant Kimberley, ...
https://www.esquire.com/news-politics/politics/a21577227/iowa-trump-china-soybean-tariffs/
GlycineCropCROPSYieldsSeedsFarmers2017State soybean2019Corn and soybeanMetric tonsChina'sAmerican Soybean AssociationTariffsAphidExports of soybeansUnited Soybean BoardResearch on soybeansProducersSoilBillion bushelsMealInclude soybeanAverage soybeanImportsPlant2021BushelsBeanAphidsTariffGlobal soybeanContentGrowersGainsAcresWeedsTonnes2018PlantingArgentinaGenetically modifiedWheatLivestockFarmerCheckoff fundsVarieties availableHerbicideProductionFutures pricesGrainGrownProteinAccessionsUSDAAgricultureMaturityChinaBiomass
Glycine6
  • Soybeans (Glycine max) usually grow to between 1 and 3 feet tall and have dense hair on their leaves and stems. (highmowingseeds.com)
  • Cover crops (CC) in corn ( Zea mays L.) and soybean [ Glycine max (L.) Merr. (unl.edu)
  • Polystyrene micro and nanoplastics attenuated the bioavailability and toxic effects of Perfluorooctane sulfonate (PFOS) on soybean (Glycine max) sprouts. (bvsalud.org)
  • This study investigated the combined effects of polystyrene (PS) MNPs and PFOS on soybean ( Glycine max ) sprouts, which are common hydroponic vegetable . (bvsalud.org)
  • Soybean [Glycine max (L.) Merr. (bvsalud.org)
  • Genome-Wide Association Study of Ureide Concentration in Diverse Maturity Group IV Soybean [Glycine max (L.) Merr. (cdc.gov)
Crop25
  • Expected size of Brazilian soybean crop weighed on the market Wednesday. (agriculture.com)
  • Soybean is an agricultural crop of tremendous economic importance. (merlot.org)
  • Corn is the biggest U.S. crop, followed by soybeans, government figures show. (nasdaq.com)
  • Soybeans futures closed at the highs of the week, unlike corn and wheat, as it's certainly pricing in a much smaller 2020 crop size than what was being advertised weeks ago. (futuresmag.com)
  • This means the crop isn't a disaster from August heat like it was in 2012 and 2003.This means the soybean crop is likely to come up with the national yield at or slightly above trend line. (futuresmag.com)
  • This handbook outlines crop production practices that farmers may use to grow soybean profitably in Nigeria. (researchgate.net)
  • Bean leaf beetles possess chewing mouth parts and feed on soybean plants at all stages of crop development. (pioneer.com)
  • After President Donald Trump threatened tariffs on $50 billion in Chinese goods, the Chinese government threatened to target soybeans, an important American cash crop. (marketplace.org)
  • Soybeans - The New King of the Crop? (theglobalist.com)
  • Of the 2008/2009 soybean crop, the US exported 55 per cent, including 1.24 billion bushels of whole soybeans. (thecattlesite.com)
  • One-third of Iowa's soybean crop, valued at $14 billion, annually goes to China, so this one slammed the state's farming communities in dozens of different ways. (esquire.com)
  • Storey said half of his soybean crop has shown damage from dicamba, an herbicide that has drifted onto unprotected fields and spawned hundreds of complaints from farmers. (businessinsider.com)
  • He thins each to one plant per row foot and suffers little yield loss from either crop: the soybeans are a gift. (fedcoseeds.com)
  • For the first time since the 2011/12 crop year, U.S. soybean exports are projected to decline from prior-year levels. (fb.org)
  • Lower soybean exports come despite a smaller-than-anticipated Argentinian crop, but also coincides with NAFTA renegotiations and concern over potential retaliations based on U.S.-imposed steel, aluminum, washing machine and solar panel import tariffs. (fb.org)
  • The species has been documented from Honduras to Virginia primarily on soybean, cotton, various row crops, fruit, and non-crop hosts. (bioone.org)
  • 2016 crop: Soybean futures may have dropped to a new low of the move, but cash prices in many spots still have not done so. (iowafarmbureau.com)
  • Cover crop productivity and subsequent soybean yield in the western Co" by Katja Koehler-Cole, Roger W. Elmore et al. (unl.edu)
  • A few farmers in the core production area have started to plant their double crop soybeans. (soybeansandcorn.com)
  • While USDA continues to show corn and soybean conditions are impeccable, some farmers say crop conditions reports don't tell. (fjfnews.com)
  • See Charcoal Rot , Crop Protection Network Bulletin CPN-1004 for a complete discussion and diagnostic photos of charcoal rot and other soybean diseases with similar symptoms. (soybeanresearchinfo.com)
  • Soybeans are doing good, but we really need some rain to finish out the crop. (soybeansouth.com)
  • MISSISSIPPI STATE -- Mississippi's soybean growers are not alone in their enthusiasm for planting a large crop this year, and the market knows it. (msstate.edu)
  • Soybean growers are expected to plant more than 2 million acres in soybeans, the largest state soybean crop since 1998. (msstate.edu)
  • With fertilizer costs so incredibly high, producers prefer soybeans, a crop that will not require as much fertilizer. (msstate.edu)
CROPS9
  • Soybean is among the major industrial and food crops grown in every continent. (researchgate.net)
  • USDA's first survey based forecasts of the size of the 2016 U.S. corn and soybean crops will be released Aug. 12. (feedstuffs.com)
  • Iowa State University cropping systems scientist Dr. Sotirios Archontoulis aims his soybean yield research at understanding the complex dynamic interactions between soils, crops, climate and management. (farmprogress.com)
  • Pricing and supply constraints of chemical fertilizers due to the war in Ukraine are pushing for more R&D on microorganisms targeting different crops other than soybeans. (mongabay.com)
  • Brazilian soybean producers have been highly successful in using genome technology to benefit their crops, with huge economic and environmental gains, a new paper highlights. (mongabay.com)
  • Scientists in Brazil have developed a sort of "biological yogurt," as the researcher Rafael de Souza calls it, a biological fertilizer that uses microorganisms instead of chemicals to help soybean crops grow stronger and healthier, in a cheaper and more sustainable way. (mongabay.com)
  • But after 70 years of research on soybeans in the country, scientists discovered a way to use diazotrophic bacteria, microorganisms that convert nitrogen from the atmosphere into ammonia through a process known as "biological nitrogen fixation " and are more efficient than chemicals at helping crops fix the gas. (mongabay.com)
  • Ben Fallen, soybean program leader at Clemson's Pee Dee Research and Education Center in Florence, said the extent of which crops are affected depends on where they are located. (soybeansouth.com)
  • Soybean growers who have obligated themselves to deliver contracted soybeans might not be able to switch to other crops. (msstate.edu)
Yields7
  • In a recent modeling project, he looked at all those factors to try to learn the primary differences that resulted in 107- to 122-bushel soybean yields at Kip Cullers' farm in southwest Missouri compared to more common 45- to 55-bushel yields in ISU fields near Ames, Iowa. (farmprogress.com)
  • Dr. Sotirios Archontoulis knows that soil organic matter, nitrogen (N) cycling, soybean varieties, temperatures, rainfall, fertilization, planting dates/rates and more goes into the equation that determines soybean yields. (farmprogress.com)
  • One bushel of soybeans yields 47.5 pounds of soybean meal and 10.7 pounds of soybean oil. (fb.org)
  • Argentina soybean production is forecast at 47 million tons, down 19 percent from last year due to lower projected yields and dry conditions. (fb.org)
  • A single tillage pass performed in the spring prior to planting did not increase soybean yields in two replicated on-farm trials in 2019. (msu.edu)
  • Helping reduce stress can have a positive impact on soybean yields. (northstargenetics.ca)
  • Both soybean and corn yields were a bit below average, due to the dry weather we had during the summer. (ussoy.org)
Seeds5
  • Monsanto-produced soybean seeds grown in Argentina are modified to be resistant to Roundup, the company's flagship herbicide. (vice.com)
  • China highest seaborne imports from US by volume are oil seeds - including soybeans, mineral fuels, wood, and cereals. (spglobal.com)
  • Soybean is a kind of very common seen oil material, the oil yield is 16-20%, for different places, different seeds, the oil yield is different. (sozailink.com)
  • Also excluded are seeds that are mainly grown for oil extraction ( oilseeds like soybeans and peanuts ), [2] and seeds which are used exclusively for sowing forage ( clovers , alfalfa ). (wikipedia.org)
  • In the United States, the domesticated soybean was introduced in 1770 by Benjamin Franklin after he sent seeds to Philadelphia from France. (wikipedia.org)
Farmers11
  • The Illinois Soybean Association (ISA) represents more than 43,000 soybean farmers in Illinois through the state soybean checkoff and membership efforts. (ilsoy.org)
  • As farmers got ready to plant their fields, they didn't have much choice but to stick to planting soybeans and hope for the best. (marketplace.org)
  • Soybean checkoff-funded international marketing efforts assist US soybean farmers and the US soy industry in reaching these record-breaking exports. (thecattlesite.com)
  • Iowa farmers could lose up to $624 million, depending on how long the tariffs are in place and the speed producers can find new markets for their soybeans, said Chad Hart, an Iowa State University economist. (esquire.com)
  • Grant Kimberley, director of market development at the Iowa Soybean Association, said farmers are holding out hope that trade disputes are resolved before the July deadline - or are short-lived if they go into place. (esquire.com)
  • Farmers are already dealing with low commodity prices and a down farm economy, and the price of soybeans has continued to drop since tariff rhetoric first began," Heisdorffer said. (businessinsider.com)
  • China is not a market that appeared overnight," he said, adding that farmers have worked with the Department of Agriculture for decades to develop foreign markets for soybeans. (businessinsider.com)
  • The summer months are a popular time for American farmers to sell soybeans to China, according to economist Kevin McNew of Farmers Business Network. (businessinsider.com)
  • The South Dakota Soybean Research and Promotion Council invites soybean farmers to apply for this year's See For Yourself tour, June 22-56. (emailmeform.com)
  • Fifteen South Dakota soybean farmers will be selected to participate in the program. (emailmeform.com)
  • He argues that so far the national soybean needs cannot be met by local soybean farmers. (industry.co.id)
20178
  • USDA's March 2018 World Agricultural Supply and Demand Estimates projects soybean exports in 2017/18 at 2.065 billion bushels, down 109 million bushels, or 5 percent, from prior marketing-year levels. (fb.org)
  • Through January of the 2017/18 marketing year, USDA Foreign Agricultural Service data reveals exports of soybeans to China at 867 million bushels, down 19 percent, while exports to Mexico were 63 million bushels, up 8 percent from prior-year levels. (fb.org)
  • Other major soybean-producing countries include Argentina and Brazil, which combined have an exportable surplus, i.e. ending stock level, of 1.9 billion bushels for the 2017/18 marketing year. (fb.org)
  • During the 2017/18 marketing year Argentinian soybean meal exports are projected to decline by 2 percent to 30.8 million metric tons. (fb.org)
  • For the 2017/18 marketing year, Brazil's soybean exports, including soybean meal and soybean oil, are projected at 3.597 billion bushels, up 383 million bushels or 12 percent from the prior year's record. (fb.org)
  • China soybeans imports reached 95 million tonnes in 2017, of which 33 million from US. (spglobal.com)
  • China imported 95 million tonnes of soybeans in 2017. (spglobal.com)
  • The top exporters of soybeans in 2017 were Brazil, Argentina, Uruguay and Canada, with total exports of soybeans to other partners than China of 20 million tonnes: Brazil 14.3 million tonnes, Argentina 1 million, Uruguay 2 million, Canada 2.7 million tonnes. (spglobal.com)
State soybean2
  • If yes, please list the organizations and any leadership positions you hold/have held (E.g. local farm bureau, state soybean organization). (emailmeform.com)
  • Dr. Rachel Vann and the NC State Soybean Extension Program are currently evaluating various combinations and will have a robust dataset to help you with this decision in a few years. (ncsoy.org)
20195
  • Many soybean producers would like to forget the 2019 growing season. (msu.edu)
  • The 2019 growing season was an incredibly challenging year for many soybean producers and one that many would like to forget. (msu.edu)
  • Because we can't say for certain that the continuously wet spring and fall weather that occurred in 2019 will never occur again, I am encouraging soybean producers to take a critical look back and identify any lessons they learned from 2019. (msu.edu)
  • However, there may be some important lessons from 2019 that will serve soybean producers well in the future. (msu.edu)
  • Soybean planted area for 2019 is estimated at 80.0 million acres, down 10 percent from last year. (fjfnews.com)
Corn and soybean2
  • Final month of 2015-16 corn and soybean marketing years is underway. (feedstuffs.com)
  • The final month of the 2015-16 corn and soybean marketing years is underway, with use during the next four weeks to determine the magnitude of year-ending stocks, according to University of Illinois agriculture economist Darrel Good. (feedstuffs.com)
Metric tons6
  • The US exported nearly 320 million bushels of US soybean meal, and exports of US soybean oil totaled nearly 900,000 metric tons. (thecattlesite.com)
  • Mexico imported the most US soybean meal at 56 million bushels and the second-highest amount of US soybeans with 113 million bushels and US soybean oil with 110,600 metric tons. (thecattlesite.com)
  • India imported the most US soybean oil, totaling 172,600 metric tons. (thecattlesite.com)
  • He said China has bought about 2.5 million metric tons of soybeans on forward contracts he expects will be cancelled. (businessinsider.com)
  • Brazil today is the largest soybean producer in the world, with 127 million metric tons of soybeans in 2021-22, ahead of the United States, with 121 million, according to data from the U.S. Department of Agriculture . (mongabay.com)
  • Soybean oil exports are projected to decline 5 percent to 5.12 million metric tons. (fb.org)
China's4
  • SHANGHAI (Reuters) - China will exempt some agricultural products from additional tariffs on U.S. goods, including pork and soybeans, China's official Xinhua News Agency said Friday, in the latest sign of easing Sino-U.S. tensions before a new round of talks aimed at curbing a bruising trade war. (reuters.com)
  • China supports relevant enterprises buying certain amounts of soybeans, pork and other agricultural products from today in accordance with market principles and WTO rules," Xinhua said, adding that the Customs Tariff Commission of China's State Council would exclude additional tariffs on those items. (reuters.com)
  • About 40 percent of China's soybean imports come from the U.S. Tariffs could slash U.S. soybean exports to China by about 65 percent, as other countries' soybeans become a better buy, a Purdue University study said. (esquire.com)
  • Imported soybeans account for 70 percent of China's supplies, according to the China National Grain and Oils Information Center. (china.org.cn)
American Soybean Association2
  • Another one was a man named Ray Gaesser, who once was the head of the American Soybean Association and who works as a consultant on farm and trade issues for the administration. (esquire.com)
  • For John Heisdorffer, president of the American Soybean Association and farmer in Iowa, the tariffs come at a challenging time. (businessinsider.com)
Tariffs5
  • U.S. farm groups cheered the goodwill gesture by the world's largest pork consumer and top soybean buyer - though they hoped for more clarity from China on exactly what tariffs would be lifted. (reuters.com)
  • Correction (May 2, 2018): The original version of this story misstated the tariff that prompted China to threaten tariffs on soybeans. (marketplace.org)
  • Soybeans are among hundreds of U.S. products China has singled out for tariffs. (esquire.com)
  • Soybean prices dropped to a near-decade lows Friday as President Donald Trump showed no signs of backing down on threats to impose $200 billion worth of additional tariffs on China, the world's largest soy importer. (businessinsider.com)
  • Beijing retaliated with in-kind tariffs on American products, including soybeans. (businessinsider.com)
Aphid6
  • The soybean aphid (Aphis glycines) is a soft bodied insect, light green to pale yellow, less than 1/16th inch long. (unl.edu)
  • The soybean aphid is the only aphid currently known to colonize on soybean in the North America. (unl.edu)
  • The soybean aphid life cycle is complex with up to 18 generations a year. (unl.edu)
  • certain soybean varieties have genetic qualities that prevent them from being heavily damaged by the soybean aphid. (unl.edu)
  • There are also some varieties that reduce soybean aphid reproduction and creates an overall unhealthy aphid. (unl.edu)
  • Watch the video: Soybean Aphid Natural Enemies! (unl.edu)
Exports of soybeans1
  • Exports of soybeans and soybean byproducts from Argentina face an export tax of nearly 30 percent, but taxes are lower for exports of soybean meal and soybean oil. (fb.org)
United Soybean Board4
  • While the United Soybean Board strives to make the information on this website as timely and accurate as possible, USB makes no claims, promises or guarantees about the accuracy, completeness or adequacy of the contents of the site, and expressly disclaims liability for errors and omissions in the content. (unitedsoybean.org)
  • Reference in this site to any specific commercial products, process or service, or the use of any trade firm or corporation name, is for the information and convenience of the farm community, or public, and does not constitute endorsement, recommendation or favoring by the United Soybean Board and its directors. (unitedsoybean.org)
  • US - Even though fall harvest has been off to a slow start in many parts of the country, the 2008/2009 marketing year for US soy exports showed no signs of slowing down the continuing trend of year-after-year growth, according to a report from the United Soybean Board (USB). (thecattlesite.com)
  • U.S. Soy is a federally registered trademark of the United Soybean Board and may not be used by third parties without explicit permission. (ussoy.org)
Research on soybeans1
  • Concentrating on his company, from 1932 to 1933 he invested over 1 million dollars in research on soybeans. (wikipedia.org)
Producers7
  • In the case of soybeans, Embrapa estimates that, by using microorganisms instead of chemical fertilizers on 80% of the planted area, Brazilian producers have saved a total of about $37.4 billion in 2021-22. (mongabay.com)
  • Major soybeans producers other than US export 20 million tonnes outside China, not enough now to replace US exports. (spglobal.com)
  • Early planting can be an important risk management strategy as it extends the soybean planting window for producers. (msu.edu)
  • Producers that plan to plant prior to April 15 should understand and mitigate the risks associated with ultra-early soybean planting . (msu.edu)
  • Producers need better information on drying and storing wet soybeans . (msu.edu)
  • A new system of transferable certificates developed by US soybean producers shows where the beans come from and whether the cultivation is sustainable. (taylordailypress.net)
  • In the Netherlands, producers process soybeans into animal feed, food and non-food applications. (taylordailypress.net)
Soil8
  • Larvae remain in the soil, feeding on soybean root hairs and nodules. (pioneer.com)
  • I thought weather, variety and soil conditions were really important, and they are, but I was surprised at how much more yield we could expect with proper management that allows soybean varieties to intercept and efficiently use more light to produce biomass and grain," Archontoulis says. (farmprogress.com)
  • Mariangela Hungria, soil microbiologist and researcher at Embrapa Soja, the soybean division of Brazil's agricultural research corporation, believes that the biofertilizers's success with Brazilian soybeans is in a way the consequence of the country's poverty. (mongabay.com)
  • Direct seed soybeans in well-drained soil that is 60-85°F. Do not plant in colder soil. (highmowingseeds.com)
  • Plant soybeans without spring tillage if the soil is level and planting equipment is equipped to handle the residue. (msu.edu)
  • Our objective was to assess CC treatment and planting practice effects on CC biomass, spring soil nitrate concentrations, and soybean yield at two rainfed sites in eastern and one irrigated site in south-central Nebraska over 4 yr. (unl.edu)
  • This should give a significant boost to the soil moisture and favor the early growth of soybeans and corn. (soybeansandcorn.com)
  • Our minimum-till system for soybeans and corn and no-till system for wheat is another way we protect our soil health. (ussoy.org)
Billion bushels4
  • After converting U.S. soybean meal and soybean oil exports to their soybean equivalents, total U.S. soybean-equivalent exports are projected at 2.764 billion bushels, down 136 million bushels from the prior marketing year's record-high export volume of 2.9 billion bushels. (fb.org)
  • Combined, soybean, soybean oil and soybean meal export-equivalents are projected at 2.733 billion bushels, down 88 million bushels from the prior marketing year. (fb.org)
  • USDA is currently projecting for soybean crushing in the U.S. to rise to 1.96 billion bushels, up 59 million bushels from the 2016/17 marketing year. (fb.org)
  • However, higher domestic crushing is expected to only partially offset the decline in export volumes, and as a result, total soybean use in the U.S. is projected to fall by 1.2 percent, to 4.163 billion bushels. (fb.org)
Meal7
  • This line adopts low-temperature soybean meal, peanut meal, wheat gluten isolated soya etc as main raw materials, which can produce textured protein and fiber protein with certain strength and toughness. (noahandthewhale.com)
  • As a result, Argentina primarily exports soybean meal and soybean oil. (fb.org)
  • Soybean oil exports are projected to be up 17 percent, soybean meal exports are up 11 percent and soybean exports are up 12 percent. (fb.org)
  • 3. DTDC for LD Good Service and High Quality Soybean Oil Pressers: usd to separate the solvent from the wet meal. (ipras.org)
  • 7. Condensers for LD Good Service and High Quality Soybean Oil Pressers: to cooling the solvent gas separated from the wet meal and miscella for recycling. (ipras.org)
  • The soybean meal can produce protein flour, the less oil, the better quality. (sozailink.com)
  • Filling open and closed trucks with soybean meal by a loading spout was observed. (cdc.gov)
Include soybean2
  • Then, in 1940, the company expanded to include soybean processing. (owensborograin.com)
  • Common insect pest of soybeans include soybean aphids, bean leaf beetles, two-spotted spider mite, Japanese beetle, stink bugs and dectes stem borer. (unl.edu)
Average soybean1
  • Following weaker demand and increasing inventories, the U.S. marketing year average soybean price is projected at $9.30 per bushel, down 17 cents from last year. (fb.org)
Imports9
  • China accounts for roughly 60% of world soybean imports and its purchases have a big impact on prices. (nasdaq.com)
  • China, with a population of more than 1.4 billion, imports 62 percent of the world's soybean production. (esquire.com)
  • Since the country highly depends on imports of fertilizers, the substitution has had a huge economic impact on the soybeans industry. (mongabay.com)
  • Imports from Brazil totaled 51 million tonnes, accounting for 53% and US 33 million tonnes, a share of 34% of Chinese soybeans imports. (spglobal.com)
  • The imports of US soybeans of 33 million tonnes could not be replaced now by imports from other countries since the available supply is only 20 million tonnes. (spglobal.com)
  • This is important for the Netherlands because, according to CBS statistics, almost a quarter of the 1.3 billion kilos of soybeans our country imports from the US a year are immediately re-exported for processing overseas. (taylordailypress.net)
  • INDUSTRY.co.id - Jakarta - The Center for Indonesian Policy Studies (CIPS) said the import duty policy on soybean imports should still be released because it makes it easier for consumers and small industries in the country. (industry.co.id)
  • According to Hezekiah, if imports of soybeans are subject to import duty, soybean import price will increase so burdensome consumers. (industry.co.id)
  • Nearly 68 percent of the national soybean demand is met by imports, and by freeing import duties, the government ensures consumers and industries can get quality soybean supplies from various sources and at affordable prices,' he said. (industry.co.id)
Plant12
  • Following mild winters, which contribute to higher than average survival, bean leaf beetle populations can reduce plant populations by feeding on newly-emerging soybeans, especially in early-planted fields. (pioneer.com)
  • CoatsKnit Eco S is created using the renewable botanic protein fibre of the soybean plant. (coats.com)
  • This will minimize the competition for water and nutrients as the soybeans we plant next spring emerge and start growing. (ussoy.org)
  • b.crushing machine for Soybean Oil Plant: soybean is crushed into 6-8 pieces. (ipras.org)
  • Softening process for Soybean Oil Plant:the purpose of softening is to adjust the moisture and temperature of oil, and make it soft. (ipras.org)
  • d.flaking process for Soybean Oil Plant: rolling raw material into flakes, and the purpose is to increae surface area, destroy the soybean cell tissue, shorten the way of oil out from cake. (ipras.org)
  • e:Extrusion for Soybean Oil Plant:through high temperature and high pressure, soybean flakes are transfered into expanded pellet, which is easy to extract oil from, and keep high nutritive value. (ipras.org)
  • The report suggested Mississippi growers will plant 2.05 million acres of soybeans, or 41 percent more than last year. (msstate.edu)
  • If growers have enough seed to plant 2 million acres of soybeans, they'll do it. (msstate.edu)
  • For the life cycle to be completed, it requires two plant host species, common buckthorn (Rhamnus cathartica) and soybeans. (unl.edu)
  • The economic threshold , or population infestation level where control measures are recommended, for late vegetative through R5 stage soybeans is 250 aphids per plant with 80% of the plants infested and populations increasing. (unl.edu)
  • Transcriptome analysis showed that PS and PFOS exposure promoted soybean sprouts to adapt to environmental stress and MARK pathway might play an important role in recognition of microplastics coated by PFOS and response to enhancing plant resistance. (bvsalud.org)
20211
  • Wet weather prevented us from planting winter wheat in 2021 and delayed soybean and corn planting last spring. (ussoy.org)
Bushels3
  • Theoretically, a 100 megajoule per square meter in extra radiation interception in August produces about 10 extra bushels for soybeans. (farmprogress.com)
  • For the 2008/09 marketing year, China remained the top importer of US soybeans with a total of 686 million bushels or 23 per cent of total US soybeans. (thecattlesite.com)
  • US soybean exports to Japan dropped slightly at 88 million bushels. (thecattlesite.com)
Bean5
  • The soybean or bean is a species of legume native to East Asia, widely grown for its edible bean which has numerous uses. (agclassroom.org)
  • Bean leaf beetle is a pest of soybean in most soybean growing regions of the United States. (pioneer.com)
  • Adult bean leaf beetles also can transmit a soybean pathogen-bean pod mottle virus-which causes "stay green" and delays soybean maturity. (pioneer.com)
  • Bean leaf beetles overwinter in woodland leaf litter, grassy fencerows, and under heavy soybean debris, and their survival is highly dependent on winter temperatures. (pioneer.com)
  • Edamame soybeans are usually eaten as a fresh bean and are green-to-yellow in color when harvested. (highmowingseeds.com)
Aphids4
  • Soybean aphids were first sighted, so too were thistle caterpillars, and Japanese beetles. (iastate.edu)
  • After summarizing 5 different pests (soybean aphids, Japanese beetles, Thistle caterpillars, gall midge, Armyworms), Matt introduces 2022's first Fun Insect Trivia question. (iastate.edu)
  • Once on soybeans, multiple generations of wingless female aphids are produced until late summer and early fall. (unl.edu)
  • soybean fields should be checked or scouted for soybean aphids every five to seven days. (unl.edu)
Tariff2
  • Before the announcement of additional tariff exemptions, Chinese firms bought at least 10 boatloads of U.S. soybeans on Thursday, the country's most significant purchases since at least June. (reuters.com)
  • In retaliation, China slapped a retaliatory tariff on soybeans. (esquire.com)
Global soybean1
  • Combined, Brazil and Argentina will represent nearly 50 percent of global soybean production this marketing year. (fb.org)
Content2
  • Soybeans are used to make soy oil and other food products, and their hulls, which have a high protein content, are usually used as feedstock for cattle. (xconomy.com)
  • Understanding the genetic basis of protein content (PC) will accelerate breeding efforts to increase soybean quality. (bvsalud.org)
Growers4
  • The potential for reduced export demand in soybeans could lead to U.S. growers planting fewer acres in 2018. (fb.org)
  • Selecting the right variety for the right environment is essential, but with more than 200 soybean varieties available to NC growers, this can be an overwhelming decision. (ncsoy.org)
  • Nematodes are pests that can also cause significant yield losses to North Carolina soybean growers. (ncsoy.org)
  • By Ron Friesen A new soybean trait to Western Canada will give growers another tool in the ongoing struggle against herbicide resistant weeds. (northstargenetics.ca)
Gains1
  • Soybeans in Chicago lost 11 percent last week, helping erase all of this year's gains as large investors sold commodities to cover losses in other capital markets. (china.org.cn)
Acres1
Weeds2
  • Like our soybeans and corn , we need to control weeds and provide nutrients for winter wheat. (ussoy.org)
  • In fields that will be planted to soybeans next spring, I applied a residual herbicide that will control weeds early next season. (ussoy.org)
Tonnes2
  • The U.S. Department of Agriculture on Friday said private exporters had sold 204,000 tonnes of U.S. soybeans to China, confirming a portion of the sales reported by Reuters. (reuters.com)
  • In February, U.S. Secretary of Agriculture Sonny Perdue said Chinese officials had committed to purchase 10 million tonnes of soybeans from the United States. (world-grain.com)
20181
  • Figures 2 and 3 highlight state-level U.S. soybean prices received for January 2018. (fb.org)
Planting2
  • Argentina continues to receive enough timely rains to maintain the soybean planting pace and germination and stand establishment. (soybeansandcorn.com)
  • Soybean planting had been slowed in southern Buenos Aires and southern La Pampa due to the dryer conditions, but they received widespread rain over the weekend and there is more in the forecast for this week. (soybeansandcorn.com)
Argentina9
  • Silvina Bettini is a bubbly young woman with purple makeup and matching earrings who lives six blocks from a soybean field in central Argentina. (vice.com)
  • She was seated just blocks away from another soybean field sprayed with pesticides in Malvinas, the poorest municipality of the Cordoba province, Argentina's central farming belt. (vice.com)
  • The agrochemical issue is most evident in Argentina's soybean industry. (vice.com)
  • At the same time, most of Argentina's soybeans - 98 percent - are genetically modified. (vice.com)
  • Because Argentina is the world's biggest soybean exporter , selling significantly more soybean to foreign markets than Brazil or the United States, the soy sent from Argentina to the rest of world may pose a threat to global food security if levels of agrochemicals in exported products are not properly monitored, experts told VICE News. (vice.com)
  • According to Avila-Vazquez, 'soy shipments from Argentina contain 100 miligrams per kilogram of glyphosate in soybean,' a claim backed by Testbiotech, a German research group that opposes GMOs. (vice.com)
  • Figure 1 highlights soybean-equivalent export volumes for Argentina, Brazil and the U.S. (fb.org)
  • The soybeans in Argentina were 39.3% planted as of late last week compared to 39.3% last year and 41.5% average according to the Buenos Aires Grain Exchange. (soybeansandcorn.com)
  • In northern Argentina, the soybeans are approximately 5% planted. (soybeansandcorn.com)
Genetically modified1
  • He has a master's degree in business administration and lives with his wife in Iowa, surrounded by genetically modified corn and soybeans. (coasttocoastam.com)
Wheat1
  • To do that, I applied herbicide right after soybeans were harvested, and before the wheat was seeded. (ussoy.org)
Livestock1
  • Soybeans are used to feed livestock, make biodiesel, and processed into many food and household products. (agclassroom.org)
Farmer2
  • Membership and advocacy efforts support Illinois soybean farmer interests in local areas, Springfield and Washington, D.C. ISA programs are designed to ensure Illinois soy is the highest quality, most dependable, sustainable and competitive in the marketplace. (ilsoy.org)
  • The checkoff funds programmes that help increase the demand and preference for US soybeans around the world,' says Jim Call, soybean farmer from Madison, Minnesota, and USB International Marketing chair. (thecattlesite.com)
Checkoff funds1
  • The checkoff funds market development, soybean production and profitability research, promotion, issues management and analysis, communications and education. (ilsoy.org)
Varieties available1
  • With nearly 300 featured varieties, the Specialty U.S. Soy Database brings you the most comprehensive database of U.S. soybean varieties available for use in soy-based foods. (ussoy.org)
Herbicide2
  • The majority of soybeans grown in the United States contain at least one genetically-engineered herbicide tolerance trait. (ncsoy.org)
  • Herbicide tolerant classes include Roundup Ready (RR), Roundup Ready 2 Yield (RR2), Liberty Link (LL), sulfonylurea-tolerant soybeans (STS), Xtend, and 2,4-D (Table 4-1). (ncsoy.org)
Production7
  • IITA along with partners has developed improved technologies for soybean production. (researchgate.net)
  • Cover: Soybean production eld. (researchgate.net)
  • And because it's a by-product of soybean production that would otherwise be discarded, the fibre is highly sustainable too. (coats.com)
  • Brazilian scientists have developed biofertilizers with nitrogen-fixing microorganisms to replace the use of chemical fertilizers in the production of soybeans. (mongabay.com)
  • Today we import 90% of the nitrogen that we use in agriculture, so it [soybean production] would be totally unfeasible economically," she tells Mongabay. (mongabay.com)
  • SSAP is a third-party audited, certified collaborative approach that monitors sustainable soybean production at the national level. (taylordailypress.net)
  • In the core production area, the soybeans are 60-65% planted. (soybeansandcorn.com)
Futures prices2
  • Soybeans futures prices and soybeans options prices listed along with commodity summary information. (agriculture.com)
  • Soybean Futures Prices Steady. (farms.com)
Grain4
  • Investing.com - U.S. grain futures regained strength on Monday, with soybean and corn prices bouncing off multi-month lows as investors returned to the market to seek cheap valuations. (nasdaq.com)
  • Owensboro Grain - Soybean Processing - Owensboro, Ky. (owensborograin.com)
  • As successful soybean processors and grain merchandisers, we have carried on a long family tradition of combining hard work and technology to produce dependable, quality products that deliver the highest levels of customer satisfaction. (owensborograin.com)
  • Citing sources familiar with the trade situation, the news agency noted that state grain buyers have not received orders to continue with the so-called goodwill buying of U.S. soybeans. (world-grain.com)
Grown1
  • If we compare the top 10% of soybean varieties grown within a single maturity group at a single location in the OVT to the bottom 10%, we can see as much as a 15 bu/ac difference in yield. (ncsoy.org)
Protein3
  • But Mielenz said his group has come up with a simple way to ferment the sugars in soybean hulls without destroying the protein. (xconomy.com)
  • 41-pound Soybean has been fondly named so because of how much muscle and protein that he packs into such a low-riding and stubby body! (petfinder.com)
  • The soybean can produce oil, protein, the husk can produce biomass material. (sozailink.com)
Accessions1
  • In the present study, a genome-wide association study (GWAS) was applied to detect quantitative trait loci (QTL) for PC in soybean using 264 re-sequenced soybean accessions and a high-quality single nucleotide polymorphism (SNP) map. (bvsalud.org)
USDA1
  • For soybeans, the difference between the average trade guess and the USDA August forecast exceeded 50 million bu. (feedstuffs.com)
Agriculture3
  • For soybeans, it appears that exports during the current marketing year may exceed the current (U.S. Department of Agriculture) forecast of 1.795 billion bu. (feedstuffs.com)
  • He said this was related to the proposal of the Ministry of Agriculture which plans to impose import duties on soybean import. (industry.co.id)
  • The U.S. Department of Agriculture released its annual prospective plantings report March 31, and it revealed significant changes in national expectations for soybeans and corn. (msstate.edu)
Maturity2
  • As soybeans reach maturity, this second generation exits the fields to alternate hosts and eventually enters hibernation (i.e., overwintering) sites. (pioneer.com)
  • Understanding and selecting the appropriate maturity for a given area is critical to maximizing soybean yield. (ncsoy.org)
China8
  • China is also expected to step up purchases of soybeans, historically the most valuable U.S. farm export, which China has largely avoided buying since the trade war began last year. (reuters.com)
  • China Stocks Up On U.S. Soybeans. (farms.com)
  • U.S. soybean prices have fallen about 12 percent since March, when the U.S.-China trade dispute began. (esquire.com)
  • Like others, Kimberley, who farms with his family in Polk County, believes China is as reluctant as the U.S. to lose soybean trade. (esquire.com)
  • Reduced China demand and lower prices for soybeans will help drive increased demand from other global markets, Hart said. (esquire.com)
  • China and Mexico are our top markets for soybean exports. (fb.org)
  • Soybean futures in China, the world's biggest buyer of the oilseed, posted the biggest weekly drop in more than three years on speculation that a global commodities sell-off will cut import costs. (china.org.cn)
  • BEIJING, CHINA - China has put a stop to purchases of U.S. soybeans amid continued trade tensions between the United States and China, according to a report from Bloomberg . (world-grain.com)
Biomass2
  • The high-temperature pretreatment to which most other high-cellulose biomass is subjected before fermentation would break down the proteins in soybean hulls, Mielenz said. (xconomy.com)
  • In 3 of 12 site-years, soybean yielded less after pre-harvest CC. Yield reductions were not correlated to CC biomass, but were likely due to greater weed pressure. (unl.edu)
Soybean Harvest
Soybean Harvest (thenews-messenger.com)
Machine À Lait Automatique Professionnelle,Ml,Pour Soja - Buy Soybean Milk Machine,Soybean Milk Machine,Soybean Milk Machine...
Machine À Lait Automatique Professionnelle,Ml,Pour Soja - Buy Soybean Milk Machine,Soybean Milk Machine,Soybean Milk Machine... (french.alibaba.com)
November WASDE projecting slight increase in US corn and soybean production | Free Podcasts | Podomatic
November WASDE projecting slight increase in US corn and soybean production | Free Podcasts | Podomatic" (podomatic.com)
IMG_0960 - Manitoba Pulse & Soybean Growers
IMG_0960 - Manitoba Pulse & Soybean Growers (manitobapulse.ca)
Other Pulses - Manitoba Pulse & Soybean Growers
Other Pulses - Manitoba Pulse & Soybean Growers (manitobapulse.ca)
Homemade Baked Beans - Manitoba Pulse & Soybean Growers
Homemade Baked Beans - Manitoba Pulse & Soybean Growers (manitobapulse.ca)
MB Ag cropping districts - Manitoba Pulse & Soybean Growers
MB Ag cropping districts - Manitoba Pulse & Soybean Growers (manitobapulse.ca)
20220613 IMG_3929 pea leaf notch - Manitoba Pulse & Soybean Growers
20220613 IMG_3929 pea leaf notch - Manitoba Pulse & Soybean Growers (manitobapulse.ca)
Field Pea Insect and Disease Identification Guide
Field Pea Insect and Disease Identification Guide (manitobapulse.ca)
7 Everyday Foods More Super Than Trendy Superfoods | Runner's World
7 Everyday Foods More Super Than Trendy "Superfoods" | Runner's World (runnersworld.com)
Item Details | Research Catalog | NYPL
Item Details | Research Catalog | NYPL (nypl.org)
Corn Prices | Successful Farming
Corn Prices | Successful Farming (agriculture.com)
Feeder Cattle Prices | Successful Farming
Feeder Cattle Prices | Successful Farming (agriculture.com)
Lean Hogs Prices | Successful Farming
Lean Hogs Prices | Successful Farming (agriculture.com)
Wheat Prices | Successful Farming
Wheat Prices | Successful Farming (agriculture.com)
Butter (cash) Prices | Successful Farming
Butter (cash) Prices | Successful Farming (agriculture.com)
Oats Prices | Successful Farming
Oats Prices | Successful Farming (agriculture.com)
EWG Farm Subsidy Database || Farm subsidies in Wisconsin
EWG Farm Subsidy Database || Farm subsidies in Wisconsin (farm.ewg.org)
Search | Soybean Research Laboratory
Search | Soybean Research Laboratory (ent.iastate.edu)
Legume - Wikipedia
Legume - Wikipedia (en.wikipedia.org)
Iowa corn & soybean 8-4-21
Iowa corn & soybean 8-4-21 (iowafarmbureau.com)
Jeffrey M. Smith | Coast to Coast AM
Jeffrey M. Smith | Coast to Coast AM (coasttocoastam.com)
Iowa corn & soybean basis 5-26-21
Iowa corn & soybean basis 5-26-21 (iowafarmbureau.com)
Marker Mondays - Page 12 - Georgia Historical Society
Marker Mondays - Page 12 - Georgia Historical Society (georgiahistory.com)
Search | Soybean Research Laboratory
Search | Soybean Research Laboratory (ent.iastate.edu)
Search | Soybean Research Laboratory
Search | Soybean Research Laboratory (ent.iastate.edu)