A protein which is a subunit of RNA polymerase. It effects initiation of specific RNA chains from DNA.
Any of the processes by which cytoplasmic or intercellular factors influence the differential control of gene action in bacteria.
A class of cell surface receptors recognized by its pharmacological profile. Sigma receptors were originally considered to be opioid receptors because they bind certain synthetic opioids. However they also interact with a variety of other psychoactive drugs, and their endogenous ligand is not known (although they can react to certain endogenous steroids). Sigma receptors are found in the immune, endocrine, and nervous systems, and in some peripheral tissues.
A DNA-directed RNA polymerase found in BACTERIA. It is a holoenzyme that consists of multiple subunits including sigma factor 54.
Proteins found in any species of bacterium.
Enzymes that catalyze DNA template-directed extension of the 3'-end of an RNA strand one nucleotide at a time. They can initiate a chain de novo. In eukaryotes, three forms of the enzyme have been distinguished on the basis of sensitivity to alpha-amanitin, and the type of RNA synthesized. (From Enzyme Nomenclature, 1992).
A species of gram-positive bacteria that is a common soil and water saprophyte.
In eukaryotes, a genetic unit consisting of a noncontiguous group of genes under the control of a single regulator gene. In bacteria, regulons are global regulatory systems involved in the interplay of pleiotropic regulatory domains and consist of several OPERONS.
The functional hereditary units of BACTERIA.
The biosynthesis of RNA carried out on a template of DNA. The biosynthesis of DNA from an RNA template is called REVERSE TRANSCRIPTION.
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
DNA sequences which are recognized (directly or indirectly) and bound by a DNA-dependent RNA polymerase during the initiation of transcription. Highly conserved sequences within the promoter include the Pribnow box in bacteria and the TATA BOX in eukaryotes.
The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.
A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.
In bacteria, a group of metabolically related genes, with a common promoter, whose transcription into a single polycistronic MESSENGER RNA is under the control of an OPERATOR REGION.
Heat and stain resistant, metabolically inactive bodies formed within the vegetative cells of bacteria of the genera Bacillus and Clostridium.
Endogenous substances, usually proteins, which are effective in the initiation, stimulation, or termination of the genetic transcription process.
The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.
Proteins obtained from ESCHERICHIA COLI.
Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.
Deoxyribonucleic acid that makes up the genetic material of bacteria.
A constellation of responses that occur when an organism is exposed to excessive heat. Responses include synthesis of new proteins and regulation of others.
Catalytically active enzymes that are formed by the combination of an apoenzyme (APOENZYMES) and its appropriate cofactors and prosthetic groups.
Proteins which are synthesized in eukaryotic organisms and bacteria in response to hyperthermia and other environmental stresses. They increase thermal tolerance and perform functions essential to cell survival under these conditions.
A genetic rearrangement through loss of segments of DNA or RNA, bringing sequences which are normally separated into close proximity. This deletion may be detected using cytogenetic techniques and can also be inferred from the phenotype, indicating a deletion at one specific locus.
Ribonucleic acid in bacteria having regulatory and catalytic roles as well as involvement in protein synthesis.
A form-genus of unicellular CYANOBACTERIA in the order Chroococcales. None of the strains fix NITROGEN, there are no gas vacuoles, and sheath layers are never produced.
Mutagenesis where the mutation is caused by the introduction of foreign DNA sequences into a gene or extragenic sequence. This may occur spontaneously in vivo or be experimentally induced in vivo or in vitro. Proviral DNA insertions into or adjacent to a cellular proto-oncogene can interrupt GENETIC TRANSLATION of the coding sequences or interfere with recognition of regulatory elements and cause unregulated expression of the proto-oncogene resulting in tumor formation.
The first nucleotide of a transcribed DNA sequence where RNA polymerase (DNA-DIRECTED RNA POLYMERASE) begins synthesizing the RNA transcript.
Salts of alginic acid that are extracted from marine kelp and used to make dental impressions and as absorbent material for surgical dressings.
The in vitro fusion of GENES by RECOMBINANT DNA techniques to analyze protein behavior or GENE EXPRESSION REGULATION, or to merge protein functions for specific medical or industrial uses.
The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.
A species of gram-negative, aerobic, rod-shaped bacteria commonly isolated from clinical specimens (wound, burn, and urinary tract infections). It is also found widely distributed in soil and water. P. aeruginosa is a major agent of nosocomial infection.
The first mixed agonist-antagonist analgesic to be marketed. It is an agonist at the kappa and sigma opioid receptors and has a weak antagonist action at the mu receptor. (From AMA Drug Evaluations Annual, 1991, p97)
The degree of pathogenicity within a group or species of microorganisms or viruses as indicated by case fatality rates and/or the ability of the organism to invade the tissues of the host. The pathogenic capacity of an organism is determined by its VIRULENCE FACTORS.
A test used to determine whether or not complementation (compensation in the form of dominance) will occur in a cell with a given mutant phenotype when another mutant genome, encoding the same mutant phenotype, is introduced into that cell.
A soil-dwelling actinomycete with a complex lifecycle involving mycelial growth and spore formation. It is involved in the production of a number of medically important ANTIBIOTICS.
A whiplike motility appendage present on the surface cells. Prokaryote flagella are composed of a protein called FLAGELLIN. Bacteria can have a single flagellum, a tuft at one pole, or multiple flagella covering the entire surface. In eukaryotes, flagella are threadlike protoplasmic extensions used to propel flagellates and sperm. Flagella have the same basic structure as CILIA but are longer in proportion to the cell bearing them and present in much smaller numbers. (From King & Stansfield, A Dictionary of Genetics, 4th ed)
The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.
A group of enzymes that catalyzes the hydrolysis of terminal, non-reducing beta-D-galactose residues in beta-galactosides. Deficiency of beta-Galactosidase A1 may cause GANGLIOSIDOSIS, GM1.
Term used to designate tetrahydroxy aldehydic acids obtained by oxidation of hexose sugars, i.e. glucuronic acid, galacturonic acid, etc. Historically, the name hexuronic acid was originally given to ascorbic acid.
Proteins which bind to DNA. The family includes proteins which bind to both double- and single-stranded DNA and also includes specific DNA binding proteins in serum which can be used as markers for malignant diseases.
A sugar acid formed by the oxidation of the C-6 carbon of GLUCOSE. In addition to being a key intermediate metabolite of the uronic acid pathway, glucuronic acid also plays a role in the detoxification of certain drugs and toxins by conjugating with them to form GLUCURONIDES.
Presence of warmth or heat or a temperature notably higher than an accustomed norm.
The genetic complement of a BACTERIA as represented in its DNA.
The arrangement of two or more amino acid or base sequences from an organism or organisms in such a way as to align areas of the sequences sharing common properties. The degree of relatedness or homology between the sequences is predicted computationally or statistically based on weights assigned to the elements aligned between the sequences. This in turn can serve as a potential indicator of the genetic relatedness between the organisms.
A species of gram-negative bacteria and nitrogen innoculant of PHASEOLUS VULGARIS.
Extrachromosomal, usually CIRCULAR DNA molecules that are self-replicating and transferable from one organism to another. They are found in a variety of bacterial, archaeal, fungal, algal, and plant species. They are used in GENETIC ENGINEERING as CLONING VECTORS.
The process in which substances, either endogenous or exogenous, bind to proteins, peptides, enzymes, protein precursors, or allied compounds. Specific protein-binding measures are often used as assays in diagnostic assessments.
A protein with a molecular weight of 40,000 isolated from bacterial flagella. At appropriate pH and salt concentration, three flagellin monomers can spontaneously reaggregate to form structures which appear identical to intact flagella.
The unfavorable effect of environmental factors (stressors) on the physiological functions of an organism. Prolonged unresolved physiological stress can affect HOMEOSTASIS of the organism, and may lead to damaging or pathological conditions.
Guanosine 5'-diphosphate 2'(3')-diphosphate. A guanine nucleotide containing four phosphate groups. Two phosphate groups are esterified to the sugar moiety in the 5' position and the other two in the 2' or 3' position. This nucleotide serves as a messenger to turn off the synthesis of ribosomal RNA when amino acids are not available for protein synthesis. Synonym: magic spot I.
The pressure required to prevent the passage of solvent through a semipermeable membrane that separates a pure solvent from a solution of the solvent and solute or that separates different concentrations of a solution. It is proportional to the osmolality of the solution.
Self-replicating cytoplasmic organelles of plant and algal cells that contain pigments and may synthesize and accumulate various substances. PLASTID GENOMES are used in phylogenetic studies.
A species of nonpathogenic fluorescent bacteria found in feces, sewage, soil, and water, and which liquefy gelatin.
A large family of signal-transducing adaptor proteins present in wide variety of eukaryotes. They are PHOSPHOSERINE and PHOSPHOTHREONINE binding proteins involved in important cellular processes including SIGNAL TRANSDUCTION; CELL CYCLE control; APOPTOSIS; and cellular stress responses. 14-3-3 proteins function by interacting with other signal-transducing proteins and effecting changes in their enzymatic activity and subcellular localization. The name 14-3-3 derives from numerical designations used in the original fractionation patterns of the proteins.
An opioid analgesic with actions and uses similar to MORPHINE. (From Martindale, The Extra Pharmacopoeia, 30th ed, p1095)
The sequential correspondence of nucleotides in one nucleic acid molecule with those of another nucleic acid molecule. Sequence homology is an indication of the genetic relatedness of different organisms and gene function.
A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.
A complex of cyclic peptide antibiotics produced by the Tracy-I strain of Bacillus subtilis. The commercial preparation is a mixture of at least nine bacitracins with bacitracin A as the major constituent. It is used topically to treat open infections such as infected eczema and infected dermal ulcers. (From Goodman and Gilman, The Pharmacological Basis of Therapeutics, 8th ed, p1140)
Use of restriction endonucleases to analyze and generate a physical map of genomes, genes, or other segments of DNA.
Proteases that contain proteolytic core domains and ATPase-containing regulatory domains. They are usually comprised of large multi-subunit assemblies. The domains can occur within a single peptide chain or on distinct subunits.
The parts of a macromolecule that directly participate in its specific combination with another molecule.
A species of gram-positive, aerobic bacteria that produces TUBERCULOSIS in humans, other primates, CATTLE; DOGS; and some other animals which have contact with humans. Growth tends to be in serpentine, cordlike masses in which the bacilli show a parallel orientation.
A serotype of Salmonella enterica that is a frequent agent of Salmonella gastroenteritis in humans. It also causes PARATYPHOID FEVER.
Process of generating a genetic MUTATION. It may occur spontaneously or be induced by MUTAGENS.
Genes which regulate or circumscribe the activity of other genes; specifically, genes which code for PROTEINS or RNAs which have GENE EXPRESSION REGULATION functions.
A species of gram-negative, aerobic bacteria that causes formation of root nodules on some, but not all, types of sweet clover, MEDICAGO SATIVA, and fenugreek.
The genetic unit consisting of three structural genes, an operator and a regulatory gene. The regulatory gene controls the synthesis of the three structural genes: BETA-GALACTOSIDASE and beta-galactoside permease (involved with the metabolism of lactose), and beta-thiogalactoside acetyltransferase.
An actinomycete from which the antibiotic CHLORTETRACYCLINE is obtained.
A sulfhydryl reagent which oxidizes sulfhydryl groups to the disulfide form. It is a radiation-sensitizing agent of anoxic bacterial and mammalian cells.
A theoretical representative nucleotide or amino acid sequence in which each nucleotide or amino acid is the one which occurs most frequently at that site in the different sequences which occur in nature. The phrase also refers to an actual sequence which approximates the theoretical consensus. A known CONSERVED SEQUENCE set is represented by a consensus sequence. Commonly observed supersecondary protein structures (AMINO ACID MOTIFS) are often formed by conserved sequences.
The determination of the pattern of genes expressed at the level of GENETIC TRANSCRIPTION, under specific circumstances or in a specific cell.
An integration host factor that was originally identified as a bacterial protein required for the integration of bacteriophage Q beta (ALLOLEVIVIRUS). Its cellular function may be to regulate mRNA stability and processing in that it binds tightly to poly(A) RNA and interferes with ribosome binding.
A species of gram-positive bacteria in the family Clostridiaceae, used for the industrial production of SOLVENTS.
Hybridization of a nucleic acid sample to a very large set of OLIGONUCLEOTIDE PROBES, which have been attached individually in columns and rows to a solid support, to determine a BASE SEQUENCE, or to detect variations in a gene sequence, GENE EXPRESSION, or for GENE MAPPING.
Recombinant proteins produced by the GENETIC TRANSLATION of fused genes formed by the combination of NUCLEIC ACID REGULATORY SEQUENCES of one or more genes with the protein coding sequences of one or more genes.
A protein which effects termination of RNA synthesis during the genetic transcription process by dissociating the ternary transcription complex RNA;-RNA POLYMERASE DNA at the termination of a gene.
Chemical compounds which yield hydrogen ions or protons when dissolved in water, whose hydrogen can be replaced by metals or basic radicals, or which react with bases to form salts and water (neutralization). An extension of the term includes substances dissolved in media other than water. (Grant & Hackh's Chemical Dictionary, 5th ed)
A family of signal transducing adaptor proteins that control the METABOLISM of NITROGEN. They are primarily found in prokaryotes.
A species of gliding bacteria found on soil as well as in surface fresh water and coastal seawater.
A species of gram-negative, aerobic bacteria that consist of slender vibroid cells.
A species of gram-negative, aerobic bacteria isolated from soil and water as well as clinical specimens. Occasionally it is an opportunistic pathogen.
The non-genetic biological changes of an organism in response to challenges in its ENVIRONMENT.
Proteins isolated from the outer membrane of Gram-negative bacteria.
The outward appearance of the individual. It is the product of interactions between genes, and between the GENOTYPE and the environment.
A sub-class of PEPTIDE HYDROLASES that act only near the ends of polypeptide chains.
Enzymes that catalyze the release of mononucleotides by the hydrolysis of the terminal bond of deoxyribonucleotide or ribonucleotide chains.
Proteins which maintain the transcriptional quiescence of specific GENES or OPERONS. Classical repressor proteins are DNA-binding proteins that are normally bound to the OPERATOR REGION of an operon, or the ENHANCER SEQUENCES of a gene until a signal occurs that causes their release.
A sequence of amino acids in a polypeptide or of nucleotides in DNA or RNA that is similar across multiple species. A known set of conserved sequences is represented by a CONSENSUS SEQUENCE. AMINO ACID MOTIFS are often composed of conserved sequences.
A genus of gram-negative, aerobic, rod-shaped bacteria usually containing granules of poly-beta-hydroxybutyrate. They characteristically invade the root hairs of leguminous plants and act as intracellular symbionts.
The first DNA-binding protein motif to be recognized. Helix-turn-helix motifs were originally identified in bacterial proteins but have since been found in hundreds of DNA-BINDING PROTEINS from both eukaryotes and prokaryotes. They are constructed from two alpha helices connected by a short extended chain of amino acids, which constitute the "turn." The two helices are held at a fixed angle, primarily through interactions between the two helices. (From Alberts et al., Molecular Biology of the Cell, 3d ed, p408-9)
Ability of a microbe to survive under given conditions. This can also be related to a colony's ability to replicate.
Diffusible gene products that act on homologous or heterologous molecules of viral or cellular DNA to regulate the expression of proteins.
Permanganic acid (HMnO4), potassium salt. A highly oxidative, water-soluble compound with purple crystals, and a sweet taste. (From McGraw-Hill Dictionary of Scientific and Technical Information, 4th ed)

Hyperproduction of alpha-hemolysin in a sigB mutant is associated with elevated SarA expression in Staphylococcus aureus. (1/2871)

To evaluate the role of SigB in modulating the expression of virulence determinants in Staphylococcus aureus, we constructed a sigB mutant of RN6390, a prototypic S. aureus strain. The mutation in the sigB gene was confirmed by the absence of the SigB protein in the mutant on an immunoblot as well as the failure of the mutant to activate sigmaB-dependent promoters (e.g., the sarC promoter) of S. aureus. Phenotypic analysis indicated that both alpha-hemolysin level and fibrinogen-binding capacity were up-regulated in the mutant strain compared with the parental strain. The increase in fibrinogen-binding capacity correlated with enhanced expression of clumping factor and coagulase on immunoblots. The effect of the sigB mutation on the enhanced expression of the alpha-hemolysin gene (hla) was primarily transcriptional. Upon complementation with a plasmid containing the sigB gene, hla expression returned to near parental levels in the mutant. Detailed immunoblot analysis as well as a competitive enzyme-linked immunosorbent assay of the cell extract of the sigB mutant with anti-SarA monoclonal antibody 1D1 revealed that the expression of SarA was higher in the mutant than in the parental control. Despite an elevated SarA level, the transcription of RNAII and RNAIII of the agr locus remained unaltered in the sigB mutant. Because of a lack of perturbation in agr, we hypothesize that inactivation of sigB leads to increased expression of SarA which, in turn, modulates target genes via an agr-independent but SarA-dependent pathway.  (+info)

General method of analysis of kinetic equations for multistep reversible mechanisms in the single-exponential regime: application to kinetics of open complex formation between Esigma70 RNA polymerase and lambdaP(R) promoter DNA. (2/2871)

A novel analytical method based on the exact solution of equations of kinetics of unbranched first- and pseudofirst-order mechanisms is developed for application to the process of Esigma70 RNA polymerase (R)-lambdaPR promoter (P) open complex formation, which is described by the minimal three-step mechanism with two kinetically significant intermediates (I1, I2), [equation: see text], where the final product is an open complex RPo. The kinetics of reversible and irreversible association (pseudofirst order, [R] >> [P]) to form long-lived complexes (RPo and I2) and the kinetics of dissociation of long-lived complexes both exhibit single exponential behavior. In this situation, the analytical method provides explicit expressions relating observed rate constants to the microscopic rate constants of mechanism steps without use of rapid equilibrium or steady-state approximations, and thereby provides a basis for interpreting the composite rate constants of association (ka), isomerization (ki), and dissociation (kd) obtained from experiment for this or any other sequential mechanism of any number of steps. In subsequent papers, we apply this formalism to analyze kinetic data obtained in the reversible and irreversible binding regimes of Esigma70 RNA polymerase (R)-lambdaP(R) promoter (P) open complex formation.  (+info)

Transient gene asymmetry during sporulation and establishment of cell specificity in Bacillus subtilis. (3/2871)

Sporulation in Bacillus subtilis is initiated by an asymmetric division generating two cells of different size and fate. During a short interval, the smaller forespore harbors only 30% of the chromosome until the remaining part is translocated across the septum. We demonstrate that moving the gene for sigmaF, the forespore-specific transcription factor, in the trapped region of the chromosome is sufficient to produce spores in the absence of the essential activators SpoIIAA and SpoIIE. We propose that transient genetic asymmetry is the device that releases SpoIIE phosphatase activity in the forespore and establishes cell specificity.  (+info)

The Escherichia coli Ada protein can interact with two distinct determinants in the sigma70 subunit of RNA polymerase according to promoter architecture: identification of the target of Ada activation at the alkA promoter. (4/2871)

The methylated form of the Ada protein (meAda) activates transcription from the Escherichia coli ada, aidB, and alkA promoters with different mechanisms. In this study we identify amino acid substitutions in region 4 of the RNA polymerase subunit sigma70 that affect Ada-activated transcription at alkA. Substitution to alanine of residues K593, K597, and R603 in sigma70 region 4 results in decreased Ada-dependent binding of RNA polymerase to the alkA promoter in vitro and impairs alkA transcription both in vivo and in vitro, suggesting that these residues define a determinant for meAda-sigma70 interaction. In a previous study (P. Landini, J. A. Bown, M. R. Volkert, and S. J. W. Busby, J. Biol. Chem. 273:13307-13312, 1998), we showed that a set of negatively charged amino acids in sigma70 region 4 is involved in meAda-sigma70 interaction at the ada and aidB promoters. However, the alanine substitutions of positively charged residues K593, K597, and R603 do not affect meAda-dependent transcription at ada and aidB. Unlike the sigma70 amino acids involved in the interaction with meAda at the ada and aidB promoters, K593, K597, and R603 are not conserved in sigmaS, an alternative sigma subunit of RNA polymerase mainly expressed during the stationary phase of growth. While meAda is able to promote transcription by the sigmaS form of RNA polymerase (EsigmaS) at ada and aidB, it fails to do so at alkA. We propose that meAda can activate transcription at different promoters by contacting distinct determinants in sigma70 region 4 in a manner dependent on the location of the Ada binding site.  (+info)

An intrinsic DNA curvature found in the cyanobacterium Microcystis aeruginosa K-81 affects the promoter activity of rpoD1 encoding a principal sigma factor. (5/2871)

The rpoD1 gene in the unicellular cyanobacterium Microcystis aeruginosa K-81 encodes a principal sigma factor of RNA polymerase and is transcribed under light and dark conditions to produce multiple monocistronic transcripts. In the 5'-upstream region from rpoD1 Promoter 2, which has a sequence of Escherichia coli type, we found a sequence-directed DNA curvature with an AT-rich sequence. Insertions of 2 to 21 base pairs introduced into the curved center changed a gross geometry of the original curved DNA structure. The rpoD1 promoter activities assayed in vivo by using transcriptional lacZ fusions were correlated with the change in the gross geometry in not only a cyanobacterium but also E. coli. In addition, RNA polymerase binding to the rpoD1 promoter region and the efficiency of the mRNA synthesis from the rpoD1 Promoter 2 were also affected in vitro by the change in the geometry. These results suggest that the tertiary structure of the curved DNA is important for the rpoD1 transcription. The deletion of the center region of the curvature resulted in a considerable reduction of the transcription from Promoter 2 in the cyanobacterium. This report demonstrates that a curved DNA plays a significant role in transcription in cyanobacteria, and that this functional curvature is located in the 5'-upstream region from the rpoD gene, which encodes a principal sigma factor in eubacteria.  (+info)

Bacillus subtilis spore coat. (6/2871)

In response to starvation, bacilli and clostridia undergo a specialized program of development that results in the production of a highly resistant dormant cell type known as the spore. A proteinacious shell, called the coat, encases the spore and plays a major role in spore survival. The coat is composed of over 25 polypeptide species, organized into several morphologically distinct layers. The mechanisms that guide coat assembly have been largely unknown until recently. We now know that proper formation of the coat relies on the genetic program that guides the synthesis of spore components during development as well as on morphogenetic proteins dedicated to coat assembly. Over 20 structural and morphogenetic genes have been cloned. In this review, we consider the contributions of the known coat and morphogenetic proteins to coat function and assembly. We present a model that describes how morphogenetic proteins direct coat assembly to the specific subcellular site of the nascent spore surface and how they establish the coat layers. We also discuss the importance of posttranslational processing of coat proteins in coat morphogenesis. Finally, we review some of the major outstanding questions in the field.  (+info)

Role of the alternative sigma factor sigmaS in expression of the AlkS regulator of the Pseudomonas oleovorans alkane degradation pathway. (7/2871)

The AlkS protein activates transcription from the PalkB promoter, allowing the expression of a number of genes required for the assimilation of alkanes in Pseudomonas oleovorans. We have identified the promoter from which the alkS gene is transcribed, PalkS, and analyzed its expression under different conditions and genetic backgrounds. Transcription from PalkS was very low during the exponential phase of growth and increased considerably when cells reached the stationary phase. The PalkS -10 region was similar to the consensus described for promoters recognized by Escherichia coli RNA polymerase bound to the alternative sigma factor sigmaS, which directs the expression of many stationary-phase genes. Reporter strains containing PalkS-lacZ transcriptional fusions showed that PalkS promoter is very weakly expressed in a Pseudomonas putida strain bearing an inactivated allele of the gene coding for sigmaS, rpoS. When PalkS was transferred to E. coli, transcription started at the same site and expression was higher in stationary phase only if sigmaS-RNA polymerase was present. The low levels of AlkS protein generated in the absence of sigmaS were enough to support a partial induction of the PalkB promoter. The -10 and -35 regions of PalkS promoter also show some similarity to the consensus recognized by sigmaD-RNA polymerase, the primary form of RNA polymerase. We propose that in exponential phase PalkS is probably recognized both by sigmaD-RNA polymerase (inefficiently) and by sigmaS-RNA polymerase (present at low levels), leading to low-level expression of the alkS gene. sigmaS-RNA polymerase would be responsible for the high level of activity of PalkS observed in stationary phase.  (+info)

Characterization of the ssnA gene, which is involved in the decline of cell viability at the beginning of stationary phase in Escherichia coli. (8/2871)

When grown in rich medium, Escherichia coli exhibits a drastic reduction of the number of viable cells at the beginning of stationary phase. The decline of cell viability was retarded by disruption of the ssnA gene, which was identified as a gene subject to RpoS-dependent negative regulation. Moreover, ssnA expression was induced at the time of decline of cell viability at early stationary phase. The viability decline was augmented in the rpoS background, and this augmentation was suppressed by ssnA mutation. Cloning of the ssnA gene in a multicopy plasmid, pBR322, caused small colony formation and slow growth in liquid medium. Cells harboring the ssnA clone showed aberrant morphology that included enlarged and filamentous shapes. The gene product was identified as a 44-kDa soluble protein, but its function could not be deduced by homology searching. From these results, we conclude that ssnA is expressed in response to a phase-specific signal(s) and that its expression level is controlled by RpoS, by a mechanism which may contribute to determination of cell number in the stationary phase.  (+info)

TY - JOUR. T1 - The alternative sigma factor sigma B of Staphylococcus aureus modulates virulence in experimental central venous catheter-related infections.. AU - Ziebuhr, Wilma. PY - 2008/3. Y1 - 2008/3. N2 - The impact of the alternative sigma factor sigma B (SigB) on pathogenesis of Staphylococcus aureus is not conclusively clarified. In this study, a central venous catheter (CVC) related model of multiorgan infection was used to investigate the role of SigB for the pathogenesis of S. aureus infections and biofilm formation in vivo. Analysis of two SigB-positive wild-type strains and their isogenic mutants revealed uniformly that the wild-type was significantly more virulent than the SigB-deficient mutant. The observed difference in virulence was apparently not linked to the capability of the strains to form biofilms in vivo since wild-type and mutant strains were able to produce biofilm layers inside of the catheter. The data strongly indicate that the alternative sigma factor SigB plays a ...
Several alternative sigma factors of M. tuberculosis regulate gene expression in response to stress, including SigH and SigE, which have been shown (SigH) or are hypothesized (SigE) to be regulated by ZASs. Though sigL is also linked to a likely ZAS gene (rslA), we did not identify oxidative or nitrosative stress conditions that either induced expression of this sigma factor or resulted in decreased survival of a sigL mutant relative to wild-type survival. These results suggest that SigL is not a stress response regulator and that other conditions encountered by the bacillus during infection in vivo may activate sigL expression.. By performing microarray analysis followed by primer extension and in vitro transcription experiments, we identified a limited set of genes that are directly regulated by SigL. Despite the small number of regulated promoters, we identified clear −35 and −10 element consensus sequences (TGAACC-N16-CGT) in the promoters recognized by SigL. Though this is similar to ...
Environmental pH stress constitutes a limiting factor for S. meliloti survival and development. The response to acidic pH stress in S. meliloti is versatile and characterized by the differential expression of genes associated with various cellular functions. The purpose of this study was to gain detailed insight into the participation of sigma factors in the complex stress response system of S. meliloti 1021 using pH stress as an effector. In vitro assessment of S meliloti wild type and sigma factor mutants provided first evidence that the sigma factor RpoH1 plays a major role in the pH stress response. Differential expression of genes related to rhizobactin biosynthesis was observed in microarray analyses performed with the rpoH1 mutant at pH 7.0. The involvement of the sigma factor RpoH1 in the regulation of S. meliloti genes upon pH stress was analyzed by comparing time-course experiments of the wild type and the rpoH1 mutant. Three classes of S. meliloti genes could be identified, which were
E. Bouffartigues, I. Si Hadj Mohand, R. Duchesne, O. Maillot, N. Orange, et al.. Insight into the mechanism controlling the activity of the extracytoplasmic function sigma factor SigX in Pseudomonas aeruginosa. XIeme Congrès de la SFM, 2015, PARIS, France. ⟨hal-02386341⟩ ...
The activation of additional promoter sites by production of an alternative sigma subunit for RNA polymerase is a common strategy for the coordinate regulation of gene expression. Many alternative sigma factors control genes for specialized, and often narrowly distributed, functions. For example, most of the alternative sigma factors in Bacillus subtilis control genes necessary for endospore formation. In contrast, the B. subtilis sigma D protein controls the expression of genes important for flagellar-based motility and chemotaxis, a form of locomotion very broadly distributed in the eubacteria. A homologous sigma factor, sigma F, controls a similar group of motility genes in the enteric bacteria. The conservation of both promoter specificity and genetic function in these two regulons allowed us to test the ability of a B. subtilis sigma factor to function within an Escherichia coli host. We demonstrate that expression of the B. subtilis sigD gene restores motility to an E. coli strain mutant ...
Shop Probable RNA polymerase sigma factor ELISA Kit, Recombinant Protein and Probable RNA polymerase sigma factor Antibody at MyBioSource. Custom ELISA Kit, Recombinant Protein and Antibody are available.
Sigma factors are initiation factors that promote the attachment of RNA polymerase to specific initiation sites and are then released. Extracytoplasmic function (ECF) sigma factors are held in an inactive form by an anti-sigma factor (RsaM, AC L7N5D7) until released by regulated intramembrane proteolysis (Probable). This sigma factor is required for the synthesis of surface or secreted molecules.
Sigma factors are initiation factors that promote the attachment of RNA polymerase to specific initiation sites and are then released. This sigma factor is involved in regulation of expression of heat shock genes. Intracellular concentration of free RpoH protein increases in response to heat shock, which causes association with RNA polymerase (RNAP) and initiation of transcription of heat shock genes, including numerous global transcriptional regulators and genes involved in maintaining membrane functionality and homeostasis. RpoH is then quickly degraded, leading to a decrease in the rate of synthesis of heat shock proteins and shut-off of the heat shock response.
sigma B, a secondary sigma factor of Bacillus subtilis, was found to increase 5- to 10-fold when cultures were shifted from 37 to 48 degrees C. Western blot (immunoblot) analyses, in which monoclonal antibodies specific for the sigB operon products RsbV, RsbW, and sigma B were used to probe extracts from wild-type and mutant B. subtilis strains, revealed that all three proteins increased coordinately after heat shock and that this increase was dependent on sigma B but not RsbV, a positive regulator normally essential for sigma B-dependent sigB expression. Nuclease protection experiments of RNA synthesized after heat shock supported the notion that the shift to 48 degrees C enhanced transcription from the sigB operons sigma B-dependent promoter. The level of mRNA initiating at the sigma B-dependent ctc promoter was also seen to increase approximately 5- to 10-fold after heat shock. Pulse-labeling of the proteins synthesized after a shift to 48 degrees C demonstrated that sigB wild-type and ...
The cell envelope of bacteria is of pivotal importance for growth and survival, and hence it is often the target of antimicrobial compounds. One of the main components involved in CESRs are extracytoplasmic function (ECF) [sigma] factors. The genome of B. subtilis encodes for seven ECF [sigma] factors, [sigma]M, [sigma]W, [sigma]X, [sigma]Y, [sigma]V, [sigma]Z and [sigma]YlaC. Several studies have been conducted to understand the role that these ECF [sigma] factors play in CESR in B. subtilis, one of the challenges found is that they display significant redundancy within their regulons. In this study, we have performed an in depth analysis of one of the ECF [sigma] factors of B. subtilis, [sigma]V, which had been previously uncharacterized. We have described the regulon of [sigma]V, the role that it plays in lysozyme resistance, and provided evidence for a novel promoter element important for [sigma]V recognition. Additionally, we have studied the role that [sigma]M plays in moenomycin ...
The general stress response comprises approximately 200 genes and is driven by the alternative sigma factor SigB. Besides the process of sporulation with approximately 500 involved gene products under initial control of Spo0A are the two most significant and extensive cellular responses that can be observed in B. subtilis. The general stress response provides vegetative growing as well as non-growing and non-sporulating cells with a comprehensive cross-protective and preventive multiple stress resistance to various hostile environmental conditions. In contrast, the endospore is the most resistant but also dormant cell type produced by B. subtilis. The scope of this study was the identification of regulatory cascades driven by the general stress response sigma factor SigB to further elucidate the structure and function of the general stress regulon itself and to uncover potential intersections between the SigB response and other major developmental programs in the regulatory network of B. ...
Background The expression of genes in Corynebacterium glutamicum, a Gram-positive non-pathogenic bacterium used mainly for the industrial production of amino acids, is regulated by seven different sigma factors of RNA polymerase, including the stress-responsive ECF-sigma factor SigH. The sigH gene is located in a gene cluster together with the rshA gene, putatively encoding an anti-sigma factor. The aim of this study was to analyze the transcriptional regulation of the sigH and rshA gene cluster and the effects of RshA on the SigH regulon, in order to refine the model describing the role of SigH and RshA during stress response. Results Transcription analyses revealed that the sigH gene and rshA gene are cotranscribed from four sigH housekeeping promoters in C. glutamicum. In addition, a SigH-controlled rshA promoter was found to only drive the transcription of the rshA gene. To test the role of the putative anti-sigma factor gene rshA under normal growth conditions, a C. glutamicum rshA deletion ...
Lien vers Pubmed [PMID] - 29229758. Biochem. J. 2018 01;475(1):341-354. In bacteria, one primary and multiple alternative sigma (σ) factors associate with the RNA polymerase core enzyme (E) to form holoenzymes (Eσ) with different promoter recognition specificities. The alternative σ factor RpoS/σ is produced in stationary phase and under stress conditions and reprograms global gene expression to promote bacterial survival. To date, the three-dimensional structure of a full-length free σ factor remains elusive. The current model suggests that extensive interdomain contacts in a free σ factor result in a compact conformation that masks the DNA-binding determinants of σ, explaining why a free σ factor does not bind double-stranded promoter DNA efficiently. Here, we explored the solution conformation of σ using amide hydrogen/deuterium exchange coupled with mass spectrometry, NMR, analytical ultracentrifugation and molecular dynamics. Our data strongly argue against a compact conformation ...
TY - JOUR. T1 - The alternative sigma factor sigh regulates major components of oxidative and heat stress responses in Mycobacterium tuberculosis. AU - Raman, S.. AU - Song, T.. AU - Puyang, X.. AU - Bardarov, S.. AU - Jacobs, Jr. AU - Husson, R. N.. PY - 2001. Y1 - 2001. N2 - Mycobacterium tuberculosis is a specialized intracellular pathogen that must regulate gene expression to overcome stresses produced by host defenses during infection. SigH is an alternative sigma factor that we have previously shown plays a role in the response to stress of the saprophyte Mycobacterium smegmatis. In this work we investigated the role of sigH in the M. Tuberculosis response to heat and oxidative stress. We determined that a M. tuberculosis sigh mutant is more susceptible to oxidative stresses and that the inducible expression of the thioredoxin reductase/thioredoxin genes trxB2/trxC and a gene of unknown function, Rv2466c, is regulated by sigH via expression from promoters directly recognized by SigH. We ...
Shop RNA polymerase principal sigma factor ELISA Kit, Recombinant Protein and RNA polymerase principal sigma factor Antibody at MyBioSource. Custom ELISA Kit, Recombinant Protein and Antibody are available.
Fingerprint Dive into the research topics of Mycobacterium tuberculosis ECF sigma factor sigC is required for lethality in mice and for the conditional expression of a defined gene set. Together they form a unique fingerprint. ...
Author Summary Positive auto-regulation of a transcriptional activator during cell differentiation or development often allows the rapid and robust deployment of cell- and stage-specific genes and the routing of the differentiating cell down a specific path. Positive auto-regulation however, raises the potential for inappropriate activity of the transcription factor. Here we unravel the role of a previously characterized anti-sigma factor, CsfB, in a negative feedback loop that prevents ectopic expression of the sporulation-specific sigma factor σG of Bacillus subtilis. σG is activated in the forespore, one of the two chambers of the developing cell, at an intermediate stage in spore development. Once active, a positive feedback loop allows the rapid accumulation of σG. Synthesis of both σG and CsfB is under the control of the early forespore regulator σF, and CsfB may help prevent the premature activity of σG in the forespore. However, CsfB is also produced under σG control in non-sporulating
Sigma factors [1] are bacterial transcription initiation factors that promote the attachment of the core RNA polymerase to specific initiation sites and are then released. They alter the specificity of promoter recognition. Most bacteria express a multiplicity of sigma factors. With regards to sequence similarity, sigma factors can be grouped into two classes: the sigma-54 and sigma-70 families. The sigma-70 family includes, in addition to the primary sigma factor, a wide variety of sigma factors. It also includes a divergent subfamily [2] that regulates gene encoding for proteins with extracytoplasmic function. The proteins that are currently known to belong to this sigma factor subfamily, known as ECF, are: ...
RNA polymerase sigma factor RpoD; Sigma factors are initiation factors that promote the attachment of RNA polymerase to specific initiation sites and are then released. This sigma factor is the primary sigma factor during exponential ...
Reference gene for normalisation - for different growth rates - posted in PCR, RT-PCR and Real-Time PCR: Hello I am just starting RT-qPCR to study the activity of the promoter of a gene present on a recombinant plasmid in E. coli. This is known to be a stationary-phase promoter. Apart from this, I would also analyse the expression of rpoS - the stationary phase sigma factor and rpoD - the primary sigma factor, for comparison. Samples would be taken from different steady states from...
The anti-anti-sigma factor BldG has a pleiotropic function in Streptomyces coelicolor A3(2), regulating both morphological and physiological differentiation. Together with the anti-sigma factor UshX, it participates in a partner-switching activation of the sigma factor σH, which has a dual role in the osmotic stress response and morphological differentiation in S. coelicolor A3(2). In addition to UshX, BldG also interacts with the anti-sigma factor ApgA, although no target sigma factor has yet been identified. However, neither UshX nor ApgA phosphorylates BldG. This phosphorylation is provided by the anti-sigma factor RsfA, which is specific for the late developmental sigma factor σF. However, BldG is phosphorylated in the rsfA mutant, suggesting that some other anti-sigma factors containing HATPase_c kinase domain are capable to phosphorylate BldG in vivo. Bacterial two-hybrid system (BACTH) was therefore used to investigate the interactions of all suitable anti-sigma factors of S. coelicolor ...
All bacteria have sigma factors, proteins that initiate transcription by binding to RNA polymerase. Sigma factors can regulate how bacteria respond to extracellular stresses, which can be diverse - from nutritional cues, to changes in oxidative state or temperature. For some sigma factors, the regulation is imposed by a group of proteins called zinc-binding anti-sigma factors (ZAS). In this system, the ZAS protein rather than the sigma factor responds to stress. ZAS protein and sigma factor are bound in a tight complex in the resting state. When a cue is received, the ZAS protein releases the sigma factor, enabling it to switch on genes that will neutralize the stress.. Different bacteria use ZAS proteins to respond to different stresses. In Mycobacterium tuberculosis, a ZAS-sigma factor complex is required for pathogenesis. In Bacillus subtilis, the system is used to protect the bacteria against antibiotics. The ZAS-sigma system is important in many bacteria for dealing with oxidative stress, ...
The σE-dependent extracytoplasmic stress response.σE is held at the membrane by the antisigma factor RseA. RseB binds to the periplasmic domain of RseA and pr
sigma factor definition: nounA protein component of bacterial RNA polymerase that recognizes the correct site on DNA for initiating transcription of a gene and that is usually released soon after transcription begins....
Although Escherichia coli is generally considered to be predominantly a commensal of the gastrointestinal tract, a number of recent studies suggest that it is also capable of long-term survival and growth in environments outside the host. As the extraintestinal physical and chemical conditions are often different from those within the host, it is possible that distinct genetic adaptations may be required to enable this transition. Several studies have shown a trade-off between growth and stress resistance in nutrient-poor environments, with lesions in the rpoS locus, which encodes the stress sigma factor RpoS (σS). In this study, we investigated a unique collection of long-term soil-persistent E. coli isolates to determine whether the RpoS-controlled general stress response is altered during adaptation to a nutrient-poor extraintestinal environment. The sequence of the rpoS locus was found to be highly conserved in these isolates, and no nonsense or frameshift mutations were detected. Known ...
InterPro provides functional analysis of proteins by classifying them into families and predicting domains and important sites. We combine protein signatures from a number of member databases into a single searchable resource, capitalising on their individual strengths to produce a powerful integrated database and diagnostic tool.
RECOMMENDED: If you have Windows errors then we strongly recommend that you download and run this (Windows) Repair Tool.. Topic Error Rate Calculation. given that the opportunity for error varies daily by the dollar amount presented and the. What is Six Sigma? Six Sigma.. The statistical representation of Six Sigma describes quantitatively how a process is performing. To achieve Six Sigma, a process must not produce more than 3.4.. An introduction to delta sigma converters without much theory and mathematics. Discover the Differences between 3 Sigma vs. 6 Sigma - Three Sigma vs. Six Sigma. the practical goal of Six Sigma programs is to continually improve the rate of. In cases where too much error is not assignable.. Shot Online Error Shot.exe As suggested elsewhere online, Ive tried every permutation of running Origin and ME. Screen Shot 2012-06-23 at 12.49.18 AM.jpg. Repeat these steps until only explorer.exe and task mgr.exe are open. In brief, the lipoaspirate were incubated in RPMI 1640 ...
Negative regulation of germination-arrest factor production in Pseudomonas fluorescens WH6 by a putative extracytoplasmic function sigma factor ...
The repertoire of genes expressed under more than a hundred different conditions, which mimic the natural, laboratory and industrial environments of B. subtilis, was determined [link to Nicolas et al in Science, Link to www.basysbio.eu/bsubtranscriptome/seb]. Through this study of unprecedented scope, we have been able to infer how the B. subtilis transcription network is regulated during adaptation to nutritional changes and physical and chemical stresses [Link to www.basysbio.eu/bsubtranscriptome]. The study identified 512 new potential genes and abundant antisense RNAs. It also identified over 3000 promoters which were classified according to their activity profiles by a newly developed statistical approach. Groups of genes with similar profiles were associated with various types of the gene expression machinery (RNA polymerase sigma factors), allowing for the first time to quantify the contribution of the sigma factors in the variation of gene expression. We discovered that switching between ...
In Escherichia coli, the stationary phase alternative sigma factor σs controls the expression of genes involved cell survival in response to cessation of growth (stationary phase) and provides cross-protection to various stresses. Levels of σs increase dramatically at the onset of stationary phase and are regulated at the transcriptional, post-transcriptional and post-translational level, making this one of the most complex regulatory systems in bacteria. The basic mechanisms for the control of translation and σs proteolysis have been understood. However, studies on the transcriptional control in E. coli lag behind and are controversial. The cAMP-CRP complex and the two component BarA/UvrY system have been implicated and, ppGpp and polyphosphate appear to have a signalling role. σs has also been reported to be a general stress regulator in the fluorescent pseudomonads (Pseudomonas aeruginosa, P. fluorescens and P. putida) and recent studies on σs regulation highlight that transcriptional ...
RNA polymerase sigma 70 antibody [2G10] for ELISA, IP, WB, Functional Assay. Anti-RNA polymerase sigma 70 mAb (GTX12088) is tested in Bacteria samples. 100% Ab-Assurance.
The general stress response (GSR) represents an important trait to survive in the environment by leading to multiple stress resistance. In alphaproteobacteria, the GSR is under the transcriptional control of the alternative sigma factor EcfG. Here we performed transcriptome analyses to investigate the genes controlled by EcfG of Sphingomonas melonis Fr1 and the plasticity of this regulation under stress conditions. We found that EcfG regulates genes for proteins that are typically associated with stress responses. Moreover, EcfG controls regulatory proteins, which likely fine-tune the GSR. Among these, we identified a novel negative GSR feedback regulator, termed NepR2, on the basis of gene reporter assays, phenotypic analyses, and biochemical assays. Transcriptional profiling of signaling components upstream of EcfG under complex stress conditions showed an overall congruence with EcfG-regulated genes. Interestingly however, we found that the GSR is transcriptionally linked to the regulation of
This is a eight-day Lean Six Sigma Greenbelt training at HBO level. How and with what success could you improve your processes? What makes it so successful? And how does the method work in practice? In this training you learn the main methods and techniques of the Lean Six Sigma methodology. During this intensive training you will be trained to become Six Sigma Green Belt.. Lean Six Sigma Green Belt training, good for the development of your organisation and your career!. The certificate Lean Six Sigma Green Belt is recognized worldwide. Many companies use the techniques of Lean and Six Sigma. These companies improve their lead times and the quality of their products. After attending the course you can make a valuable contribution to this process. There is so much demand for experts in the field of Lean Six Sigma. A good addition to your CV so!. ...
PubMed comprises more than 30 million citations for biomedical literature from MEDLINE, life science journals, and online books. Citations may include links to full-text content from PubMed Central and publisher web sites.
Bacteria necessitate multiple signal transduction systems to sense the ever-changing environments and mediate the cellular response accordingly. The major bacterial signal transduction systems are one-component system (1CS), two-component system (2CS) and extracytoplasmic function (ECF) σ factor. Compared to 1CSs and 2CSs, ECF σ factors have only been identified much later and therefore the knowledge about their molecular mechanisms and physiological roles is less profound. This thesis mainly focuses on the study of ECF σ factors from the bacterial phyla, Planctomycetes and Actinobacteria., In the first two parts of this study, ECF σ factors from eight planctomycetal genomes and 119 actinobacterial genomes were classified and analyzed in depth. This led to the identification of eight novel ECF groups consisting of 202 protein members from Planctomycetes and 18 novel ECF groups consisting of 427 protein members from Actinobacteria, respectively. Many of these novel ECF groups were found to ...
Sigma legt mit seiner über 50 Jahren währende Geschichte großen Wert auf das Gesamtpaket ihrer Produkte. So wählten sie nicht ohne Grund den Namen Sigma für ihr Unternehmen.. Der griechische Buchstabe S steht für die Gesamtsumme und ist Sinnbild für die Unternehmensphilosophie von Sigma.. Sigma legt die Schwerpunkte auf Entwicklung und Produktion, sodass Sigma Objektive immer auf dem neuesten Stand der Technik sind.. Sigma achtet ganz besonders bei der Produktion der Objektive darauf, dass weder umweltbelastende Stoffe wie Blei oder Arsen verwendet werden, noch das mit den Ressourcen verschwenderisch umgegangen wird.. Grundlegende Eckpunkte der Philosophie sind:. ...
Compatible with full-frame image sensors, these high-speed cine prime lenses are available for EF, E and PL mounts. Part of the family of CINE lenses from Sigma, they represent the companys investment in a segment that expanded the three distinct lines introduced, under the name Global Vision, by Sigma in 2012: Art, Contemporary and Sport. In a short period of time Sigma has created a series of 10 lenses for cinematographers, and suggests the family may expand, in the future, to anamorphic lenses.. The wide-angle lens from the duo, the 14mm T2, is, according to Sigma, the worlds first and only to offer an incredibly fast T2 at this ultra-wide angle focal length for full frame sensors. Bringing remarkable optical performance to the art of capturing moving images, the Sigma 14mm T2 offers cinematographers the opportunity for robust cinematic expression.. For the second lens, the 135mm T2, Sigma claims astonishing rendering performance unmatched by almost any lens on the market. Retaining the ...
Paul Keller is President and Chief Operating Officer of Quality America, a Six Sigma consulting, training, and publishing firm. Description: Six Sigma is among the most effective process methods used today-and its also among the most baffling topics to those new to the subject. The good news is Six Sigma DeMYSTiFieD, Second Edition, explains it all in a language youll understand. This easy-to-understand reference teaches the methods of Six Sigma, explains their applications, and tests expertise-without confusing statistics and formulas. In no time, youll develop the skills you need to solve problems, anticipate customer needs, and meet the demands of the most challenging markets. Filled with practical hands-on advice and essential organizational tips, Six Sigma DeMYSTiFieD provides a complete blueprint for developing strategies, plotting growth, and performing at peak efficiency for maximum profits. This fast and easy guide offers: • Proven techniques for building a solid Six Sigma ...
Redox regulated effector systems that counteract oxidative stress are essential for all forms of life. Here, we uncover a new paradigm for sensing oxidative stress centred on the hydrophobic core of a sensor protein. RsrA is an archetypal zinc-binding anti-sigma factor that responds to disulfide stress in the cytoplasm of Actinobacteria. We show that RsrA utilizes its hydrophobic core to bind the sigma factor σR preventing its association with RNA polymerase, and that zinc plays a central role in maintaining this high-affinity complex. Oxidation of RsrA is limited by the rate of zinc release, which weakens the RsrA-σR complex by accelerating its dissociation. The subsequent trigger disulfide, formed between specific combinations of RsrAs three zinc-binding cysteines, precipitates structural collapse to a compact state where all σR-binding residues are sequestered back into its hydrophobic core, releasing σR to activate transcription of anti-oxidant genes.
Binnie C, Lampe M, Losick R (1986) Gene encoding the sigma 37 species of RNA polymerase sigma factor from Bacillus subtilis. Proc Natl Acad Sci U S A 83:5943-7.[PMID:3016731 ...
The stressosome complex regulates downstream effectors in response to environmental signals. In Bacillus subtilis, it activates the alternative sigma factor σ(B), leading to the upregulation of the general stress regulon. Herein, we characterize a stressosome-regulated biochemical pathway in Moorell …
Get Sigma 14-24mm f/2.8 DG HSM Art at B&H Photo.. Confirming conclusions about lens performance is best done by shooting numerous scenes and seeing that all is in accord. The less than satisfying performance seen in Across the Canyon View of Checkerboard Mesa at 22mm is here evaluated at 23mm in a more complex 3D scene, to rule out field curvature as an explanation for the disappointing results.. In my review of the Sigma 14-24mm f/2.8 DG HSM Art:. Sigma 14-24mm f/2.8 DG HSM Art Aperture Series @ 23mm: Sandy Wash in Side Canyon, Zion. Includes up to full resolution images from f/2.8 through f/11 plus a 3-frame focus stack at f/9.. It is important when testing a zoom to test it across the zoom range, and also with near focus and far focus. I am not nearly so happy with performance at 22mm as at 14mm.. This series and others are important to understanding how to get the best out of the Sigma 14-24mm f/2.8 DG HSM Art, just as my review coverage of the Sigma 12-24mm f/4 DG HSM Art was and is. A lens ...
Gentec International, the exclusive Canadian distributor of Sigma lenses, announces the worlds first F1.4 ultra-wide-angle lens for full-frame DSLRs, the Sigma 20mm F1.4 DG HSM , Art. Incorporating the same advanced optical technology as Sigmas award-winning 24mm F1.4, 35mm F1.4 and 50mm F1.4 Art lenses, this ultra-wide angle, large aperture lens offers superb image quality and stunning bokeh. Allowing the photographer to leverage the perspective provided by the wide-angle and the shallow depth of field provided by the large aperture, this lens is ideal not only for such ultra-wide-angle subject as landscapes and starry skies, but also for snapshots in low light, indoor photography, portraits with a natural bokeh effect, and more much.. The Sigma 20mm F1.4 DG HSM lens has a suggested retail price of $1,249.95 in Canada and will be available for Sigma, Canon and Nikon mounts in December 2015.. ...
Non-linear sigma models with extended supersymmetry have constrained target space geometries, and can serve as effective tools for investigating and constructing new geometries. Analyzing the geometrical and topological properties of sigma models is necessary to understand the underlying structures of string theory.. The most general two-dimensional sigma model with manifest N=(2,2) supersymmetry can be parametrized by chiral, twisted chiral and semichiral superfields. In the research presented in this thesis, N=(4,4) (twisted) supersymmetry is constructed for a semichiral sigma model. It is found that the model can only have additional supersymmetry off-shell if the target space has a dimension larger than four. For four-dimensional target manifolds, supersymmetry can be introduced on-shell, leading to a hyperkähler manifold, or pseudo-supersymmetry can be imposed off-shell, implying a target space which is neutral hyperkähler.. Different sigma models and corresponding geometries can be ...
The PDB archive contains information about experimentally-determined structures of proteins, nucleic acids, and complex assemblies. As a member of the wwPDB, the RCSB PDB curates and annotates PDB data according to agreed upon standards. The RCSB PDB also provides a variety of tools and resources. Users can perform simple and advanced searches based on annotations relating to sequence, structure and function. These molecules are visualized, downloaded, and analyzed by users who range from students to specialized scientists.
Transcription initiation is a critical step in bacterial gene regulation and is often controlled by transcription regulators. The alternate sigma factor (sigma54) is one such regulator that facilitates activator-dependent ...
Yoshimine, M.; McLean, A.D.; Liu, B., Band strengths for electric dipole transitions from ab initio computation: LiO (X2«PI»-X2«PI», (A2«SIGMA»+-A2«SIGMA»+), (X2«PI»-A2«SIGMA»+); AlO (X2«SIGMA»+-X2«SIGMA»+), (A2«PI»-A2«PI»), (X2«SIGMA»+-A2«PI»), (B2«SIGMA»+-B2«SIGMA»+), (X2«SIGMA»+-B2«SIGMA»+), J. Chem. Phys., 1973, 58, 4412. [all data] Linton and Nicholls, 1969 ...
cansSAR 3D Structure of 5VT0_L | ESCHERICHIA COLI 6S RNA DERIVATIVE IN COMPLEX WITH ESCHERICHIA COLI RNA POLYMERASE SIGMA70-HOLOENZYME | 5VT0
The Bacillus cereus sensu lato group consists of six species (B. anthracis, B. cereus, B. mycoides, B. pseudomycoides, B. thuringiensis, and B. weihenstephanensis). While classical microbial taxonomy proposed these organisms as distinct species, newer molecular phylogenies and comparative genome sequencing suggests that these organisms should be classified as a single species (thus, we will refer to these organisms collectively as the Bc species-group). How do we account for the underlying similarity of these phenotypically diverse microbes? It has been established for some time that the most rapidly evolving and evolutionarily flexible portions of the bacterial genome are regulatory sequences and transcriptional networks. Other studies have suggested that the sigma factor gene family of these organisms has diverged and expanded significantly relative to their ancestors; sigma factors are those portions of the bacterial transcriptional apparatus that control RNA polymerase recognition for promoter
Background Sigma factors are proteins that regulate transcription in bacteria. Sigma factors can be activated in response to different environmental conditions. The rpoS (RNA polymerase, sigma S) gene encodes sigma-38 (σ38, or RpoS), a 37.8 kDa protein in Pseudomonas aeruginosa (P. aeruginosa) strains. RpoS is a central regulator of the general stress response and operates in both retroactive and proactive manners; not only does it allow the cell to survive environmental challenges; it also prepares the cell for subsequent stresses (cross-protection). Methods The significance of RpoS for stress resistance and protein expression in stationary-phase P. aeruginosa cells was assessed. The goal of the current study was to characterize RpoS of P. aeruginosa PAO1 using bioinformatics tools. Results The results showed that RpoS is an unstable protein that belongs to the sigma-70 factor family. Secondary structure analysis predicted that random coil is the predominant structure followed by extended alpha helix.
The intestinal pathogen V. cholerae has a complicated life cycle that includes growth within an aquatic environment, oral ingestion by human hosts, passage through the low pH environment of the stomach, colonization within the small intestine, and subsequent dissemination in the cholera stool back into its aquatic niche. The study of environmentally induced gene regulation of V. cholerae has primarily focused on the production and regulation of virulence factors within the host environment (16, 20). Recently, however, the role of the stationary-phase sigma factor RpoS in regulation of genes required for surviving a variety of environmental stresses was demonstrated (22). In addition, the V. cholerae RpoS was found to positively regulate expression of at least 25 different genes upon entry into stationary phase (22). Similar but diverse roles for RpoS in response to environmental stresses have been demonstrated in a variety of bacterial species, including E. coli, S. flexneri, Y. enterocolitica, ...
The soil living, Gram-positive bacterium Bacillus subtilis is frequently exposed to a wide variety of stress and starvation conditions in its natural environment. In order to survive under these environmental and energy stresses, the bacterium acquired a general stress response mechanism mediated by the alternative sigma factor, SigB. A wide-variety of stress conditions such as environmental stress conditions like ethanol stress, heat stress, oxidative stress, osmotic stress or limitation of glucose, oxygen, phosphate etc.; and low temperature growth induce this SigB-dependent general stress response. Though much is known about the mechanisms of activation of this general stress response, the conditions that induce the SigB regulon and its general functions, the definition of the structure of the SigB regulon is not completely clear. The SigB-dependent general stress regulon has previously been characterized by proteomic approaches as well as DNA-array based expression studies. Genome-wide ...
Sigma factors and the alarmone ppGpp control the allocation of RNA polymerase to promoters under stressful conditions. Both ppGpp and the sigma factor σS (RpoS) are potentially subject to variability across the species Escherichia coli. To find out the extent of strain variation we measured the level of RpoS and ppGpp using 31 E. coli strains from the ECOR collection and one reference K-12 strain. Nine ECORs had highly deleterious mutations in rpoS, 12 had RpoS protein up to 7-fold above that of the reference strain MG1655 and the remainder had comparable or lower levels. Strain variation was also evident in ppGpp accumulation under carbon starvation and spoT mutations were present in several low-ppGpp strains. Three relationships between RpoS and ppGpp levels were found: isolates with zero RpoS but various ppGpp levels, strains where RpoS levels were proportional to ppGpp and a third unexpected class in which RpoS was present but not proportional to ppGpp concentration. High-RpoS and high-ppGpp
Check out a huge selection of Sigma Pi merchandise on the FindGreek marketplace now! Welcome to the website of Beta Phi Boulé, the Roanoke • Lynchburg, Virginia Boulé of Sigma Pi Phi Fraternity. the Grand Boulé, is the first and oldest African American Greek-letter fraternal organization. That, is why I Believe. As of June 2012, Sigma Pi Phi has over 5,000 members and over 135 member boulés (comparable to chapters) throughout the United States, the United Kingdom and the Bahamas. Alpha Sigma Phi Fraternity mourns the loss of Brother Richard L. Jackson, Ohio Wesleyan 50. 640 likes. 717-299-4710 The fraternity became national in 1921 when a Third chapter was founded at Bradley Universityin Peoria, Illinois. View 0 reviews. Welcome to the home page of Sigma Delta Sigma chapter of Phi Beta Sigma Fraternity Inc. Woodstock GA is our base of operation but we are dedicated to provide services in the name of Sigma where we are needed. Aug 4, 2018 - Explore Livi Burkes board Phi Sigma Pi , ...
These guys are awesome. Kappa Sigma - University of Miami, Coral Gables, FL. 43) Kappa Phi Lambda ~ ΚΦΛ. You can track the performance of The Caduceus of Kappa Sigma every hour of every day across different countries, categories and devices. Delta Chi (ΔX) ... Click here to see all the college rankings-from most beautiful to most rigorous and more. Associates with:Sigma Chi FraternityPi Beta Phi Sorority. Kappa Sigma is the largest college social fraternity in the world with more than 200,000 living members, including over 17,000 undergraduates and 305 chapters and colonies located throughout the United States and Canada. Rank History shows how popular The Caduceus of Kappa Sigma is in the iOS, and how thats changed over time. Kappa Sigma builds better men through commitment to fellowship, leadership, scholarship, and service. Great group of guys every year. 3. IMG_9691. Charity Classic 2018. Kappa Sigma was founded in 1896 and comes from the University of Virginia. I can trust them with ...
The Pm promoter of the TOL plasmid of Pseudomonas putida is expressed at high level along the growth curve. This transcription is dependent on the positive regulator XylS activated by 3-methylbenzoate. The sigma factor sigma 38 is required for expression in early stationary phase and thereafter. To …
FIG. 4. Role of RssB-ClpXP and putative signal input in the σS recognition and degradation pathway. The response regulator RssB is an essential, specific, and direct σS recognition factor. RssB delivers σS to the ClpXP protease, where σS is unfolded and completely degraded whereas RssB is released. σS binding requires RssB phosphorylation, but it is unclear whether the catalytic cycle of RssB involves obligatory dephosphorylation during release and subsequent rephosphorylation. Stress signals may affect (i) the phosphorylation of RssB and therefore RssB-σS complex formation; (ii) the cellular level of RssB (which in growing cells is rate limiting for σS proteolysis); (iii) the synthesis of σS such that RssB becomes titrated on σS overproduction; (iv) σS association with RNA polymerase core enzyme, which protects against binding by RssB; and (v) the function of the ClpXP protease itself (see the text for details). However, the molecular details of the stress signal input pathways ...
A viable and connecting with way workers can learn Six Sigma and put its ideas into play. Some portion of the well known Big Book of Games arrangement, which benefits from the demonstrated successful technique for working environment preparing, this first book of preparing amusements for Six Sigma guarantees that representatives will better hold Six Sigmas mind boggling points.. This significant device offers 50 experiential exercises that instruct the center change approach of Six Sigma, called DMAIC (Define, Measure, Analyze, Improve, Control), and also a large number of the famous factual change apparatuses, including Pareto graphs and Failure Mode Effects Analysis (FMEA). These recreations:. Show Six Sigma parts and association. Intend the collaborate for achievement. Recognize issues and produce arrangements. Show extend administration. Help groups comprehend the requirement for Six Sigma. ...
In the version of central limit theorem for strictly stationary but weakly dependent (for instance $\alpha$-mixing with fast decaying mixing coefficient) random variables $X_1, X_2, \cdots$, the theorem in this Wikipedia page states (see also Billingsley 1995 Theorem 27.4):. Theorem. Suppose that $X_1, X_2, \cdots$ is stationary and $\alpha$-mixing with $\alpha_n = O(n^{−5})$ and that $\mathbb{E} X_n = 0$ and $\mathbb{E} X_n^{12} , \infty$. Denote $S_n = X_1 + \cdots + X_n$, then the limit $\sigma^2 = \lim_{n\to \infty} \mathbb{E} S_n^2/n$ exists, and if $\sigma \ne 0$ then $S_n/(\sigma \sqrt{n})$ converges in distribution to the standard Gaussian distribution $\mathcal{N}(0, 1)$.. Here $\alpha_n$ is the mixing coefficients defined as e.g. in this Wikipedia page.. My question is: Is there a proof for the necessity of $\sigma , 0$? What can we conclude (if possible) when $\sigma = 0$? In the wikipedia page, there is a little remark trying to explain the necessity of $\sigma , 0$ (note that ...
When prokaryotic organisms transcribe DNA into RNA it involves in many cases the binding of a sigma factor upstream of the transcription start site. This guides the RNA polymerase (RNAP) into position to facilitate the transcription process. Sigma factors also have important regulatory functions and many different factors acts to ensure differential regulation of different classes of genes under different conditions. In this exercise we will look at σ70 (or RpoD) which is the housekeeping sigma factor responsible for regulating most genes in the prokaryotic cell. It has two distinct binding sites -10 and -35 upstream of the transcription start site, often denoted by the consensus sequences: TATAAT and TTGACA. Since the hexamers rarely match the consensus, information theory is often used to describe the observed variation and to measure how well a given promoter fits a model. This measure is provided in bits of information. ...
The Bacillus subtilis σ W regulon is induced by different stresses that most probably affect integrity of the cell envelope. The activity of the extracytoplasmic function (ECF) sigma factor σ W is modulated by the transmembrane anti-sigma factor RsiW, which undergoes stress-induced degradation in a process known as regulated intramembrane proteolysis, finally resulting in the release of σ W and the transcription of σ W-controlled genes. Mutations in the ecsA gene, which encodes an ATP binding cassette (ABC) of an ABC transporter of unknown function, block site-2 proteolysis of RsiW by the intramembrane cleaving protease RasP (YluC). In addition, degradation of the cell division protein FtsL, which represents a second RasP substrate, is blocked in an ecsA-negative strain. The defect in σ W induction of an ecsA-knockout strain could be partly suppressed by overproducing RasP. A B. subtilis rasP-knockout strain displayed the same pleiotropic phenotype as an ecsA knockout, namely defects in processing
You might need to reconsider your definition of Sigma.. I take mine from the article The Nature of Six Sigma Quality by Mikel Harry, published by the Motorola University Press in the early 1990s (the specific copyright date varies depending on the date of printing.) By definition, an X Sigma process is one which, when centered halfway between the lower and upper specification limits (LSL & USL), the LSL is located at [mu - X*sigma] (where s is the process standard deviation), and the USL is located at [mu + X*sigma].. A 6 Sigma process is one where, IF the process were centered, the LSL is exactly at [mu - 6*sigma] and the USL is exactly at [mu + 6*sigma).. This is the definition given by Mikel Harry in his article. Its shown in Figure 8.. When the much debated 1.5*sigma shift occurs (here assuming a shift to the right for the sake of computation), the LSL & USL are no longer as described before, now they are at [mu - (X + 1.5)*sigma] & [mu + (X - 1.5)*sigma], respectively. For a 6 Sigma ...
Lean Six Sigma Black Belt is the creme de la creme of Lean Six Sigma. It is the end of the belt like structure that is Lean Six Sigma...
SWISS-MODEL Repository entry for P77994 (SIGA_THEMA), RNA polymerase sigma factor SigA. Thermotoga maritima (strain ATCC 43589 / MSB8 / DSM 3109 / JCM 10099)
OVERVIEW_[ ->As a Six Sigma team moves into the Analyze phase of a project, team members begin analyzing the information and data collected in the earlier phases. During the Analyze phase, Six Sigma teams identify possible sources of variation, underlying root causes, and areas for improvement. It is here where assumptions or hypotheses about a process, product, or service are made and validated using tests based on sample data. This course aims to familiarize you with some of the advanced hypothesis tests used in Six Sigma. You are taken through the key steps in testing hypotheses for proportions, variances, and analysis of variance (ANOVA), and their underlying assumptions, with the help of examples and case studies. You will also learn how to use goodness-of-fit test statistics and contingency tables for validating hypotheses about various aspects of the variables being analyzed. This course is aligned with the ASQ Certified Six Sigma Black Belt certification exam and is designed to assist ...
See my Sigma SLR lenses wishlist at B&H Photo.. This far distance series evaluates lens performance from f/1.4 through f/5.6 across the frame, giving an excellent look at just how good the Sigma 28mm f/1.4 DG HSM Art is.. Uniform sharpness is very challenging for a lens for far distance scenes like this, so that precise focus is critical. This series was focused perfectly so as to extract maximum performance across the field so this series represents an optimal performance with the Sigma 28mm f/1.4 DG HSM Art.. Sigma 28mm f/1.4 DG HSM Aperture Series: View of Peaks near Mt Whitney, Very Late Dusk (Nikon D850). Includes images up to full camera resolution from f/1.4 through f/5.6.. ...
The Sigma APO 300-800mm F5.6 EX IF HSM is one of several new products introduced at Photokina 2002 by Sigma Corporation of Japan (2-3-15, Iwado-Minami, Komae-shi, Tokyo, Japan). Sigma APO 300-800mm F5.6 EX IF HSM provides a constant F-number from 300mm telephoto to 800mm ultra-telephoto. This super-telephoto zoom lens has a horizontal angle of view of 6.9 at 300mm and 2.6 at 800mm. Its ability to zoom from a fixed position offers unparalleled versatility in composing an image. It incorporates two pieces of ELD (Extraordinary Low Dispersion) glass in the front for effective compensation of chromatic aberration. Since focusing and zooming do not change its overall length, this lens offers ease of handling and operation. The HSM ensures a quiet, high-speed AF function as well as full-time manual focusing capability for Sigma, Canon, Nikon mount lenses. A 46mm filter can be inserted near the rear of the lens, and a circular polarizing filter can be used. When this lens is used with the 1.4x EX or 2x EX Apo
Size: Large to medium fit Lens shape: Cylindrical Franchise: LO FI Weather Condition: Solar Lens Technology: SIGMA Filtration color: Sigma Coating: MULTILAYER/TRI-TECH Extra Lenses: SIGMA - SILVER PINK - MULTILAYER - LOW LIGHT Lens: SIGMA BLACK...
Some pros and cons of six sigma an academic perspective pdf, Article information: To cite this document: Jiju Antony, (),Some pros and cons of six sigma: an academic perspective, The TQM Magazine, Vol. 16 Iss 4 pp., Advantages & Disadvantages of Six Sigma | Small Business - madvirgin.org
A crossed beam investigation of the reactions of tricarbon molecules, C(3)(X(1)Sigma(+)(g)),with acetylene, C(2)H(2)(X(1)Sigma(+)(g)), ethylene, C(2)H(4)(X(1)A(g)), and benzene, C(6)H(6)(X(1)A(1g)) Article ...
b). However, the solution model of RseA121-216/RseB clearly shows that its envelope is more globular than either free RseB or the RseA169-196/RseB complex, thereby suggesting that the cleft in free RseB is occupied by a certain region of RseA. Since the minimum binding fragment (RseA169-196) was not clearly visualized in the RseA169-196/RseB complex and the empty cleft in free RseB was occupied in the complex of RseA121-216/RseB, it is thought that some other region of RseA was also involved in RseB binding and was visualized in the SAXS model of the RseA121-216/RseB complex. Taking these results together, it can be proposed that the unstructured free RseA becomes more structured and stabilized when it binds to RseB, and more than two separate regions of RseA are involved in RseB binding. Consistently with our notion, it has been proposed that the periplasmic domain of RseA would interact with RseB using two regions: residues near 169-186 and an undefined region (Cezairliyan & Sauer, 2007 ...
PubMed comprises more than 30 million citations for biomedical literature from MEDLINE, life science journals, and online books. Citations may include links to full-text content from PubMed Central and publisher web sites.
I will assume Sigma read this thread! ,,LEAF SHUTTER LENS!, come on sigma! The FP is useless for flash photography (and artificial light) without a mechanical shutter. Leaf shutter lens allow syncing flash at a higher speed than can focal plane. Normal territory of medium format. Time to compete with Hasselblad X1D! Sigma know how to make superb leaf shutter lens in the DP series. Make compact 28/75 mm f2.8 leaf shutter prime lens, just like your 45mm - but put a leaf shutter in that one too. Take the FP to the next level. Leaf shutter lens will attract a huge new number of people to the FP and L mount system for photography. ...
Microbiology Society journals contain high-quality research papers and topical review articles. We are a not-for-profit publisher and we support and invest in the microbiology community, to the benefit of everyone. This supports our principal goal to develop, expand and strengthen the networks available to our members so that they can generate new knowledge about microbes and ensure that it is shared with other communities.
Intracellular Signaling. To survive, bacteria must continuously monitor changes in nutrient status & adjust their physiology. During rapid growth, our lab strain grows predominantly as non-motile, chained cells. The decision to switch to a single-cell, motile mode occurs during the transition between rapid growth & stationary phase, which is regulated by increased expression & activity of an alternative sigma factor, SigD. We discovered that SigD levels & activity are controlled by cellular levels of the small intracellular molecules GTP & p(ppGpp). This work is significant because it provides evidence that graded levels of key intracellular signaling molecules regulate developmental decisions (and transcriptional programs). We hypothesize that intracellular levels of one or more small molecules is also responsible for coordinating DNA replication rates, protein synthesis, transcription, & cell growth/division with cellular nutrient status.. Q. A. Ababneh and J. K. Herman. CodY regulates SigD ...
com.sigma.fs3.argos.domain.gpc.GpcArticlesRev[id=com.sigma.fs3.argos.domain.gpc.GpcArticlesRevPK[ifcactivitat=ARE, ifccomptador=54664]], camposKey:0035-8711 2020-01-01 Amino acetaldehyde conformers: structure and spectroscopic properties18271833, com.sigma.fs3.argos.domain.gpc.GpcArticlesRev[id=com.sigma.fs3.argos.domain.gpc.GpcArticlesRevPK[ifcactivitat=ARE, ifccomptador=54675]], camposKey:0004-6361 2020-01-01 Reconstruction of water ice: the neglected process OH + OH =, H2O + O19, com.sigma.fs3.argos.domain.gpc.GpcArticlesRev[id=com.sigma.fs3.argos.domain.gpc.GpcArticlesRevPK[ifcactivitat=ARE, ifccomptador=57486]], camposKey:0004-637X 2020-01-01 Structure and Spectroscopic Properties of Hydrocalcium Isocyanide Isomers: Plausible Astronomical Ca-bearing Molecules00, com.sigma.fs3.argos.domain.gpc.GpcArticlesRev[id=com.sigma.fs3.argos.domain.gpc.GpcArticlesRevPK[ifcactivitat=ARE, ifccomptador=50466]], camposKey:2472-3452 2019-01-01 Formation of Protonated Glycine Isomers in the Interstellar ...
In 1983, Lambda Omega Sigma became the first Greek Fraternity at Pepperdine with the motto Through Service We Shine and in 1998 they became the Lambda Sigma Chapter of Psi Upsilon, and kept that focus on service. The chapter hosts a wildly successful philanthropy that not only includes the Greek community, but also attracts participation outside the fraternity and sorority world. During this years Psi U Think U Can Dance Philanthropy, the Lambda Sigma chapter not only sold nearly 500 tickets, but also raised over $18,000 for Conquer Paralysis Now, a non-profit started by the chapters first president, Sam Schmidt 86. Read the article in the JANUARY 29, 2020 Pepperdine Graphic ...
In addition, the Company is continuing with its strategic alternatives review process. Sigma Designs does not plan to hold a conference call in association with the information in this news release. The Company will provide an update on these actions when it determines that further disclosures are appropriate. Use of Non-GAAP Financial Information In addition to reporting financial results in accordance with generally accepted accounting principles (GAAP), Sigma reports non-GAAP financial measures, as Sigma believes that evaluating its ongoing operating results may be difficult if limited to reviewing only GAAP financial measures. Non-GAAP financial measures are not a substitute for financial information prepared in accordance with GAAP. Therefore, non-GAAP financial measures should not be considered in isolation, but should be considered together with the most directly comparable GAAP financial measures and the reconciliation of the non-GAAP financial measures to the most directly comparable ...
Abstract: We determine the moduli space of classical solutions to the field equations of Poisson Sigma Models on arbitrary Riemann surfaces for Poisson structures with vanishing Poisson form class. This condition ensures the existence of a presymplectic form on the target Poisson manifold which agrees with the induced symplectic forms of the Poisson tensor upon pullback to the leaves. The dimension of the classical moduli space as a function of the genus of the worldsheet Sigma and the corank k of the Poisson tensor is determined as k(rank(H^1(Sigma))+1). Representatives of the classical solutions are provided using the above mentioned presymplectic 2-forms, and possible generalizations to cases where such a form does not exist are discussed. The results are compared to the known moduli space of classical solutions for two-dimensional BF and Yang-Mills theories ...
Sigma receptors, both Sigma‐1(S1R) and Sigma‐2 (S2R), are small molecule‐regulated, primarily endoplasmic reticulum (ER) membrane‐associated sites
The Sigma Resort Palette includes some of the most beautiful eyeshadow colors Sigma released in 2013. The eyeshadow colors range from neutral to striking, making Resort the perfect name for this palette. Of the 8 shadows included, I can see at least 4.5 becoming a favorite at Handmade Reviews. To be fair, I loved them all with the exception of Muse. Muse is grayish ash color that contains some fall outs and does not blend as smoothly as the other shadows. My favorite eyeshadow would have to be Neela because it is so vibrant and different. It could be a little difficult to wear this color without looking like Mimi from the Drew Carey Show. Luckily, the Sigma Resort Palette comes with an instructional tutorial guide on how to achieve different looks with the eyeshadows! And the winner of the cutest eyeshadow name award? Papaya! ...
FOUR SEVEN SIGMA™ is a modern, progressive goggle with design details that recall Salomons heritage of innovation. FOUR SEVEN SIGMA™ boasts a unique anatomical fit, wide field of vision, and a SIGMA™ lens that amplifies contrast, enabling the eye to read
FOUR SEVEN SIGMA™ is a modern, progressive goggle with design details that recall Salomons heritage of innovation. FOUR SEVEN SIGMA™ boasts a unique anatomical fit, wide field of vision, and a SIGMA™ lens that amplifies contrast, enabling the eye to read
Want to work at Sigma Science, Inc.? Apply for Sigma Science, Inc. jobs, learn about the culture, read reviews and more. Find Sigma Science, Inc. careers in your area today!
Functional profiling of the crosstalk among sigma factors in P. aeruginosa.The PseudoCAP annotation [55] was used to categorize the members of the direct (viole
This is an old question, but I feel this is still worthy of an answer. If you dont want to use orthonormal frames, there are still methods that allow one to organize data into easy-to-handle forms that make these calculations simpler.. First note that $R^\rho_{\ \sigma\mu\nu}=\partial_\mu\Gamma^\rho_{\nu\sigma}-\partial_\nu\Gamma^\rho_{\mu\sigma}+\Gamma^\rho_{\mu\lambda}\Gamma^\lambda_{\nu\sigma}-\Gamma^\rho_{\nu\lambda}\Gamma^\lambda_{\mu\sigma}$, which can be organized into several matrix equations, if we define $\Gamma_\mu$ to be the matrix whose $(\rho,\sigma)$-th element is $\Gamma^\rho_{\mu\sigma}$. Then there exits 6 independent Riemann-matrices, $\mathbf{R}_{\mu\nu}$ ($\mu,\nu$ skew-symmetric) for which $$ \mathbf{R}_{\mu\nu}=\partial_\mu\Gamma_\nu-\partial_\nu\Gamma_\mu+[\Gamma_\mu,\Gamma_\nu]. $$ This potentially involves more calculations than simply isolating the 20 independent components and brute-forcing them, but the use of matrices allows a very clear overview and organization ...
In general as far as I know customers who bought Sigma Small Contour - F05 or other products in the Internet also were interested in reviews, cheap & lowest prices in outlets and stores, shipping, gift ideas, city deals, sales, coupons online, new, holiday & daily deals, bargain, best buy products including special offers on Sigma Small Contour - F05, best deals, discount coupons, top & hot deals, great offers, last minute deals and so on ...
Sigma Life Science, the innovative biological products and services research business of Sigma-Aldrich® (Nasdaq: SIAL), today announced the release of OligoArchitectTM, an online primer and probe design tool. This freely available tool offers automated design of probes and primers for real-time qPCR assays, powered by the industry standard Beacon DesignerTM platform from PREMIER Biosoft, it complements Sigma Life Sciences comprehensive portfolio of oligonucleotide and qPCR products and customized oligonucleotide services...
Information about Novaquimica Sigma Pharma-Natures Plus products database; lists of Novaquimica Sigma Pharma-Natures Plus pharmaceutical drugs and health care production from Drugs-about.com
Sigma already has a collection of fully vegan synthetic brushes: Sigmax Synthetic Face Kit. I find their synthetic brushes to be the best brushes they produce. They are softer, hypoallergenic, cruelty-free, and function just as well as the natural bristle brushes. Frankly, I wouldnt mind if Sigma decided to replace their entire line with synthetic brushes ...
... sigma factor There are also anti-sigma factors that inhibit the function of sigma factors and anti-anti-sigma factors that ... Sigma factors in E. coli: σ70(RpoD) - σA - the "housekeeping" sigma factor or also called as primary sigma factor (Group 1), ... The number of sigma factors varies between bacterial species. E. coli has seven sigma factors. Sigma factors are distinguished ... A sigma factorfactor or specificity factor) is a protein needed for initiation of transcription in bacteria. It is a ...
... different transcriptional factor and sigma factor interact with their correspondent anti-sigma factor. Third, anti-sigma factor ... RsbW is an anti-sigma factor that regulates another anti-sigma factor , sigma B. RsbW binds to sigma B and prevents it from ... of sigma factor affect by several mechanism such as add up anti-sigma factor between sigma or twist the anti-sigma factor ... anti-sigma factors bind to sigma factors and inhibit transcriptional activity. Anti-sigma factors have been found in a number ...
Her postdoctoral research focused on alginate gene regulation with a focus on the alginate-specific sigma factor, AlgT/U, and ... Hughes, Kelly T.; Mathee, Kalai (1998-10-01). "The anti-sigma factors". Annual Review of Microbiology. 52 (1): 231-286. doi: ... Mathee, K; Howe, M M (1993-09-01). "Bacteriophage Mu Mor protein requires sigma 70 to activate the Mu middle promoter". Journal ... Adonizio, Allison; Kong, Kok-Fai; Mathee, Kalai (2008). "Inhibition of Quorum Sensing-Controlled Virulence Factor Production in ...
Group 1 sigma factors are critical for cell viability. Group 2, similar in structure to Group 1, is not essential for cell ... As noted above in RNA Polymerase and Sigma Factors, the beta clamp proteins within the RNAP complex have a higher initial ... Thus the gene is not effectively repressed.Synechocystis possesses the 70S sigma factor (σ70), which can be divided into three ... RNA polymerase (RNAP) and sigma factors are necessary proteins for transcription of DNA into messenger RNA (mRNA). Eubacterial ...
The gene rpoN (RNA polymerase, nitrogen-limitation N) encodes the sigma factor sigma-54 (σ54, sigma N, or RpoN), a protein in ... RpoN antagonizes RpoS sigma factors. Originally identified as a regulator of genes involved in nitrogen metabolism and ... Buck M, Cannon W (July 1992). "Specific binding of the transcription factor sigma-54 to promoter DNA". Nature. 358 (6385): 422- ... Gruber TM, Gross CA (2003). "Multiple sigma subunits and the partitioning of bacterial transcription space". Annual Review of ...
The RNA polymerase core associates with the sigma factor to form RNA polymerase holoenzyme. Sigma factor reduces the affinity ... General transcription factors (GTFs), also known as basal transcriptional factors, are a class of protein transcription factors ... Because of the RNA polymerase association with sigma factor, the complete RNA polymerase therefore has 6 subunits: the sigma ... Sigma factors provide promoter recognition specificity to the RNA polymerase (RNAP) and contribute to DNA strand separation, ...
The origin of the Gen-Factor was revealed: Sigma. The Gen-Factor was the source of superhuman powers for many characters in the ... 35 Sigma #2 WildC.A.T.s #29 Deathblow #27 Gen¹³ #11 Backlash #20 Wetworks #17 Stormwatch #36 WildC.A.T.s #30 Sigma #3 Finale ... On Earth, Damocles' opponent from his homeworld had been reborn as the superhero Sigma. Damocles was assisted in his quest by ... Fire From Heaven #½ Prelude Sword Of Damocles #1 Sigma #1 Deathblow #26 Chapters Fire From Heaven #1 Backlash #19 Gen¹³ #10 ...
A sigma (σ) factor binds to the core, forming the holoenzyme. After transcription starts, the factor can unbind and let the ... RNAP core associates with the transcription initiation factor sigma (σ) to form RNA polymerase holoenzyme. Sigma reduces the ... the functions of the bacterial general transcription factor sigma are performed by multiple general transcription factors that ... There are multiple interchangeable sigma factors, each of which recognizes a distinct set of promoters. For example, in E. coli ...
The gene rpoE (RNA polymerase, extracytoplasmic E) encodes the sigma factor sigma-24 (σ24, sigma E, or RpoE), a protein in ... the gene encoding the second heat-shock sigma factor, sigma E, in Escherichia coli". The EMBO Journal. 14 (5): 1032-42. doi: ... De Las Peñas, A; Connolly, L; Gross, CA (Nov 1997). "SigmaE is an essential sigma factor in Escherichia coli". Journal of ... De Las Peñas, A; Connolly, L; Gross, CA (Nov 1997). "SigmaE is an essential sigma factor in Escherichia coli". Journal of ...
... encodes the sigma factor sigma-38 (σ38, or RpoS), a 37.8 kD protein in Escherichia coli. Sigma factors are proteins that ... Brown L, Elliott T (July 1996). "Efficient translation of the RpoS sigma factor in Salmonella typhimurium requires host factor ... Sigma factors can be activated in response to different environmental conditions. rpoS is transcribed in late exponential phase ... RpoS proteolysis forms another level of the sigma factor's regulation. Degradation occurs via ClpXP, a barrel-shaped protease ...
... sigma } the factor in the MSE remains approximately 2. Choosing a suitable value for τ {\displaystyle \tau } is a major ... The estimator of also reaches an MSE which is a constant factor times σ 2 N {\displaystyle {\frac {\sigma ^{2}}{N}}} . In this ... sigma ^{2}}{N}}} assuming a white Gaussian noise w n ∼ N ( 0 , σ 2 ) {\displaystyle w_{n}\sim {\mathcal {N}}(0,\sigma ^{2})} . ... sigma }}\int \limits _{x}^{\infty }e^{-w^{2}/2\sigma ^{2}}\,dw} Here τ {\displaystyle \tau } is a parameter leveraging our ...
ArcZ positively stimulates expression of RpoS stationary phase sigma factor. In plant pathogen Erwinia amylovora ArcZ was shown ...
... the Z-factor is defined as: Z-factor = 1 − 3 ( σ p + σ n ) , μ p − μ n , {\displaystyle {\text{Z-factor}}=1-{3(\sigma _{p}+\ ... sigma }}_{p}+{\hat {\sigma }}_{n}) \over ,{\hat {\mu }}_{p}-{\hat {\mu }}_{n},}} The following interpretations for the Z-factor ... The constant factor 3 in the definition of the Z-factor is motivated by the normal distribution, for which more than 99% of ... sigma _{n}) \over ,\mu _{p}-\mu _{n},}} In practice, the Z-factor is estimated from the sample means and sample standard ...
... displaystyle Z-factor=1-{\frac {2.575(\sigma _{SDA+UV}+\sigma _{UV})}{,{\text{mutation rate}}_{SDA+UV}-{\text{mutation rate}}_{ ... Using differential mutational signatures, RNP-MaP sites are identified based on universal normalization factors and thresholds ... the standard deviation of reactivities for all nucleotides The calculated Z-factor is greater than zero The calculated Z-factor ... sigma _{nt}={\frac {\sqrt {{\text{mutation rate}}_{nt}}}{\sqrt {{\text{reads}}_{nt}}}}} , where n t {\displaystyle nt} is ...
Zhou, Zhan; Li, Qi; Tudyk, Julie; Li, Yong-Quan; Wang, Yufeng (4-6 December 2011). ECF sigma factor-associated regulatory ...
This RNA polymerase appears to operate without a sigma factor/subunit. The purified Φ6 RdRP displays processive elongation in ...
In bacteria The promoter is recognized by RNA polymerase and an associated sigma factor, which in turn are often brought to the ... RNA polymerase holoenzymes containing other sigma factors recognize different core promoter sequences. <-- upstream downstream ... An inactive enhancer may be bound by an inactive transcription factor. Phosphorylation of the transcription factor may activate ... Several cell function specific transcription factors (there are about 1,600 transcription factors in a human cell) generally ...
"Regulation of Escherichia coli starvation sigma factor (sigma s) by ClpXP protease". Journal of Bacteriology. 178 (2): 470-476 ... McCann, M. P.; Kidwell, J. P.; Matin, A. (1991). "The putative sigma factor KatF has a central role in development of ... Regulation of Escherichia coli starvation sigma factor (σs) by ClpXP protease. Journal of Bacteriology 178: 470-476. Schultz, J ... and that this sigma factor thereby controlled development of the general stress response. Hunger stress was found to trigger ...
Also, it appears that these ncRNAs are regulated by RpoS sigma-factor. CsrB/RsmB RNA family CsrC RNA family PrrB/RsmZ RNA ...
In bacteria, the sigma factor recognizes and binds to the promoter sequence. In eukaryotes, the transcription factors perform ... General transcription factors (GTFs) or basal transcription factors are protein transcription factors that have been shown to ... TFIIF (two subunits, RAP30 and RAP74, showing some similarity to bacterial sigma factors) and Pol II enter the complex together ... Chromatin structure-oriented factors are more complex than for initiation control. Often the chromatin-altering factor becomes ...
It is homologous to eukaryotic TFIIB and, more distantly, to bacterial sigma factor. Like these proteins, it is involved in ... In bacteria and eukaryotes, proteins TFIIB and sigma factor are involved in the initiation of transcription, where they ... Archaeal transcription factor B (ATFB or TFB) is a protein family of extrinsic transcription factors that guide the initiation ... TFB is recruited by another translation factor, TBP, after it recognizes the TATA box and bends the DNA so transcription can ...
"Identification and characterization of the gene encoding the Acidobacterium capsulatum major sigma factor". Gene. 376 (1): 144- ...
Campagne S, Damberger FF, Kaczmarczyk A, Francez-Charlot A, Allain FH, Vorholt JA (2012). "Structural basis for sigma factor ...
"A DNA damage response in Escherichia coli involving the alternative sigma factor, RpoS". Proceedings of the National Academy of ...
The holoenzyme is composed of a specific component known as the sigma factor. The sigma factor functions in aiding in promoter ... After the sigma factor performs its required function, it dissociates, while the catalytic portion remains on the DNA and ... When all σ-factor is present, RNA polymerase is in its active form and is referred to as the holoenzyme. When the σ-factor ... The σ-factor is needed to initiate transcription but is not needed to continue transcribing the DNA. The σ-factor dissociates ...
In bacteria, there is one general RNA transcription factor known as a sigma factor. RNA polymerase core enzyme binds to the ... the functions of the bacterial general transcription factor sigma are performed by multiple general transcription factors that ... However, later data showed that upon and following promoter clearance, the sigma factor is released according to a stochastic ... In bacteria, it was historically thought that the sigma factor is definitely released after promoter clearance occurs. This ...
The video ends as Sigma, Ora and others have Christmas dinner together. Sigma and Ora performed the song on The X Factor on 29 ... "Sigma & Rita Ora - Coming Home (Official Music Video)". YouTube. Retrieved 7 November 2015. "iTunes - Music - Life by Sigma". ... The video features Sigma walking in the forest amongst a group of people while Rita sings in a vacant house. ... "Coming Home" is a song by British drum and bass duo Sigma and British singer Rita Ora. The song was released on 6 November 2015 ...
The activity of this sigma factor peaks at the start of the stationary phase. Autolysins are naturally produced by ... and lytF genes together leads to flagellar motility and is controlled by the activity of the chemotaxis sigma factor, σD. ...
Bautz's most important discovery is that of sigma factor, the first known transcription factor. He developed methods for the ... Burgess RR, Travers AA, Dunn JJ, Bautz EK: Factor stimulating transcription by RNA polymerase. Nature 1969, 221(5175):43-46). ... Transcription factors, Rutgers University faculty, Molecular geneticists). ...
Ms1 does not require the presence of the main sigma factor for RNAP interaction. There is evidence that Ms1 RNA may function ...
... and late sigma factor (gp55) interaction". J Mol Biol. 319 (2): 289-304. doi:10.1016/S0022-2836(02)00298-X. PMID 12051907. ... Malik P, Terry TD, Bellintani F, Perham RN (October 1998). "Factors limiting display of foreign peptides on the major coat ... Gommans WM, Haisma HJ, Rots MG (December 2005). "Engineering zinc finger protein transcription factors: the therapeutic ...
According to the definition of extinction, σ e = σ s + σ a {\displaystyle \sigma _{e}=\sigma _{s}+\sigma _{a}} and Q e = Q s + ... the form factor). The notable features of these results are the Mie resonances, sizes that scatter particularly strongly or ... sigma _{i}} , to the particle protected area, Q i = σ i π a 2 {\displaystyle Q_{i}={\frac {\sigma _{i}}{\pi a^{2}}}} , where a ... where Q is the efficiency factor of scattering, which is defined as the ratio of the scattering cross-section and geometrical ...
Due to the large amount of downed wires, residents living along Ladd Road north to Sigma Place were urged to remain in their ... another factor favoring thunderstorm formation. Over the following hours, an isolated thunderstorm developed just outside the ...
ISBN 0-8493-0464-4. Werbowy, S., Windholz, L. Studies of Landé gJ-factors of singly ionized neodymium isotopes (142, 143 and ... https://doi.org/10.1007/BFb0111260 "Neodymium 261157". Sigma-Aldrich. Pol, Arjan; Barends, Thomas R. M.; Dietl, Andreas; Khadem ...
Sigma male is used to denote a male who is equally dominant to an alpha male, but exists outside the alpha-beta male hierarchy ... the influence of extrinsic factors and a dominance hierarchy". Canadian Journal of Zoology. 74 (5): 769-783. doi:10.1139/z96- ... "Is the Sigma Male the New Alpha? Does It Even Matter?". www.yahoo.com. Retrieved 2022-04-07. Dazed (2022-01-13). "Rise and ... "Sigma, simp and all the other misinterpreted terms on social media you need to know about". The Financial Express. Retrieved ...
Two factors during the 1960s contributed to future football success in Hartford City. First, the city began a Pee Wee Football ... Parkside Elementary School was built on the west side of town adjacent to Sigma Phi Gamma park. It replaced an old west side ... The football field was located adjacent to the city's Sigma Phi Gamma Park, which was within walking distance of the high ...
As a result, an IFN-stimulated gene factor 3 (ISGF3) complex forms-this contains STAT1, STAT2 and a third transcription factor ... Miller JE, Samuel CE (September 1992). "Proteolytic cleavage of the reovirus sigma 3 protein results in enhanced double- ... They described these observations in a 1959 publication, naming the responsible factor viral inhibitory factor (VIF). It took ... Other cytokines, such as interleukin 1, interleukin 2, interleukin-12, tumor necrosis factor and colony-stimulating factor, can ...
The combination of several glass models together with other relevant functions can be used for optimization and six sigma ... and many other factors. A pioneering article about the subject was written by Carl Kröger in 1953. For modeling of the glass ... of several glass models together with further relevant technological and financial functions can be used in six sigma ...
Combined with other factors, including the cold temperatures, the flaw caused the tank wall to split in less than a second. In ... "Sigma Chi/Significant Sigs/Business and Industry". www.shsu.edu. Retrieved 2020-07-22. "Honorary Degree Recipients , Honorary ... In 1988, Ashland was named Business Citizen of the Year by the University of Kentucky chapter of Beta Gamma Sigma in ... He also received a Significant Sig award from Sigma Chi Fraternity in 1985. The following year, The Ohio State University ...
... sigma \nu }T^{\sigma \nu }+\Gamma ^{\nu }{}_{\sigma \nu }T^{\mu \sigma }\end{aligned}}} The 4-gradient is used in a number of ... Many authors set factors of c {\displaystyle c} and ℏ {\displaystyle \hbar } and G {\displaystyle G} to dimensionless unity. ... sigma \nu }T^{\sigma \nu }+\Gamma ^{\nu }{}_{\sigma \nu }T^{\mu \sigma }\\T^{\mu \nu }{}_{;\nu }&=T^{\mu \nu }{}_{,\nu }+\Gamma ... The factor of (1/c) is to keep the correct unit dimensionality, [length]−1, for all components of the 4-vector and the (−1) is ...
... sigma _{i}^{2}=x_{i}\sigma ^{2}} (an example of a scedastic function), so the variance is proportional to the value of x. More ... atmospheric distortion and a variety of other factors. The data you collect would exhibit heteroscedasticity. One of the ... sigma ^{2}{\begin{bmatrix}1&0&0\\0&2&0\\0&0&3\\\end{bmatrix}}&C&=\sigma ^{2}{\begin{bmatrix}x_{1}&0&0\\0&x_{2}&0\\0&0&x_{3}\\\ ... Sigma _{1}),N(\mu _{2},\Sigma _{2}),} are both homoscedastic and lack Serial correlation if they share the same diagonals in ...
The higher the Q factor of the capacitor, the closer it approaches the behavior of an ideal capacitor. The Q factor of a ... Sigma }{\boldsymbol {D}}({\boldsymbol {r}},\omega )\cdot d{\boldsymbol {\Sigma }}\\&=\left[G(\omega )+j\omega C(\omega )\right] ... The quality factor (or Q) of a capacitor is the ratio of its reactance to its resistance at a given frequency, and is a measure ... Factors such as voltage and chassis material are of secondary consideration, which are more related to how easily a shock can ...
... sigma ^{2}<\infty } , let Y n = 1 n X X T {\displaystyle Y_{n}={\frac {1}{n}}XX^{T}} and let λ 1 , λ 2 , … , λ m {\displaystyle ... are the significant common factors. For instance, obtaining a correlation matrix of a year long series (i.e. 252 trading days) ... sigma ^{2}=1} , is given by G μ ( z ) = z + λ − 1 − ( z − λ − 1 ) 2 − 4 λ 2 λ z {\displaystyle G_{\mu }(z)={\frac {z+\lambda -1 ... sigma ^{2}(1-\lambda )r(x)}}\right)} and r ( x ) = λ + − x x − λ − {\displaystyle r(x)={\sqrt {\frac {\lambda _{+}-x}{x-\lambda ...
PL mount Rollei-mount Sigma SA-mount (Sigma MC-11 SA-E with AF and electronic aperture control) T2-mount (screw) A focal ... The 1/3 light fall-off equals 1/2 stop and may decrease the image quality accordingly when available light is a limiting factor ... Handevision Irix Lens Samyang Optics / Rokinon Sigma Corporation Shenyang Zhongyi Optical and Electronic Company (ZY Optics) ... although a crop factor will have to be taken into account for all cameras with APS-C or Super-35mm sensor format. Additionally ...
The dark conductivity of such a material is given by σ d = e ( N d − N d + ) β μ τ {\displaystyle \sigma _{d}=e\left(N_{d}-N_{d ... The refractive index of a material is the factor by which the phase velocity is decreased relative to the velocity of light in ... sigma _{ph}=e\left(N_{d}-N_{d}^{+}\right){\frac {sI\mu \tau }{h\nu }}} in which s is the effective cross-section for ...
... sigma _{\mathrm {elliptical\ crack} }=\sigma _{\mathrm {applied} }\left(1+2{\sqrt {\frac {a}{\rho }}}\right)=2\sigma _{\mathrm ... Brittle fracture may be avoided by controlling three primary factors: material fracture toughness (Kc), nominal stress level (σ ... Putting these two equations together gets σ f r a c t u r e = E γ ρ 4 a r o . {\displaystyle \sigma _{\mathrm {fracture} }={\ ... sigma _{\mathrm {F} }{\sqrt {\pi \mathrm {c} }}\mathrm {f\ (c/a)} } Where:- f ( c / a ) {\displaystyle \mathrm {f\ (c/a)} } is ...
Blackburn was a member of the Chi Omega sorority, the Sigma Alpha Epsilon Little Sisters of Minerva (an auxiliary to a male ... Dickson, Caitlin (June 9, 2013). "The Fringe Factor: Women Don't Want Equal Pay Laws". The Daily Beast. Archived from the ...
... pay gap between men and women was explained by three factors: Where and when rides originate from (i.e., time and location) ... sigma ^{2})} is a normally distributed random variable. After correction for the potentially confounding variables in a ... "The gender pay gap for Uber drivers can be completely explained by three factors, and not discrimination". AEI. April 2, 2019. ... Robustness to Base Rates and Other Factors". Psychological Methods. 13 (1): 19-30. doi:10.1037/1082-989X.13.1.19. PMID 18331151 ...
In the design of experiments, Latin squares are a special case of row-column designs for two blocking factors. In algebra, ... sigma _{0}(A)}{\binom {\operatorname {per} A}{n}},} where Bn is the set of all n × n {0, 1}-matrices, σ0(A) is the number of ...
... and the nominal south pole star is Sigma Octantis, which with magnitude 5.5 is barely visible to the naked eye even under ideal ... Technical factors of astrology, Celestial mechanics). ...
... sigma _{2}^{2}/a=4\pi ^{2}n^{2}(\sigma _{2}/a)^{2}/a} , i.e., the FWHM increases as the square of the order of peak, and so as ... is a dimensionless shape factor, with a value close to unity. The shape factor has a typical value of about 0.9, but varies ... sigma _{2}^{2}}}={\frac {a^{2}}{n^{2}\pi ^{2}\sigma _{2}^{2}}}} i.e., the height of successive peaks drop off as the order of ... sigma _{2}} equals a. This gives λ = a 3 σ 2 2 {\displaystyle \lambda ={\frac {a^{3}}{\sigma _{2}^{2}}}} which is in effect an ...
The idea is related to a property of the bosonic string in a curve background, better known as nonlinear sigma model. First ... Veneziano, G. (1991). "Scale factor duality for classical and quantum strings". Physics Letters B. 265 (3-4): 287-294. Bibcode: ...
Which leads to the simple expression: σ = ε ε 0 ψ 0 λ D {\displaystyle \sigma ={\frac {\varepsilon \varepsilon _{0}\psi _{0}}{\ ... is the Boltzmann factor: C = C 0 e − ψ z e k B T {\displaystyle C=C_{0}e^{-{\frac {\psi ze}{k_{\mathrm {B} }T}}}} where z is ... sigma ={\sqrt {8c_{0}\varepsilon \varepsilon _{0}k_{\mathrm {B} }N_{a}T}}\sinh \left({\frac {ze\psi _{0}}{2k_{\mathrm {B} }T}}\ ... sigma ={\frac {q}{A}}} According to Gauss's law, a conductor at equilibrium carrying an applied current has no charge on its ...
Six Sigma doctrine places (active) customers in opposition to two other classes of people: not-customers and non-customers: ... ISBN 978-1-86152-147-7. Kansal, B.B.; Rao, P.C.K. (2006). "Environmental Factors in Management". Preface to Management ( ... Many authors in ITIL and Six Sigma methodologies define "internal customer" as an internal part of a company that uses the ... Geoff Tennant, a Six Sigma consultant from the United Kingdom, uses the following analogy to explain the difference: A ...
Sigma {\frac {dr}{d\lambda }}&=\pm {\sqrt {R(r)}}\\\Sigma {\frac {d\theta }{d\lambda }}&=\pm {\sqrt {\Theta (\theta )}}\\\Sigma ... To a distant viewer, the apparent perpendicular distance between images decreases at a factor of e2π (about 500). However, fast ... Sigma ^{2}}}W\left[{\dot {x}}+i{\dot {y}}-{\frac {x+iy}{r}}{\dot {r}}\right]-M(x+iy)\left({\frac {4r^{2}}{\Sigma }}-1\right){\ ... Sigma }}-1\right){\frac {C}{r\Sigma ^{2}}}} where C {\displaystyle C} is analogous to Carter's constant and W {\displaystyle W ...
Montclare was elected a member of Iota Sigma Pi. She moved to Yale University for her graduate degree, earning master's in 2001 ... She worked in the lab of Alanna Schepartz, completing a thesis on the recognition of DNA by natural transcription factors. Her ... Iota Sigma Pi. Retrieved 2019-02-17. "Jin Montclare". STEM Women on Fire. Retrieved 2019-02-17. "Career Advice From Jin ...
He made his debut for the club as a starter on 16 January in a 3-1 win over Sigma Olomouc. Bah arrived at the club as a ... which was also a significant factor in Bah's choice. After attending ISI Idrætsefterskole in Ikast in 2014-15, he returned to ...
Thiamin and oxaloacetic acid as growth factors. Proc. Soc. Exp. Biol. Med. 58: 199-201. 1945. Biology of Pityrosporum ovalc. ... The Society of the Sigma Xi, the Harvey Society, the Microbiological Section of the New York Academy of Medicine, the Society ...
The simultaneous confidence coefficient is exactly 1 − α, whether the factor level sample sizes are equal or unequal. (Usually ... sigma }}_{e}^{2}\sum _{i=1}^{r}{\frac {c_{i}^{2}}{n_{i}}},} where ni is the size of the sample taken from the ith population ( ... which applies to the set of all possible factor levels. Let μ1, ..., μr be the means of some variable in r disjoint populations ... the one whose mean is μi), and σ ^ e 2 {\displaystyle {\hat {\sigma }}_{e}^{2}} is the estimated variance of the errors. It can ...
Timeline for Protein Sigma factor SigR from a.177.1.1: Sigma2 domain of RNA polymerase sigma factors: *Protein Sigma factor ... Protein Sigma factor SigR from a.177.1.1: Sigma2 domain of RNA polymerase sigma factors appears in SCOPe 2.05. *Protein Sigma ... anti-sigma factor binding domain. More info for Protein Sigma factor SigR from a.177.1.1: Sigma2 domain of RNA polymerase sigma ... Protein Sigma factor SigR from a.177.1.1: Sigma2 domain of RNA polymerase sigma factors appears in the current release, SCOPe ...
The cytokine group of proteins includes lymphokines, interferons, colony stimulating factors and chemokines. Growth factors are ... The MILLIPLEX® Human Cytokine/Chemokine/Growth Factor Panel A thus enables you to focus on the therapeutic potential of ... Simultaneously analyze up to 48 multiple cytokine, chemokine, and growth factor biomarkers with Bead-Based Multiplex Assays ... Quality Control Ranges: Human Cytokine/ Chemokine/Growth Factor Magnetic Bead Panel A ...
We constructed a mutant lacking the sigma factor gene, sigC, by allelic exchange, in the virulent CDC1551 strain of M. ... Bacterial alternative RNA polymerase sigma factors are key global adaptive response regulators with a likely role in ... Mycobacterium tuberculosis ECF sigma factor sigC is required for lethality in mice and for the conditional expression of a ... We constructed a mutant lacking the sigma factor gene, sigC, by allelic exchange, in the virulent CDC1551 strain of M. ...
RNA Polymerase and Alternative sigma factors Abraham L Sonenshein 1 Jeralyn D. Haraldsen Bruno Dupuy 2 Details. ... RNA Polymerase and Alternative sigma factors. Peter Dürre. Handbook on Clostridia, Taylor & Francis Group, pp.607-629, 2005, 0- ...
The present work brings new insights into the influencing factors of atomic order in the binary sigma phase. We calculated the ... of the binary sigma phase by using first-principles calculations. The calculation results show that besides the size factor and ... the total number of electron shells is found as the third factor that affects the atomic order of the sigma phase. Moreover, ... we dissociated the effects of individual influencing factors on atomic order of the sigma phase combining with the measured ...
Wow factor heating with new Sigma & Fog towel warmers by Aestus. For those that want to make a statement in the bathroom or ... Sigma has a standard width of 600mm with three variations of height: 1088mm, 1400mm and 1712mm and it delivers a heat output of ... Sigma is sure to be a signature piece in any room, especially in the bathroom where this contemporary design will create a ... Specifically designed with the style conscious in mind, Sigma and Fog command your attention with their distinct silhouettes, ...
... revealing a unique network topology of interacting sigma factors. Analysis of the operational state of the sigma factor network ... Bacteria contain multiple sigma factors, each targeting diverse, but often overlapping sets of promoters, thereby forming a ... Here we integrate multi-omic data sets to determine the topology, the operational, and functional states of the sigma factor ... Characterizing the interplay between multiple levels of organization within bacterial sigma factor regulatory networks. ...
... synopsis on Critical Success Factors Of Six Sigma Implementation That Describes Success Factors For Six Sigma ... Critical Success Factors of Six Sigma Implementation in an Organisation is a report that describes the success factors for six ... This report can brief about the critical success factors of six sigma factors. This is one of the best reports on Critical ... Success Factors of Six Sigma Implementation in an Organisation Free project report on Critical Success Factors of Six Sigma ...
Therefore, loss development factors are used to project the additional cost expected on claims associated with each loss period ... These factors quantify the late developing aspects of certain losses, such as claims involving medical complications not ...
Changes related to "Sigma factor". From The School of Biomedical Sciences Wiki ...
Crystal Structure of Thermus aquaticus RNA Polymerase Sigma Subunit Fragment, Region 4 ... sigma factor sigA. A. 73. Thermus aquaticus. Mutation(s): 1 Gene Names: sigA. ... sigma(3), and sigma(4), connected by flexible linkers. Crystal structures of each domain were determined, as well as of sigma(4 ... sigma(3), and sigma(4), connected by flexible linkers. Crystal structures of each domain were determined, as well as of sigma(4 ...
Crystal Structure of the Bacillus stearothermophilus Anti-Sigma Factor SpoIIAB with the Sporulation Sigma Factor SigmaF ... Crystal Structure of the Bacillus stearothermophilus Anti-Sigma Factor SpoIIAB with the Sporulation Sigma Factor SigmaF ... Crystal structure of the Bacillus stearothermophilus anti-sigma factor SpoIIAB with the sporulation sigma factor sigmaF. Cell( ... Anti-sigma F factor: AB. sigma factor: C. SMTL:PDB. SMTL Chain Id:. PDB Chain Id:. A. A ...
Sigma Cyber Security - Cyber Security - Inspect Factor Q2 Earnings Gains on Healthy And Balanced Cyber Protection Demand ... Inspect Factor Q2 Earnings Gains on Healthy And Balanced Cyber Protection Demand - USNews.com. *by admin ...
Sigma Factor:. Sigma70 Sigmulon. Distance from start of the gene:. 27 Sequence:. tgtcaacatcgcgacaactttcgtaaa ...
Mycobacterium Tuberculosis Rna Polymerase Transcription Initiation Open Complex with A Chimeric Ecf Sigma Factor Sigh/E ... Mycobacterium Tuberculosis Rna Polymerase Transcription Initiation Open Complex with A Chimeric Ecf Sigma Factor Sigh/E. ... Mycobacterium Tuberculosis Rna Polymerase Transcription Initiation Open Complex with A Chimeric Ecf Sigma Factor Sigh/E, PDB ... of 2 in the Mycobacterium Tuberculosis Rna Polymerase Transcription Initiation Open Complex with A Chimeric Ecf Sigma Factor ...
Influence of the Alternative Sigma Factor RpoN on Global Gene Expression and Carbon Catabolism in Enterococcus faecalis V583. ... The alternative sigma factor σ54 has been shown to regulate the expression of a wide array of virulence-associated genes, as ... Influence of the Alternative Sigma Factor RpoN on Global Gene Expression and Carbon Catabolism in Enterococcus faecalis V583 ... In this study, we show that the Enterococcus faecalis alternative sigma factor σ54 (RpoN) and its cognate enhancer binding ...
We found that the alternative sigma factor SigF2, which is a target of RpaA and RpaB24,37, factors into the dark-inducing ... A sigma factor that modifies the circadian expression of a subset of genes in cyanobacteria. EMBO J. 15, 2488-2495 (1996). ... The RB-TnSeq screen revealed the antagonistic importance of two sigma factors in natural competence: sigF2 and rpoD2 (Fig. 1a ... Imamura, S. & Asayama, M. Sigma factors for cyanobacterial transcription. Gene Regul. Syst. Bio 3, 65-87 (2009). ...
Six of these alternative sI factors have cognate membrane-associated anti-σ factors (RsgI) that contain C-terminal sensory ... our research groups discovered a collection of eight alternative s factors that are related to the Bacillus subtilis sI factor ... transcriptional regulation by alternative sigma factors in cellulolytic clostridia; production of biocommodities from ... During the last several years, our research group has focused on demonstrating that individual C. thermocellum sI factors ...
Regulation of sigma factor competition by the alarmone ppGpp Genes & Development, CSH Press 2002, Vol. 16, (10) : 1260-1270 ... The σ-factor FliA, ppGpp and DksA coordinate transcriptional control of the aer2 gene of Pseudomonas putida ... Properties of RNA polymerase bypass mutants: implications for the role of ppGpp and its co-factor DksA in controlling ... Integration of global regulation of two aromatic-responsive sigma(54)-dependent systems: a common phenotype by different ...
Interaction of the Streptomyces Wbl protein WhiD with the principal sigma factor σHrdB depends on the WhiD [4Fe-4S] cluster. ... Hypoxia-inducible factors are heterodimeric transcription factors that play a crucial role in a cells ability to adapt to low ... The transcription factor NF-ĸB is a master regulator of the innate immune response and plays a central role in inflammatory ... The ribosome assembly factor Nop53 controls association of the RNA exosome with pre-60S particles in yeast. Journal of ...
Sporulation proteins and sigma factors. Similar to Bacillus, the sporulation process in Clostridium is controlled by the ... An analysis on the presence or absence of respective genes for sporulation and sigma factors is presented in Additional file 6 ... orchestrated expression of a series of alternative sigma factors [22, 31, 32]. Homologs of sigH, sigF, sigE, sigG, and sigK ... Bahl H, Gottwald M, Kuhn A, Rale V, Andersch W, Gottschalk G. Nutritional factors affecting the ratio of solvents produced by ...
The alternative sigma factor KatF (RpoS) regulates Salmonella virulence. Proc Natl Acad Sci U S A (1992) 89:11978-82. doi: ... Central regulatory role for the RpoS sigma factor in expression of Salmonella dublin plasmid virulence genes. J Bacteriol (1995 ... Gupta S, Chowdhury R. Bile affects production of virulence factors and motility of Vibrio cholerae. Infect Immun (1997) 65:1131 ... The factors that can induce changes in the gut microbiome include transit time, abundance of proteolytic enzymes, antimicrobial ...
Cho, B.-K., Kim, D., Knight, E. M., Zengler, K., and Palsson, B. O. (2014). Genome-scale reconstruction of the sigma factor ... Sauer, U., Santangelo, J. D., Treuner, A., Buchholz, M., and Durre, P. (1995). Sigma factor and sporulation genes in ... Sauer, U., Treuner, A., Buchholz, M., Santangelo, J. D., and Durre, P. (1994). Sporulation and primary sigma factor homologous ... Feklistov, A., Sharon, B. D., Darst, S. A., and Gross, C. A. (2014). Bacterial Sigma Factors: A Historical, Structural, and ...
Manganelli, R.; Dubnau, E.; Tyagi, S.; Kramer, F.R.; Smith, I. Differential expression of 10 sigma factor genes in ... Sigma-Aldrich, St. Louis, MO, USA) and RNase (50 μg/mL, Sigma-Aldrich, St. Louis, MO, USA), in 50 mM Tris-HCl pH 7.5, 20 mM ... Sigma-Aldrich, St. Louis, MO, USA). The samples from S. aureus, B. subtilis, S. pneumoniae, E. coli and S. pneumoniae were ... Sigma-Aldrich, St. Louis, MO, USA) at 4 °C for 48 h. HF was washed off by centrifugation with 100 mM Tris-HCl pH 7.0. The ...
Lets review and compare the top best sigma rf mount to find what will work well with your needs. ... How To Choose The Best Sigma Rf Mount?. When choosing the best sigma rf mount, it is important to look at a variety of factors ... What Are The Criteria For The Selection Of A Sigma Rf Mount?. There are a number of factors that we consider when selecting a ... Should You Buy Sigma Rf Mount Online Or in A Physical Store? There are a number of reasons you should buy sigma rf mount on the ...
sigma factor AlgU Pseudomonas aeruginosa UCBPP-PA14 - Assembly GCF_000014625.1 PA14_54430 RNA polymerase sigma factor AlgU 193 ... sigma factor regulator, VreR Pseudomonas aeruginosa UCBPP-PA14 - Assembly GCF_000014625.1 PA14_55540 transmembrane sensor 319 ...
Response to environmental stress, particularly the role of extracytoplasmic function (ECF) sigma factors. ... Role of the stationary growth phase sigma factor RpoS of Burkholderia pseudomallei in response to physiological stress ... biosynthesis and transport genes of Burkholderia cenocepacia are regulated by an extracytoplasmic function sigma factor which ... Identification of transcription factors CysB and SsuR and their role in control of target genes. J BACTERIOL. , 189(5), 1675- ...
Although sigma factors of this group have previously been noted on plasmids, scant information has been published about their ... These isolates carried plasmids encoding all 6 pCT regions that were investigated (blaCTX-M-14, nikB, putative sigma factor, ... The first, and most notable, is a putative RNA polymerase sigma factor (CDS pCT_066) within the sequence, which shares homology ... PCRs to amplify DNA encoding the putative sigma factor, pilN gene, and shufflon recombinase were developed into a multiplex PCR ...
Some of the sigma factors include sigma E and sigma 70. These two factors act upon and induce different proteases and ... E coli have several native sigma factors in the genome that are upregulated during envelope stress. ... p,Raivio T., and Silhavy, T. (2001). Periplasmic stress and ECF Sigma factors. Annual Review of Microbiology, 55, 591-624. . ... Raivio T., and Silhavy, T. (2001). Periplasmic stress and ECF Sigma factors. Annual Review of Microbiology, 55, 591-624. ...

No FAQ available that match "sigma factor"

No images available that match "sigma factor"