An annual legume. The SEEDS of this plant are edible and used to produce a variety of SOY FOODS.
Proteins which are present in or isolated from SOYBEANS.
Oil from soybean or soybean plant.
A high-molecular-weight protein (approximately 22,500) containing 198 amino acid residues. It is a strong inhibitor of trypsin and human plasmin.
Proteins which are present in or isolated from vegetables or vegetable products used as food. The concept is distinguished from PLANT PROTEINS which refers to non-dietary proteins from plants.
A low-molecular-weight protein (minimum molecular weight 8000) which has the ability to inhibit trypsin as well as chymotrypsin at independent binding sites. It is characterized by a high cystine content and the absence of glycine.
A genus of gram-negative, aerobic, rod-shaped bacteria usually containing granules of poly-beta-hydroxybutyrate. They characteristically invade the root hairs of leguminous plants and act as intracellular symbionts.
Foodstuff used especially for domestic and laboratory animals, or livestock.
One or more types of plant seed proteins providing the large amounts of AMINO ACIDS utilized in GERMINATION and SEEDLING growth. As seeds are the major food source from AGRICULTURAL CROPS, seed storage proteins are a major source of DIETARY PROTEINS.
The encapsulated embryos of flowering plants. They are used as is or for animal feed because of the high content of concentrated nutrients like starches, proteins, and fats. Rapeseed, cottonseed, and sunflower seed are also produced for the oils (fats) they yield.
Proteins found in plants (flowers, herbs, shrubs, trees, etc.). The concept does not include proteins found in vegetables for which VEGETABLE PROTEINS is available.
The process of breakdown of food for metabolism and use by the body.
A hemoglobin-like oxygen-binding hemeprotein present in the nitrogen-fixing root nodules of leguminous plants. The red pigment has a molecular weight approximately 1/4 that of hemoglobin and has been suggested to act as an oxido-reduction catalyst in symbiotic nitrogen fixation.
A group of compounds which can be described as benzo-pyrano-furano-benzenes which can be formed from ISOFLAVONES by internal coupling of the B ring to the 4-ketone position. Members include medicarpin, phaseolin, and pisatin which are found in FABACEAE.
Serine proteinase inhibitors which inhibit trypsin. They may be endogenous or exogenous compounds.
An enzyme that catalyzes the hydrolysis of 1,4-alpha-glycosidic linkages in starch, glycogen, and related polysaccharides and oligosaccharides so as to remove successive beta-maltose units from the non-reducing ends of the chains. EC 3.2.1.2.
Proteins obtained from foods. They are the main source of the ESSENTIAL AMINO ACIDS.
The formation of a nitrogen-fixing cell mass on PLANT ROOTS following symbiotic infection by nitrogen-fixing bacteria such as RHIZOBIUM or FRANKIA.
The functional hereditary units of PLANTS.
3-Phenylchromones. Isomeric form of FLAVONOIDS in which the benzene group is attached to the 3 position of the benzopyran ring instead of the 2 position.
An enzyme of the oxidoreductase class primarily found in PLANTS. It catalyzes reactions between linoleate and other fatty acids and oxygen to form hydroperoxy-fatty acid derivatives.
The usually underground portions of a plant that serve as support, store food, and through which water and mineral nutrients enter the plant. (From American Heritage Dictionary, 1982; Concise Dictionary of Biology, 1990)
A genus of destructive parasitic OOMYCETES in the family Peronosporaceae, order Peronosporales, affecting numerous fruit, vegetable, and other crops. Differentiation of zoospores usually takes place in the sporangium and no vesicle is formed. It was previously considered a fungus.
Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action in plants.
A plant genus of the family Cruciferae. It contains many species and cultivars used as food including cabbage, cauliflower, broccoli, Brussel sprouts, kale, collard greens, MUSTARD PLANT; (B. alba, B. junica, and B. nigra), turnips (BRASSICA NAPUS) and rapeseed (BRASSICA RAPA).
The collective designation of three organizations with common membership: the European Economic Community (Common Market), the European Coal and Steel Community, and the European Atomic Energy Community (Euratom). It was known as the European Community until 1994. It is primarily an economic union with the principal objectives of free movement of goods, capital, and labor. Professional services, social, medical and paramedical, are subsumed under labor. The constituent countries are Austria, Belgium, Denmark, Finland, France, Germany, Greece, Ireland, Italy, Luxembourg, Netherlands, Portugal, Spain, Sweden, and the United Kingdom. (The World Almanac and Book of Facts 1997, p842)
Structures which collect and store urine and are emptied by catheterization of a cutaneous stoma or internal diversion to the urethra. The reservoirs are surgically created during procedures for urinary diversion.
The relationships of groups of organisms as reflected by their genetic makeup.
A belief or practice which lacks adequate basis for proof; an embodiment of fear of the unknown, magic, and ignorance.
Days commemorating events. Holidays also include vacation periods.
A quantitative measure of the frequency on average with which articles in a journal have been cited in a given period of time.
Oils derived from plants or plant products.
Unctuous combustible substances that are liquid or easily liquefiable on warming, and are soluble in ether but insoluble in water. Such substances, depending on their origin, are classified as animal, mineral, or vegetable oils. Depending on their behavior on heating, they are volatile or fixed. (Dorland, 28th ed)
An order of very small, fringed-wing INSECTS including many agricultural pests.
Works containing information articles on subjects in every field of knowledge, usually arranged in alphabetical order, or a similar work limited to a special field or subject. (From The ALA Glossary of Library and Information Science, 1983)
The geographic designation for states bordering on or located in the Pacific Ocean. The states so designated are Alaska, California, Hawaii, Oregon, and Washington. (U.S. Geologic Survey telephone communication)
Viruses whose genetic material is RNA.
The type species of AQUABIRNAVIRUS, causing infectious pancreatic necrosis in salmonid fish and other freshwater and marine animals including mollusks.
A formal process of examination of patient care or research proposals for conformity with ethical standards. The review is usually conducted by an organized clinical or research ethics committee (CLINICAL ETHICS COMMITTEES or RESEARCH ETHICS COMMITTEES), sometimes by a subset of such a committee, an ad hoc group, or an individual ethicist (ETHICISTS).
A republic consisting of an island group in Melanesia, in the southwest Pacific Ocean. Its capital is Suva. It was discovered by Abel Tasman in 1643 and was visited by Captain Cook in 1774. It was used by escaped convicts from Australia as early as 1804. It was annexed by Great Britain in 1874 but achieved independence in 1970. The name Fiji is of uncertain origin. In its present form it may represent that of Viti, the main island in the group. (From Webster's New Geographical Dictionary, 1988, p396 & Room, Brewer's Dictionary of Names, 1992, p186)
Committees established by professional societies, health facilities, or other institutions to consider decisions that have bioethical implications. The role of these committees may include consultation, education, mediation, and/or review of policies and practices. Committees that consider the ethical dimensions of patient care are ETHICS COMMITTEES, CLINICAL; committees established to protect the welfare of research subjects are ETHICS COMMITTEES, RESEARCH.
Critical and exhaustive investigation or experimentation, having for its aim the discovery of new facts and their correct interpretation, the revision of accepted conclusions, theories, or laws in the light of newly discovered facts, or the practical application of such new or revised conclusions, theories, or laws. (Webster, 3d ed)
Hospital or other institutional committees established to protect the welfare of research subjects. Federal regulations (the "Common Rule" (45 CFR 46)) mandate the use of these committees to monitor federally-funded biomedical and behavioral research involving human subjects.
Investigative technique commonly used during ELECTROENCEPHALOGRAPHY in which a series of bright light flashes or visual patterns are used to elicit brain activity.
A plant genus of the family LYTHRACEAE that contains ALKALOIDS.
A plant genus of the family PORTULACACEAE.
A plant genus, in the family AMARANTHACEAE, best known as a source of high-protein grain crops and of Red Dye No. 2 (AMARANTH DYE). Tumbleweed sometimes refers to Amaranthus but more often refers to SALSOLA.
An allergic contact dermatitis caused by exposure to plants of the genus Toxicodendron (formerly Rhus). These include poison ivy, poison oak, and poison sumac, all plants that contain the substance urushiol, a potent skin sensitizing agent. (From Dorland, 27th ed)
A plant growing in a location where it is not wanted, often competing with cultivated plants.
A plant genus in the family PINACEAE, order Pinales, class Pinopsida, division Coniferophyta. They are coniferous evergreen trees and should not be confused with hemlock plants (CICUTA and CONIUM).
The reduction or regulation of the population of noxious, destructive, or dangerous plants, insects, or other animals. This includes control of plants that serve as habitats or food sources for animal pests.

Asthma visits to emergency rooms and soybean unloading in the harbors of Valencia and A Coruna, Spain. (1/3573)

Soybean unloading in the harbor of Barcelona, Spain, has been associated with large increases in the numbers of asthma patients treated in emergency departments between 1981 and 1987. In this study, the association between asthma and soybean unloading in two other Spanish cities, Valencia and A Coruna, was assessed. Asthma admissions were retrospectively identified for the period 1993-1995, and harbor activities were investigated in each location. Two approaches were used to assess the association between asthma and soybean unloading: One used unusual asthma days (days with an unusually high number of emergency room asthma visits) as an effect measure, and the other estimated the relative increase in the daily number of emergency room visits by autoregressive Poisson regression, adjusted for meteorologic variables, seasonality, and influenza incidence. No association between unusual asthma days and soya unloading was observed in either Valencia or A Coruna, except for one particular dock in Valencia. When the association between unloaded products and the daily number of emergency asthma visits was studied, a statistically significant association was observed for unloading of soya husk (relative risk = 1.50, 95% confidence interval 1.16-1.94) and soybeans (relative risk = 1.31, 95% confidence interval 1.08-1.59) in A Coruna. In Valencia, a statistical association was found only for the unloading of soybeans at two particular docks. Although these findings support the notion that asthma outbreaks are not a common hidden condition in most harbors where soybeans are unloaded, the weak associations reported are likely to be causal. Therefore, appropriate control measures should be implemented to avoid soybean dust emissions, particularly in harbors with populations living in the vicinity.  (+info)

Mutation in GDP-fucose synthesis genes of Sinorhizobium fredii alters Nod factors and significantly decreases competitiveness to nodulate soybeans. (2/3573)

We mutagenized Sinorhizobium fredii HH103-1 with Tn5-B20 and screened about 2,000 colonies for increased beta-galactosidase activity in the presence of the flavonoid naringenin. One mutant, designated SVQ287, produces lipochitooligosaccharide Nod factors (LCOs) that differ from those of the parental strain. The nonreducing N-acetylglucosamine residues of all of the LCOs of mutant SVQ287 lack fucose and 2-O-methylfucose substituents. In addition, SVQ287 synthesizes an LCO with an unusually long, C20:1 fatty acyl side chain. The transposon insertion of mutant SVQ287 lies within a 1.1-kb HindIII fragment. This and an adjacent 2.4-kb HindIII fragment were sequenced. The sequence contains the 3' end of noeK, nodZ, and noeL (the gene interrupted by Tn5-B20), and the 5' end of nolK, all in the same orientation. Although each of these genes has a similarly oriented counterpart on the symbiosis plasmid of the broad-host-range Rhizobium sp. strain NGR234, there are significant differences in the noeK/nodZ intergenic region. Based on amino acid sequence homology, noeL encodes GDP-D-mannose dehydratase, an enzyme involved in the synthesis of GDP-L-fucose, and nolK encodes a NAD-dependent nucleotide sugar epimerase/dehydrogenase. We show that expression of the noeL gene is under the control of NodD1 in S. fredii and is most probably mediated by the nod box that precedes nodZ. Transposon insertion into neoL has two impacts on symbiosis with Williams soybean: nodulation rate is reduced slightly and competitiveness for nodulation is decreased significantly. Mutant SVQ287 retains its ability to form nitrogen-fixing nodules on other legumes, but final nodule number is attenuated on Cajanus cajan.  (+info)

A novel 53-kDa nodulin of the symbiosome membrane of soybean nodules, controlled by Bradyrhizobium japonicum. (3/3573)

A nodule-specific 53-kDa protein (GmNOD53b) of the symbiosome membrane from soybean was isolated and its LysC digestion products were microsequenced. cDNA clones of this novel nodulin, obtained from cDNA library screening with an RT-PCR (reverse-transcriptase polymerase chain reaction)-generated hybridization probe exhibited no homology to proteins identified so far. The expression of GmNOD53b coincides with the onset of nitrogen fixation. Therefore, it is a late nodulin. Among other changes, the GmNOD53b is significantly reduced in nodules infected with the Bradyrhizobium japonicum mutant 184 on the protein level as well as on the level of mRNA expression, compared with the wild-type infected nodules. The reduction of GmNOD53b mRNA is related to an inactivation of the sipF gene in B. japonicum 184, coding for a functionally active signal peptidase.  (+info)

A multisubunit acetyl coenzyme A carboxylase from soybean. (4/3573)

A multisubunit form of acetyl coenzyme A (CoA) carboxylase (ACCase) from soybean (Glycine max) was characterized. The enzyme catalyzes the formation of malonyl CoA from acetyl CoA, a rate-limiting step in fatty acid biosynthesis. The four known components that constitute plastid ACCase are biotin carboxylase (BC), biotin carboxyl carrier protein (BCCP), and the alpha- and beta-subunits of carboxyltransferase (alpha- and beta-CT). At least three different cDNAs were isolated from germinating soybean seeds that encode BC, two that encode BCCP, and four that encode alpha-CT. Whereas BC, BCCP, and alpha-CT are products of nuclear genes, the DNA that encodes soybean beta-CT is located in chloroplasts. Translation products from cDNAs for BC, BCCP, and alpha-CT were imported into isolated pea (Pisum sativum) chloroplasts and became integrated into ACCase. Edman microsequence analysis of the subunits after import permitted the identification of the amino-terminal sequence of the mature protein after removal of the transit sequences. Antibodies specific for each of the chloroplast ACCase subunits were generated against products from the cDNAs expressed in bacteria. The antibodies permitted components of ACCase to be followed during fractionation of the chloroplast stroma. Even in the presence of 0.5 M KCl, a complex that contained BC plus BCCP emerged from Sephacryl 400 with an apparent molecular mass greater than about 800 kD. A second complex, which contained alpha- and beta-CT, was also recovered from the column, and it had an apparent molecular mass of greater than about 600 kD. By mixing the two complexes together at appropriate ratios, ACCase enzymatic activity was restored. Even higher ACCase activities were recovered by mixing complexes from pea and soybean. The results demonstrate that the active form of ACCase can be reassembled and that it could form a high-molecular-mass complex.  (+info)

Further studies of the role of cyclic beta-glucans in symbiosis. An NdvC mutant of Bradyrhizobium japonicum synthesizes cyclodecakis-(1-->3)-beta-glucosyl. (5/3573)

The cyclic beta-(1-->3),beta-(1-->6)-D-glucan synthesis locus of Bradyrhizobium japonicum is composed of at least two genes, ndvB and ndvC. Mutation in either gene affects glucan synthesis, as well as the ability of the bacterium to establish a successful symbiotic interaction with the legume host soybean (Glycine max). B. japonicum strain AB-14 (ndvB::Tn5) does not synthesize beta-glucans, and strain AB-1 (ndvC::Tn5) synthesizes a cyclic beta-glucan lacking beta-(1-->6)-glycosidic bonds. We determined that the structure of the glucan synthesized by strain AB-1 is cyclodecakis-(1-->3)-beta-D-glucosyl, a cyclic beta-(1-->3)-linked decasaccharide in which one of the residues is substituted in the 6 position with beta-laminaribiose. Cyclodecakis-(1-->3)-beta-D-glucosyl did not suppress the fungal beta-glucan-induced plant defense response in soybean cotyledons and had much lower affinity for the putative membrane receptor protein than cyclic beta-(1-->3),beta-(1-->6)-glucans produced by wild-type B. japonicum. This is consistent with the hypothesis presented previously that the wild-type cyclic beta-glucans may function as suppressors of a host defense response.  (+info)

The involvement of cysteine proteases and protease inhibitor genes in the regulation of programmed cell death in plants. (6/3573)

Programmed cell death (PCD) is a process by which cells in many organisms die. The basic morphological and biochemical features of PCD are conserved between the animal and plant kingdoms. Cysteine proteases have emerged as key enzymes in the regulation of animal PCD. Here, we show that in soybean cells, PCD-activating oxidative stress induced a set of cysteine proteases. The activation of one or more of the cysteine proteases was instrumental in the PCD of soybean cells. Inhibition of the cysteine proteases by ectopic expression of cystatin, an endogenous cysteine protease inhibitor gene, inhibited induced cysteine protease activity and blocked PCD triggered either by an avirulent strain of Pseudomonas syringae pv glycinea or directly by oxidative stress. Similar expression of serine protease inhibitors was ineffective. A glutathione S-transferase-cystatin fusion protein was used to purify and characterize the induced proteases. Taken together, our results suggest that plant PCD can be regulated by activity poised between the cysteine proteases and the cysteine protease inhibitors. We also propose a new role for proteinase inhibitor genes as modulators of PCD in plants.  (+info)

Dietary soybeans intake and bone mineral density among 995 middle-aged women in Yokohama. (7/3573)

To investigate relationship of dietary factors, especially source of calcium intake, to bone mineral density (BMD) among Japanese middle-aged women, a total of 995 healthy women age of 40 to 49 (mean +/- SD, 45 +/- 3), who lives in Yokohama-city, were recruited through convenience sampling by the municipal information paper and health announcement at each 18 public health center in 18 wards for the three-day course on prevention of osteoporosis from October 1996 to March 1998. The BMD of the 2nd metacarpal bone was measured using Computed X-ray Densitometry (CXD) method, by a trained radiologist. Dietary intake of calcium was assessed by self-reporting food frequency questionnaire on calcium dietary sources such as milk, dairy products, small fish, vegetables, and soybeans and carefully checked by trained dietician. An independent gradient of non-adjusted and adjusted BMD for age and weekly calcium intake, through soybeans intake frequency (p = 0.03) was noted. This study suggest soybeans, through possible beneficial effects of vitamin-K, soyprotein, and isoflavonoid, may affect BMD of middle aged women.  (+info)

Degradation of two protein sources at three solids retention times in continuous culture. (8/3573)

Effects of solids retention times (SRT) of 10, 20, and 30 h on protein degradation and microbial metabolism were studied in continuous cultures of ruminal contents. Liquid dilution rate was constant across all retention times at .12 h(-1) (8.3 h mean retention time). Two semipurified diets that contained either soybean meal (SBM) or alfalfa hay (ALFH) as the sole nitrogen source were provided in amounts that decreased as SRT was increased. Digestion coefficients for DM, NDF, and ADF increased with increasing SRT. Digestion coefficients for nonstructural carbohydrates were higher in the SBM diet than in the ALFH diet but were not affected by SRT. Protein degradation in the ALFH diet averaged 51% and was unaffected by retention time. In the SBM diet, digestion of protein was 77, 78, and 96% at 10-, 20-, and 30-h retention times, respectively. Microbial efficiency decreased with increasing SRT and was greater for the SBM than for the ALFH diet. Efficiencies ranged from 30.6 to 35.7 and 20.8 to 29.2 g of N/kg of digested DM for the SBM and ALFH diets, respectively, as SRT decreased from 30 to 10 h. The diaminopimelic acid content of the microbes increased as SRT increased, indicating that changes in microbial species occurred owing to passage rates. From these results, we concluded that the digestibility decreases associated with increased ruminal turnover rates may be less for nonstructural carbohydrates and protein than for the fiber fractions.  (+info)

Two low-phytate soybean (Glycine max(L.) Merr.) mutant lines- V99-5089 (mipsmutation on chromosome 11) and CX-1834 (mrp-landmrp-nmutations on chromosomes 19 and 3, respectively) have proven to be valuable resources for breeding of low-phytate, high-sucrose, and low-raffinosaccharide soybeans, traits that are highly desirable from a nutritional and environmental standpoint. A recombinant inbred population derived from the cross CX1834 x V99-5089 provides an opportunity to study the effect of different combinations of these three mutations on soybean phytate and oligosaccharides levels. Of the 173 recombinant inbred lines tested, 163 lines were homozygous for various combinations of MIPS and two MRP loci alleles. These individuals were grouped into eight genotypic classes based on the combination of SNP alleles at the three mutant loci. The two genotypic classes that were homozygousmrp-l/mrp-nand either homozygous wild-type or mutant at themipslocus (MIPS/mrp-l/mrp-normips/mrp-l/mrp-n) displayed ...
Comportamiento de seis cultivares de frijol soya (Glycine max L. Merr.), en el sistema maíz (Zea mays L.) + frijol soya, con sombra de maíz ...
Phosphoenolpyruvate carboxylase (PEPC) from soybean (Glycine max L.Merr.) nodules was purified 187-fold to a final specific activity of 56 units mg-1 of protein. Sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis (PAGE) revealed one major polypeptide band, with a molecular mass of 110 kD, after the final purification step. Two-dimensional PAGE resolved four isoelectric forms of the purified enzyme. Antibodies raised against the purified enzyme immunoprecipitated PEPC activity from a desalted nodule extract. Two cross-reacting bands were obtained when protein immunoblots of crude nodule extracts subjected to SDS-PAGE were probed with the antiserum. One of these corresponded to the 110-kD subunit of PEPC, and the other had a molecular mass of about 60 kD. PEPC was shown to be activated in a time-dependent manner when desalted soybean nodule extracts were preincubated with Mg.ATP in vitro. Activation was observed when PEPC was assayed at pH 7 in the absence of glycerol but not at pH 8 ...
Abstract The quality of oil determined by the constituents and proportion of fatty acid components, and the understanding of heredity of fatty acid components are of importance to breeding good quality soybean varieties. Embryo, cytoplasmic and maternal effects and genotype × environment interaction effects for quality traits of soybean [Glycine max (L.) Merrill.] seeds were analyzed using a general genetic model for quantitative traits of seeds with parents, F1 and F2, of 20 crosses from a diallel mating design of five parents planted in the field in 2003 and 2004 in Harbin, China. The interaction effects of palmitic, stearic, and linoleic acid contents were larger than the genetic main effects, while the genetic main effects were equal to interaction effects for linolenic and oleic acid content. Among all kinds of genetic main effects, the embryo effects were the largest for palmitic, stearic, and linoleic acids, while the cytoplasm effects were the largest for oleic and linolenic acids. ...
A soybean cultivar designated S090130 is disclosed. The invention relates to the seeds of soybean cultivar S090130, to the plants of soybean S090130, to plant parts of soybean cultivar S090130, and to methods for producing a soybean plant produced by crossing soybean cultivar S090130 with itself or with another soybean variety. The invention also relates to methods for producing a soybean plant containing in its genetic material one or more transgenes and to the transgenic soybean plants and plant parts produced by those methods. This invention also relates to soybean cultivars, or breeding cultivars, and plant parts derived from soybean variety S090130, to methods for producing other soybean cultivars, lines or plant parts derived from soybean cultivar S090130, and to the soybean plants, varieties, and their parts derived from use of those methods. The invention further relates to hybrid soybean seeds, plants, and plant parts produced by crossing the
A soybean cultivar designated 1486018 is disclosed. The invention relates to the seeds of soybean cultivar 1486018, to the plants of soybean 1486018, to plant parts of soybean cultivar 1486018 and to methods for producing a soybean plant produced by crossing soybean cultivar 1486018 with itself or with another soybean variety. The invention also relates to methods for producing a soybean plant containing in its genetic material one or more transgenes and to the transgenic soybean plants and plant parts produced by those methods. This invention also relates to soybean cultivars or breeding cultivars and plant parts derived from soybean variety 1486018, to methods for producing other soybean cultivars, lines or plant parts derived from soybean cultivar 1486018 and to the soybean plants, varieties, and their parts derived from use of those methods. The invention further relates to hybrid soybean seeds, plants and plant parts produced by crossing the
Isoflavone content of soybean [ Glycine max (L). Merr.] cultivars with different nitrogen sources and growing season under dry land conditions
The Use of DNA Microsatellite Markers for Genetic Diversity Identification of Soybean (Glycine max (L) Meriil.) as a Supplementary Method in Reference Collections Management
Phytopathology 91:941-947...Phytopathology 91:941-947...Pathogenesis of Alfalfa mosaic virus in Soybean (Glycine max) and Expression of Chimeric Rabies Peptide in Virus-Infected Soybean Plants...Nina Fleysh , Deepali Deka , Maria Drath , Hilary Koprowski , and Vidadi Yusibov...
Recently, we showed that secretion of citrate in an aluminium (Al) tolerant cultivar soybean (Glycine max) (cv. Suzunari) is a specific response to Al stress [Yang et al. (2000) Physiol Plant 110: 72-77]. Here we investigated the intrinsic mechanisms behind the secretion of citrate induced by Al. The amount of citrate secreted during the 24-h Al treatment period increased with increasing concentration of Al (0-70 μM). We analysed citrate secretion basically under 3 conditions: (1) by varying light-exposure, (2) with intact or excised shoots and (3) by using a divided chamber technique. Further, the content of organic acids in the tissue and the activity of enzymes involved in organic acid metabolism were analysed and evaluated. The results indicate that high rate of citrate secretion in soybean requires a 4-h induction period. Al had a continuous effect on the citrate secretion when Al was removed from the treatment solution. Citrate secretion increased steadily under exposure to continuous ...
Somaclonal variations of Soybeans Glycine Max. L. Merr stimulated by drought stress based on random amplified polymorphic DNAs RAPDs. . Biblioteca virtual para leer y descargar libros, documentos, trabajos y tesis universitarias en PDF. Material universiario, documentación y tareas realizadas por universitarios en nuestra biblioteca. Para descargar gratis y para leer online.
Villanueva, M.A.; Metcalf, T.N.IIi; Wang, J.L., 1986: Monoclonal antibodies directed against protoplasts of soybean glycine max cells generation of hybridomas and characterization of a monoclonal antibody reactive with the cell surface
Glycine Soja, also known as Soybean Seed Extract, is a plant-derived ingredient that is found in skin care products. Soybean Seed Extract functions to add moisture to products. In addition to its moisturizing benefits, it has also been found to deliver amino acids, proteins, vitamins, and minerals into the body.. The Soybean is rich in Vitamin E and the ingredient may be found in hair care products, skin care products, soaps, and lotions. Soybeans have been found to offer several other benefits including reduced cholesterol and improved skin. The ingredient, when included in anti-aging products has been found to reduce the appearance of lines and wrinkles while stimulating collagen production.. Soy extract is a powerful antioxidant that is derived from the phytochemical. The soy extract is naturally able to combat free radicals while improving the appearance of the skin. Research indicates that soy extract is effective in reducing the damaging effects of UVB on the skin cells.. Glycine Soja ...
Prolonged, continuous rainfall is the main climatic characteristic of autumn in Southwest China, and it has been found to cause mildew outbreaks in pre-harvest soybean fields. Low temperature and humidity (LTH) stress during soybean maturation in the field promotes pre-harvest mildew, resulting in damage to different organs of soybean fruits to different extents, but relatively little information on the resistance mechanisms in these fruits is available. Therefore, to understand the metabolic responses of soybean fruits to field mold (FM), the metabonomic variations induced by LTH were characterized using proton nuclear magnetic resonance spectroscopy (1H-NMR), and the primary metabolites from the pod, seed coat and cotyledon of pre-harvest soybean were quantified. Analysis of FM-damaged soybean germplasms with different degrees of resistance to FM showed that extracts were dominated by 66 primary metabolites, including amino acids, organic acids and sugars. Each tissue had a characteristic metabolic
Key message Fifteen stable QTLs were identified using a high-density soybean genetic map across multiple environments. One major QTL, qIF5- 1, contributing to total isoflavone content explained...
TY - JOUR. T1 - Polyamines as potential regulators of nutrient exchange across the peribacteroid membrane in soybean root nodules. AU - Whitehead, Lynne F.. AU - Tyerman, Stephen D.. AU - Day, David A.. PY - 2001. Y1 - 2001. N2 - The effect of cytoplasmic polyamines on peribacteroid membrane transport processes in soybean (Glycine max L.) was investigated. The concentration of free polyamines in soybean nodule cytoplasm has been estimated by others to be in the micromolar range. The H+-ATPase was inhibited by 37 and 54% by 200 μM spermidine and putrescine, respectively. Spermine applied to the cytoplasmic face of the peribacteroid membrane was found to inhibit both inward and outward currents through a non-selective cation channel permeable to ammonium (Kd 2.1 μM at - 100 mV). Malate transport into intact symbiosomes was reduced by 15-30% by 15 mM spermidine, cadaverine and putrescine. A non-specific stimulation of malate transport by polycations was found to occur at concentrations in the ...
Genotypic variations in Soybean genotypes towards salinity, 978-3-659-57708-6, Since salinization of soil is an important worldwide problem, identification of salt tolerant plants and their underlying mechanism for salt tolerance is an important phenomenon in distinguishing plant salinity relation. The biochemical and molecular study showed that there is variability in salt tolerance behaviour in soybean genotypes. There is clear indication of role of antioxidant defence system in conferring slat-tolerance and sensitiveness in soybean genotypes. Moreover our data suggest that RAPD markers are suitable to assess genetic diversity between different local populations and to examine genetic relationships. Therefore, the present study may aid breeders interested in selecting genetically diverse source for salt tolerant and sensitiveness for broadening the genetic base as well as for development of mapping population of soybean genotypes.
Made from soybeans. I looked in all my books, including The International Cosmetic Ingredient Dictionary and Handbook, and this is not in there. However, they have many pages of Glycine soja in different forms, such as Glycine soja extract (extract from the soybean plant), Glycine soja fiber (the fiber from the soybean) and Glycine soja oil (the oil from soybeans). So Im going to say, until I can find otherwise, but based on the pattern Im seeing in Gottshalck, that his is the milk made from soybeans, or soymilk --T ...
Understanding the mechanism for salt tolerance in wild soybean (Glycine soja) can help researchers improve that trait in cultivated soybean lines. We analyzed the effects of excess NaCl on the growth,
The homeodomain leucine zipper (HD-Zip) transcription factor family is one of the largest plant specific superfamilies, and includes genes with roles in modulation of plant growth and response to environmental stresses. Many HD-Zip genes are characterized in Arabidopsis (Arabidopsis thaliana), and members of the family are being investigated for abiotic stress responses in rice (Oryza sativa), maize (Zea mays), poplar (Populus trichocarpa) and cucumber (Cucmis sativus). Findings in these species suggest HD-Zip genes as high priority candidates for crop improvement. In this study we have identified members of the HD-Zip gene family in soybean cv. Williams 82, and characterized their expression under dehydration and salt stress. Homology searches with BLASTP and Hidden Markov Model guided sequence alignments identified 101 HD-Zip genes in the soybean genome. Phylogeny reconstruction coupled with domain and gene structure analyses using soybean, Arabidopsis, rice, grape (Vitis vinifera), and Medicago
Expression profiles of GsCML27 in Glycine soja.A. Tissue specific expression of GsCML27 in Glycine soja. Total RNA was extracted from root, young stem, old stem
Six experiments using 3,659 nursery and finishing pigs were conducted to evaluate the effects of dietary soybean hulls and ingredient processing in corn-soybean meal or corn-soybean meal-DDGS diets on nursery and finishing performance. Experiment 1 tested increasing soybean hulls (0, 5, 10, 15, and 20%) and increasing soybean hulls decreased ADG and G:F. Experiment 2 evaluated increasing soybean hulls (0, 10, and 20%) in diets balanced or not for NE and showed reduced performance with increasing soybean hulls. Balancing for NE resulted in G:F similar to pigs fed the control. Experiments 3 and 4 evaluated increasing dietary soybean hulls in corn-soybean meal and corn-soybean meal-DDGS diets. Soybean hulls in either diet worsened G:F and improved caloric efficiency, suggesting current INRA (2004) values for soybean hulls underestimate their energy value. Experiment 5 evaluated 10 and 20% ground or unground soybean hulls in meal and pelleted diets. Caloric efficiency improved with high levels of ...
Soybean cyst nematode (SCN) is the most serious soybean pathogen in North Carolina. Since its discovery in North Carolina (and the United States) in 1954, it has spread to all counties in the Coastal Plain, Tidewater, and some Piedmont counties with large soybean acreages. Severe yield loss caused by this pest is especially common in sandy coastal plain soils. SCN, however, is not restricted to any soil type and often causes significant soybean yield losses which may go unnoticed. Races of Soybean Cyst Nematode Field populations of SCN are characterized as races (numbered 1 through 16). A race designation of cyst nematode is an indication of a field populations ability to reproduce on each of several soybean varieties or lines. Knowing the race of cyst nematode in a given field can assist the grower in making decisions about which resistant varieties should be used. For example, if a field has race 1 or 3, then selection of a variety resistant to these races would be the appropriate choice. ...
Root system architecture is important for water acquisition and nutrient acquisition for all crops. In soybean breeding programs, wild soybean alleles have been used successfully to enhance yield and seed composition traits, but have never been investigated to improve root system architecture. Therefore, in this study, high-density single-feature polymorphic markers and simple sequence repeats were used to map quantitative trait loci (QTLs) governing root system architecture in an inter-specific soybean mapping population developed from a cross between Glycine max and Glycine soja. Wild and cultivated soybean both contributed alleles towards significant additive large effect QTLs on chromosome 6 and 7 for a longer total root length and root distribution, respectively. Epistatic effect QTLs were also identified for taproot length, average diameter, and root distribution. These root traits will influence the water and nutrient uptake in soybean. Two cell division-related genes (D type
After soybean rust, caused by Phakopsora pachyrhizi, was confirmed in the USA in 2004 in soybean (Glycine max) (4), sentinel plots were established in 2005 in 26 soybean-producing states to monitor its spread. Funding for establishing, sampling, and monitoring the plots came from the USDA, national, regional, and state soybean commodity boards, and state departments of agriculture, extension services, and universities. Sentinel plots were a minimum of 8 m × 16 m in size, planted as early as possible for a particular area, and represented either separate plots or marked areas in commercial fields that were monitored regularly by scouts primarily from state universities and extension services for soybean rust.. The presence of sentinel plots for soybean rust monitoring provided the potential for reducing the time and expense of extensive statewide travel for collection of soybean leaf samples for monitoring the incidence of other foliar diseases of soybean in Illinois. In many Midwestern states, ...
In order to exploit the genetic resources of wild soybean (Glycine soja) which is the progenitor of cultivated soybean (Glycine max), the genic frequencies of Ti (coding trypsin inhibitors) and Sp1 (coding β-amylase isozymes) for 13 populations of wild soybean in Beijing region were determined. There are 2 alleles (Tia and Tib) in Ti locus of Beijing populations. Calculation of heterozygosity indicates Sp1 is polymorphic, while this monomorphic within a population. Based on the vatiation (from 0 to 50%) for heterozygosity of Sp1 among populations, with special reference to the values of genetic distances among populatious, and no heterozygote has been found in 1300 plants which would be heterozygotes if they were outbreeder, we suggested that wild soybean in natural populations is absolute inbreeder. The frequencies of Ti and Sp1 alleles vary from place to place extremely, however, no correlation exists between allozyme frequencies and ecological factors. Field investigation has shown that ...
We used native polyacrylamide gel electrophoresis to identify polymorphism levels in a- and b-esterase loci from leaf tissues of Brazilian soybean cultivars for the analysis of population genetic diversity and structure, and to investigate relationships between conventional and genetically modified cultivars. The cultivars included lines developed by a soybean-grower cooperative (CD), by EMBRAPA (BR), and “Roundup Ready” (RR) cultivars. Esterase isozymes recorded with α-naphthyl acetate and β-naphthyl acetate were produced from 14 loci. Two to three allelic variants were detected in leaves from 420 plants of 21 CD, BR, and RR cultivars at Est-1, Est-2, Est-3, Est-5, and Est-14 loci. The estimated proportion of polymorphic loci in CD cultivars was 21.4%, and in BR and RR cultivars it was 28.6%. High and low HO and HE values were observed within CD and BR cultivars and a very high cultivar differentiation level was evident in the plants of the 21 CD, BR, and RR cultivars (FST = 0
Objective:Investigating the microbes and interactions of the beneficial symbiotic relationships between the components of the system ecology in the food chains and life cycles is one of the modern sustainable agriculture topics. In this regard, to evaluate the effects of bacteria and vermicompost on morphological characteristics and yield of soybean an experiment was conducted as split plot in a completely randomized block design with three replications. Methods: Main plots of experiment were at two levels including the non-use and the use of bacteria and the subplots were at three levels including the non-use of vermicompost (control), the use of 5 tons of vermicompost per acre and the use of 10 tons of vermicompost per acre. Results: The results of mean comparison showed that the treatment including 10 tons of vermicompost had the highest amount of oil content (11%) and the lowest amount was obtained from the treatment including use of 5 tons with the amount of 9.77%. Increasing the seed growing and
Rag6 and Rag3c were delimited to a 49-kb interval on chromosome 8 and a 150-kb interval on chromosome 16, respectively. Structural variants in the exons of candidate genes were identified.. The soybean aphid, an invasive species, has significantly threatened soybean production in North America since 2000. Host-plant resistance is known as an ideal management strategy for aphids. Two novel aphid-resistance loci, Rag6 and Rag3c, from Glycine soja 85-32, were previously detected in a 10.5-cM interval on chromosome 8 and a 7.5-cM interval on chromosome 16, respectively. Defining the exact genomic position of these two genes is critical for improving the effectiveness of marker-assisted selection for aphid resistance and for identification of the functional genes. To pinpoint the locations of Rag6 and Rag3c, four populations segregating for Rag6 and Rag3c were used to fine map these two genes. The availability of the Illumina Infinium SoySNP50K/8K iSelect BeadChip, combined with single-nucleotide ...
The development of a universal soybean (Glycine max [L.] Merr.) cytogenetic map that associates classical genetic linkage groups, molecular linkage groups, and a sequence-based physical map with the karyotype has been impeded due to the soybean chromosomes themselves, which are small and morphologically homogeneous. To overcome this obstacle, we screened soybean repetitive DNA to develop a cocktail of fluorescent in situ hybridization (FISH) probes that could differentially label mitotic chromosomes in root tip preparations. We used genetically anchored BAC clones both to identify individual chromosomes in metaphase spreads and to complete a FISH-based karyotyping cocktail that permitted simultaneous identification of all 20 chromosome pairs. We applied these karyotyping tools to wild soybean, G. soja Sieb. and Zucc., which represents a large gene pool of potentially agronomically valuable traits. These studies led to the identification and characterization of a reciprocal chromosome ...
The soybean aphid, Aphis glycines (Hemiptera: Aphididae), is a consistent pest of soybean in Iowa. Current management is heavily reliant on the use of insecticides, which can be expensive and time consuming to apply. Soybean varieties resistant to the aphid are available. These varieties primarily include one resistance gene (Rag1) for soybean aphid control. Varieties incorporating two genes (Rag1 + Rag2) have recently become available. We sought to compare soybean lines susceptible to the soybean aphid with lines carrying a single resistance gene (Rag1 or Rag2) and a line carrying two resistance genes (Rag1 + Rag2). We evaluated the lines based on aphid control and yield protection.
Article Inheritance of resistance to the Soybean aphid in Soybean PI 200538. The soybean aphid (Aphis glycines Matsumura) is a major soybean [Glycine max (L.) Merr.] insect pest. Soybean plant introduction (PI) 200538 has strong resistance to the aph...
The soybean cyst nematode (SCN) Heterodera glycines Ichinohe is responsible for substantial economic losses in soybean (Glycine max L. Merr.) production throughout the U.S. Results from past efforts to quantify the severity of crop damage resulting from SCN are often subject to variable experimental conditions resulting from differences in weather, soil type, and cultivar. Because of the difficulty in accounting for these variables, a process-oriented crop growth simulation model was chosen as a platform for studying the dynamics of SCN damage and for transferring knowledge between crop production scenarios. The objective of this study was to develop and evaluate hypotheses for coupling SCN damage to the process-oriented crop growth model CROPGRO-Soybean. A monomolecular function was used to relate daily SCN damage to initial population density of SCN eggs. The equation was incorporated into the crop model in order to test two hypotheses of how SCN damage occurs. The first hypothesis was that SCN reduce
Soybean Expeller, Soybean Expeller Suppliers There are 13,279 soybean expeller suppliers, mainly located in Asia. The top supplying countries or regions are China, India, and Turkey, which supply 92%, 7%, and 1% of soybean expeller respectively. Soybean expeller products are most popular in Africa, Domestic Market, and Southeast Asia.. soybean in iran, soybean in iran Suppliers and Manufacturers. Oilpress offers 206 soybean in iran products. About 0% of these are Soybeans, 2% are Soybean Oil, and 0% are Fish Meal. A wide variety of soybean in iran options are available to you, such as use, packaging, and cultivation type.. soybean sesame oil press production line sweden. soybean expeller pressing machine sweden Best Oil Expeller China Automatic Oil Screw Press Machine of 6yl Type for screw oil press machine seed oil press best selling heavy duty oil press machine screw oil Coconut Oil Expeller,Oil Expeller China Oil Press (6YL-80, 100) China Oil Press, Oil Expeller 6YL-68 Best Seller Factory ...
OBJECTIVES: The purpose of this study was to analyze the effects of soybean extracts obtained using different extraction methods on the skin of female rats. ...
The Market.Biz research report on Soybean Phospholipid Enzyme Hydrolysate offers a detailed study of Soybean Phospholipid Enzyme Hydrolysate industry worldwide concentrating on key regions like North America, Europe, and Asia. Various factors which influence the growth of Soybean Phospholipid Enzyme Hydrolysate market has been covered at depth in this report. Initially, the report states the product definition, description, range of applications, supply and demand analysis of Soybean Phospholipid Enzyme Hydrolysate industry.. The major regions present in the continents like United States, Germany, Japan and China and their contribution to global Soybean Phospholipid Enzyme Hydrolysate market is elaborated in this research document. In next section, the report discusses industry policies and plans, cost structures, the outline of Soybean Phospholipid Enzyme Hydrolysate market globally, manufacturing processes. The growth rate exhibited by Soybean Phospholipid Enzyme Hydrolysate market based on ...
Identifying Soybean Genotypes with High Charcoal Rot Resistance. Experimental field plots. Field plots were established from 2006 to 2008 at the West Tennessee Research and Education Center at University of Tennessee in Jackson, TN. The soil was a Dexter fine-silty loam (mixed, active, thermicultic hapludalfs). Soybean genotypes in MG III through V including six plant introductions were selected based on their commercial use, high yield in state variety trials, and performance in breeding trials. A total of 149 soybean genotypes consisting of 27 MG III, 29 Early MG IV, 34 Late MG IV, and 59 MG V were evaluated for reaction to M. phaseolina infection. Seeds were treated with 0.8 ml/kg of mefenoxam + fludioxinal + molybeenum (Apron Maxx + Moly, Syngenta, Greensboro, NC) prior to planting. The experiments were conducted in the same area each year and genotypes were planted in four 6.1-m rows spaced 0.7 m using an Almaco 4-row cone planter (model #AJ4RP2, Almaco, Nevada, IA). Within each MG the ...
Master of Life: Black soybean diet black soybean soybean milk anthocyanin supplement supplement ◆ black soybean 180 ◆ (for approximately three months) for business use [product] - Purchase now to accumulate reedemable points! | Rakuten Global Market
Master of Life: Black soybean diet black soybean soybean milk anthocyanin supplement supplement ◆ black soybean 60 ◆ (for approximately one month) for business use [product] - Purchase now to accumulate reedemable points! | Rakuten Global Market
During August of 2004, soybean (Glycine max (L.) Merr.) plants exhibiting symptoms typical of sudden death syndrome (SDS) caused by Fusarium solani (Mart.) Sacc. f. sp. glycines (= Fusarium virguliforme Akoi, ODonnell, Homma, & Lattanzi) (1) were observed in Nemaha and Pierce counties in eastern Nebraska. Leaf symptoms ranged from small chlorotic spots to prominent interveinal necrosis on plants at R5-R6 growth stages. Taproots of symptomatic plants were plated on potato dextrose agar (PDA) amended with hymexazol, ampicillin, and rifampicin (HAR). Resulting fungal isolates grew slowly and developed masses of blue macroconidia, characteristic of F. solani f. sp. glycines. Sorghum seed infested with the isolates were placed 1.5 cm below soybean seeds of the susceptible cv. Sloan planted in clay pots (3). Noninfested sorghum seed and sorghum seed infested with F. oxysporum were controls.
All Seed Dreams seeds are grown the old-fashioned way without the use of pesticides or chemicals, and through the hard work and dedication of California farmer Shane Murphy, and Seed Curator and farmer at our Port Townsend farm, Tessa Gowans, as well as the time and love of generous volunteers ...
The distribution of flavonoids, isoflavonoids, and their conjugates in developing soybean (Glycine max L.) seedling organs and in root and seed exudates has been examined. Conjugates of the isoflavones daidzein and genistein are major metabolites in all embryonic organs within the dry seed and in seedling roots, hypocotyl, and cotyledon tissues at all times after germination. Primary leaf tissues undergo a programmed shift from isoflavonoid to flavonoid metabolism 3 days after germination and become largely predominated by glycosides of the flavonols kampferol, quercetin, and isorhamnetin by 5 days. Cotyledons contain relatively constant and very high levels of conjugates of both daidzein and genistein. Hypocotyl tissues contain a third unidentified compound, P19.3, also present in multiple conjugated forms. Conjugates of daidzein, genistein, and P19.3 are at their highest levels in the hypocotyl hook and fall off progressively down the hypocotyl. These isoflavones also undergo a programmed and ...
TC218173 TC218173 AGCCGGCGAACGGAAGAGAGGAACCATTAAACCATGTTGAAGCAGAGAGACAGAGGAGGG AGAAGCTGAACCAGAGATTCTACGCGCTTCGTGCTGTGGTTCCCAACGTGTCAAAGATGG ACNNNGCGTCGCTTCTGGGCGACGCGATATCTTACATCACCGAGCTGAAGTCCAAGCTTC AGACCCTCGAATCTGATAAAGATGTATTGCATAAGCAGCTTGAAGGAGTGAAGAAGGAAC TCGAGAAAACAACTTATAACGTTTCTTCTAATCACGCGTGTAATAATAACAATAACAACA AGTTGTCGTCGAATCAGCCGGCGTTAATTGACTTGGTTGAGATGGACGTGAAGATCATTG GGTGGGACGCGATGATAACGATCACATGCAGCAAGAAGAACCACCCCGCGGCGACGTTGA TGACGGCATTGATGGAGTTGGACTTGGACGTGCACTACGCCACCGTAACGTTGGTCAACG ATTTGATGATCCAACAAGCAACGGTGAAGATGGGAAGTAGATTTTACACGCAGGAGCAGC TTCGAGCGGTGCTGTCGGCTAAGGTTGGGGATGTACGATGATGTTGGCACTTTGCGGCAG CGTTGAGATTATAAGTGTGTGTTTGTGTCATGTTATTAGCTAGCTATCTCTTTCTAAGTT GTGTGCTGCTCTGGGGTATTTTAAGCCTTCCCGGTAGCTGTTTCTGTAAAATTTTAAGAT TTTATTTTTCTTTATTGGGCAGCTTAGTATTGAATTTTGAGGTAATCAAGCTGGGAAGCT CCATGGAGTAGTAGTATAACTAGCTAGGGACAGTTTNAANNNAATCTGTGGTGGAGTGAA ATAGGGGTAATTTTATCTGTTTAGGTA ...
Based on the optimum control theory (1) , integrative effect of 11 controllable factors of soybean field on soybean aphid (Aphis glycines Matsumura), natural enemies and summer soybean yield was studied systematically by the approaching optimum point and Orthogonal design L27 (3)13 from 1993 to 1996. According to the criterion of not only good control of the pest and increase of soybean yield but also protection of natural enemies, the controllable factors were evaluated synthetically and optimum system control of soybean aphid was suggested as follows: soybean sown in the same maize hole (4 soybean plants to 1 maize plant) or soybean interplanted in maize field (9 rows of soybeans to 2 rows of maize), cultivar Lusoybean 4, sowing time about 10 June, dressing seeds with trace fertilizer at 1800 g/ha, dosage of fertilizer N, P2O5 and K2O application at 45, 60 and 150 kg/ha, dosage of solid manure application at 22500 kg/ha, control soybean aphid with Pirmicarb at 60 g/ha. The technologies of ...
Abstract Background Soybean (Glycine max L. Merr.) is an important nitrogen-fixing crop that provides much of the worlds protein and oil. However, the available tools for investigation of soybean gene function are limited. Nevertheless, chemical mutagenesis can be applied to soybean followed by screening for mutations in a target of interest using a strategy known as Targeting Induced Local Lesions IN Genomes (TILLING). We have applied TILLING to four mutagenized soybean populations, three of which were treated with ethyl methanesulfonate (EMS) and one with N-nitroso-N-methylurea (NMU). Results We screened seven targets in each population and discovered a total of 116 induced mutations. The NMU-treated population and one EMS mutagenized population had similar mutation density (~1/140 kb), while another EMS population had a mutation density of ~1/250 kb. The remaining population had a mutation density of ~1/550 kb. Because of soybeans polyploid history, PCR amplification of multiple targets ...
Through much of the upper Midwest, soybeans are planted in April to June and harvested in September to November. Soybeans are well adapted to grow in soils similar to corn production. In many cases, soybeans are grown in rotation with corn or wheat to break insect, weed, and disease cycles.. Nutrient requirements are generally less for soybeans than other crops. Major nutrient requirements include nitrogen, phosphorous, and potassium. Much of the nitrogen is gained through a relationship with bacteria. A soil pH in the range of 5.5 to 7.0 will enhance nutrient availability and soybean growth.. Weed control is necessary to achieve optimal yields, and use of biotech seeds has eased the ability to control weeds during the growing season. Currently in the United States, over 90% of soybeans planted are herbicide resistant.. Many insects and diseases are common in soybeans grown in the upper Midwest. The most damaging pest to soybeans is soybean cyst nematode, a soil-borne parasitic roundworm that ...
GLYCINE SOJA (SOYBEAN) STEROLS. Un sterol este un alcool complex solid derivat din animale si plante. Sterolii ajuta la refacerea functiei de bariera naturala a pielii deteriorate, imbunatatesc fluiditatea si rezistenta membranei, protejeaza impotriva iritantilor externi, mentin echilibrul de apa, reduc...
Soybean aphid (Aphis glycines Matsumura) is a native pest of soybean [Glycine max (L.) Merr.] in eastern Asia and was detected on soybeans in North America in 2000. In 2004, the soybean cultivar Dowling was described to be resistant to soybean aphids with the Rag1 gene for resistance. In 2006, a virulent biotype of soybean aphid in Ohio was reported to proliferate on soybeans with the Rag1 gene. The objective was to survey the occurrence of virulent aphid populations on soybean indicator lines across geographies and years. Nine soybean lines were identified on the basis of their degree of aphid resistance and their importance in breeding programs. Naturally occurring soybean aphid populations were collected in 10 states (Kansas, Illinois, Indiana, Iowa, Michigan, Minnesota, North Dakota, Ohio, South Dakota, and Wisconsin) and the Canadian province of Ontario. The reproductive capacity of field-collected soybean aphid populations was tested on soybean lines; growth rates were compared in ...
Summary:Delayed planting has been suggested to reduce density of the bean leaf beetle Cerotoma trifurcata (Förster), the principal vector of Bean pod mottle virus. Therefore, planting date was explored to determine if it might impact damage caused by the virus. Four planting dates, ranging from mid-March to mid-June, and two soybean Glycine max (L.) cultivars were examined for their effect on the relative damage caused by the virus in central Iowa for the years 2000-2002. Damage was assessed in terms of ...
Plant viral vectors are valuable tools for heterologous gene expression, and because of virus-induced gene silencing (VIGS), they also have important applications as reverse genetics tools for gene function studies. Viral vectors are especially useful for plants such as soybean (Glycine max) that are recalcitrant to transformation. Previously, two generations of bean pod mottle virus (BPMV; genus Comovirus) vectors have been developed for overexpressing and silencing genes in soybean. However, the design of the previous vectors imposes constraints that limit their utility. For example, VIGS target sequences must be expressed as fusion proteins in the same reading frame as the viral polyprotein. This requirement limits the design of VIGS target sequences to open reading frames. Furthermore, expression of multiple genes or simultaneous silencing of one gene and expression of another was not possible. To overcome these and other issues, a new BPMV-based vector system was developed to facilitate a variety
0022]More specifically, the inventive process for preparing a whole soybean milk comprises the steps of mechanically milling feed soybeans, e.g., by a mill such as a crusher; micronizing the resulting crude-milled soybeans by a means selected from the group consisting of an enzymatic degradation reaction, mechanical micronization using a rotating micronizer, or a combination thereof; and homogenizing the resulting micronized milled soybean. Optionally, the crude-milled soybeans may be filtered to separate the initially generated soybean milk (first soybean milk) and a solid portion containing curd refuse and soybean peels; the micronization and homogenization of the solid portion is carried out to obtain a second batch of soybean milk (second soybean milk); and the second soybean milk is combined with the first soybean milk to obtain the whole soybean milk. In the optional process, the micronized solid portion may be combined with the first soybean milk, followed by homogenizing the resulting ...
We identified a glycoside hydrolase family 12 (GH12) protein, XEG1, produced by the soybean pathogen Phytophthora sojae that exhibits xyloglucanase and β-glucanase activity. It acts as an important virulence factor during P. sojae infection but also acts as a pathogen-associated molecular pattern (PAMP) in soybean (Glycine max) and solanaceous species, where it can trigger defense responses including cell death. GH12 proteins occur widely across microbial taxa, and many of these GH12 proteins induce cell death in Nicotiana benthamiana. The PAMP activity of XEG1 is independent of its xyloglucanase activity. XEG1 can induce plant defense responses in a BAK1-dependent manner. The perception of XEG1 occurs independently of the perception of ethylene-inducing xylanase. XEG1 is strongly induced in P. sojae within 30 min of infection of soybean and then slowly declines. Both silencing and overexpression of XEG1 in P. sojae severely reduced virulence. Many P. sojae RXLR effectors could suppress defense ...
Changes in acidification and starch behaviour were investigated during co-fermentation of cassava and soybean into gari, an African fermented product. Non-volatile acidity, pH and starch content were evaluated using standard analytical methods. Starch breakdown and pasting characteristics were also analysed using a Brabender viscoamylograph. Fermentation caused significant variations in the pH, non-volatile acidity and starch concentration. The pH decreased with concomitant increases in non-volatile acidity during co-fermentation of the cassava dough. Soy fortification up to 20% caused only minimal effects on the pH, titratable acidity and starch content during the fermentation period. Starch content decreased from 69.8% to 60.4% within the 48 h fermentation time in the unfortified sample, with similar trends noted at all levels of fortification. Starch pasting characteristics showed varied trends in pasting temperature, peak viscosity, viscosity at 95_C and at 50_C-hold with increasing ...
Soybean rust, caused by Phakopsora pachyrhizi, is an important foliar disease of soybean. Disease severity is dependent on several environmental factors, although the precise nature of most of these factors under field conditions is not known. To help understand the environmental factors that affect disease development, soybean rust epidemics were studied in Nigeria by sequentially planting an early-maturing, highly susceptible cultivar, TGx 1485-1D, and a late-maturing, moderately susceptible cultivar, TGx 1448-2E, at 30- to 45-day intervals from August 2004 to September 2006. Within each planting date, disease onset occurred earlier on TGx 1485-1D than on TGx 1448-2E, and rust onset was at least 20 days earlier on soybean planted between August and October than on soybean planted between November and April. The logistic model provided a better description of the temporal increase in rust severity than the Gompertz model. Based on the logistic model, the highest absolute rates of disease ...
South Africa Soybean Oil Press Machine, South African Soybean. Soybean and corn oil, provides healthy cooking oil to south african households. It contains the goodness of natural soybean in light and tasty edib.... Soya Oil , Manufacturers & Suppliers Johannesburg South. At Irwing Soya, we are the leading manufacturers and suppliers of soyabean oil in South Africa. As a result of our highly effective extraction process, our yield has the finest nutritional profile with a long shelf life that is well suited for a wide range of food manufacturing purposes.. Soybean Oil In Africa Wholesale, Soybean Suppliers. There are 1,496 soybean oil in africa suppliers, mainly located in Asia. The top supplying countries or regions are China, South Africa, and United Kingdom, which supply 60%, 35%, and 1% of soybean oil in africa respectively. Soybean oil in africa products are most popular in Africa, Southeast Asia, and Mid East.. South Africa Soybean Oil, South Africa Soybean Oil Manufacturers. South Africa ...
Bean pod mottle virus causes green to yellow mottling of young leaves. In severe infections, leaves may become distorted. Seeds from infected plants may be mottled or discolored, but other factors can also cause mottled seed. Symptoms may not be apparent at high temperatures or after pod set. Pod formation may be reduced when infected plants are under moisture stress. BPMV can interact with the soybean mosaic virus to create severe symptoms in plants infected by both viruses. BPMV may also be related to the development of green stem syndrome, in which plants retain green stems and leaves after pods and most nearby plants have matured.. ...
Aphid-resistant soybean varieties with Rag (Resistance to Aphis glycines) genes are promising tools for the management of soybean aphid. Intriguingly, there are soybean aphid populations that can overcome such genetic resistance (i.e. virulent aphids) and cause yield losses. Previous research suggests refuge with aphid-susceptible soybean has the potential to control virulent aphid populations, but it is not clear whether it can reverse the proliferation of virulent aphid populations. Seed treatment has shown improvement of soybean aphid control on Rag soybean. To date, however, it is unknown whether refuge strategy and seed treatment combined could improve soybean aphid virulence management. Therefore we evaluated aphid virulence management by planting refuge soybean in a 1:3 aphid-susceptible:Rag-soybean ratio. Seed treatment was applied to either the aphid-susceptible and/or Rag-soybean. All soybean plants were infested with both avirulent (i.e. biotype 1) and virulent (i.e. biotype 4) ...
free project topics, download complete project material, hire a writer, research topics in nigeria, kenya, ghana, south africa, undergraduate, postgraduate, final year students, free research project, business administration topics, mass communication, accounting, computer science, economics, statistics, education
Conditions are favorable for soybean seedling disease in many areas. Wet soil, slow emergence, and delayed planting have been favorable for seedling diseases in many areas of southern and central Minnesota. Learn more about soybean seedling diseases from Dean Malvick in Minnesota Crop News.
Isoflavonoid signal molecules from soybean (Glycine max (L.) Merr.) seed and root exudate induce the transcription of nodulation (nod) genes in Bradyrhizobium japonicum. In this study, a new compound with symbiotic activity was isolated from soybean root exudate. The isolated 2,4,4-trihydroxychalcone (isoliquiritigenin) is characterized by its strong inducing activity for the nod genes of B. japonicum. These genes are already induced at concentrations 1 order of magnitude below those required of the previously described isoflavonoid inducers genistein and daidzein. Isoliquiritigenin is also a potent inducer of glyceollin resistance in B. japonicum, which renders this bacterium insensitive to potentially bactericidal concentrations of glyceollin, the phytoalexin of G. max. No chemotactic effect of isoliquiritigenin was observed. The highly efficient induction of nod genes and glyceollin resistance by isoliquiritigenin suggests the ecological significance of this compound, although it is not a ...
Thursday, as DTNs index of national cash soybean prices closed at $10.06 a bushel, I cant help but think about the old fable of The Dog and His … Amid several bearish concerns for soybeans in 2020, one bright spot is soybean oil. This page contains data on US Soybean Oil. Cofeed provides China soybean oil price today, soybean oil production, soybean oil import and export volume, soybean oil inventory and soybean oil futures price trend. Comprehensive information about the Bloomberg Soybean Oil index. FAO price indices for oilseeds, vegetable oils and oilmeals Last updated in November 2020. Soybean futures and options are an easy, liquid tool for speculating or hedging against price movements for one of the worlds most widely grown crops. More information can be found in other sections, such as historical data, charts and technical analysis. The total business generated in soybean oil category is 254294 USD last month. Palm oil prices rose about 2 1/2 percent (December contract +83 ringgit ...
soya flour manufacturers , soya flour toasted , high protein soya flour , sonic biochem , soya flour for biscuits ,soya lecithin , soya chunks , soya granules , soya proteins , jeecon , soya flour supplier , soya flour wholesaler , soya flour distributor, soya tvp, soya meal exporters , rich soyabari , mahakali , prestige , vippy industries ...
BACKGROUND: Soybean is an important crop that provides valuable proteins and oils for human use. Because soybean growth and development is extremely sensitive to water deficit, quality and crop yields are severely impacted by drought stress. In the face of limited water resources, drought-responsive genes are therefore of interest. Identification and analysis of dehydration- and rehydration-inducible differentially expressed genes (DEGs) would not only aid elucidation of molecular mechanisms of stress response, but also enable improvement of crop stress tolerance via gene transfer. Using Digital Gene Expression Tag profiling (DGE), a new technique based on Illumina sequencing, we analyzed expression profiles between two soybean genotypes to identify drought-responsive genes.. RESULTS: Two soybean genotypes - drought-tolerant Jindou21 and drought-sensitive Zhongdou33 - were subjected to dehydration and rehydration conditions. For analysis of DEGs under dehydration conditions, 20 cDNA libraries ...
Bean pod mottle virus (BPMV) is a virus disease spread primarily by the bean leaf beetle, Cerotoma trifurcata. Seed transmission is al
Soybean cyst nematode is the most economically significant pest of soybeans in Iowa and has been found in 98 of the 99 Iowa counties. Infested soybean plants often show no symptoms other than reduced yield. The 62-page field guide is designed as a resource for agronomists and farmers to manage soybean cyst nematode. ...
soybean lecithin soft gel manufacturers soybean lecithin soft gel suppliers Directory - Browse soybean lecithin soft gel products,Choose Quality soybean lecithin soft gel manufacturers, suppliers, factory at B2BAGE
Here is the situation: Soybean cyst nematode (SCN) is the worst pest of soybeans in the U. S. A. including Missouri.Fortunately, this pest can be managed, but farmers must take steps before planting soybean this year to protect against soybean cyst nematode.The first step is to test the soil for SCN.
Here is the situation: Soybean cyst nematode (SCN) is the worst pest of soybeans in the U. S. A. including Missouri.Fortunately, this pest can be managed, but farmers must take steps before planting soybean this year to protect against soybean cyst nematode.The first step is to test the soil for SCN.
INTRODUCTION A recent outbreak of soybean [Glycine max (L.) Merril] bud blight in Wenscelau Braz County, State of Paraná, Brazil, may be an indication of the occurrence of a virus disease. The outbreak occurred in an area close to a region where the presence of Tobacco streak virus (TSV), family Bromoviridae, genus Ilarvirus, is historical. Preliminary evaluations using electron microscopy of infected leaves showed the presence of spherical particles. Additional studies proved that TSV was responsible for the problem. Although no resistance to this virus has been found in the soybean germplasm the disease has been controlled by delaying the sowing date (Almeida & Corso, 1991; Almeida et al., 1994). The TSV was identified in tobacco (Nicotiana tabaccum L.) plants in Brazil in 1940 (Costa, 1945), and it is currently known to infect several cash crops such as cotton (Gossypium hirsutum L.), tomato (Lycopersicon esculentum Mill.), tobacco (Nicotiana tabacum L.), soybean, peanut (Arachis hypogaea ...
Producers are currently reporting that this years soybeans are very immature and have a high level of sclerotinia. Reports indicate that very green samples (80-90% green) have a nutrient content similar to mature soybeans - about 41% crude protein and 18% fat. Due to the high fat content, the amount of soybeans in the diet needs to be limited to keep the total fat content in the ration to less than 5%. Higher levels of fat can decrease fibre digestion in the rumen. In dairy diets, raw soybeans should be limited to about 4 lbs/day. Roasting soybeans increases the bypass value of the protein and decreases anti-nutritional factors. Roasted soybeans can be fed to dairy cows at a higher rate - up to 6 lbs/day. Raw soybeans can be fed to beef cattle at 10 % of the diet - approximately 1.5 lbs/day for 600 lb growing cattle and 3 lbs/day for bred cows. Soybeans can be fed whole or just broken into halves or quarters. Avoid fine grinding. Sclerotinia is not associated with health problems in cattle ...
The role of soil microorganisms in plant growth, nutrient utilization, drought tolerance as well as biocontrol activity cannot be over-emphasized, especially in this era when food crisis is a global challenge. This research was therefore designed to gain genomic insights into plant growth promoting (PGP) Rhizobium species capable of enhancing soybean (Glycine max L.) seeds germination under drought condition. Rhizobium sp. strain R1, Rhizobium tropici strain R2, Rhizobium cellulosilyticum strain R3, Rhizobium taibaishanense strain R4 and Ensifer meliloti strain R5 were found to possess the entire PGP traits tested. Specifically, these rhizobial strains were able to solubilize phosphate, produce exopolysaccharide (EPS), 1-aminocyclopropane-1-carboxylate (ACC), siderophore and indole-acetic-acid (IAA). These strains also survived and grew at a temperature of 45 °C and in an acidic condition with a pH 4. Consequently, all the Rhizobium strains enhanced the germination of soybean seeds (PAN 1532 R) under
Soybean Oil Production LineSoyoil Solvent Extracting Plant Professional Soybean Oil Manufacturing Process oilmillplant Oil Mill Plant Manufacture with Soybean YouTube Professional Process of Soybean Oil Production Oil mill Professional Soybean Oil Extraction Process oilmillplant High Quality Factory Price Professional Soybean Oil 12 Best Cooking oil refining machine images in 2019 56 Best Palm oil processing machine images Palm fruit oil Soybean Processing Crown Iron Works Successfully Installed Soybean Oil Processing Plant in Nigeria Cooking oil Manufacturers Suppliers, China cooking oil How to set up a soybean oil making factory in the United States Watersaving technologies AOCS ALSO INSIDE: 3MCPD in modified oils Biobased AOCS A Prophecy Misread That Could Have Been: Regulatory MANUFACTURING Staley Museum
This publication contains information about how well fungicide seed treatments control soybean seedling diseases in the United States. Information was developed by members of the North Central Regional Committee on Soybean Diseases (NCERA-137). This publication was created by the Crop Protection Network, which includes authors from Land Grant universities across the North Central Region and Ontario. CSI ...
One of the most destructive diseases of soybean is Phytophthora root and stem rot, caused by the oomycete pathogen Phytophthora sojae, which thrives in wet conditions and poorly drained soils. This disease can cause major damage to soybean yields resulting in economic losses. P. sojae has been successfully controlled by genetic resistance in soybean cultivars. Breeding for this resistance is critical to Ohio agriculture and business because of soybeans importance as an export, animal feed, and industrial product. Current methods for breeding for resistance to P. sojae involve time-consuming disease assays requiring a relatively large number of seed. Alternatively, molecular markers can be efficiently applied to an earlier generation of a single plant from large numbers of breeding lines. In addition, molecular markers can be used for the combination of multiple resistance genes that will provide a full spectrum of resistance against virulent P. sojae strains. Designing these markers begin with ...
Send Inquiry to Leci Impex - We are leading Manufacturer of sunrise soya lecithin, soya lecithin ink grade, industrial grade lecithin, sunrise soya lecithin oil, Soya Lecithin Feed Grade from Indore Madhya Pradesh India.
An automatic soybean milk boiling device comprises an electric heating bottle and a filtering screen structure. The electric heating bottle is provided with a bottle body capable of containing a quantitative amount of water. A heating controller is arranged on the bottle body. The filtering screen structure is provided with a filtering screen drum, a quantitative amount of smashed soybean can be loaded in the filtering screen drum, and the filtering screen structure is arranged in the bottle body. When a soybean milk boiling function is operated, a heating mode preset for the crashed soybean and water in the bottle body can be conducted through the heating controller. The heating mode is mainly used for controlling temperature and time for heating the smashed soybean and water so as to remove trypsin of the soybean milk and avoid phenomena that soybean milk foam overflows or the soybean milk is overheated to be burned and the soybean milk has burnt flavor.
Search Indian Industrial Soya Lecithin Manufacturers and Suppliers Details - Contact to Industrial Soya Lecithin Exporters in India, Industrial Soya Lecithin Wholesalers, Industrial Soya Lecithin Distributors and Traders from India.
Citation: Qi, M., Link, T.I., Muller, M., Hirschburger, D., Pedley, K.F., Braun, E., Voegele, R.T., Baum, T., Whitham, S.A. 2016. A small cysteine-rich protein from the Asian soybean rust fungus, Phakopsora pachyrhizi, suppresses plant immunity. PLoS Pathogens. 12(9): e1005827. doi:10.1371/journal.ppat.1005827. Interpretive Summary: The Asian soybean rust fungus, Phakopsora pachyrhizi, is an obligate pathogen capable of causing explosive disease epidemics that drastically reduce the yield of soybean. Currently, the mechanisms by which P. pachyrhizi and other related fungi cause disease are poorly understood. The genome sequences and other data obtained from these fungi indicate that a variety of small proteins play essential roles that enable them to cause disease. These proteins, called effectors, are released by the pathogen and interfere with a plants ability to fight the disease. Here, we identify an effector protein produced by P. pachyrhizi and demonstrate that it is capable of ...
Cooking oils and their health properties have long since been a topic of debate for scientists all over the world. With numerous varieties of oils in the markets, it doesnt come as a surprise that the diet conscious get confused and argue about which oil is healthier. Soybean oil and genetically modified (GM) soybean oil are two such products whose health properties are highly debated, with the latter often getting the upper hand. However, a study has now busted the myth that GM soybean oil is healthier than normal soybean oil, warning that its harmful to liver function. According to University Of California Riverside researchers, while soybean oil induces less obesity and insulin resistance than soybean oil, but its effects on diabetes and fatty liver are similar to those of soybean oil. The team tested Plenish®, a genetically-modified (GM) soybean oil released by DuPont in 2014. Plenish is engineered to have low linoleic acid, resulting in an oil similar in composition to olive oil, the
ethiopia machines for soybean oil extraction | edible oilethiopia best buy soybean oil closed loop extractor. High quality soybean oil processing machine, soybean oil. Soybean oil press machine in soybean oil processing plant. Soybean oil solvent extraction plant: Solvent extraction is to use N-hexane to extract the oil from the processed oil seeds or cakes.Good […]
Complete set of soybean oil making machine for sale, Soybean oil making machine is the main machine to produce soybean oil.The full set of soybean oil making machine mainly includes: soybean oil pretreatment machine, soybean oil extraction machine and soybean oil refinery plant.
The process of N fixation is energy consuming and inefficient. In most cases 20 to 40% of the energy that is supplied to nitrogenase for the reduction of N2 is utilized for the reduction of protons to H2. Some strains of R. japonicum contain a membrane-bound hydrogenase that is capable of oxidizing all of the H2 that is produced during N2 fixation. This study was conducted to evaluate the effects of inoculation of soybeans [Glycine max (L.) Merr.] with Rhizobium japonicum containing H2 recycling capability on N fixation efficiency and soybean yield at various physiological stages of growth.. In these experiments, a H2-oxidizing strain SR (Hup+) and SR3 (Hup−), a mutant derived from SR which is unable to oxidize H2, were utilized. Soybeans cv. Wilkin were grown under bacteriological conditions utilizing a drip-irrigated nutriculture system. Nodules from plants inoculated with SR evolved no measurable amount of H2, while nodules from plants innoculated with SR3 evolved between 2.7 and 10 ...
HM09-W150 is a type of Soybean (Glycine Max), released by The Ohio State University in late April of 2015. It has a relative maturity of 3.0.
Soybean response to N is, however, more likely to occur in high-yielding environments (, 80 bu/ac) and in certain conditions such as soil pH , 5.5, organic matter , 1.5 %, or poor nodulation.. When it comes to applications of compost, manure and other specialty products (micronutrients, foliar products, etc.), more research is needed to identify specific environmental conditions and soybean varieties where those applications might be warranted.. Soil pH was found to be the main factor influencing soybean yield and grain protein content. Significant decline in soybean yield and grain protein was observed at pH , 7.5., which is outside the optimal soil pH range (5.5-7.0) for soybean nutrient uptake and biological N-fixation.. Recent advances in on-the-go field mapping for various soil properties and areal/satellite imagery can help farmers identify areas of the field with high soil pH and treat them as site-specific zones.. Improving soybean management when soil is calcareous with pH , 7.5, ...
As folks consider spraying fields for soybean aphid, we want to remind everyone that soybean aphid has developed resistance to pyrethroid (Group 3A) insecticides. Currently, any populations of soybean aphid in Minnesota should be considered potentially resistant to pyrethroids. Insecticide rotations are an important part of insecticide resistance management and may help reduce the chances of further development of insecticide resistance in soybean aphid. If a field needs to be sprayed more than once, it is important to rotate to a different insecticide group for the follow-up spray. On a new webpage, we provide some guidance for insecticide rotations for pyrethroid-resistant soybean aphid ...
Since the most recent issue (No. 17, July 18, 2003) of the Bulletin was printed and mailed, there has been considerable telephone and e-mail traffic regarding soybean aphids in northern Illinois. We have received numerous reports regarding insecticide applications to control the aphids in soybean fields. Although some fields still do not have densities of aphids large enough to warrant control, the densities in a fairly large number of fields have exceeded economic thresholds. In addition, some people are finding very few natural enemies in some fields, so aphid population densities have increased rapidly.. Drs. David Voegtlin (Illinois Natural History Survey) and David Onstad (Department of Natural Resources and Environmental Sciences) recently visited several soybean fields in Kendall County. They have studying soybean aphid populations there since 2001. In fact, one of the first fields of soybeans Dave Voegtlin visited in 2000 was in Kendall County. They have provided an overview of the ...
0142]The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference. [0143]Allard, Principles of plant breeding, John Wiley & Sons, NY, University of California, Davis, Calif., 50-98, 1960. [0144]Anderson, Weed science principles, West Pub. Co., 1983. [0145]Bates, Genetic transformation of plants by protoplast electroporation, Mol. Biotechnol., 2(2):135-145, 1994. [0146]Bernard and Cremeens, Registration of Williams 82 Soybean, Crop Sci., 28:1027-1028, 1988. [0147]Bernard and Weiss, Qualitative genetics, In: Soybeans: Improvement, Production, and Uses, Caldwell (ed), Am. Soc. of Agron., Madison, Wis., 117-154, 1973. [0148]Boerma and Moradshahi, Pollen movement within and between rows to male-sterile soybeans, Crop Sci., 15:858-861, 1975. [0149]Borthwick and Parker, Photoperiodic perception in Biloxi soybeans, Bot. Gaz., 100:374-387, 1938. [0150]Bowers, ...
When it comes to sauces, China is home to soy sauce, which is made from fermented soybeans and wheat. A number of sauces are ... Doufuru can be pickled together with soy beans, red yeast rice or chili to create different color and flavor. This is more of a ... Tofu is made of soybeans and is another popular food product that supplies protein. The production process of tofu varies from ... Several kinds of soybean products are sold in a farmer's market in Haikou, China. ...
... soybeans; upland cotton; and wheat. The 2002 Farm Bill replaced production flexibility contract (PFC) payments (which were ...
"Soybeans planted first in Georgia". The Rockmart Journal. Georgia. 31 August 1994. p. 13. Retrieved 25 April 2014. Morse, ... Hymowitz, T.; Harlan, J. R. (1983). "Introduction of soybean to North America by Samuel Bowen in 1765". Economic Botany. 37 (4 ... Chaplin 1996, p. 146-7. Omahen, Sharon (30 August 2006). "Soybeans". New Georgia Encyclopedia. University of Georgia. Retrieved ...
and soybeans. Some luxuries such as hybrid coconuts, cocoa, coffee, pepper, vanilla, tea, cashews, and cotton are also produced ...
... soybeans, 9.4%; corn, 8%. Production contract This article incorporates public domain material from the Congressional Research ...
... and soybeans. Number of Farms: 253 Total area: 16,757 ha. Area of permanent crops: 12 ha. Area of perennial crops: 2,693 ha. ...
... after soybean oil and palm oil. The oil has many non-food uses and, like soybean oil, is often used interchangeably with non- ... "Soybean oil, salad or cooking, fat composition, 100 g". US National Nutrient Database, Release 28, United States Department of ... It covers a large percentage of that shortage with soybean imports from Brazil, the U.S. and Argentina." There are several ... "Soybean oil, salad or cooking, (partially hydrogenated), fat composition, 100 g". US National Nutrient Database, Release 28, ...
soybeans: 27,000 ha. sorghum: 5,000 ha. In the health sector there were 04 hospitals with 133 beds and 10 public health clinics ...
... soybeans, and tomatoes. Production was very modest due to the limited area of the municipality. Farm data in 2006 Number of ...
... legumes including soybeans; lettuce; onion; peanuts; fruit including apples and pears; sugarcane; sunflower, and tobacco. The ...
... soybeans, and corn. There was an alcohol distilling plant using the sugarcane produced locally. The cattle industry was very ...
Soybeans: 10,000 ha. Beans: 1,550 ha. Sorghum: 760 ha. Potatoes: 350 ha. Tomatoes: 276 ha. Manioc: 150 ha. Rice: 100 ha. ... Traditionally this region was used for cattle raising, but in recent years the growing of soybeans has made encroachments ...
Soybeans: 17,500 ha. Tomatoes: 423 ha. Wheat: 156 ha. Number of cattle: 79,643 head raised by 1,232 producers Number of poultry ... soybeans, corn (maize), citrus fruits, tomatoes, beans, and manioc are also cultivated. In recent years the region has become ... the last feww years Araguari has been changing rapidly and receiving many important investments as Selecta which produces soy ...
LaPlante, Alice (18 July 1994). "Soybeans by Satellite". Computerworld. p. 85. Retrieved 2018-04-23. Currently, DTN services ... more for analyses of issues like Asian soybean rust and avian influenza; and energy customers gained access to online exchanges ...
Soybeans: 4,500 ha. Tomatoes: 446 ha. Farm data in 2006 Number of farms: 3,135 Agricultural area: 232,334 ha. Planted area: ...
... is a large producer of corn, soybeans and cotton. The cattle herd is substantial, with almost one hundred and fifty ... Soybeans: 36,500 ha. Sorghum: 5,300 Agribusiness Major agro-industrial industries are: Alca Foods (cereals) Braspelco (leather ... Itumbiara is one of the most prosperous cities in Goiás and is a major producer of soybeans, corn, cattle, and milk. Itumbiara ...
soybeans: 700 ha. sorghum: 280 ha. In the health sector there were 02 health clinics and no hospitals. In the educational ...
The crops with a planted area of more than 100 hectares were rice, sugarcane (6,379 ha.), soybeans (4,123 ha.), sorghum (803 ha ...
soybeans: 2,500 ha. In the health sector there were 09 health clinics and 01 hospital with 29 beds. In the educational sector ...
Soybeans: 100,000 ha. Sorghum: 1,250 Tomatoes: 240 ha. Wheat: 336 ha. Number of farms: 1,093 Agricultural area: 282,692 ha. ...
The main perennial crops were rice, sugarcane, beans, manioc, corn (2,400 ha.), soybeans, and tomatoes. In the health sector ...
Soybeans: 4,700 ha. Cotton: 680 ha. (Sepin) Farms: 157 Total area: 31,630 ha. Area of permanent crops: 132 ha. Area of ... Cotton, corn, and soybeans are the most important crops. Retail establishments: 100 in 2007 Industrial establishments: 09 ...
Soybeans: 700 ha. Infant mortality rate in 2000: 16.89 Hospitals (2007): 01 with 29 beds Literacy rate in 2000: 86.8 Schools: ... The economy is based on cattle raising and soybean growing. The region had 211,000 head of cattle including 15,900 milking cows ...
Soybeans: 55,000 ha. Sorghum: 2,000 ha. Farm data for 2006 Number of farms: 1,342 Area of the farms: 305,085 Planted area: ... Buritis is a large producer of soybeans, beans, and corn. There were some small transformation industries (41 in 2005) and ...
Soybeans: 18,900 ha. Farm data for 2006 Number of farms: 598 Agricultural area: 106,302 ha. Planted area: 16,600 ha. Area of ... and soybeans. In 2005 there were 5 small transformation industries and 74 commercial retail establishments. Public ...
Soybeans: 21,600 ha. Modest production of wheat and beans There were 1,324 students in primary schools and 246 students in ...
Soybeans: 11,300 ha. Agricultural establishments: 421 Total agricultural area: 62,157 ha. Area of perennial crops: 1,923 ha. ... Inaciolândia is a large producer of cotton and soybeans. Inaciolândia is located in the Meia Ponte Microregion in the extreme ...
The crops with a planted area of more than 100 hectares were cotton, sugarcane (6,050 ha.), soybeans (20,500 ha.), sorghum ( ...
... soybeans (11,500 ha.), corn (6,800 ha. ), and sorghum (600 ha.). In 2006 there were 632 farms with a total agricultural area of ...
The main crops were coffee, garlic, peas, beans (1,900 ha.), soybeans (38,000 ha.), and corn (4,950 ha.). In the health sector ... It is a large producer of cattle and grains, especially soybeans. Guarda-Mor belongs to the Paracatu statistical microregion. ...
Soybean agglutinins (SBA) also known as soy bean lectins (SBL) are lectins found in soybeans. It is a family of similar legume ... Consumption of soybean agglutinin resulted in a depletion of lipid and an overgrowth of small intestine and pancreas in rats. ... Meanwhile, poor growth of spleen and kidneys and pancreatic hypertrophy was observed in the soybean agglutinin-fed rats.[5][6] ... Li, Z; Li, D; Qiao, S; Zhu, X; Huang, C (Aug 2003). "Anti-nutritional effects of a moderate dose of soybean agglutinin in the ...
Soybeans are a high protein legume. They are very versatile in use. Some common soy products are soy milk, soy sauce, tofu, and ... Soybeans and Tofu. Soybeans are a high protein legume. They are very versatile in use. Some common soy products are soy milk, ... What has the lowest biological value black beans soy beans crab or lamb. ?. Asked by Wiki User ... What changed soybean farming in Alabama in 1969. ?. Asked by Wiki User ...
Soybeans bring appeasement to EU-US trade war. The EUs pledge to import more soybeans from US farmers was the dealmaker in ... One fifth of beef and soybean exports from Brazil to the European Union is produced on land that was illegally deforested, ... The United States has supplanted Brazil as the European Unions top supplier of soybeans since a deal in July with President ... Biofuels: Commission blacklists palm oil, throws soybeans lifeline. In an eagerly-awaited decision, the European Commission ...
Soybeans Grow Where Nuclear Waste Glows. Soy crops are so tough they can flourish in the contaminated soil around Chernobyl and ... Citation: Proteomic Analysis of Mature Soybean Seeds from the Chernobyl Area Suggests Plant Adaptation to the Contaminated ... Photo: Soybeans growing near the Chernobyl nuclear reactor. Courtesy of Martin Hajduch. ...
Similarity between soybean and Arabidopsis seed methylomes and loss of non-CG methylation does not affect seed development Jer- ... An analysis of ozone damage to historical maize and soybean yields in the United States Justin M. McGrath, Amy M. Betzelberger ...
Chinas limit on soybean imports has stoked a simmering war of words that illustrates why many countries now accuse Beijing of ... Soybeans Sow Woes for China. Protection of Crop Aids Farmers, Hurts Consumers, Angers U.S.. ... HARBIN, China -- Under a pale autumn sky, Chang Wuqing unloads sacks of soybeans from the cart of his rusted tractor, dumping ... He doesnt know that soybean prices have spiked this year because China has recently restricted imports. He hasnt heard about ...
Indian soybean and soyoil futures were treading water on Friday as profit-taking driven by a likely rise in soybean supplies ... Indian soybean and soyoil futures were treading water on Friday as profit-taking driven by a likely rise in soybean supplies ... Soybean harvesting in key growing areas was disrupted earlier this month due to heavy rainfalls. The weather has become dry now ... At 0815 GMT, the key November soybean contract was up 0.13 percent at 3,590 rupees ($58.58) per 100 kg on the National ...
How Chinas desperate efforts to source soybeans from all over the world is explained by the countrys fear of running out of ... China used to grow its own soybeans-the soybean, in fact, originated in eastern China-but that has changed radically in just ... About half of U.S. soybean exports go to China, which is roughly one-third of the U.S. soybean crop. ... Soybeans have become quite important to China. They are the answer-for now-to a looming crisis building for 20 years that now ...
Latest Soybean farming News. Farmer returns prosthetic leg that skydiver lost during jump. Jul. 29, 2020 4:00 PM EDT ... thanks to a farmer who kept an eye out for it and spotted it in a soybean field. Double amputee Chris Marckres, of Hyde Park, ... thanks to a farmer who kept an eye out for it and spotted it in a soybean field. Double amputee Chris Marckres, of Hyde Park, ...
soybean, soya bean, or soy pea, leguminous plant (Glycine max,G. soja, or Soja max) of the family Leguminosae (pulse [1] family ... Soybean Plant Sciences COPYRIGHT 2001 The Gale Group Inc.. Soybean. Soybean, Glycine max, is an important crop throughout the ... Culinary soybean products include extracted soy protein, tofu (soybean curd), tempeh (fermented soybean mash), soy sauce, soy ... Soybean. The soybean (Glycine max) is a domesticated species in the pea family (Fabaceae). Like other cultivated species in ...
Soybean vein necrosis virus (SVNV, previously: Soybean vein necrosis associated virus SVNaV) is a plant pathogenic virus of ... A known vector of the virus is Sericothrips variablilis (soybean thrips). Soybean thrips are found in many regions of the US ... Cultivars of soybeans have been shown to differ in expression of symptoms. Mildly impacted cultivars may only show thread-like ... Presently the soybean thrips (Neohydatothrips variabilis) is the only known vector of SVNV. Research needs to be done to verify ...
Please complete this form as well as submit your 4 minute MP4 video in accordance with the 2018 Soybean Research Funding ...
Farmers will be planting even less corn than expected as the soybean takes its turn as the darling of agriculture this year, ... The soybean crop could total 3.1 billion bushels, the third largest on record, and corn plantings could yield 12.2 billion ... Corn opens today near its all-time high at $5.60 a bushel, while soybeans are at a still-strong $12.67. The crop report could ... Farmers will be planting even less corn than expected as the soybean takes its turn as the darling of agriculture this year, ...
Chinese officials lifted a ban on Brazilian soybean exports following a four-and-a-half-hour meeting in Beijing, the Brazilian ... SAO PAULO, Brazil -- Chinese officials lifted a ban on Brazilian soybean exports following a four-and-a-half-hour meeting in ...
Rust is a devastating fungal disease that afflicts many crops from corn to soybeans. Pictured here erupting from beneath the ... Soybean rust. Rust is a devastating fungal disease that afflicts many crops from corn to soybeans. Pictured here erupting from ... Rust is a devastating fungal disease that afflicts many crops from corn to soybeans. Pictured here erupting from beneath the ...
Get strategies and peruse herbicide tables for managing weeds in corn, sorghum, soybeans, small grains, legumes, grass forages ... Herbicide recommendations for management of noxious pigweeds in corn, soybean, and forages. More ...
... the United Soybean Board (USB) works to maintain and expand domestic and foreign markets and uses for soybeans and soybean ... Comprising 70 soybean farmers, the USB facilitates trade servicing and technical support programs with importers, processors, ... Working through the U.S. Soybean Export Council, the USB annually conducts about 140 projects in international markets to ... Another important component of the soybean marketing effort is to invite international buyers, processors, and other users of U ...
... - BellaOnline Nutrition Database - BellaOnline is committed to helping our ... Soybeans, mature seeds, sprouted, raw. Food Group: Vegetables and Vegetable Products. Long Description: Soybeans, mature seeds ... Soybeans, mature seeds, sprouted, raw Nutrition. This page is all about the nutrition of Soybeans, mature seeds, sprouted, raw ... Soybeans, mature seeds, sprouted, raw Nutrition Information - Full Details. All values shown in the detailed view below are per ...
Non-GM IOM soybeans in Japan are usually just called "Non-GM soybeans". Soybean utilization FAQ, Karl E. Weingartner at the ... IOM soybeans is an industrial designation for soybeans from the U.S. states of Indiana, Ohio, and Michigan. Beans grown in ... IOM soybeans are traded on the following Japanese commodity exchanges: Kansai Commodities Exchange (KEX) Tokyo Grain Exchange ( ... "IOM soybeans" are unsegregated, meaning any mixture of genetically modified and not. ...
The soybean is economically the most important bean in the world, providing vegetable protein for millions of people and ... Soybean, annual legume of the pea family (Fabaceae) and its edible seed. ... cereal processing: Soybean. Soybean (. Glycine max. ) is not a cereal but a legume; because of its widespread use in the baking ... soybean fieldField of soybeans (Glycine max) on a farm in Oklahoma, U.S.. AdstockRF. ...
It has been proposed that the widespread adoption of soybean as a crop around the world may have contributed in part to this ... is one of the most important diseases of soybean in several regions around the world. The pathogen was first identified in Asia ... Soybean rust (SBR), caused by the fungus Phakopsora pachyrhizi, ... Soybean field severely affected by soybean rust in Alabama, U.S ... Soybean rust (SBR), caused by the fungus Phakopsora pachyrhizi, is one of the most important diseases of soybean in several ...
It was first observed in 2001 in southern Wisconsin and soon afterwards became noticed in most other northern soybean-growing ... The soybean aphid (fig. 1) was introduced into the United States sometime in the late 1990s. ... Figure 5. Soybean aphids. Figure 6. Soybean aphids on terminal leaf. Management. Researchers in numerous Midwest states ... Scouting for soybean aphid is done by walking into the field at least 100 feet from the fields edge. Individual soybean plants ...
The Soybean Entomology Lab is a diverse group of field entomologists, and combines research and extension programs from Drs. ... Soybean Research Laboratory. 2001 Advanced Teaching and Research Building (ATRB). Iowa State University. 2313 Pammel Drive. ...
Soybeans prices (ZS), including contracts quotes and price charts from the CBOT. Soybeans futures prices and soybeans options ... Soybeans July 2021 (CBOT) Date. Open. High. Low. Last. Change. Percent. 06/18. 1330.750. 1392.000. 1330.750. 1390.250. 60.500. ... Soybeans close $1.18 lower, corn ends limit down , Thursday, June 17, 2021. 6/17/2021 1:49 pm ... Soybeans close 43¢ lower, corn falls 31¢ , Monday, June 14, 2021. 6/14/2021 1:41 pm ...
Soybeans prices (ZS), including contracts quotes and price charts from the CBOT. Soybeans futures prices and soybeans options ... Soybeans July 2021 (CBOT) Date. Open. High. Low. Last. Change. Percent. 05/13. 1639.750. 1645.250. 1577.000. 1581.000. -61.500 ... Soybean market rips higher, over $16 level , Tuesday, May 11, 2021. 5/11/2021 2:16 pm ... Soybeans finish the session 27¢ higher , Wednesday, May 12, 2021. 5/12/2021 2:01 pm ...
Soybeans prices (ZS), including contracts quotes and price charts from the CBOT. Soybeans futures prices and soybeans options ... Soybeans July 2021 (CBOT) Date. Open. High. Low. Last. Change. Percent. 06/11. 1544.500. 1551.250. 1496.500. 1508.500s. -35.500 ... The July soybean contract closes $1.15 below weeks high , Friday, June 11, 2021. 6/11/2021 1:39 pm ... Weather concerns goose the corn, soybean markets , June 8, 2021. 6/8/2021 1:43 pm ...
Soybeans prices (ZS), including contracts quotes and price charts from the CBOT. Soybeans futures prices and soybeans options ... Soybeans close $1.18 lower, corn ends limit down , Thursday, June 17, 2021. 6/17/2021 1:49 pm ... Investors believe rain is coming; corn, soybeans close mostly lower , Wednesday, June 16, 2021. 6/16/2021 1:39 pm ... Soybean futures rebound, corn futures mixed. 6/21/2021 11:32 am ... Soybeans Cash (CBOT) Date. Open. High. Low. Last. Change. ...
is currently divided into two subgenera Glycine and Soja (Moench) F. J. Herm.1 The subgenus Soja includes the soybean, G. max(L ... Trypsin Inhibitor Seed Protein Soybean Seed Wild Soybean Soybean Trypsin Inhibitor These keywords were added by machine and not ... Crystallization of a soybean trypsin inhibitor from soybean. Science 101: 668-669.PubMedCrossRefGoogle Scholar ... Screening the USDA soybean germplasm collection for 5.11 variants. Soybean Genet. Newsl. 6: 30-32.Google Scholar ...
Title: Turf Maintenance,Biostimulants,Organic Fertilizers,Specialty Soybeans SOIL TECHNOLOGIES CORP. ... Subject: Turf Maintenance,Biostimulants,Organic Fertilizers,Specialty Soybeans. *From: "Lawrence F. London, Jr." ,[email protected] ... Turf Maintenance,Biostimulants,Organic Fertilizers,Specialty Soybeans. *To: [email protected] ...
... was 0.03 Grams Per Capita Per Day. Discover more data with NationMaster! ... How does Ivory Coast rank in Soybeans Protein supply quantity?. #. 123 Countries. Grams Per Capita Per Day. Last. YoY. 5‑years ... In 2017, the country was number 73 among other countries in Soybeans Protein supply quantity with 0.03 Grams Per Capita Per Day ... Ivory Coast - Soybeans Protein supply quantity Grams Per Capita Per Day - 2014 to 2017 ...
  • Soybean agglutinin, Glycine max. (wikipedia.org)
  • soybean, soya bean, or soy pea, leguminous plant ( Glycine max, G. soja, or Soja max ) of the family Leguminosae ( pulse family), native to tropical and warm temperate regions of Asia, where it has been cultivated as a principal crop for at least 5,000 years. (encyclopedia.com)
  • Soybean, Glycine max , is an important crop throughout the world. (encyclopedia.com)
  • Cultivated soybean and its wild ancestor, Glycine soja , are members of the legume family, Fabaceae. (encyclopedia.com)
  • Soybean vein necrosis virus (SVNV, previously: Soybean vein necrosis associated virus SVNaV) is a plant pathogenic virus of soybeans (Glycine max). (wikipedia.org)
  • Soybean , ( Glycine max ), also called soja bean or soya bean , annual legume of the pea family ( Fabaceae ) and its edible seed . (britannica.com)
  • soybean Soybeans ( Glycine max ). (britannica.com)
  • soybean field Field of soybeans ( Glycine max ) on a farm in Oklahoma, U.S. (britannica.com)
  • Cyto-genetical studies on the wild and cultivated Manchurian soybeans ( Glycine L.) Jap. (springer.com)
  • 1962. Studies on the qualitative and quantitative inheritance of an interspecific cross of soybean, Glycine max x G. formosana. (springer.com)
  • As a member of Phaseoleae, the most economically important legume tribe, the soybean, Glycine max (L.) Merr. (springer.com)
  • The soybean or soya bean ( Glycine max ) [3] is a species of legume native to East Asia , widely grown for its edible bean , which has numerous uses. (wikipedia.org)
  • includes the cultivated soybean, Glycine max (L.) Merr. (wikipedia.org)
  • and the wild soybean, Glycine soja Sieb. (wikipedia.org)
  • Phomopsis seed decay (PSD) of soybean , Glycine max (L.) Merrill, is caused primarily by the fungal pathogen Phomopsis longicolla Hobbs et al. (hindawi.com)
  • Soybean aphids are small (1/16 inch) insects with the typical cornicles, or tail pipes, at the rear of the insect (fig. 2). (osu.edu)
  • Aphids are interesting creatures in that all of them during the spring and summer are females, and they give live birth to new female aphids until soybean maturity. (osu.edu)
  • Later symptoms of a large aphid population are soybean leaves covered with honey dew produced by the aphids, and subsequently the sooty mold that develops (fig. 4). (osu.edu)
  • Individual soybean plants are pulled from the soil and soybean aphids counted or estimated. (osu.edu)
  • Having done this over a few weeks, if the average number of soybean aphids is over the established economic or action threshold of 250 aphids per plant, an insecticide treatment is warranted. (osu.edu)
  • Growers should be aware that at the early buildup of soybean aphids in a field, aphids will normally be found on the upper 2-3 leaves of the plant (fig. 6), making counting of aphids easier. (osu.edu)
  • The action threshold, when an insecticide treatment is warranted, is an average of 250 soybean aphids per plant with a rising population. (osu.edu)
  • I recently learned that this sternorrhynchan storm is composed of soybean aphids (Aphis glycines) . (scienceblogs.com)
  • Sensing the end of summer, the aphids are moving en masse to their winter host, buckthorn . (scienceblogs.com)
  • That's when the first soybean aphids, an Asian species, showed up in Wisconsin. (scienceblogs.com)
  • The soybean aphid is being found in more and more fields according to Iowa State University agronomist Clark McGrath.McGrath says it's a pest that found its way into the Midwest a couple of years ago, and he says soybean aphids have been a "pain in the neck ever since. (radioiowa.com)
  • McGrath says the aphids are hitting a little later than normal, but can still do a lot of damage during the time that pods are setting on the soybean plants. (radioiowa.com)
  • Matt and Erin kick off the 2015 growing season with a summary of soybean planting progress in Iowa and predictions for soybean aphids this year. (iastate.edu)
  • As we wait for soybean aphids to arrive, we discuss how the early and large outbreak of Japanese beetles in central Iowa may harm crop production. (iastate.edu)
  • As soybeans reach the late reproductive stages the need to manage aphids decreases. (iastate.edu)
  • However, aphids persist in soybean fields around the midwest. (iastate.edu)
  • When aphids are deposited into soybean fields in the vegetative stages during mid-season flights, they will reproduce more rapidly and reach economic thresholds two weeks sooner than aphids deposited into fields in the early reproductive stages. (msu.edu)
  • In an eagerly-awaited decision, the European Commission last week categorised palm oil as a high-emitting biofuel crop but provided some controversial exemptions for smallholders and spared soybeans from the delegated act's provisions. (euractiv.com)
  • Virtually all the world's soybeans-a crop used for food products but mostly as the basis of feed for livestock like pigs-come from the U.S., Brazil, and Argentina. (fastcompany.com)
  • In the United States they are now a leading crop, and Brazil, Argentina, and Paraguay also are significant soybean-exporting nations. (encyclopedia.com)
  • The crop report could trigger yet more volatility in coming weeks with agricultural commodities, especially soybeans. (cnbc.com)
  • The soybean crop could total 3.1 billion bushels, the third largest on record, and corn plantings could yield 12.2 billion bushels, the second largest, based on the USDA's projected yields and the usual amount of shrinkage from plantings to harvested area. (cnbc.com)
  • An ancient crop, the soybean has been used in China, Japan , and Korea for thousands of years as a food and a component of medicines. (britannica.com)
  • It has been proposed that the widespread adoption of soybean as a crop around the world may have contributed in part to this movement. (osu.edu)
  • In 1765, the first soybeans arrived in North America, but they did not soon catch on as a crop. (treehugger.com)
  • During the 1940s and early 1950s, the soybean crop was harvested and crushed primarily for the 20 percent of the bean that was oil. (treehugger.com)
  • The wild soybean genome assembly has wide applications in comparative genomic and evolutionary studies, as well as in crop breeding and improvement programs. (nature.com)
  • Crop varieties get mixed up in U.S. silos and there are at least nine commercially available biotech varieties of both corn and soybeans approved for cultivation in the U.S. that aren't allowed in Brazil, the USDA said. (yahoo.com)
  • Chicago soybean futures drop after rally to 5-week top * Price pull back on doubts over Chinese demand (Adds details, quote in paragraph) By Naveen Thukral SINGAPORE, Dec 19 (Reuters) - Chicago soybean futures lost ground on Thursday, with prices pulling back from a five-week high touched earlier this week, as concerns over Chinese demand and expectations of a record Brazilian crop weighed on the market. (reuters.com)
  • U.S. soybean exports rose 15 million bushels for the 2011/12 crop year and soybean prices are expected to rise, the U.S. Department of Agriculture said Tuesday. (ibtimes.com)
  • Global production of oilseed, which includes soybeans, peanuts and sunflowerseeds, is projected to drop approximately 1.1 percent, or 5.2 million tons, to 440.6 million tons for the 2011/12 crop year, with a large portion of the drop in production coming from Brazil, where soybean production is forecast to fall 2.5 million tons. (ibtimes.com)
  • Soybeans are the second most cultivated crop in the U.S. after corn. (ibtimes.com)
  • Since the availability of the soybean genome sequence has revolutionized molecular research on this important crop species, the book also describes how the genome sequence has shaped research on transposon biology and applications for gene identification, tilling and positional gene cloning. (springer.com)
  • Dominic is a field crop entomologist at North Carolina State University and has a wide range of responsibilities, for pest management including corn, soybean, cotton and wheat. (iastate.edu)
  • This insecticide is an option in corn and soybean in Iowa and restricting or removing the use could have potential implications for field crop pest management. (iastate.edu)
  • Erin summarizes field crop pest activity in central and southern Iowa, mainly some caterpillar feeding in corn and bean leaf beetle feeding in soybean. (iastate.edu)
  • Since soybeans were first introduced into Paraguay in 1921, the country has become the world's fastest-growing producer of the commodity and is now the world's fourth largest exporter of the crop. (coha.org)
  • Corn is the biggest U.S. crop, followed by soybeans, hay and wheat, USDA data show. (bloomberg.com)
  • Soybeans enrich the soil with nitrogen, which can then be used by other plants, making them beneficial for crop rotations.7 In the United States, this has usually meant planting soybeans and corn in alternating years. (worldwatch.org)
  • Genetically modified soybeans were introduced to the market in 1996 to be resistant to the pesticide glyphosate, commonly sold as Roundup.23 In 2005, "Roundup Ready" soybeans accounted for 87 percent of the crop in the United States and 98 percent in Argentina. (worldwatch.org)
  • Argentina's Agro-industry minister Ricardo Buryaile estimated the 2016/17 corn crop should reach 52.9 million tons, given a 20% increase in the area planted, which will be in detriment of soybeans. (mercopress.com)
  • Parrott, a crop and soil sciences professor, is studying soybean genes to see if there is a way to engineer longer-lasting economical control of the fungus. (uga.edu)
  • Wayne Parrott, a crop and soil sciences professor at the University of Georgia College of Agricultural and Environmental Sciences, checks out the growth of a few of his soybean plants. (uga.edu)
  • Wayne Parrott, a crop and soil sciences professor at the University of Georgia College of Agricultural and Environmental Sciences, examines an agar plate with just-formed soybean plants. (uga.edu)
  • Soy vegetable oil , used in food and industrial applications, is another product of processing the soybean crop. (wikipedia.org)
  • [8] [9] Perennial soybean ( Neonotonia wightii ) originated in Africa and is now a widespread pasture crop in the tropics. (wikipedia.org)
  • Based on the samples we analyzed, the 2011 soybean crop was of a good quality. (newswire.ca)
  • And the problem is a key factor driving soybean buyers from the U.S. to Brazil, where warmer weather helps offset the impact of higher crop yields on protein levels. (dailymail.co.uk)
  • New, and unusual, opportunities in biotech foods, as Japanese food scientists claim eating genetically modified soybeans could promote hair growth and prevent hair loss. (foodnavigator.com)
  • Roundup Ready soybeans may refer to either of many varieties of genetically modified soybeans resistant against Monsanto's Roundup, for example: GTS 40-3-2, a first-generation variety MON 89788, a second-generation variety This article includes a list of related items that share the same name (or similar names). (wikipedia.org)
  • What are the benefits of genetically modified soybeans? (jazzledazzlecrafts.com)
  • Monsanto Co., eager to get royalties from growers in Argentina on genetically modified soybeans, said on Wednesday it was still trying to resolve a dispute with the government over inspections, while an agricultural ministry source said a deal may be reached in the coming days. (mercopress.com)
  • Please complete this form as well as submit your 4 minute MP4 video in accordance with the 2018 Soybean Research Funding Guidelines and Policy. (google.com)
  • The most active soybeans futures, which rose to their highest since June 2018 in the previous session, were up 0.1% at $9.47 a bushel. (reuters.com)
  • FILE PHOTO: Soybeans sit in a truck as they are loaded at the Ruff Brothers Grain elevator in Leonore, Illinois, U.S., July 6, 2018. (reuters.com)
  • 94%In 2018, GMO soybeans made up 94% of all soybeans planted, GMO cotton made up 94% of all cotton planted, and 92% of corn planted was GMO corn. (jazzledazzlecrafts.com)
  • SBA binds to intestinal epithelial cells, causing inflammation and intestinal permeability , and is a major factor in acute inflammation from raw soybean meal fed to animals. (wikipedia.org)
  • Soybean meal is the world's largest source of protein feed, consumed indirectly by humans through products like chicken, pork, and beef. (fastcompany.com)
  • The products included whole soybeans, soybean meal (primarily used for livestock and poultry feed), and edible soybean oil. (usda.gov)
  • Soybean meal serves as a high-protein meat substitute in many food products, including baby foods and vegetarian foods, and can be imparted with a meatlike texture for increasing the cooked yield of ground meats. (britannica.com)
  • With little new grassland to support expanding beef and dairy herds, farmers started feeding their animals more grain supplemented with soybean meal in order to produce more beef and milk. (treehugger.com)
  • By 1960 soybean meal had become the primary product of soybean crushing and oil the secondary one. (treehugger.com)
  • For the first time, the value of the meal exceeded that of the oil, an early sign of things to come in the changing role of the soybean. (treehugger.com)
  • This rise in the demand for soybean meal reflected the discovery by animal nutritionists that combining 1 part soybean meal with 4 parts grain, usually corn, in feed rations would sharply boost the efficiency with which livestock and poultry converted grain into animal protein. (treehugger.com)
  • The chemical you refer to in commercial Soybean Meal has absolutely no effect on the Trypsin Inhibitor, rather the Hexane is used as a solvent to extract the Oil from the Soybean Meal. (backyardchickens.com)
  • The U.S. season-average soybean price is expected to be between $12 and $12.50 a bushel in April compared with $11.40 to $12.60 the month before, while soybean meal prices are expected to rise to $335 to $355 a ton compared with an earlier projection of $310 to $340. (ibtimes.com)
  • Similarly, GM soybeans accounted for 41 percent of Brazil's harvested area-an 88 percent increase from 2004.24 Though the European Union was the top soy meal importer in 2005, it imports very little soybean oil for human consumption because of mandatory GM labeling and public stigma surrounding genetic engineering. (worldwatch.org)
  • Fat-free (defatted) soybean meal is a significant and cheap source of protein for animal feeds and many packaged meals . (wikipedia.org)
  • For instance, when soybean seed is crushed and the oil extracted, what's left is called soybean meal. (eurekalert.org)
  • Soybean meal contains high-quality protein. (eurekalert.org)
  • Globally, close to 98% of soybean meal produced is used in animal feed. (eurekalert.org)
  • The protein in soybean meal is considered high-quality because it is composed of a fairly well-balanced set of amino acids. (eurekalert.org)
  • Soybean meal complements corn well in animal feed," says Diers. (eurekalert.org)
  • When crushed, Canadian soybeans produce both oil and a high protein meal. (newswire.ca)
  • Soybean oil is used in shortening and margarine products, while the high protein meal is used in feed rations for livestock. (newswire.ca)
  • Compared to 20 years ago, we're probably feeding 70 percent less soybean meal than we used to," he said. (dailymail.co.uk)
  • Our mission is to improve soybean, common bean, and wheat to provide sustainable solutions for consumers in America and around the world. (usda.gov)
  • In the United States there is now more land in soybeans than in wheat. (treehugger.com)
  • Commodity funds were net buyers of CBOT soybean and soymeal futures contracts on Wednesday, and net sellers of corn, wheat and soyoil futures, traders said. (reuters.com)
  • Around 11:30 Thursday morning, soybeans surprised a lot of people after they "exploded" higher taking corn and wheat with it. (agweb.com)
  • Wheat and soybeans fell. (bloomberg.com)
  • Corn and wheat markets followed soybeans lower. (reuters.com)
  • Nodules formed on soybean roots through seed-placed inoculation with Bradyrhizobium japonicum (left), and with previous year wheat seed inoculated (right) in soils with no previous soybean inoculation history. (ndsu.edu)
  • Argentina's much-watched soybean sowings will set a record this season, but the country is heading for a weaker wheat harvest, despite ideas of very good yields, the country's farm ministry said. (mercopress.com)
  • Citation: 'Proteomic Analysis of Mature Soybean Seeds from the Chernobyl Area Suggests Plant Adaptation to the Contaminated Environment. (wired.com)
  • Soybean seeds vary in size and are commonly yellow in color, but can also be green, black, or brown. (encyclopedia.com)
  • My discovery of soybeans led to the creation of my seed company, Salt Spring Seeds, in 1986. (motherearthnews.com)
  • Edamame or butter bean soybeans are varieties that are best used at the green stage, when the seeds have just plumped the pods. (motherearthnews.com)
  • And Monsanto holds huge shares of those markets - about 80% of U.S. corn and more than 90% of U.S. soybeans are grown with seeds containing Monsanto's patented seed traits (whether sold by Monsanto itself or by licensees). (jazzledazzlecrafts.com)
  • Argentina authorized the use of genetically modified soybean seeds resistant to herbicides other than glyphosate, as the European Union (EU) debates whether to extend the license of weed-killers containing the ingredient. (mercopress.com)
  • Like most plants, soybeans grow in distinct morphological stages as they develop from seeds into fully mature plant. (wikipedia.org)
  • Soybean oil is produced from the seeds of the soybean plant. (medicinenet.com)
  • Infected soybean seeds can be symptomless, but are typically shriveled, elongated, cracked, and have a chalky white appearance. (hindawi.com)
  • Soybean seeds infected by P. longicolla can be symptomless [ 22 ] but are typically shriveled, elongated, or cracked, and often appear chalky white (Figure 1 ). (hindawi.com)
  • The invention relates to the seeds of soybean cultivar 0585540, to the plants of soybean 0585540 and to methods for producing a soybean plant produced by crossing the cultivar 0585540 with itself or another soybean variety. (freepatentsonline.com)
  • The invention further relates to hybrid soybean seeds and plants produced by crossing the cultivar 0585540 with another soybean cultivar. (freepatentsonline.com)
  • e) harvesting seeds produced on said emasculated plants of the soybean line. (freepatentsonline.com)
  • Soybeans are a high protein legume. (answers.com)
  • During World War II soybeans became important in both North America and Europe chiefly as substitutes for other protein foods and as a source of edible oil. (encyclopedia.com)
  • Legumes are particularly valuable because, in conjunction with symbiotic bacteria, they fix atmospheric nitrogen and they are excellent sources of protein, with soybeans containing the highest level of this nutrient. (encyclopedia.com)
  • The soybean is economically the most important bean in the world, providing vegetable protein for millions of people and ingredients for hundreds of chemical products. (britannica.com)
  • The soybean is one of the richest and cheapest sources of protein and is a staple in the diets of people and animals in numerous parts of the world. (britannica.com)
  • Because soybeans contain no starch , they are a good source of protein for diabetics . (britannica.com)
  • 3-10 Evidence gather from cytogenetic, morphological and seed protein studies suggest that the two species are conspecific 11-16 and supports the hypothesis that G. soja is the wild ancestor of the cultivated soybean. (springer.com)
  • Since 2014, Ivory Coast Soybeans Protein supply quantity jumped by 14.5% year on year. (nationmaster.com)
  • In 2017, the country was number 73 among other countries in Soybeans Protein supply quantity with 0.03 Grams Per Capita Per Day. (nationmaster.com)
  • For centuries, soybeans have been used as a source of protein and a healthy alternative to meat and fish. (acupuncturetoday.com)
  • As a food source, soybeans provide a wealth of important nutrients, including protein, several amino acids and isoflavones. (acupuncturetoday.com)
  • Since 2014, Bosnia and Herzegovina Soybeans Protein supply quantity was down by 37.3% year on year. (nationmaster.com)
  • At 0.67 Grams Per Capita Per Day in 2017, the country was ranked number 30 comparing other countries in Soybeans Protein supply quantity. (nationmaster.com)
  • Packed with protein fiber, vitamins and minerals, soybeans are easy to grow and taste terrific. (motherearthnews.com)
  • Soybeans are very high in protein and are the only legume that contains all nine essential amino acids (the only proteins the human body can't manufacture on its own). (motherearthnews.com)
  • As the charts below show, tofu contains half as much protein, and much less fiber, vitamins and minerals than cooked whole soybeans. (motherearthnews.com)
  • But high demand for corn for ethanol production and distiller's grains (a high-protein animal feed) has driven many farmers to plant two years of corn for every year of soybeans.8 This in large part explains the 7-percent decline in total U.S. soybean harvested area in 2005.9 Globally, however, harvested area stayed stable at 92 million hectares.10 (See Figure 3. (worldwatch.org)
  • Are Soybeans Protein or Carbohydrate? (livestrong.com)
  • The protein in soybeans is considered a complete protein, having the essential amino acids in the correct amounts. (livestrong.com)
  • The protein in soybeans can vary by type and preparation method. (livestrong.com)
  • A half-cup of cooked soybeans contains 16 g of protein and a half-cup of roasted soybeans has 39 g protein. (livestrong.com)
  • There are approximately 10 g of protein in 1 cup of plain soymilk, 13 g in 4 oz. of firm tofu and 9 g in 4 oz. of silken or soft tofu, according to The Minnesota Soybean Research & Promotion Council. (livestrong.com)
  • The first is based on turning off a protein in the plant that the fungus needs to be pathogenic, "altering the plant a little bit so that the fungus doesn't recognize soybean as a host," he said. (uga.edu)
  • For example, soybean products, such as textured vegetable protein (TVP), are ingredients in many meat and dairy substitutes. (wikipedia.org)
  • Soybean is the most important protein source for feed farm animals (that in turn yields animal protein for human consumption). (wikipedia.org)
  • It has proved difficult to develop soybean varieties with both high protein levels and high yields. (eurekalert.org)
  • These two characteristics are negatively correlated: when soybean yields are high, protein levels tend to decrease, and vice-versa. (eurekalert.org)
  • Their initial results suggest it might be possible to breed soybeans with higher protein concentration without significantly decreasing yields. (eurekalert.org)
  • If high-protein varieties of soybean have relatively low yields, they may not be chosen by growers, says Diers. (eurekalert.org)
  • InFor this study, the researchers tested a gene that increases protein by breeding it into two different varieties of soybean. (eurekalert.org)
  • The study has also increased our understanding of the genetics of protein concentration in soybean," says Diers. (eurekalert.org)
  • That's important because soybean protein concentration is impacted by many genes. (eurekalert.org)
  • Different versions of genes at each location can lead to higher or lower protein concentration in soybean. (eurekalert.org)
  • They developed experimental lines with and without the high protein gene by breeding the gene into two varieties of soybean and testing the lines for both protein concentration and yield. (eurekalert.org)
  • The gene increased protein concentration between 8 to 14 grams per kilogram of soybean. (eurekalert.org)
  • This gene could be a good choice for breeders to use when they want soybeans with higher protein concentration. (eurekalert.org)
  • That's in contrast to the impact of a gene on chromosome 20 that increased protein concentration but also significantly decreased yields in soybean varieties. (eurekalert.org)
  • High-protein, high-yield varieties of soybean would be attractive for growers and end-users. (eurekalert.org)
  • A more precise genetic map could help breeders generate other high-protein varieties of soybean. (eurekalert.org)
  • INSIGHT-Protein plight: Brazil steals U.S. soybean. (dailymail.co.uk)
  • CHICAGO, Jan 25 (Reuters) - U.S. soybean growers are losing market share in the all-important China market because the race to grow higher-yielding crops has robbed their most prized nutrient: protein. (dailymail.co.uk)
  • Declining protein levels make soybeans less valuable to the $400 billion industry that produces feed for cattle, pigs, chickens and fish. (dailymail.co.uk)
  • The U.S. soybean industry also faces rising competition from a growing number of synthetic and organic alternative feeds that provide more protein for less money. (dailymail.co.uk)
  • Over the long term, however, falling protein levels could have dire consequences for the U.S. industry as a whole - especially in China, which buys two-thirds of all soybeans traded in the world market to feed its vast livestock operations. (dailymail.co.uk)
  • China needs soybeans, and we're at risk of becoming a residual supplier if we don't work on protein improvements," said North Dakota farmer Jared Hagert, a director and past chairman of the United Soybean Board (USB), an industry association. (dailymail.co.uk)
  • This threshold is useful from flowering through the R5 growth stage of soybean (pods beginning to fill with seed). (osu.edu)
  • Soybeans grow in pods and can be green, yellow, brown or black. (livestrong.com)
  • This bush-habit soybean is easy to grow, with excellent branching and heavy production of curved, 2- to 3-inch green to buff pods. (parkseed.com)
  • Soybean pods can be infected at any time after they form. (hindawi.com)
  • Whole soybeans are used to make soymilk by crushing them with water and adding sugar and flavorings. (livestrong.com)
  • There are a couple of points to watch out for when cooking whole soybeans, which are noted below in copious detail. (justhungry.com)
  • For soybean farmers, the United Soybean Board (USB) works to maintain and expand domestic and foreign markets and uses for soybeans and soybean products. (usda.gov)
  • Since the soybean is a legume, fixing atmospheric nitrogen in the soil, it is not as fertilizer-responsive as, say, corn, which has a ravenous appetite for nitrogen. (treehugger.com)
  • Soybeans are the most cultivated legume in the world, with a long history in China. (livestrong.com)
  • Plants can use only ammonium-N or nitrate-N. Soybeans are a legume and normally should provide adequate N through a symbiotic relationship with N-fixing bacteria of the species Bradyrhizobium japonicum . (ndsu.edu)
  • Varieties of soybeans to grow include Natto, Jewel, Manitoba Brown and Jacques Brown. (motherearthnews.com)
  • Brown and black varieties such as 'Jacques Brown,' 'Hokkaido Black,' 'Jewel' and Lammer's Black' have the best flavor for dry soybeans, but it's hard to find these except through a few seed companies. (motherearthnews.com)
  • Variety Selection - No highly effective sources of resistance are currently available in commercial soybean varieties. (pioneer.com)
  • However, Pioneer ® brand soybean varieties differ in tolerance to charcoal rot drought complex. (pioneer.com)
  • a Scores are based on Pioneer research observations of the comparative ability to tolerate drought and limit losses from charcoal rot infection among various soybean varieties. (pioneer.com)
  • Pioneer soybean breeders are using new genetic sources and implementing new screening methods to improve future charcoal rot tolerance in commercial varieties. (pioneer.com)
  • We haven't seen any yield drag with LibertyLink soybeans compared to existing genetics-both in Roundup Ready and conventional varieties we're working with. (agweb.com)
  • Varieties of soybeans are used for many purposes. (wikipedia.org)
  • Therefore, growers decide which varieties of soybean to grow based primarily on yields. (eurekalert.org)
  • USA organic family black soybeans soaked overnight and thoroughly cooked with zero chemical additives at Eden's certified organic, kosher cannery. (edenfoods.com)
  • A native of Asia, black soybeans are the best edible soybean for human consumption. (edenfoods.com)
  • While salted black soybeans are used as a food source, tasteless black soybeans are used in herbal medicine. (acupuncturetoday.com)
  • Soybeans have long been known to contain many anticancer factors and recent research has shown that black soybeans are much higher in those factors than other soybeans. (motherearthnews.com)
  • CHICAGO (Reuters) - Private exporters sold 464,000 tonnes of U.S. soybeans to China for shipment in the 2019/20 marketing year that began Sept. 1, the U.S. Department of Agriculture (USDA) said on Wednesday, the latest in a flurry of purchases by the world's top soy importer. (reuters.com)
  • Cultivation of the soybean, long confined chiefly to China, gradually spread to other countries. (encyclopedia.com)
  • according to some sources, the cultivation of soybeans dates back more than 3,000 years. (acupuncturetoday.com)
  • A March 30 report from the USDA projected a decrease of 1 million acres of soybean cultivation in the U.S. as farmers switch to corn, Murphy said. (ibtimes.com)
  • Some farmers in the southern U.S. may begin to buy back land from cotton cultivation to plant soybeans if the price remains high. (ibtimes.com)
  • In most soybean-producing areas, foliar fungicide use has increased to help manage common foliar diseases and potentially improve yields. (pioneer.com)
  • Planting the correct maturity group is critical to maximizing soybean yields when planting in June. (msu.edu)
  • Can you buy your way to greater soybean yields with more inputs? (umn.edu)
  • Phytophthora is the #1 disease that suppresses soybean yields. (valent.com)
  • In addition to overseeing the USB, AMS provides critical market data that supports the marketing of soybeans and soy products through USDA Market News . (usda.gov)
  • USDA announced a fresh batch of soybean sales Thursday. (agriculture.com)
  • China has bought more than 2.1 million tonnes of U.S. soybeans since resuming purchases in early September, according to USDA data. (reuters.com)
  • The increase in U.S. soybean exports partly offsets reduced export prospects for South America resulting from drought-reduced soybean crops, the USDA report said. (ibtimes.com)
  • The USDA projection of global soybean inventories came in slightly higher at 55.5 million tons than the 55.3 million ton consensus of analysts surveyed by Bloomberg. (ibtimes.com)
  • China has not been an active buyer of U.S. soybeans in recent weeks and the world's top importer has yet to take delivery on at least 3 million tonnes of U.S. soybeans that buyers there have purchased, according to the USDA. (reuters.com)
  • There are 19.89 g of carbohydrates in 1 cup of cooked, green soybeans and 56.28 g of carbohydrates in 1 cup of dry roasted soybeans, according to the USDA Agricultural Research Service Nutrient Data Lab. (livestrong.com)
  • CATCH THE BUZZ - The Minnesota Department Of Agriculture Says It Received 253 Complaints From Soybean Growers Last Season. (beeculture.com)
  • In addition, coupled with Ignite herbicide, LibertyLink soybeans can help growers manage which modes of action they are using on entire fields to prevent weed resistance issues from popping up. (agweb.com)
  • Purdue University researchers have identified two genes within the soybean genome that are highly resistant to a soilborne pathogen that causes Phytophthora root and stem rot, a disease that costs U.S. soybean growers more than $250 million annually in lost yield. (purdue.edu)
  • But soybean growers face a challenge. (eurekalert.org)
  • Growers are typically paid based on the weight of soybeans they deliver to buyers," says Diers, a researcher at the University of Illinois at Urbana-Champaign. (eurekalert.org)
  • In the United States , soybean products such as tofu, miso, and soy milk have become especially popular in lowfat and vegetarian diets (see vegetarianism ). (encyclopedia.com)
  • Population growth is also driving up the demand for soybeans, either indirectly through the consumption of livestock products or directly through the consumption of tofu, miso, and tempeh. (treehugger.com)
  • Foods made with soybeans, such as soy milk, soy burgers and tofu. (emagazine.com)
  • Soybeans are also used to make traditional foods such as tofu, tempeh, miso soup and soy flour. (livestrong.com)
  • I regularly consume soy products like soy milk , tofu and okara , not to mention fermented soybean products like natto and tempeh. (justhungry.com)
  • Traditional unfermented food uses of soybeans include soy milk , from which tofu and tofu skin are made. (wikipedia.org)
  • MUMBAI, Oct 18 (Reuters) - Indian soybean and soyoil futures were treading water on Friday as profit-taking driven by a likely rise in soybean supplies offset healthy demand for edible oils due to festivals. (yahoo.com)
  • Soybeans futures prices and soybeans options prices listed along with commodity summary information. (agriculture.com)
  • Soybean futures surged to four-year highs following another weekend of heavy rain in the Midwest and a forecast for more rain this week. (latimes.com)
  • SHANGHAI, Dec 27 (Reuters) - U.S. soybean futures rose in early trade on Friday, hovering below an 18-month high hit in the previous session, as bullish hopes that China will ramp up soy purchases following a recently struck trade deal supported the market. (reuters.com)
  • Soybean futures were up Tuesday, according to the CME Group. (ibtimes.com)
  • and in the past were traded on: Central Japan Commodity Exchange (C-COM) Fukuoka Futures Exchange (FFE) The Japanese contracts called "IOM soybeans" are unsegregated, meaning any mixture of genetically modified and not. (wikipedia.org)
  • Soybean futures for March delivery dropped 0.1 percent to $13.865 a bushel. (bloomberg.com)
  • CHICAGO (Reuters) - U.S. soybean futures plunged to 9-1/2-month lows on Wednesday, after a media report renewed fears that China could hit U.S. soybeans with retaliatory tariffs if Washington follows through on threats to slap duties on Chinese goods, traders and analysts said. (reuters.com)
  • Benchmark Chicago Board of Trade July soybean futures closed down 1.9 percent on Wednesday at $9.36 a bushel after touching a low of $9.34-1/4, the lowest for a most active contract month since Aug. 31. (reuters.com)
  • From 2005 to 2016, soybean producers in Ohio have not had to consider managing this disease. (osu.edu)
  • The country imported more than 36 million tonnes of U.S. soybeans in the 2016/17 season, according to U.S. Department of Agriculture data. (reuters.com)
  • Soybeans are by far the most valuable U.S. agricultural export, with $22.8 billion in shipments in 2016. (dailymail.co.uk)
  • According to the US Department of Agriculture, more than 90 percent of the soybeans churned out on US farms each year are genetically engineered to withstand herbicides, nearly all of them involving one called Roundup. (jazzledazzlecrafts.com)
  • In April, floods inundated key farm areas of Argentina, the world's third-biggest exporter of raw soybeans, prompting the U.S. Department of Agriculture to slash its forecast for soybean output to 56.5 million metric tons this year. (mercopress.com)
  • According to the United States Department of Agriculture Economic Research Service, farmers planted 77.4 million acres of soybeans last year and harvested 3.3 million bushels valued at $38.6 billion. (uga.edu)
  • But the Purdue team made its discovery looking for a genetic answer to another soybean problem, said Hughes, a U.S. Department of Agriculture plant pathologist and adjunct professor in Purdue's Department of Botany and Plant Pathology. (purdue.edu)
  • Still, Brazilian crushers need the soybeans, especially as the next harvest is expected to be delayed by dry weather. (yahoo.com)
  • Soybeans are packed with nutrition, includes how to grow soybeans, when to harvest, how to cook soybeans and a nutritional breakdown of this wonder bean. (motherearthnews.com)
  • The world soybean harvest reached a record 214 million tons in 2005, the latest year with data, an increase of 4.4 percent from 2004.1 (See Figure 1. (worldwatch.org)
  • WINNIPEG , March 30, 2012 /CNW/ - Before deciding to buy Canadian soybeans, many customers prefer to review quality data like the Canadian Grain Commission's annual harvest quality report. (newswire.ca)
  • Harvest quality reports are an important tool to market Canadian soybeans to domestic and export customers. (newswire.ca)
  • Young soybeans, known as edamame, are commonly steamed or boiled and eaten directly from the pod. (britannica.com)
  • Soybeans are used whole as a vegetable called edamame. (livestrong.com)
  • The best for delicious, fresh-from-the-garden edamame, Midori Giant is the biggest and earliest soybean available for home gardens. (parkseed.com)
  • And green soybeans or edamame are always a great snack. (justhungry.com)
  • CATCH THE BUZZ - What kind of insect pollinators are commonly found in corn and soybean fields? (beeculture.com)
  • Heavy and frequent rainfall can make timely corn and soybean planting a challenge. (umn.edu)
  • Here we report a reference-grade genome of wild soybean accession W05, with a final assembled genome size of 1013.2 Mb and a contig N50 of 3.3 Mb. (nature.com)
  • Although reference genomes are currently available for two soybean cultivars, the Williams 82 (Wm82) genome has been most commonly used for a range of applications 4 , 5 . (nature.com)
  • A high-quality reference genome from wild soybean is also a crucial tool for use in such studies, because it increases the precision of population genetic analysis of complicated genomes. (nature.com)
  • We have previously reported whole-genome sequencing data for wild and cultivated soybeans, and demonstrated the high genome diversity in wild soybean populations compared with cultivated soybean 9 . (nature.com)
  • In resolution of this important issue, we report here a high-quality genome for the wild soybean accession W05. (nature.com)
  • State-of-the-art whole-genome sequencing technologies were used to assemble a high-quality reference genome for wild soybean accession W05 with long contigs and high sequence fidelity. (nature.com)
  • This book examines the application of soybean genome sequences to comparative, structural, and functional genomics. (springer.com)
  • Further, the book shows how the genome sequence influences research in the areas of genetic mapping, marker development, and genome-wide association mapping for identifying important trait genes and soybean breeding. (springer.com)
  • Given the pending release of the soybean genome sequence, through the efforts of the Department of Energy's Joint Genome Institute, this book will stand as a critical source of information on soybean. (springer.com)
  • Because the soybean plant's own genetic resistance to Phytophthora sojae has proven to be the best way to control the pathogen, the mapping of the soybean genome in recent years has improved the odds of finding other resistant genes. (purdue.edu)
  • There are about 46,000 predicted gene models in what we call the reference soybean genome," Ma said. (purdue.edu)
  • The EU's pledge to import more soybeans from US farmers was the 'dealmaker' in the agreement between European Commission President Jean-Claude Juncker and US President Donald Trump to stop the dispute and open trade talks, EU sources told EURACTIV. (euractiv.com)
  • If successful, the massive infrastructure project would expand Peru's trade options and give Brazil's soybean farmers a cheaper, more direct route to China than the increasingly expensive shipping through the Panama Canal. (fastcompany.com)
  • Farmers will be planting even less corn than expected as the soybean takes its turn as the darling of agriculture this year, according to a key government report released Monday that also points to higher food prices at the supermarket. (cnbc.com)
  • Comprising 70 soybean farmers, the USB facilitates trade servicing and technical support programs with importers, processors, livestock producers, and aquaculture operations. (usda.gov)
  • AMS administers a wide range of programs and services that create domestic and international marketing opportunities for U.S. producers of food, fiber, and specialty crops - including soybean farmers. (usda.gov)
  • Thanks to consistent quality and the hard work and dedication of soybean farmers, with support from AMS and the USB, the U.S. soy industry continues to reach new heights in producing soybean products to help feed the world. (usda.gov)
  • Some 3,000 years ago, farmers in eastern China domesticated the soybean. (treehugger.com)
  • Soybean production has also fallen recently as some farmers have switched from growing soybeans to growing higher-priced corn. (ibtimes.com)
  • The high prices are good for U.S. soybean farmers, and China is expected to increase soybean imports dramatically this year, according to Murphy. (ibtimes.com)
  • The goal of the collaborative project is to not only find genes that would keep soybeans safer, but to find other ways to help farmers in the field. (uga.edu)
  • But Georgia farmers grew 500,000 acres of soybeans in 2009, worth $168.4 million. (uga.edu)
  • Phytophthora sojae has been a problem for Indiana soybean farmers since it was first found in the state in 1948. (purdue.edu)
  • This has the potential to provide a higher profit margin for soybean farmers, as well as reducing the use of harmful chemicals and promoting a cleaner environment," Ma said. (purdue.edu)
  • One fifth of beef and soybean exports from Brazil to the European Union is produced on land that was illegally deforested, according to a report published in Science magazine on Thursday (16 July). (euractiv.com)
  • The American, Argentine, and Brazilian economies have all benefited from this strong, consistent demand in soybean exports to China. (fastcompany.com)
  • SAO PAULO, Brazil -- Chinese officials lifted a ban on Brazilian soybean exports following a four-and-a-half-hour meeting in Beijing, the Brazilian government said. (wsj.com)
  • For six decades, the United States was both the leading producer and exporter of soybeans, but in 2011 Brazil's exports narrowly eclipsed those from the United States. (treehugger.com)
  • As we move through the early spring, and we continue to see the reports of the affects of the drought in Brazil and Argentina, it's not surprising that there's an increase in exports, said Danny Murphy, American Soybean Association first vice president. (ibtimes.com)
  • Soybean exports are expected to fall for Argentina, Brazil, Paraguay and Uruguay, while soybean imports are also expected to drop for several nations, including Vietnam, Iran and Mexico. (ibtimes.com)
  • With a 63% market share, the United States is the largest soybean supplier to Japan, with exports totaling $976 million in 2017. (ustr.gov)
  • They offer all of the nourishment of yellow soybeans and then some, including the naturally occurring isoflavone nutrients genistein, daidzein, and glycetein - 40 mg per half cup serving. (edenfoods.com)
  • Chart: Nutrients contained in soybeans. (motherearthnews.com)
  • Learn about growing, harvesting and cooking soybeans and the high nutrients available in this versatile plant. (motherearthnews.com)
  • Rich in nutrients, soybeans are very easy to grow. (parkseed.com)
  • In Alabama, yield losses of up to 60 percent have been observed in commercial soybean fields. (osu.edu)
  • Whether yield can be saved by spraying at this time is questionable, and depends on environmental conditions, value of the soybean, and cost of insecticide application. (osu.edu)
  • Damaged soybeans reduce yield, and honey bee visitation. (beeculture.com)
  • For example, stem canker can cause severe yield losses in soybeans, but results of fungicide applications have often been inconsistent. (pioneer.com)
  • Average soybean yield response to foliar fungicide across DuPont Pioneer on-farm trials conducted from 2007 to 2011. (pioneer.com)
  • As a result, many soybean fields will be planted in June and producers need to implement specific management practices to maximize the yield potential of late-planted soybeans. (msu.edu)
  • This disease causes poor seed quality and suppresses yield in most soybean-growing countries. (hindawi.com)
  • This disease causes poor seed quality and suppresses yield in most soybean-growing countries, especially in the mid-southern region of the United States [ 2 , 3 ]. (hindawi.com)
  • The world demand for soybeans is increasing by some 7 million tons per year. (treehugger.com)
  • Satisfying the climbing global demand for soybeans poses a huge challenge. (treehugger.com)
  • Herbicide recommendations for management of noxious pigweeds in corn, soybean, and forages. (psu.edu)
  • In the United States the majority of soybean crops are genetically modified for resistance to the herbicide glyphosate. (britannica.com)
  • Increasing illness parallels the introduction and spread of GM soybeans tolerant to Monsanto's glyphosate-based herbicide, Roundup. (i-sis.org.uk)
  • LibertyLink soybeans, the only nonselective, herbicide-tolerant trait alternative to Roundup Ready soybeans, are on track to be released for the 2009 growing season. (agweb.com)
  • At this time, there are no specific biocontrol agents available that will prevent economic losses if aphid populations get off to a good start in soybean fields. (osu.edu)
  • Also, Erin saw a small plot with increasing soybean aphid populations - it was also noted in other research plots compared to last week. (iastate.edu)
  • Soybean aphid populations reach threshold in Iowa and japanese beetles are becoming an increasing problem for both soybean and corn. (iastate.edu)
  • Quote:Acutally HeadHen the compound in rasw soybeans is a Trypsin Inhibitor that prevents the Trypsin excreted in the gut of monogastrics to cleave various bonds in the proteins found in Soybeans. (backyardchickens.com)
  • All forms of Soybean Meals are heated in some manner to destroy the Trypsin Inhibitor. (backyardchickens.com)
  • Cultivars of soybeans have been shown to differ in expression of symptoms. (wikipedia.org)
  • The discovery, made by a team of scientists led by Jianxin Ma and Teresa Hughes, could lead to the development of soybean cultivars better able to withstand the pathogen Phytophthora sojae . (purdue.edu)
  • During its three years of study the Purdue researchers have developed molecular "markers" - identifying tags - that can be used to expedite the transfer of the resistant genes to soybean cultivars. (purdue.edu)
  • PSD has been exacerbated in recent years because of the use of the early soybean production system (ESPS), which generally involves planting of early-maturing cultivars in April to avoid the late-season droughts typical of the region in the mid-southern USA [ 14 ]. (hindawi.com)
  • The United States has supplanted Brazil as the European Union's top supplier of soybeans since a deal in July with President Donald Trump to avert a trade war, according to EU data seen by Reuters on Thursday (20 September). (euractiv.com)
  • The thought is that we lose about half a billion dollars to this pathogen in soybean alone. (uga.edu)
  • The pathogen thrives in wet, cool conditions and produces spores that move in water and onto soybean roots. (purdue.edu)
  • Phomopsis seed decay (PSD) of soybean is caused primarily by the fungal pathogen Phomopsis longicolla Hobbs along with other Phomopsis and Diaporthe spp. (hindawi.com)
  • The research on PSD including pathogen characterization, germplasm screening, and genetic resistance in the USA were summarized and presented at the World Soybean Research Conference VII in 2009 [ 21 ]. (hindawi.com)
  • The main soybean producers today, in round numbers, are the United States at 80 million tons, Brazil at 70 million tons, and Argentina at 45 million tons. (treehugger.com)
  • A network of 160 physicians, health workers and researchers in Argentina are demanding a ban on aerial spraying of pesticides based on increases in cancer and a range of pesticide-related illnesses since the introduction of genetically modified (GM) soybeans. (i-sis.org.uk)
  • Argentina could export up to 25% fewer soybeans this year than last, analysts said, after severe rains left many fields underwater, damaging oilseed quality. (mercopress.com)
  • The American Soybean Association (ASA) supports a strong global marketplace and is pleased the White House has finalized a trade agreement with Japan, a top 10 export market for soybeans. (ustr.gov)
  • However, today it imports more than 2.7 billion bushels- quite a change from 18 million 20 years ago-making China the world's largest importer of soybeans. (fastcompany.com)
  • In the most recent marketing year (2014 - 2015), about 59 percent of total U.S. soybean production was exported to international markets - that's a total of more than 2.3 billion bushels with an astounding value of more than $24 billion. (usda.gov)
  • Is most evident as soybean plants reach maturity though it may also appear on young plants. (pioneer.com)
  • With more than 80 leading seed companies poised to market LibertyLink soybeans, the highestyielding soybeans with a wide maturity range will be available-0.5 to 4.9. (agweb.com)
  • Also, remember that soybean maturity is delayed by one day for every three to four days that planting is delayed, increasing your risk of frost or freeze injury in the fall. (msu.edu)
  • Soybean maturity zones in Michigan. (msu.edu)
  • Modifications of optimum adaption zones for soybean maturity groups in the USA. (msu.edu)
  • In 1995, China grew their own soybeans for use in food and livestock feed and imported only 18 million bushels. (fastcompany.com)
  • Yes, such a railroad through the heart of the Amazon would shorten times for soybean shipping between Brazil and mainland China, and bypassing the Panama Canal to ship across South America and then from a Peruvian port would likely save the Chinese money. (fastcompany.com)
  • It needs to buy almost every soybean grown in South America. (fastcompany.com)
  • Total U.S. soybean sales to China, however, remain well below normal as importers have sourced the majority of their soybeans from South America since the trade war with the United States erupted last year. (reuters.com)
  • Warm weather and a drought in South America cut soybean production there and contributed to global oil seed production falling 5.2 million tons, the agency said. (ibtimes.com)
  • Experts predict this insatiable appetite could outstrip the entire global production of soybeans-including in the U.S. and Brazil-within a decade. (fastcompany.com)
  • In Brazil, the area in soybeans exceeds that of all grains combined. (treehugger.com)
  • Bloomberg) -- The U.S. has started selling soybeans to Brazil after the world's top exporter lowered import tariffs in order to bridge a domestic shortage. (yahoo.com)
  • Brazil is facing a domestic shortage of soybeans after shipping a record amount of the oilseed to China, the world's biggest buyer. (yahoo.com)
  • A decade ago, the United States supplied 38 percent of soybeans to China, the world's top importer, compared to 34 percent from Brazil. (dailymail.co.uk)
  • The U.S. soy industry continues to reach new heights in producing soybean products to help feed the world. (usda.gov)
  • Studies on the morphology, physiology and cytogenetics of cultivated, semi-cultivated and wild soybeans. (springer.com)
  • Sixty percent of all soybeans grown worldwide are now exported to China, with 5% to 8% growth per year and no signs of slowing down . (fastcompany.com)
  • Most soybean that is now grown are engineered to enable the crops to withstand doses of herbicides that would otherwise kill them. (backyardchickens.com)
  • Vast acreages of soybeans are grown as fodder for cattle and pigs. (motherearthnews.com)
  • In short, organically grown soybeans are probably one of the most eco-friendly and nutritious foods you can eat. (motherearthnews.com)
  • The remaining 9 percent or so of soybeans are conventionally grown, but not genetically modified. (jazzledazzlecrafts.com)
  • Studies in North Dakota have compared many inoculums brands in fields where soybeans previously were grown and successfully inoculated. (ndsu.edu)
  • Many of the states on the grant are from the Midwest because most of the nation's soybeans are grown there. (uga.edu)
  • 1 The subgenus Soja includes the soybean, G. max (L.) Merr. (springer.com)
  • and its closest relative, the wild soybean, G. soja Sieb. (springer.com)
  • Typically thrips feeding alone on soybean plants does not cause economic damage, however it may if the plant is under some other form of stress. (wikipedia.org)
  • Soybean and kudzu are the most common host plants in the United States. (osu.edu)
  • Symptoms of rust in the lower canopy of soybean plants (A). Soybean field severely affected by soybean rust in Alabama, U.S. (B) ( Photo courtesy of Dr. Ed Sikora, Auburn University ). (osu.edu)
  • Purdue researchers found that honeybees collect pollen from a wide range of plants, even in areas dominated by corn and soybeans. (beeculture.com)
  • Infection of soybean plants typically occurs early in the spring when soil moisture is high. (pioneer.com)
  • The large plant size of soybean is advantageous to such studies, and permits the use of techniques that are difficult or impossible for practice on smaller plants. (springer.com)
  • People who are allergic to peanuts, soybeans and other plants that are members of the Fabaceae/Leguminosea family might also be allergic to soybean oil. (medicinenet.com)
  • The soybean may be cultivated in most types of soil , but it thrives in warm, fertile, well-drained, sandy loam. (britannica.com)
  • Whenever possible, plant soybean seed into at least 0.5 inches of uniform soil moisture. (msu.edu)
  • Iwai K, Nakaya N, Kawasaki Y, Matsue H: Antioxidative functions of natto, a kind of fermented soybeans: Effect on LDL oxidation and lipid metabolism in cholesterol-fed rats. (acupuncturetoday.com)
  • Intake of fermented soybean (natto) increases circulating vitamin K2 (menaquinone-7) and gamma-carboxylated osteocalcin concentration in normal individuals. (acupuncturetoday.com)
  • Aaron Collins, regional manger for seed producer Precision Soya in Farmer City, IL, has worked with LibertyLink soybeans for the past two years. (agweb.com)
  • Chinese importers have defaulted on U.S. and Brazilian soybean cargoes worth around $300 million, the biggest in a decade. (cnbc.com)
  • The Brazilian market just keeps going up so crushers will find ways to bring in soybeans from the U.S.," said Tarso Veloso, an analyst at Chicago-based AgResource. (yahoo.com)
  • The annual Soybean Transportation Guide provides a snapshot of Brazilian soybean transportation. (usda.gov)
  • Soybean prices have risen almost 25 percent since the start of the year due to heat and drought that have severely damaged Brazilian crops, the Des Moines Register reported. (ibtimes.com)
  • Brazilian soybean production will fall because of warm temperatures and a lack of rainfall since late February in the southern state of Rio Grande do Sul, the report said. (ibtimes.com)
  • Such findings illustrate the power of this assembly in the analysis of large structural variations in soybean germplasm collections. (nature.com)
  • The Soybean/maize Germplasm, Pathology, and Genetics Research is located in Urbana, IL and is part of the Midwest Area . (usda.gov)
  • Naturally occurring Phytophthora sojae resistance exists in soybean germplasm. (purdue.edu)
  • The drought tolerance of soybeans is a special asset, as water is becoming an increasingly precious resource. (motherearthnews.com)
  • Argentine and Paraguayan soybean production is also expected to fall due to drought. (ibtimes.com)
  • Bacterial diseases such as bacterial blight or bacterial pustule, and viral diseases such as the soybean vein necrosis virus are not controlled by fungicides. (pioneer.com)
  • China, the world's largest consumer of soybeans, and the United States struck a "Phase 1" trade deal that includes a commitment by Beijing to increase purchases of U.S. agricultural products. (reuters.com)
  • The cultivated soybean plant is an erect, bushy annual. (encyclopedia.com)
  • The soybean is an erect branching plant and can reach more than 2 metres (6.5 feet) in height. (britannica.com)
  • Soybeans are usually harvested mechanically, after the leaves have fallen off the plant and the moisture content of the seed has dropped to 13 percent, permitting safe storage. (britannica.com)
  • The extensive genetic resources of soybean and the associated physiological tools available to scientists present a set of unique opportunities to study areas ranging from seed development, to the biology of polyploidization, to a huge array of pathogenic and symbiotic plant-host interactions. (springer.com)
  • The process of soybean infection by N-fixing bacteria and symbiotic N fixation is a complex process between the bacteria and the plant. (ndsu.edu)
  • A soybean plant flourishes under the grow lights in Wayne Parrott's lab. (uga.edu)
  • Soybeans grow on a plant at a UGA lab in Athens. (uga.edu)
  • Diseased roots form lesions that can move up the stem and kill the entire soybean plant. (purdue.edu)
  • Plant sterols, chemicals derived from soybean oil, are used to lower total cholesterol and "bad" low-density lipoprotein (LDL) cholesterol. (medicinenet.com)
  • Soybean oil plant sterols used in margarine seem to help lower total cholesterol and "bad" LDL cholesterol without affecting "good" HDL . (medicinenet.com)
  • The DNA in soybean cells - as in all plant and animal cells - is packaged into structures called chromosomes. (eurekalert.org)
  • 2. A soybean plant produced by growing the seed of claim 1. (freepatentsonline.com)
  • 5. A soybean plant having all of the physiological and morphological characteristics of the soybean plant designated 0585540, wherein seed of 0585540 has been deposited as ATCC accession No. 75732. (freepatentsonline.com)
  • 7. A soybean plant with all of the physiological and morphological characteristics of the soybean plant designated 0585540, seed of which has been deposited as ATCC accession No. 75732, said soybean plant produced by the tissue culture process using soybean plant 0585540 as the starting material of such a process. (freepatentsonline.com)
  • In the two leading consumers of soybeans, the United States and China, populations are growing by 3 million and 6 million per year, respectively. (treehugger.com)
  • It is being driven primarily by the 3 billion people who are moving up the food chain, consuming more grain- and soybean-intensive livestock products. (treehugger.com)
  • Studies on rats fed SBA had complex changes: With increasing doses of soybean agglutinin, the activities of aspartate aminotransferase linearly increased in plasma and decreased plasma insulin content without decrease in blood glucose levels. (wikipedia.org)
  • PSD severely affects soybean seed quality due to reduction in seed viability and oil content, alteration of seed composition, and increased frequencies of moldy and/or split beans [ 4 - 7 ]. (hindawi.com)
  • Soybeans were introduced into the United States in 1804 and became particularly important in the South and Midwest in the mid-20th century. (britannica.com)
  • Commodity prices surged, led by soybeans in the flood-ravaged Midwest and oil in New York. (latimes.com)
  • If these two genes are effectively used in Indiana and other Midwest soybean crops, an annual net increase in soybean production would be anticipated. (purdue.edu)
  • Uses a dual mode of action to protect soybeans from Pythium and Phytophthora. (valent.com)
  • Soybean producers can use this information to help adjust their management practices and make informed decisions for late-planted soybeans. (msu.edu)
  • Working through the U.S. Soybean Export Council , the USB annually conducts about 140 projects in international markets to promote U.S. soy products. (usda.gov)
  • Whole fermented soybeans are widely available at Asian markets, specialty stores and some supermarkets. (acupuncturetoday.com)
  • He doesn't know that soybean prices have spiked this year because China has recently restricted imports. (wsj.com)
  • The tariff waiver on soybean imports will last until Jan. 15 and the suspension for corn until March 31. (yahoo.com)
  • The Commission is set to offer Washington a way out from current trade tensions with China authorising imports of soybeans from the US to produce biofuels. (euractiv.com)
  • For these and additional reasons, soybean genomic research has seen major advances in recent years. (springer.com)
  • Genetics and Genomics of Soybean chronicles advances in soybean genomic research, while addressing and anticipating the potential for future discoveries in a rapidly evolving field. (springer.com)
  • Together they account for over four fifths of world soybean production. (treehugger.com)
  • The principal effect of soaring world soybean consumption has been a restructuring of agriculture in the western hemisphere. (treehugger.com)
  • Unfortunately, if world soybean consumption continues to climb at a rapid rate, the economic pressures to clear more land could become intense. (treehugger.com)
  • A breakthrough by CSIRO-led scientists has made the world's strongest material more commercially viable, thanks to the humble soybean. (www.csiro.au)
  • Until fairly recently I had a blind spot when it came to the humble soybean. (justhungry.com)