Sodium chloride-dependent neurotransmitter symporters located primarily on the PLASMA MEMBRANE of serotonergic neurons. They are different than SEROTONIN RECEPTORS, which signal cellular responses to SEROTONIN. They remove SEROTONIN from the EXTRACELLULAR SPACE by high affinity reuptake into PRESYNAPTIC TERMINALS. Regulates signal amplitude and duration at serotonergic synapses and is the site of action of the SEROTONIN UPTAKE INHIBITORS.
A group of membrane transport proteins that transport biogenic amine derivatives of catechol across the PLASMA MEMBRANE. Catecholamine plasma membrane transporter proteins regulate neural transmission as well as catecholamine metabolism and recycling.
Membrane proteins whose primary function is to facilitate the transport of molecules across a biological membrane. Included in this broad category are proteins involved in active transport (BIOLOGICAL TRANSPORT, ACTIVE), facilitated transport and ION CHANNELS.
The movement of materials (including biochemical substances and drugs) through a biological system at the cellular level. The transport can be across cell membranes and epithelial layers. It also can occur within intracellular compartments and extracellular compartments.
A family of sodium chloride-dependent neurotransmitter symporters that transport the amino acid GLYCINE. They differ from GLYCINE RECEPTORS, which signal cellular responses to GLYCINE. They are located primarily on the PLASMA MEMBRANE of NEURONS; GLIAL CELLS; EPITHELIAL CELLS; and RED BLOOD CELLS where they remove inhibitory neurotransmitter glycine from the EXTRACELLULAR SPACE.
A family of plasma membrane neurotransmitter transporter proteins that couple the uptake of GLUTAMATE with the import of SODIUM ions and PROTONS and the export of POTASSIUM ions. In the CENTRAL NERVOUS SYSTEM they regulate neurotransmission through synaptic reuptake of the excitatory neurotransmitter glutamate. Outside the central nervous system they function as signal mediators and regulators of glutamate metabolism.
The lipid- and protein-containing, selectively permeable membrane that surrounds the cytoplasm in prokaryotic and eukaryotic cells.
A biochemical messenger and regulator, synthesized from the essential amino acid L-TRYPTOPHAN. In humans it is found primarily in the central nervous system, gastrointestinal tract, and blood platelets. Serotonin mediates several important physiological functions including neurotransmission, gastrointestinal motility, hemostasis, and cardiovascular integrity. Multiple receptor families (RECEPTORS, SEROTONIN) explain the broad physiological actions and distribution of this biochemical mediator.
A family of plasma membrane neurotransmitter transporter proteins that regulates extracellular levels of the inhibitory neurotransmitter GAMMA-AMINOBUTYRIC ACID. They differ from GABA RECEPTORS, which signal cellular responses to GAMMA-AMINOBUTYRIC ACID. They control GABA reuptake into PRESYNAPTIC TERMINALS in the CENTRAL NERVOUS SYSTEM through high-affinity sodium-dependent transport.
Sodium chloride-dependent neurotransmitter symporters located primarily on the PLASMA MEMBRANE of noradrenergic neurons. They remove NOREPINEPHRINE from the EXTRACELLULAR SPACE by high affinity reuptake into PRESYNAPTIC TERMINALS. It regulates signal amplitude and duration at noradrenergic synapses and is the target of ADRENERGIC UPTAKE INHIBITORS.
Membrane transporters that co-transport two or more dissimilar molecules in the same direction across a membrane. Usually the transport of one ion or molecule is against its electrochemical gradient and is "powered" by the movement of another ion or molecule with its electrochemical gradient.
A large group of membrane transport proteins that shuttle MONOSACCHARIDES across CELL MEMBRANES.
Transport proteins that carry specific substances in the blood or across cell membranes.
Proteins obtained from ESCHERICHIA COLI.
Sodium chloride-dependent neurotransmitter symporters located primarily on the PLASMA MEMBRANE of dopaminergic neurons. They remove DOPAMINE from the EXTRACELLULAR SPACE by high affinity reuptake into PRESYNAPTIC TERMINALS and are the target of DOPAMINE UPTAKE INHIBITORS.
The movement of materials across cell membranes and epithelial layers against an electrochemical gradient, requiring the expenditure of metabolic energy.
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
Proteins which are found in membranes including cellular and intracellular membranes. They consist of two types, peripheral and integral proteins. They include most membrane-associated enzymes, antigenic proteins, transport proteins, and drug, hormone, and lectin receptors.
The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.
A broad category of membrane transport proteins that specifically transport FREE FATTY ACIDS across cellular membranes. They play an important role in LIPID METABOLISM in CELLS that utilize free fatty acids as an energy source.
Thin structures that encapsulate subcellular structures or ORGANELLES in EUKARYOTIC CELLS. They include a variety of membranes associated with the CELL NUCLEUS; the MITOCHONDRIA; the GOLGI APPARATUS; the ENDOPLASMIC RETICULUM; LYSOSOMES; PLASTIDS; and VACUOLES.
Thin layers of tissue which cover parts of the body, separate adjacent cavities, or connect adjacent structures.
A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.
The process of moving proteins from one cellular compartment (including extracellular) to another by various sorting and transport mechanisms such as gated transport, protein translocation, and vesicular transport.
Lipids, predominantly phospholipids, cholesterol and small amounts of glycolipids found in membranes including cellular and intracellular membranes. These lipids may be arranged in bilayers in the membranes with integral proteins between the layers and peripheral proteins attached to the outside. Membrane lipids are required for active transport, several enzymatic activities and membrane formation.
A sequence-related subfamily of ATP-BINDING CASSETTE TRANSPORTERS that actively transport organic substrates. Although considered organic anion transporters, a subset of proteins in this family have also been shown to convey drug resistance to neutral organic drugs. Their cellular function may have clinical significance for CHEMOTHERAPY in that they transport a variety of ANTINEOPLASTIC AGENTS. Overexpression of proteins in this class by NEOPLASMS is considered a possible mechanism in the development of multidrug resistance (DRUG RESISTANCE, MULTIPLE). Although similar in function to P-GLYCOPROTEINS, the proteins in this class share little sequence homology to the p-glycoprotein family of proteins.
A family of MEMBRANE TRANSPORT PROTEINS that require ATP hydrolysis for the transport of substrates across membranes. The protein family derives its name from the ATP-binding domain found on the protein.
The voltage differences across a membrane. For cellular membranes they are computed by subtracting the voltage measured outside the membrane from the voltage measured inside the membrane. They result from differences of inside versus outside concentration of potassium, sodium, chloride, and other ions across cells' or ORGANELLES membranes. For excitable cells, the resting membrane potentials range between -30 and -100 millivolts. Physical, chemical, or electrical stimuli can make a membrane potential more negative (hyperpolarization), or less negative (depolarization).
Proteins found in any species of bacterium.
Cell-surface proteins that bind SEROTONIN and trigger intracellular changes which influence the behavior of cells. Several types of serotonin receptors have been recognized which differ in their pharmacology, molecular biology, and mode of action.
A serotonin receptor subtype found widely distributed in peripheral tissues where it mediates the contractile responses of variety of tissues that contain SMOOTH MUSCLE. Selective 5-HT2A receptor antagonists include KETANSERIN. The 5-HT2A subtype is also located in BASAL GANGLIA and CEREBRAL CORTEX of the BRAIN where it mediates the effects of HALLUCINOGENS such as LSD.
The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.
The characteristic 3-dimensional shape of a protein, including the secondary, supersecondary (motifs), tertiary (domains) and quaternary structure of the peptide chain. PROTEIN STRUCTURE, QUATERNARY describes the conformation assumed by multimeric proteins (aggregates of more than one polypeptide chain).
A serotonin receptor subtype found distributed through the CENTRAL NERVOUS SYSTEM where they are involved in neuroendocrine regulation of ACTH secretion. The fact that this serotonin receptor subtype is particularly sensitive to SEROTONIN RECEPTOR AGONISTS such as BUSPIRONE suggests its role in the modulation of ANXIETY and DEPRESSION.
The semi-permeable outer structure of a red blood cell. It is known as a red cell 'ghost' after HEMOLYSIS.
The rate dynamics in chemical or physical systems.
The movement of ions across energy-transducing cell membranes. Transport can be active, passive or facilitated. Ions may travel by themselves (uniport), or as a group of two or more ions in the same (symport) or opposite (antiport) directions.
A stack of flattened vesicles that functions in posttranslational processing and sorting of proteins, receiving them from the rough ENDOPLASMIC RETICULUM and directing them to secretory vesicles, LYSOSOMES, or the CELL MEMBRANE. The movement of proteins takes place by transfer vesicles that bud off from the rough endoplasmic reticulum or Golgi apparatus and fuse with the Golgi, lysosomes or cell membrane. (From Glick, Glossary of Biochemistry and Molecular Biology, 1990)
Compounds that specifically inhibit the reuptake of serotonin in the brain.
The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.
A quality of cell membranes which permits the passage of solvents and solutes into and out of cells.
Artificially produced membranes, such as semipermeable membranes used in artificial kidney dialysis (RENAL DIALYSIS), monomolecular and bimolecular membranes used as models to simulate biological CELL MEMBRANES. These membranes are also used in the process of GUIDED TISSUE REGENERATION.
Models used experimentally or theoretically to study molecular shape, electronic properties, or interactions; includes analogous molecules, computer-generated graphics, and mechanical structures.
Drugs that bind to but do not activate serotonin receptors, thereby blocking the actions of serotonin or SEROTONIN RECEPTOR AGONISTS.
The residual portion of BLOOD that is left after removal of BLOOD CELLS by CENTRIFUGATION without prior BLOOD COAGULATION.
Membrane proteins whose primary function is to facilitate the transport of positively charged molecules (cations) across a biological membrane.
Proteins isolated from the outer membrane of Gram-negative bacteria.
Established cell cultures that have the potential to propagate indefinitely.
Theoretical representations that simulate the behavior or activity of biological processes or diseases. For disease models in living animals, DISEASE MODELS, ANIMAL is available. Biological models include the use of mathematical equations, computers, and other electronic equipment.
The normality of a solution with respect to HYDROGEN ions; H+. It is related to acidity measurements in most cases by pH = log 1/2[1/(H+)], where (H+) is the hydrogen ion concentration in gram equivalents per liter of solution. (McGraw-Hill Dictionary of Scientific and Technical Terms, 6th ed)
Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.
A member of the alkali group of metals. It has the atomic symbol Na, atomic number 11, and atomic weight 23.
The process in which substances, either endogenous or exogenous, bind to proteins, peptides, enzymes, protein precursors, or allied compounds. Specific protein-binding measures are often used as assays in diagnostic assessments.
Cellular uptake of extracellular materials within membrane-limited vacuoles or microvesicles. ENDOSOMES play a central role in endocytosis.
Vesicles that are involved in shuttling cargo from the interior of the cell to the cell surface, from the cell surface to the interior, across the cell or around the cell to various locations.
A serotonin receptor subtype found primarily in the CENTRAL NERVOUS SYSTEM and the CHOROID PLEXUS. This receptor subtype is believed to mediate the anorectic action of SEROTONIN, while selective antagonists of the 5-HT2C receptor appear to induce ANXIETY. Several isoforms of this receptor subtype exist, due to adenine deaminase editing of the receptor mRNA.
The motion of phospholipid molecules within the lipid bilayer, dependent on the classes of phospholipids present, their fatty acid composition and degree of unsaturation of the acyl chains, the cholesterol concentration, and temperature.
Cells propagated in vitro in special media conducive to their growth. Cultured cells are used to study developmental, morphologic, metabolic, physiologic, and genetic processes, among others.
Glycoproteins found on the membrane or surface of cells.
Microscopy using an electron beam, instead of light, to visualize the sample, thereby allowing much greater magnification. The interactions of ELECTRONS with specimens are used to provide information about the fine structure of that specimen. In TRANSMISSION ELECTRON MICROSCOPY the reactions of the electrons that are transmitted through the specimen are imaged. In SCANNING ELECTRON MICROSCOPY an electron beam falls at a non-normal angle on the specimen and the image is derived from the reactions occurring above the plane of the specimen.
A basic element found in nearly all organized tissues. It is a member of the alkaline earth family of metals with the atomic symbol Ca, atomic number 20, and atomic weight 40. Calcium is the most abundant mineral in the body and combines with phosphorus to form calcium phosphate in the bones and teeth. It is essential for the normal functioning of nerves and muscles and plays a role in blood coagulation (as factor IV) and in many enzymatic processes.
Membrane proteins whose primary function is to facilitate the transport of negatively charged molecules (anions) across a biological membrane.
A broad category of proteins involved in the formation, transport and dissolution of TRANSPORT VESICLES. They play a role in the intracellular transport of molecules contained within membrane vesicles. Vesicular transport proteins are distinguished from MEMBRANE TRANSPORT PROTEINS, which move molecules across membranes, by the mode in which the molecules are transported.
A subclass of G-protein coupled SEROTONIN receptors that couple preferentially to the GQ-G11 G-PROTEINS resulting in increased intracellular levels of INOSITOL PHOSPHATES and free CALCIUM.
Cytoplasmic vesicles formed when COATED VESICLES shed their CLATHRIN coat. Endosomes internalize macromolecules bound by receptors on the cell surface.
A serotonin receptor subtype found in the BRAIN; HEART; LUNGS; PLACENTA and DIGESTIVE SYSTEM organs. A number of functions have been attributed to the action of the 5-HT2B receptor including the development of cardiac myocytes (MYOCYTES, CARDIAC) and the contraction of SMOOTH MUSCLE.
Drugs used for their effects on serotonergic systems. Among these are drugs that affect serotonin receptors, the life cycle of serotonin, and the survival of serotonergic neurons.
The level of protein structure in which combinations of secondary protein structures (alpha helices, beta sheets, loop regions, and motifs) pack together to form folded shapes called domains. Disulfide bridges between cysteines in two different parts of the polypeptide chain along with other interactions between the chains play a role in the formation and stabilization of tertiary structure. Small proteins usually consist of only one domain but larger proteins may contain a number of domains connected by segments of polypeptide chain which lack regular secondary structure.
A serotonin receptor subtype found at high levels in the BASAL GANGLIA and the frontal cortex. It plays a role as a terminal autoreceptor that regulates the rate of SEROTONIN release from nerve endings. This serotonin receptor subtype is closely related to and has similar drug binding properties as the 5-HT1D RECEPTOR. It is particularly sensitive to the agonist SUMATRIPTAN and may be involved in mediating the drug's antimigraine effect.
Endogenous compounds and drugs that bind to and activate SEROTONIN RECEPTORS. Many serotonin receptor agonists are used as ANTIDEPRESSANTS; ANXIOLYTICS; and in the treatment of MIGRAINE DISORDERS.
Microscopy of specimens stained with fluorescent dye (usually fluorescein isothiocyanate) or of naturally fluorescent materials, which emit light when exposed to ultraviolet or blue light. Immunofluorescence microscopy utilizes antibodies that are labeled with fluorescent dye.
A system of cisternae in the CYTOPLASM of many cells. In places the endoplasmic reticulum is continuous with the plasma membrane (CELL MEMBRANE) or outer membrane of the nuclear envelope. If the outer surfaces of the endoplasmic reticulum membranes are coated with ribosomes, the endoplasmic reticulum is said to be rough-surfaced (ENDOPLASMIC RETICULUM, ROUGH); otherwise it is said to be smooth-surfaced (ENDOPLASMIC RETICULUM, SMOOTH). (King & Stansfield, A Dictionary of Genetics, 4th ed)
Elements of limited time intervals, contributing to particular results or situations.
Techniques to partition various components of the cell into SUBCELLULAR FRACTIONS.
Recombinant proteins produced by the GENETIC TRANSLATION of fused genes formed by the combination of NUCLEIC ACID REGULATORY SEQUENCES of one or more genes with the protein coding sequences of one or more genes.
A large lobed glandular organ in the abdomen of vertebrates that is responsible for detoxification, metabolism, synthesis and storage of various substances.
A subclass of G-protein coupled SEROTONIN receptors that couple preferentially to GI-GO G-PROTEINS resulting in decreased intracellular CYCLIC AMP levels.
A light microscopic technique in which only a small spot is illuminated and observed at a time. An image is constructed through point-by-point scanning of the field in this manner. Light sources may be conventional or laser, and fluorescence or transmitted observations are possible.
Components of a cell produced by various separation techniques which, though they disrupt the delicate anatomy of a cell, preserve the structure and physiology of its functioning constituents for biochemical and ultrastructural analysis. (From Alberts et al., Molecular Biology of the Cell, 2d ed, p163)
An adenine nucleotide containing three phosphate groups esterified to the sugar moiety. In addition to its crucial roles in metabolism adenosine triphosphate is a neurotransmitter.
The directed transport of ORGANELLES and molecules along nerve cell AXONS. Transport can be anterograde (from the cell body) or retrograde (toward the cell body). (Alberts et al., Molecular Biology of the Cell, 3d ed, pG3)
An element in the alkali group of metals with an atomic symbol K, atomic number 19, and atomic weight 39.10. It is the chief cation in the intracellular fluid of muscle and other cells. Potassium ion is a strong electrolyte that plays a significant role in the regulation of fluid volume and maintenance of the WATER-ELECTROLYTE BALANCE.
Calcium-transporting ATPases found on the PLASMA MEMBRANE that catalyze the active transport of CALCIUM from the CYTOPLASM into the extracellular space. They play a role in maintaining a CALCIUM gradient across plasma membrane.
A primary source of energy for living organisms. It is naturally occurring and is found in fruits and other parts of plants in its free state. It is used therapeutically in fluid and nutrient replacement.
An adverse drug interaction characterized by altered mental status, autonomic dysfunction, and neuromuscular abnormalities. It is most frequently caused by use of both serotonin reuptake inhibitors and monoamine oxidase inhibitors, leading to excess serotonin availability in the CNS at the serotonin 1A receptor.
A subfamily in the family MURIDAE, comprising the hamsters. Four of the more common genera are Cricetus, CRICETULUS; MESOCRICETUS; and PHODOPUS.
Membrane transporters that co-transport two or more dissimilar molecules in the opposite direction across a membrane. Usually the transport of one ion or molecule is against its electrochemical gradient and is "powered" by the movement of another ion or molecule with its electrochemical gradient.
Drugs that bind to but do not activate SEROTONIN 5-HT2 RECEPTORS, thereby blocking the actions of SEROTONIN or SEROTONIN 5-HT2 RECEPTOR AGONISTS. Included under this heading are antagonists for one or more specific 5-HT2 receptor subtypes.
The part of a cell that contains the CYTOSOL and small structures excluding the CELL NUCLEUS; MITOCHONDRIA; and large VACUOLES. (Glick, Glossary of Biochemistry and Molecular Biology, 1990)
The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.
A large family of MONOMERIC GTP-BINDING PROTEINS that play a key role in cellular secretory and endocytic pathways. EC 3.6.1.-.
Red blood cells. Mature erythrocytes are non-nucleated, biconcave disks containing HEMOGLOBIN whose function is to transport OXYGEN.
The intracellular transfer of information (biological activation/inhibition) through a signal pathway. In each signal transduction system, an activation/inhibition signal from a biologically active molecule (hormone, neurotransmitter) is mediated via the coupling of a receptor/enzyme to a second messenger system or to an ion channel. Signal transduction plays an important role in activating cellular functions, cell differentiation, and cell proliferation. Examples of signal transduction systems are the GAMMA-AMINOBUTYRIC ACID-postsynaptic receptor-calcium ion channel system, the receptor-mediated T-cell activation pathway, and the receptor-mediated activation of phospholipases. Those coupled to membrane depolarization or intracellular release of calcium include the receptor-mediated activation of cytotoxic functions in granulocytes and the synaptic potentiation of protein kinase activation. Some signal transduction pathways may be part of larger signal transduction pathways; for example, protein kinase activation is part of the platelet activation signal pathway.
Cellular release of material within membrane-limited vesicles by fusion of the vesicles with the CELL MEMBRANE.
Any spaces or cavities within a cell. They may function in digestion, storage, secretion, or excretion.
A strain of albino rat used widely for experimental purposes because of its calmness and ease of handling. It was developed by the Sprague-Dawley Animal Company.
Inorganic compounds derived from hydrochloric acid that contain the Cl- ion.
The parts of a macromolecule that directly participate in its specific combination with another molecule.
An enzyme that catalyzes the active transport system of sodium and potassium ions across the cell wall. Sodium and potassium ions are closely coupled with membrane ATPase which undergoes phosphorylation and dephosphorylation, thereby providing energy for transport of these ions against concentration gradients.
Electrophoresis in which a polyacrylamide gel is used as the diffusion medium.
The tendency of a gas or solute to pass from a point of higher pressure or concentration to a point of lower pressure or concentration and to distribute itself throughout the available space. Diffusion, especially FACILITATED DIFFUSION, is a major mechanism of BIOLOGICAL TRANSPORT.
The property of objects that determines the direction of heat flow when they are placed in direct thermal contact. The temperature is the energy of microscopic motions (vibrational and translational) of the particles of atoms.
Body organ that filters blood for the secretion of URINE and that regulates ion concentrations.
Minute projections of cell membranes which greatly increase the surface area of the cell.
The uptake of naked or purified DNA by CELLS, usually meaning the process as it occurs in eukaryotic cells. It is analogous to bacterial transformation (TRANSFORMATION, BACTERIAL) and both are routinely employed in GENE TRANSFER TECHNIQUES.
Artificial, single or multilaminar vesicles (made from lecithins or other lipids) that are used for the delivery of a variety of biological molecules or molecular complexes to cells, for example, drug delivery and gene transfer. They are also used to study membranes and membrane proteins.
A darkly stained mat-like EXTRACELLULAR MATRIX (ECM) that separates cell layers, such as EPITHELIUM from ENDOTHELIUM or a layer of CONNECTIVE TISSUE. The ECM layer that supports an overlying EPITHELIUM or ENDOTHELIUM is called basal lamina. Basement membrane (BM) can be formed by the fusion of either two adjacent basal laminae or a basal lamina with an adjacent reticular lamina of connective tissue. BM, composed mainly of TYPE IV COLLAGEN; glycoprotein LAMININ; and PROTEOGLYCAN, provides barriers as well as channels between interacting cell layers.
The relationship between the dose of an administered drug and the response of the organism to the drug.
Layers of lipid molecules which are two molecules thick. Bilayer systems are frequently studied as models of biological membranes.
Microscopy in which the samples are first stained immunocytochemically and then examined using an electron microscope. Immunoelectron microscopy is used extensively in diagnostic virology as part of very sensitive immunoassays.
The species Oryctolagus cuniculus, in the family Leporidae, order LAGOMORPHA. Rabbits are born in burrows, furless, and with eyes and ears closed. In contrast with HARES, rabbits have 22 chromosome pairs.
Proteins prepared by recombinant DNA technology.
Protein analogs and derivatives of the Aequorea victoria green fluorescent protein that emit light (FLUORESCENCE) when excited with ULTRAVIOLET RAYS. They are used in REPORTER GENES in doing GENETIC TECHNIQUES. Numerous mutants have been made to emit other colors or be sensitive to pH.
A fungal metabolite which is a macrocyclic lactone exhibiting a wide range of antibiotic activity.
A membrane of squamous EPITHELIAL CELLS, the mesothelial cells, covered by apical MICROVILLI that allow rapid absorption of fluid and particles in the PERITONEAL CAVITY. The peritoneum is divided into parietal and visceral components. The parietal peritoneum covers the inside of the ABDOMINAL WALL. The visceral peritoneum covers the intraperitoneal organs. The double-layered peritoneum forms the MESENTERY that suspends these organs from the abdominal wall.
Test for tissue antigen using either a direct method, by conjugation of antibody with fluorescent dye (FLUORESCENT ANTIBODY TECHNIQUE, DIRECT) or an indirect method, by formation of antigen-antibody complex which is then labeled with fluorescein-conjugated anti-immunoglobulin antibody (FLUORESCENT ANTIBODY TECHNIQUE, INDIRECT). The tissue is then examined by fluorescence microscopy.
Identification of proteins or peptides that have been electrophoretically separated by blot transferring from the electrophoresis gel to strips of nitrocellulose paper, followed by labeling with antibody probes.
Specific particles of membrane-bound organized living substances present in eukaryotic cells, such as the MITOCHONDRIA; the GOLGI APPARATUS; ENDOPLASMIC RETICULUM; LYSOSOMES; PLASTIDS; and VACUOLES.
RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.
A subclass of serotonin receptors that form cation channels and mediate signal transduction by depolarizing the cell membrane. The cation channels are formed from 5 receptor subunits. When stimulated the receptors allow the selective passage of SODIUM; POTASSIUM; and CALCIUM.
Genetically identical individuals developed from brother and sister matings which have been carried out for twenty or more generations or by parent x offspring matings carried out with certain restrictions. This also includes animals with a long history of closed colony breeding.
A class of morphologically heterogeneous cytoplasmic particles in animal and plant tissues characterized by their content of hydrolytic enzymes and the structure-linked latency of these enzymes. The intracellular functions of lysosomes depend on their lytic potential. The single unit membrane of the lysosome acts as a barrier between the enzymes enclosed in the lysosome and the external substrate. The activity of the enzymes contained in lysosomes is limited or nil unless the vesicle in which they are enclosed is ruptured. Such rupture is supposed to be under metabolic (hormonal) control. (From Rieger et al., Glossary of Genetics: Classical and Molecular, 5th ed)
The domestic dog, Canis familiaris, comprising about 400 breeds, of the carnivore family CANIDAE. They are worldwide in distribution and live in association with people. (Walker's Mammals of the World, 5th ed, p1065)
Organic compounds that generally contain an amino (-NH2) and a carboxyl (-COOH) group. Twenty alpha-amino acids are the subunits which are polymerized to form proteins.
Negatively charged atoms, radicals or groups of atoms which travel to the anode or positive pole during electrolysis.
The principal sterol of all higher animals, distributed in body tissues, especially the brain and spinal cord, and in animal fats and oils.
Proteins involved in the transport of organic anions. They play an important role in the elimination of a variety of endogenous substances, xenobiotics and their metabolites from the body.
A major integral transmembrane protein of the ERYTHROCYTE MEMBRANE. It is the anion exchanger responsible for electroneutral transporting in CHLORIDE IONS in exchange of BICARBONATE IONS allowing CO2 uptake and transport from tissues to lungs by the red blood cells. Genetic mutations that result in a loss of the protein function have been associated with type 4 HEREDITARY SPHEROCYTOSIS.
Endogenous compounds and drugs that specifically stimulate SEROTONIN 5-HT2 RECEPTORS. Included under this heading are agonists for one or more of the specific 5-HT2 receptor subtypes.
Intracellular fluid from the cytoplasm after removal of ORGANELLES and other insoluble cytoplasmic components.
CELL LINES derived from the CV-1 cell line by transformation with a replication origin defective mutant of SV40 VIRUS, which codes for wild type large T antigen (ANTIGENS, POLYOMAVIRUS TRANSFORMING). They are used for transfection and cloning. (The CV-1 cell line was derived from the kidney of an adult male African green monkey (CERCOPITHECUS AETHIOPS).)
Minute intercellular channels that occur between liver cells and carry bile towards interlobar bile ducts. Also called bile capillaries.
Domesticated bovine animals of the genus Bos, usually kept on a farm or ranch and used for the production of meat or dairy products or for heavy labor.
The sum of the weight of all the atoms in a molecule.
Agents that emit light after excitation by light. The wave length of the emitted light is usually longer than that of the incident light. Fluorochromes are substances that cause fluorescence in other substances, i.e., dyes used to mark or label other compounds with fluorescent tags.
A network of membrane compartments, located at the cytoplasmic side of the GOLGI APPARATUS, where proteins and lipids are sorted for transport to various locations in the cell or cell membrane.
The first continuously cultured human malignant CELL LINE, derived from the cervical carcinoma of Henrietta Lacks. These cells are used for VIRUS CULTIVATION and antitumor drug screening assays.
Orientation of intracellular structures especially with respect to the apical and basolateral domains of the plasma membrane. Polarized cells must direct proteins from the Golgi apparatus to the appropriate domain since tight junctions prevent proteins from diffusing between the two domains.
A partitioning within cells due to the selectively permeable membranes which enclose each of the separate parts, e.g., mitochondria, lysosomes, etc.
CELL LINE derived from the ovary of the Chinese hamster, Cricetulus griseus (CRICETULUS). The species is a favorite for cytogenetic studies because of its small chromosome number. The cell line has provided model systems for the study of genetic alterations in cultured mammalian cells.
An enzyme that catalyzes the hydroxylation of TRYPTOPHAN to 5-HYDROXYTRYPTOPHAN in the presence of NADPH and molecular oxygen. It is important in the biosynthesis of SEROTONIN.
Gated, ion-selective glycoproteins that traverse membranes. The stimulus for ION CHANNEL GATING can be due to a variety of stimuli such as LIGANDS, a TRANSMEMBRANE POTENTIAL DIFFERENCE, mechanical deformation or through INTRACELLULAR SIGNALING PEPTIDES AND PROTEINS.
A species of the genus SACCHAROMYCES, family Saccharomycetaceae, order Saccharomycetales, known as "baker's" or "brewer's" yeast. The dried form is used as a dietary supplement.
Endogenous compounds and drugs that specifically stimulate SEROTONIN 5-HT1 RECEPTORS. Included under this heading are agonists for one or more of the specific 5-HT1 receptor subtypes.
Proteins obtained from the species SACCHAROMYCES CEREVISIAE. The function of specific proteins from this organism are the subject of intense scientific interest and have been used to derive basic understanding of the functioning similar proteins in higher eukaryotes.
Property of membranes and other structures to permit passage of light, heat, gases, liquids, metabolites, and mineral ions.
A subtype of G-protein-coupled SEROTONIN receptors that preferentially couple to GS STIMULATORY G-PROTEINS resulting in increased intracellular CYCLIC AMP. Several isoforms of the receptor exist due to ALTERNATIVE SPLICING of its mRNA.
A class of porins that allow the passage of WATER and other small molecules across CELL MEMBRANES.
A strain of albino rat developed at the Wistar Institute that has spread widely at other institutions. This has markedly diluted the original strain.
Female germ cells derived from OOGONIA and termed OOCYTES when they enter MEIOSIS. The primary oocytes begin meiosis but are arrested at the diplotene state until OVULATION at PUBERTY to give rise to haploid secondary oocytes or ova (OVUM).
Cell surface proteins that bind signalling molecules external to the cell with high affinity and convert this extracellular event into one or more intracellular signals that alter the behavior of the target cell (From Alberts, Molecular Biology of the Cell, 2nd ed, pp693-5). Cell surface receptors, unlike enzymes, do not chemically alter their ligands.
Purifying or cleansing agents, usually salts of long-chain aliphatic bases or acids, that exert cleansing (oil-dissolving) and antimicrobial effects through a surface action that depends on possessing both hydrophilic and hydrophobic properties.
Cellular proteins and protein complexes that transport amino acids across biological membranes.
The arrangement of two or more amino acid or base sequences from an organism or organisms in such a way as to align areas of the sequences sharing common properties. The degree of relatedness or homology between the sequences is predicted computationally or statistically based on weights assigned to the elements aligned between the sequences. This in turn can serve as a potential indicator of the genetic relatedness between the organisms.
Histochemical localization of immunoreactive substances using labeled antibodies as reagents.
A sulfhydryl reagent that is widely used in experimental biochemical studies.
Cell membranes associated with synapses. Both presynaptic and postsynaptic membranes are included along with their integral or tightly associated specializations for the release or reception of transmitters.
The ability of a substance to be dissolved, i.e. to form a solution with another substance. (From McGraw-Hill Dictionary of Scientific and Technical Terms, 6th ed)
The process by which ELECTRONS are transported from a reduced substrate to molecular OXYGEN. (From Bennington, Saunders Dictionary and Encyclopedia of Laboratory Medicine and Technology, 1984, p270)
Semiautonomous, self-reproducing organelles that occur in the cytoplasm of all cells of most, but not all, eukaryotes. Each mitochondrion is surrounded by a double limiting membrane. The inner membrane is highly invaginated, and its projections are called cristae. Mitochondria are the sites of the reactions of oxidative phosphorylation, which result in the formation of ATP. They contain distinctive RIBOSOMES, transfer RNAs (RNA, TRANSFER); AMINO ACYL T RNA SYNTHETASES; and elongation and termination factors. Mitochondria depend upon genes within the nucleus of the cells in which they reside for many essential messenger RNAs (RNA, MESSENGER). Mitochondria are believed to have arisen from aerobic bacteria that established a symbiotic relationship with primitive protoeukaryotes. (King & Stansfield, A Dictionary of Genetics, 4th ed)
A 51-amino acid pancreatic hormone that plays a major role in the regulation of glucose metabolism, directly by suppressing endogenous glucose production (GLYCOGENOLYSIS; GLUCONEOGENESIS) and indirectly by suppressing GLUCAGON secretion and LIPOLYSIS. Native insulin is a globular protein comprised of a zinc-coordinated hexamer. Each insulin monomer containing two chains, A (21 residues) and B (30 residues), linked by two disulfide bonds. Insulin is used as a drug to control insulin-dependent diabetes mellitus (DIABETES MELLITUS, TYPE 1).
Drugs that bind to but do not activate SEROTONIN 5-HT1 RECEPTORS, thereby blocking the actions of SEROTONIN 5-HT1 RECEPTOR AGONISTS. Included under this heading are antagonists for one or more of the specific 5-HT1 receptor subtypes.
Multisubunit enzymes that reversibly synthesize ADENOSINE TRIPHOSPHATE. They are coupled to the transport of protons across a membrane.
Detergent-insoluble CELL MEMBRANE components. They are enriched in SPHINGOLIPIDS and CHOLESTEROL and clustered with glycosyl-phosphatidylinositol (GPI)-anchored proteins.
A 170-kDa transmembrane glycoprotein from the superfamily of ATP-BINDING CASSETTE TRANSPORTERS. It serves as an ATP-dependent efflux pump for a variety of chemicals, including many ANTINEOPLASTIC AGENTS. Overexpression of this glycoprotein is associated with multidrug resistance (see DRUG RESISTANCE, MULTIPLE).
A plasma membrane exchange glycoprotein transporter that functions in intracellular pH regulation, cell volume regulation, and cellular response to many different hormones and mitogens.
A non-penetrating amino reagent (commonly called SITS) which acts as an inhibitor of anion transport in erythrocytes and other cells.
A group of enzymes which catalyze the hydrolysis of ATP. The hydrolysis reaction is usually coupled with another function such as transporting Ca(2+) across a membrane. These enzymes may be dependent on Ca(2+), Mg(2+), anions, H+, or DNA.
A family of monosaccharide transport proteins characterized by 12 membrane spanning helices. They facilitate passive diffusion of GLUCOSE across the CELL MEMBRANE.
The phenotypic manifestation of a gene or genes by the processes of GENETIC TRANSCRIPTION and GENETIC TRANSLATION.
Preparation for electron microscopy of minute replicas of exposed surfaces of the cell which have been ruptured in the frozen state. The specimen is frozen, then cleaved under high vacuum at the same temperature. The exposed surface is shadowed with carbon and platinum and coated with carbon to obtain a carbon replica.
Stable elementary particles having the smallest known positive charge, found in the nuclei of all elements. The proton mass is less than that of a neutron. A proton is the nucleus of the light hydrogen atom, i.e., the hydrogen ion.
A clear, odorless, tasteless liquid that is essential for most animal and plant life and is an excellent solvent for many substances. The chemical formula is hydrogen oxide (H2O). (McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)
The commonest and widest ranging species of the clawed "frog" (Xenopus) in Africa. This species is used extensively in research. There is now a significant population in California derived from escaped laboratory animals.
Cells that line the inner and outer surfaces of the body by forming cellular layers (EPITHELIUM) or masses. Epithelial cells lining the SKIN; the MOUTH; the NOSE; and the ANAL CANAL derive from ectoderm; those lining the RESPIRATORY SYSTEM and the DIGESTIVE SYSTEM derive from endoderm; others (CARDIOVASCULAR SYSTEM and LYMPHATIC SYSTEM) derive from mesoderm. Epithelial cells can be classified mainly by cell shape and function into squamous, glandular and transitional epithelial cells.
Genetically engineered MUTAGENESIS at a specific site in the DNA molecule that introduces a base substitution, or an insertion or deletion.
Proteins which are involved in the phenomenon of light emission in living systems. Included are the "enzymatic" and "non-enzymatic" types of system with or without the presence of oxygen or co-factors.
Liquid chromatographic techniques which feature high inlet pressures, high sensitivity, and high speed.
Members of the class of compounds composed of AMINO ACIDS joined together by peptide bonds between adjacent amino acids into linear, branched or cyclical structures. OLIGOPEPTIDES are composed of approximately 2-12 amino acids. Polypeptides are composed of approximately 13 or more amino acids. PROTEINS are linear polypeptides that are normally synthesized on RIBOSOMES.
The level of protein structure in which regular hydrogen-bond interactions within contiguous stretches of polypeptide chain give rise to alpha helices, beta strands (which align to form beta sheets) or other types of coils. This is the first folding level of protein conformation.
The network of filaments, tubules, and interconnecting filamentous bridges which give shape, structure, and organization to the cytoplasm.
A 700-kDa cytosolic protein complex consisting of seven equimolar subunits (alpha, beta, beta', gamma, delta, epsilon and zeta). COATOMER PROTEIN and ADP-RIBOSYLATION FACTOR 1 are principle components of COAT PROTEIN COMPLEX I and are involved in vesicle transport between the ENDOPLASMIC RETICULUM and the GOLGI APPARATUS.
Accumulation of a drug or chemical substance in various organs (including those not relevant to its pharmacologic or therapeutic action). This distribution depends on the blood flow or perfusion rate of the organ, the ability of the drug to penetrate organ membranes, tissue specificity, protein binding. The distribution is usually expressed as tissue to plasma ratios.
The basic cellular units of nervous tissue. Each neuron consists of a body, an axon, and dendrites. Their purpose is to receive, conduct, and transmit impulses in the NERVOUS SYSTEM.
Immunologic method used for detecting or quantifying immunoreactive substances. The substance is identified by first immobilizing it by blotting onto a membrane and then tagging it with labeled antibodies.
Organic, monobasic acids derived from hydrocarbons by the equivalent of oxidation of a methyl group to an alcohol, aldehyde, and then acid. Fatty acids are saturated and unsaturated (FATTY ACIDS, UNSATURATED). (Grant & Hackh's Chemical Dictionary, 5th ed)
Proteins involved in the transport of specific substances across the membranes of the MITOCHONDRIA.
Single-stranded complementary DNA synthesized from an RNA template by the action of RNA-dependent DNA polymerase. cDNA (i.e., complementary DNA, not circular DNA, not C-DNA) is used in a variety of molecular cloning experiments as well as serving as a specific hybridization probe.
The part of CENTRAL NERVOUS SYSTEM that is contained within the skull (CRANIUM). Arising from the NEURAL TUBE, the embryonic brain is comprised of three major parts including PROSENCEPHALON (the forebrain); MESENCEPHALON (the midbrain); and RHOMBENCEPHALON (the hindbrain). The developed brain consists of CEREBRUM; CEREBELLUM; and other structures in the BRAIN STEM.
Specialized forms of antibody-producing B-LYMPHOCYTES. They synthesize and secrete immunoglobulin. They are found only in lymphoid organs and at sites of immune responses and normally do not circulate in the blood or lymph. (Rosen et al., Dictionary of Immunology, 1989, p169 & Abbas et al., Cellular and Molecular Immunology, 2d ed, p20)
A characteristic feature of enzyme activity in relation to the kind of substrate on which the enzyme or catalytic molecule reacts.
The relationship between the chemical structure of a compound and its biological or pharmacological activity. Compounds are often classed together because they have structural characteristics in common including shape, size, stereochemical arrangement, and distribution of functional groups.
Filamentous proteins that are the main constituent of the thin filaments of muscle fibers. The filaments (known also as filamentous or F-actin) can be dissociated into their globular subunits; each subunit is composed of a single polypeptide 375 amino acids long. This is known as globular or G-actin. In conjunction with MYOSINS, actin is responsible for the contraction and relaxation of muscle.
A subfamily of Q-SNARE PROTEINS which occupy the same position as syntaxin 1A in the SNARE complex and which also are most similar to syntaxin 1A in their AMINO ACID SEQUENCE. This subfamily is also known as the syntaxins, although a few so called syntaxins are Qc-SNARES.
The processes whereby the internal environment of an organism tends to remain balanced and stable.
An iron-binding beta1-globulin that is synthesized in the LIVER and secreted into the blood. It plays a central role in the transport of IRON throughout the circulation. A variety of transferrin isoforms exist in humans, including some that are considered markers for specific disease states.
The main structural coat protein of COATED VESICLES which play a key role in the intracellular transport between membranous organelles. Each molecule of clathrin consists of three light chains (CLATHRIN LIGHT CHAINS) and three heavy chains (CLATHRIN HEAVY CHAINS) that form a structure called a triskelion. Clathrin also interacts with cytoskeletal proteins.
Linear POLYPEPTIDES that are synthesized on RIBOSOMES and may be further modified, crosslinked, cleaved, or assembled into complex proteins with several subunits. The specific sequence of AMINO ACIDS determines the shape the polypeptide will take, during PROTEIN FOLDING, and the function of the protein.
A cytotoxic member of the CYTOCHALASINS.

Induction of serotonin transporter by hypoxia in pulmonary vascular smooth muscle cells. Relationship with the mitogenic action of serotonin. (1/1378)

-The increased delivery of serotonin (5-hydroxytryptamine, 5-HT) to the lung aggravates the development of hypoxia-induced pulmonary hypertension in rats, possibly through stimulation of the proliferation of pulmonary artery smooth muscle cells (PA-SMCs). In cultured rat PA-SMCs, 5-HT (10(-8) to 10(-6) mol/L) induced DNA synthesis and potentiated the mitogenic effect of platelet-derived growth factor-BB (10 ng/mL). This effect was dependent on the 5-HT transporter (5-HTT), since it was prevented by the 5-HTT inhibitors fluoxetine (10(-6) mol/L) and paroxetine (10(-7) mol/L), but it was unaltered by ketanserin (10(-6) mol/L), a 5-HT2A receptor antagonist. In PA-SMCs exposed to hypoxia, the levels of 5-HTT mRNA (measured by competitive reverse transcriptase-polymerase chain reaction) increased by 240% within 2 hours, followed by a 3-fold increase in the uptake of [3H]5-HT at 24 hours. Cotransfection of the cells with a construct of human 5-HTT promoter-luciferase gene reporter and of pCMV-beta-galactosidase gene allowed the demonstration that exposure of cells to hypoxia produced a 5.5-fold increase in luciferase activity, with no change in beta-galactosidase activity. The increased expression of 5-HTT in hypoxic cells was associated with a greater mitogenic response to 5-HT (10(-8) to 10(-6) mol/L) in the absence as well as in the presence of platelet-derived growth factor-BB. 5-HTT expression assessed by quantitative reverse transcriptase-polymerase chain reaction and in situ hybridization in the lungs was found to predominate in the media of pulmonary artery, in which a marked increase was noted in rats that had been exposed to hypoxia for 15 days. These data show that in vitro and in vivo exposure to hypoxia induces, via a transcriptional mechanism, 5-HTT expression in PA-SMCs, and that this effect contributes to the stimulatory action of 5-HT on PA-SMC proliferation. In vivo expression of 5-HTT by PA-SMC may play a key role in serotonin-mediated pulmonary vascular remodeling.  (+info)

Nongenomic steroidal modulation of high-affinity serotonin transport. (2/1378)

The ability of steroids to modulate high-affinity 5-HT transport was investigated using cell-based models which stably manifest all known properties of this transport system. beta-Estradiol (E2) exhibited noncompetitive, and possibly allosteric, inhibition of both radiolabeled serotonin ([3H]5-HT) transport by, and radiolabeled cocaine congener ([3H]CFT) binding to, this system. Such inhibitory effects were observed within short time courses and unlikely to result from genomic effects normally ascribed to estrogen action. Rather, such nongenomic effects on 5-HT uptake were more akin to modulatory effects of select steroid metabolites on other plasma membrane systems such as neurotransmitter receptors and ionic channels. Beyond E2, preliminary examination of other steroid metabolites and synthetic steroid receptor agonists/antagonists revealed that inhibition of 5-HT transport is additionally attributable only to estriol (E3, an E2 metabolite) and tamoxifen (a nonsteroidal, E2 receptor antagonist). These findings indicate that the present form of transport modulation is only rendered by select compounds and not a general property of steroidal and related agents. Assessments of covalent conjugates of E2 suggested that E2 interacts with the transporter protein at allosteric site(s) inaccessible from the extracellular domain. These findings collectively suggest that steroid-mediated regulation of 5-HT transport may be a physiologically relevant mechanism, and that antidepressant as well as psychostimulant effects in vivo may contain a steroidal component.  (+info)

Modeling geriatric depression in animals: biochemical and behavioral effects of olfactory bulbectomy in young versus aged rats. (3/1378)

Geriatric depression exhibits biological and therapeutic differences relative to early-onset depression. We studied olfactory bulbectomy (OBX), a paradigm that shares major features of human depression, in young versus aged rats to determine mechanisms underlying these differences. Young OBX rats showed locomotor hyperactivity and a loss of passive avoidance and tactile startle. In contrast, aged OBX animals maintained avoidance and startle responses but showed greater locomotor stimulation; the aged group also exhibited decreased grooming and suppressed feeding with novel presentation of chocolate milk, effects which were not seen in young OBX. These behavioral contrasts were accompanied by greater atrophy of the frontal/parietal cortex and midbrain in aged OBX. Serotonin transporter sites were increased in the cortex and hippocampus of young OBX rats, but were decreased in the aged OBX group. Cell signaling cascades also showed age-dependent effects, with increased adenylyl cyclase responses to monoaminergic stimulation in young OBX but no change or a decrease in aged OBX. These data indicate that there are biological distinctions in effects of OBX in young and aged animals, which, if present in geriatric depression, provide a mechanistic basis for differences in biological markers and drug responses. OBX may provide a useful animal model with which to test therapeutic interventions for geriatric depression.  (+info)

Characteristics of drug interactions with recombinant biogenic amine transporters expressed in the same cell type. (4/1378)

We characterized the effects of drugs on the uptake of [3H]neurotransmitter by and the binding of [125I](3beta-(4-iodophenyl)tropane-2beta-carboxylic acid methyl ester ([125I]RTI-55) to the recombinant human dopamine (hDAT), serotonin (hSERT), or norepinephrine (hNET) transporters stably expressed in human embryonic kidney 293 cells. RTI-55 had similar affinity for the hDAT and hSERT and lower affinity for hNET (Kd = 1. 83, 0.98, and 12.1 nM, respectively). Kinetic analysis of [125I]RTI-55 binding indicated that the dissociation rate (k-1) was significantly lower for hSERT and the association rate (k+1) was significantly lower for hNET compared with the hDAT. The potency of drugs at blocking [3H]neurotransmitter uptake was highly correlated with potency at blocking radioligand binding for hDAT and hSERT. Substrates were more potent at the inhibition of [3H]neurotransmitter uptake than radioligand binding. The potency of drugs was highly correlated between displacement of [3H]nisoxetine (Kd = 6.0 nM) and [125I]RTI-55 from the hNET, suggesting that these radioligands recognize similar sites on the transporter protein. The correlation observed between inhibitory potency for uptake and binding of either ligand at the hNET was lower than correlations between uptake and binding for hDAT and hSERT. The present results indicate that the cocaine analog [125I]RTI-55 has unique binding properties at each of the transporters and that the use of recombinant transporters expressed by a single cell type can provide a powerful screening tool for drugs interacting with biogenic amine transporters, such as possible cocaine antagonists.  (+info)

Molecular chaperones stimulate the functional expression of the cocaine-sensitive serotonin transporter. (5/1378)

The serotonin transporter (SERT) is an N-glycosylated integral membrane protein that is predicted to contain 12 transmembrane regions. SERT is the major binding site in the brain for antidepressant drugs, and it also binds amphetamines and cocaine. The ability of various molecular chaperones to interact with a tagged version of SERT (Myc-SERT) was investigated using the baculovirus expression system. Overexpression of Myc-SERT using the baculovirus system led to substantial quantities of inactive transporter, together with small amounts of fully active and, therefore, correctly folded molecules. The high levels of inactive Myc-SERT probably arose because folding was rate-limiting due, perhaps, to insufficient molecular chaperones. Therefore, Myc-SERT was co-expressed with the endoplasmic reticulum (ER) molecular chaperones calnexin, calreticulin and immunoglobulin heavy chain binding protein (BiP), and the foldase, ERp57. The expression of functional Myc-SERT, as determined by an inhibitor binding assay, was enhanced nearly 3-fold by co-expressing calnexin, and to a lesser degree on co-expression of calreticulin and BiP. Co-expression of ERp57 did not increase the functional expression of Myc-SERT. A physical interaction between Myc-SERT-calnexin and Myc-SERT-calreticulin was demonstrated by co-immunoprecipitation. These associations were inhibited in vivo by deoxynojirimycin, an inhibitor of N-glycan precusor trimming that is known to prevent the calnexin/calreticulin-N-glycan interaction. Functional expression of the unglycosylated SERT mutant, SERT-QQ, was also increased on co-expression of calnexin, suggesting that the interaction between calnexin and SERT is not entirely dictated by the N-glycan. SERT is the first member of the neurotransmitter transporter family whose folding has been shown to be assisted by the molecular chaperones calnexin, calreticulin, and BiP.  (+info)

Transmembrane domain I contributes to the permeation pathway for serotonin and ions in the serotonin transporter. (6/1378)

Mutation of a conserved Asp (D98) in the rat serotonin (5HT) transporter (rSERT) to Glu (D98E) led to decreased 5HT transport capacity, diminished coupling to extracellular Na+ and Cl-, and a selective loss of antagonist potencies (cocaine, imipramine, and citalopram but not paroxetine or mazindol) with no change in 5HT Km value. D98E, which extends the acidic side chain by one carbon, affected the rank-order potency of substrate analogs for inhibition of 5HT transport, selectively increasing the potency of two analogs with shorter alkylamine side chains, gramine, and dihydroxybenzylamine. D98E also increased the efficacy of gramine relative to 5HT for inducing substrate-activated currents in Xenopus laevis oocytes, but these currents were noticeably dependent on extracellular medium acidification. I-V profiles for substrate-independent and -dependent currents indicated that the mutation selectively impacts ion permeation coupled to 5HT occupancy. The ability of the D98E mutant to modulate selective aspects of substrate recognition, to perturb ion dependence as well as modify substrate-induced currents, suggests that transmembrane domain I plays a critical role in defining the permeation pathway of biogenic amine transporters.  (+info)

Phosphorylation and sequestration of serotonin transporters differentially modulated by psychostimulants. (7/1378)

Many psychotropic drugs interfere with the reuptake of dopamine, norepinephrine, and serotonin. Transport capacity is regulated by kinase-linked pathways, particularly those involving protein kinase C (PKC), resulting in transporter phosphorylation and sequestration. Phosphorylation and sequestration of the serotonin transporter (SERT) were substantially impacted by ligand occupancy. Ligands that can permeate the transporter, such as serotonin or the amphetamines, prevented PKC-dependent SERT phosphorylation. Nontransported SERT antagonists such as cocaine and antidepressants were permissive for SERT phosphorylation but blocked serotonin effects. PKC-dependent SERT sequestration was also blocked by serotonin. These findings reveal activity-dependent modulation of neurotransmitter reuptake and identify previously unknown consequences of amphetamine, cocaine, and antidepressant action.  (+info)

Excess of serotonin (5-HT) alters the segregation of ispilateral and contralateral retinal projections in monoamine oxidase A knock-out mice: possible role of 5-HT uptake in retinal ganglion cells during development. (8/1378)

Retinal ganglion cell (RGCs) project to the ipsilateral and contralateral sides of the brain in the dorsal lateral geniculate nucleus (dLGN) and the superior colliculus (SC). Projections from both eyes are initially intermingled until postnatal day 3 (P3) but segregate into eye-specific layers by P8. We report that this segregation does not occur in monoamine oxidase A knock-out mice (MAOA-KO) that have elevated brain levels of serotonin (5-HT) and noradrenaline. The abnormal development of retinal projections can be reversed by inhibiting 5-HT synthesis from P0 to P15. We found that in MAOA-KO mice, 5-HT accumulates in a subpopulation of RGCs and axons during embryonic and early postnatal development. The RGCs do not synthesize 5-HT but reuptake the amine from the extracellular space. In both MAOA-KO and normal mice, high-affinity uptake of 5-HT and serotonin transporter (SERT) immunoreactivity are observed in retinal axons from the optic cup to retinal terminal fields in the SC and dLGN. In the dLGN, transient SERT labeling corresponds predominantly to the ipsilateral retinal projection fields. We show that, in addition to SERT, developing RGCs also transiently express the vesicular monoamine transporter gene VMAT2: thus, retinal axons could store 5-HT in synaptic vesicles and possibly use it as a borrowed neurotransmitter. Finally we show that the 5-HT-1B receptor gene is expressed by RGCs throughout the retina from E15 until adult life. Activation of this receptor is known, from previous studies, to reduce retinotectal activity; thus 5-HT in excess could inhibit activity-dependent segregation mechanisms. A hypothesis is proposed whereby, during normal development, localized SERT expression could confer specific neurotransmission properties on a subset of RGCs and could be important in the fine-tuning of retinal projections.  (+info)

Serotoninergic pathways underlying delusion symptoms in Alzheimers disease (AD) have not been fully clarified. 5-Hydroxytryptamine transporter gene-linked polymorphic region (5-HTTLPR) is a variable number tandem repeats in the promoter region of serotonin transporter encoding-gene affecting transcription. We investigated the association of 5-HTTLPR with delusions in a total of 257 consecutive patients clinically diagnosed as AD according to the National Institute on Aging-Alzheimers Association criteria. All participants underwent a comprehensive evaluation with a standardized comprehensive geriatric assessment and Neuropsychiatric Inventory. Delusion symptoms were observed in 171 patients (66.54%). In respect to AD patients without delusions, AD patients with delusions showed a low prevalence of S-plus carriers (5-HTTLPR-L/S + 5-HTTLPR-S/S genotypes) [p | 0.001; odds ratio (OR) = 0.240, 95% confidence interval (CI) = 0.121-0.471]. Logistic regression analysis adjusted for the apolipoprotein E
TY - JOUR. T1 - Serotonin transporter gene polymorphism and its association with bipolar disorder across different ethnic groups in Malaysia. AU - Mohamed Saini, Suriati. AU - Nik Jaafar, Nik Ruzyanei. AU - Sidi, Hatta. AU - Midin, Marhani. AU - Mohd Radzi, Azizah. AU - Abdul Rahman, Abdul Hamid. PY - 2014/1. Y1 - 2014/1. N2 - Objectives The risk variants have been shown to vary substantially across populations and a genetic study in a heterogeneous population might shed a new light in the disease mechanism. This preliminary study aims to determine the frequency of the serotonin transporter gene polymorphism (5-HTTLPR) in the three main ethnic groups in Malaysia and its association with bipolar disorder. Methods This is a candidate gene association study of randomly selected forty five unrelated bipolar disorder probands and sixty six controls. Diagnosis was evaluated using the Mini International Neuropsychiatric Interview (M.I.N.I). The control group consisted of healthy volunteers without ...
Research on aggression over the past two decades has focused on gene-environment interaction models to explain the relative contribution of each to this behavioral phenotype in various clinical populations. Recent investigations suggest a link between aggression in people with intellectual disabilities the functionality of the serotonin transporter. The aims in this study were to examine the possible association of the STin2 and/or the 5-HTTLPR serotonin transporter polymorphisms in adult males with and without intellectual disabilities, and to examine the association of these polymorphisms with aggression in people with intellectual disabilities. DNA samples and behavioral records were obtained from adult males with intellectual disabilities, distinguished only by the presence or absence of aggression. No association was found between either transporter polymorphism for aggression. However, the long 5-HTTLPR allele, and not the short allele or the heterozygous state, was associated with the ...
TY - JOUR. T1 - Serotonin transporter expression is predicted by early life stress and is associated with disinhibited behavior in infant rhesus macaques. AU - Kinnally, E. L.. AU - Tarara, E. R.. AU - Mason, W. A.. AU - Mendoza, S. P.. AU - Abel, K.. AU - Lyons, Leslie A. AU - Capitanio, J. P.. PY - 2010/2. Y1 - 2010/2. N2 - Serotonin transporter (5-HTT) expression patterns may contribute to the risk for adverse psychological outcomes following early life stress. The present study investigated whether two types of early life stress, maternal and social aggression, and a serotonin transporter gene promoter polymorphism (rh5-HTTLPR) predicted lower post-stressor peripheral blood mononuclear cell (PBMC) 5-HTT expression in infant rhesus macaques. We further probed the relationships among these factors and infant behavioral disinhibition within a stressful situation. Fifty-three infants residing with mothers in large, complex social groups were observed over the first 12 postnatal weeks, during ...
Introduction: Symptoms of somatoform and affective disorders are thought to be connected to serotonergic neurotransmission because serotonin is known to regulate the functions relevant in these disorders, such as pain and mood. Previous studies have reported associations of these disorders with a functional polymorphism in the promoter region of the serotonin transporter gene, a limiting factor of the serotonergic neuronal system, as its alleles have been associated with differences in levels of synthesized transporter and therefore differences in reuptake efficiency.. Method: Ninety-one patients with at least 2 unexplained physical symptoms were clinically evaluated and genotyped for the triallelic genotypes of the serotonin transporter gene polymorphism; patients were recruited from 2001 until 2004. DSM-IV diagnoses were assessed using the International Checklists for ICD-10 and DSM-IV. Somatic complaints were quantified with an interview version of the Screening for Somatoform Symptoms, ...
Early post-mortem data suggest that damage to brain serotonin neurones might play a role in some features (e.g., depression) of Parkinsons disease (PD). However, it is not known whether such damage is a typical characteristic of living patients with PD or whether the changes are regionally widespread. To address this question we measured, by positron emission tomography imaging, levels of the brain serotonin transporter (SERT), a marker for serotonin neurones, as inferred from binding of [11C]-3-amino-4-(2-dimethylaminomethyl-phenylsulfanyl)-benzonitrile (DASB), a second generation SERT radioligand, in subcortical and cerebral cortical brain areas of clinically advanced non-depressed (confirmed by structured psychiatric interview) patients with PD. SERT binding levels in PD were lower than those in controls in all examined brain areas, with the changes statistically significant in orbitofrontal cortex (−22%), caudate (−30%), putamen (−26%), and midbrain (−29%). However, only a slight ...
Background: The etiology and pathology of anxiety disorders involve both genetic and environmental influences. Adverse working conditions may contribute to the development of anxiety. The serotonin transporter-linked polymorphic region (5-HTTLPR) has been implicated in stress sensitivity. Therefore, we investigated the potential interplay between 5-HTTLPR and job-related risk factors in the prediction of the occurrence of anxiety. Methods: We conducted a prospective study using the first two waves of a Swedish population-based cohort. At Wave l, 1585 individuals without anxiety, depression or dysthymia who were active in the labor market during both waves were included. Information on job demands, skill discretion, decision authority and social climate was collected at Wave I. After a three year interval, the presence of anxiety disorders was determined at Wave II, All 1585 participants were genotyped for 5-HTTLPR. Both additive and multiplicative models were considered in examining the ...
Gillihan, S. J., Rao, H., Wang, J., Detre, J., Breland, J., … Farah, M. J. (2010). Serotonin transporter genotype modulates amygdala activity during mood recovery. Social Cognitive and Affective Neuroscience, 5, 1-10.. ...
Background Because the effects of susceptibility genes on alcohol use may differ as a function of age throughout adolescence and young adulthood, prospective study designs, in addition to cross-sectional ones are needed in genetic association studies. The short, low activity allele of a polymorphism (5-HTTLPR) in the serotonin transporter gene (SLC6A4) has been related to alcohol dependence. In the current study we tested whether 5-HTTLPR genotype was associated with adolescent alcohol use both cross-sectionally and longitudinally. Methods Non-regular drinkers (n=202) were selected from Dutch, nationwide sample of adolescents (mean age 13.4 at baseline) who were assessed across five annual waves. Latent growth curve modeling was applied to examine individual development of alcohol use over time, by estimating the initial level of alcohol use at Wave 2 (intercept), and the rate of change in alcohol use across time (slope). Results The 5-HTTLPR short allele predicted adolescents growth (slope) in ...
TY - JOUR. T1 - Expression of serotonin transporter protein in developing rat brain. AU - Zhou, Feng C.. AU - Sari, Youssef. AU - Zhang, Jing K.. PY - 2000/1/3. Y1 - 2000/1/3. N2 - Serotonin transporter (5-HTT), a transmembrane protein, has been shown in adult brain to be distributed not only on synaptic terminals but to a great extent on axons as well. Here we report the ontogeny of 5-HTT and its relationship with serotonin (5-HT) neurons using established 5-HTT and 5-HT antibodies. Both 5-HTT- and 5-HT-immunostaining (-im) appear in 5-HT neurons at embryonic day 12 (E12) in rostral raphe nuclei (RRN). Soon after appearing, 5-HTT-im is highly expressed on axons, similar to adult expression. However, in contrast to adult, 5-HTT-im also outlines the soma-dendrites. Rich 5-HTT-im appears along the entire length of projecting axons, extending to the growth tip. In the next 2 days, intensive 5-HTT-im axons from RRN travel a course preferentially in the floor plate and later, the medial forebrain ...
Particularly serotonin transporter gene polymorphism 5-HTTLPR of the 5-HTT gene has been associated as a risk factor for the development of affective disorders.[23] The presence of one or two short copies of 5-HTTLPR is correlated with reduced expression and function of the serotonin transporter protein, and increased behaviour related to fear and anxiety.[23] When two short copies of this gene polymorphism is present, an increased vulnerability to depressive symptoms under stress is exhibited along with increased cortisol production.[23] It is possible that this variant of the 5-HTT serotonin transporter gene may be a risk factor for the development of BPD as individuals with BPD exhibits symptoms that are characteristic for serotonin dysfunction.[23] In one study, BPD patients were genotyped in the 5-HTTLPR polymorphism and were asked to report on their borderline-specific symptoms.[23] The results show: carriers of two short alleles of the 5-HTTLPR reported more symptoms of borderline, ...
We examined a deletion/insertion promoter polymorphism of the serotonin transporter gene, which confers an approximately 40% reduction in expression of the protein, in 196 subjects with late onset Alzheimers disease (AD) and 271 controls. The frequency of the 484 bp low activity allele was elevated in the subjects with AD (p = 0.004), and an excess of the low activity genotype (30%) was also found in comparison with the controls (20%) (chi 2 = 7.16; p = 0.03). This association was unrelated to the age of the subjects or controls, or to epsilon 4 alleles of the ApoE gene. The odds ratio for the effect of the homozygous low activity genotype was 1.7 (95% CI 1.08-2.67), with a population attributable risk of 33% (95% CI 5-54%). These findings indicate that the low activity allele of the serotonin transporter is a risk factor for late onset AD.
Post-stroke depression (PSD) is a mental illness characterized by subjective feelings of depression, cognitive dysfunction, and decreased interest. The serotoninergic system is involved in the pathogenesis of depressive disorders and is regulated by the serotonin transporter gene. The serotonin transporter-linked polymorphic region (5-HTTLPR) has been examined as a factor associated with depression and other mental disorders. This study was performed to explore the relationship between 5-HTTLPR and PSD in a Han Chinese population. ...
Abstract: A cDNA encoding the human platelet serotonin (5-HT) uptake site was isolated and sequenced using the PCR. The cDNA represents a ˜3.1-kb mRNA transcript and contains an open reading frame encoding a hydrophobic polypeptide of 630 amino acids with 12 membrane-spanning segments, a calculated molecular mass of 70,320 Da, and an estimated isoelectrical point of 5.84. The human platelet 5-HT uptake site is identical with the human brain 5-HT transporter and ˜92% homologous to the rat protein. Hydropathicity analysis indicates 12 membrane-spanning segments with two putative glycosylation sites within the second extracellular loop. The human platelet 5-HT uptake site contains two intraplasmatic consensus phosphorylation sites for cyclic AMP-dependent protein kinase recognition located in the cytoplasmatic N-terminal region and three potential protein kinase C phosphorylation sites. The identity of the human platelet 5-HT uptake site and the brain 5-HT transporter indicates that both proteins ...
Genetic variation at the serotonin transporter-linked polymorphic region (5-HTTLPR) is associated with altered amygdala reactivity and lack of prefrontal regulatory control. Similar regions mediate decision-making biases driven by contextual cues and ambiguity, for example the framing effect. We hypothesized that individuals hemozygous for the short (s) allele at the 5-HTTLPR would be more susceptible to framing. Participants, selected as homozygous for either the long (la) or s allele, performed a decision-making task where they made choices between receiving an amount of money for certain and taking a gamble. A strong bias was evident toward choosing the certain option when the option was phrased in terms of gains and toward gambling when the decision was phrased in terms of losses (the frame effect). Critically, this bias was significantly greater in the ss group compared with the lala group. In simultaneously acquired functional magnetic resonance imaging data, the ss group showed greater ...
Genetic variation at the serotonin transporter-linked polymorphic region (5-HTTLPR) is associated with altered amygdala reactivity and lack of prefrontal regulatory control. Similar regions mediate decision-making biases driven by contextual cues and ambiguity, for example the framing effect. We hypothesized that individuals hemozygous for the short (s) allele at the 5-HTTLPR would be more susceptible to framing. Participants, selected as homozygous for either the long (la) or s allele, performed a decision-making task where they made choices between receiving an amount of money for certain and taking a gamble. A strong bias was evident toward choosing the certain option when the option was phrased in terms of gains and toward gambling when the decision was phrased in terms of losses (the frame effect). Critically, this bias was significantly greater in the ss group compared with the lala group. In simultaneously acquired functional magnetic resonance imaging data, the ss group showed greater ...
Objectif : Savoir si la réponse variable aux antidépresseurs peut être influencée par une interaction entre le polymorphisme du promoteur du transporteur de la sérotonine (5 HTTLPR) et la concentration dantidépresseur. Méthodes : On a déterminé le génotype de sujets âgés atteints de dépression traitée à la paroxétine (n = 110) et on les a évalués au moyen de léchelle de dépression de Hamilton (HAMD). On a utilisé une analyse à effets mixtes de mesures répétées. Résultats : On a constaté quune interaction entre la concentration de paroxétine au début et le génotype de la 5 HTTLPR était associée à une amélioration des symptômes en 12 semaines (F 18,59,5 = 1,8, p < 0,05), et que la concentration de paroxétine (F 68,55,3 = 2,4, p < 0,005) et le génotype (F 2,74,2 = 5,7, p < 0,005) étaient associés à des effets principaux. On a établi une corrélation entre les concentrations de paroxétine et lévolution des résultats du test HAMD après deux semaines de ...
Sigma-Aldrich offers abstracts and full-text articles by [Adrian G Fischer, Tanja Endrass, Martin Reuter, Christian Kubisch, Markus Ullsperger].
PubMed comprises more than 30 million citations for biomedical literature from MEDLINE, life science journals, and online books. Citations may include links to full-text content from PubMed Central and publisher web sites.
In humans, exposure to stress during development is associated with structural and functional alterations of the prefrontal cortex (PFC), amygdala (AMY), and hippocampus (HC) and their circuits of connectivity, and with an increased risk for developing major depressive disorder particularly in carriers of the short (s) variant of the serotonin transporter (5-HTT) gene-linked polymorphic region (5-HTTLPR). Although changes in these regions are found in carriers of the s allele and/or in depressed patients, evidence for a specific genotype x developmental stress effect on brain structure and function is limited. Here, we investigated the effect of repeated stress exposure during adolescence in mice with partial knockout of the 5-HIT gene (HET) vs. wildtype (WT) on early-adulthood behavioral measures and brain structure [using magnetic resonance imaging (MRI)] relevant to human major depression. Behaviorally, adolescent stress (AS) increased anxiety and decreased activity and did so to a similar degree in
The serotonin (5-HT) transporter (SERT) regulates serotoninergic neurotransmission by clearing 5-HT released into the synaptic space. Phosphorylation of SERT on serine and theronine mediates SERT regulation. Whether tyrosine phosphorylation regulates SERT is unknown. Here, we tested the hypothesis that tyrosine-phosphorylation of SERT regulates 5-HT transport. In support of this, alkali-resistant 32P-labelled SERT was found in rat platelets and Src-tyrosine kinase inhibitor PP2 decreased platelet SERT function and expression. In human placental trophoblast (HTR) cells expressing SERT, PP2 reduced transporter function, expression and stability. While siRNA silencing of Src expression decreased SERT function and expression, coexpression of Src resulted in PP2-sensitive increases in SERT function and expression. PP2 treatment markedly decreased SERT protein stability. Compared to WT-SERT, SERT tyrosine mutants, Y47F and Y142F exhibited reduced 5-HT transport despite their higher total and cell ...
The hypothesis that the S allele of the 5-HTTLPR serotonin transporter promoter region is associated with increased risk of depression, but only in individuals exposed to stressful situations, has generated much interest, research and controversy since first proposed in 2003. Multiple meta-analyses combining results from heterogeneous analyses have not settled the issue. To determine the magnitude of the interaction and the conditions under which it might be observed, we performed new analyses on 31 data sets containing 38 802 European ancestry subjects genotyped for 5-HTTLPR and assessed for depression and childhood maltreatment or other stressful life events, and meta-analysed the results. Analyses targeted two stressors (narrow, broad) and two depression outcomes (current, lifetime). All groups that published on this topic prior to the initiation of our study and met the assessment and sample size criteria were invited to participate. Additional groups, identified by consortium members or ...
The hypothesis that the S allele of the 5-HTTLPR serotonin transporter promoter region is associated with increased risk of depression, but only in individuals exposed to stressful situations, has generated much interest, research and controversy since first proposed in 2003. Multiple meta-analyses combining results from heterogeneous analyses have not settled the issue. To determine the magnitude of the interaction and the conditions under which it might be observed, we performed new analyses on 31 data sets containing 38 802 European ancestry subjects genotyped for 5-HTTLPR and assessed for depression and childhood maltreatment or other stressful life events, and meta-analysed the results. Analyses targeted two stressors (narrow, broad) and two depression outcomes (current, lifetime). All groups that published on this topic prior to the initiation of our study and met the assessment and sample size criteria were invited to participate. Additional groups, identified by consortium members or self
There is evidence from animal studies that serotonin (5-HT) can influence the antinociceptive effects of opioids at the spinal cord level. Therefore, there could be an influence of genetic polymorphisms in the serotonin system on individual variability in response to opioid treatment of pain. The serotonin transporter (5-HTT) is a key regulator of serotonin metabolism and availability and its gene harbors several known polymorphisms that are known to affect 5-HTT expression (e.g. 5-HTTLPR, rs25531). The aim of this study was to investigate if the triallelic 5-HTTLPR influences pain sensitivity or the analgesic effect of opioids in humans. 43 healthy volunteers (12 men, 31 women, mean age 26 years) underwent heat pain stimulations before and after intravenous injection of Remifentanil; a rapid and potent opioid drug acting on μ-type receptors. Subjects rated their perceived pain on a visual analogue scale (VAS). All participants were genotyped for the 5-HTTLPR and the rs25531 polymorphism. We recruited
Serotonin is a monoamine neurotransmitter that has long been implicated in the etiology of Autism. Serotonin was originally identified as playing a role in Autism in the 1960s when a study found that a significant number of Autistic individuals had increased levels of blood platelet serotonin [18]. Subsequent studies have found that changes in serotonin levels during development can affect white and grey matter density and overall brain morphology. Research also suggests that there may be an asymmetry in serotonin synthesis in the brain, which has been associated with deficiencies in language and communication (which are two of the core symptoms of Autism) [8]. A number of serotonin transporter gene polymorphisms have also been associated with Autism however, there is not a single gene variant responsible for Autism [11]. Most studies in past have implicated excess serotonin in the aberrant development in Autism in both the brain and the periphery. However, newer studies also suggest that ...
This thesis describes studies on the effects of obesity, weight loss and meal timing on the human brain and glucose metabolism. We investigated effects of meal timing during a hypocaloric diet and weight loss on brain serotonin transporters (SERT) and dopamine transporters (DAT), neuronal activity patterns and metabolism. In addition, we studied the effect of bright light conditions on glucose and lipid metabolism in lean and obese subjects with type 2 diabetes (T2D). First, we show a trend towards lower hypothalamic SERT binding in obese compared to lean controls and a reduced SERT binding in the diencephalon in obese insulin resistant compared to equally obese insulin sensitive and lean subjects. Second, we show that subjects who consumed most of the calories in the morning during a hypocaloric diet, increased striatal DAT binding and reduced neuronal activation in response to high calorie food pictures in the caudate nucleus, while consuming most of the calories in the evening reduced ...
Abstract. Maternal serotonin transporter genotype affects risk for ASD with exposure to prenatal stress. Stress exposure during gestation is implicated in several neuropsychiatric conditions, including autism spectrum disorder (ASD). Previous research showed that prenatal stress increases risk for ASD with peak exposure during the end of the second and the beginning of the third trimester. However, exposures to prenatal stress do not always result in ASD, suggesting that other factors may interact with environmental stressors to increase ASD risk. The present study examined a maternal genetic variation in the promoter region of the serotonin transporter gene (5-HTTLPR) affecting stress tolerance and its interaction with the effect of environmental stressors on risk for ASD. Two independent cohorts of mothers of ASD children recruited by the University of Missouri and Queens University were surveyed regarding the prenatal environment and genotyping on 5-HTTLPR was performed to explore this ...
Multiple meta-analyses have reviewed the impact of the 5-HTTLPR on antidepressant efficacy. Most recently, Karlovic et al. reviewed results from 35 studies and 3 meta-analyses (n=8,424).4 The results were divided by medication class and ethnicity. Among Caucasians taking SSRIs, 14 of 17 studies showed an impact of the 5-HTTLPR on treatment outcome. Seven of those 14 studies found that carriers of the S allele (L/S or S/S) had a poorer outcome when taking SSRIs, while the other 7 found the S/S genotype to have a poorer outcome. In contrast, analyses for patients of other ancestries taking SSRI antidepressants showed mixed results, suggesting a weaker effect within non-Caucasian populations. These results mirror that of Porcelli et al., who found that when analyzing 9 studies of Caucasians taking SSRIs, individuals with the S/S genotype were significantly less likely to respond to SSRI treatment than individuals with the L/L genotype (OR=1.71, p=0.003).5 These findings are similar to the results ...
TY - JOUR. T1 - Clinical risk factors and serotonin transporter gene variants associated with antidepressant-induced mania. AU - Frye, Mark A. AU - McElroy, Susan L.. AU - Prieto, Miguel L.. AU - Harper, Kelly L.. AU - Walker, Denise L.. AU - Kung, Simon. AU - Chauhan, Mohit. AU - Crow, Scott. AU - Sutor, Bruce. AU - Galardy, Christine W.. AU - Veldic, Marin D. AU - Palmer, Brian A.. AU - Geske, Jennifer R.. AU - Fuentes, Manuel. AU - Cuellar-Barboza, Alfredo B.. AU - Seymour, Lisa R.. AU - Mori, Nicole. AU - Biernacka, Joanna M. PY - 2015/2/1. Y1 - 2015/2/1. N2 - INTRODUCTION: Identifying clinical and genetic risk factors associated with antidepressant-induced mania (AIM) may improve individualized treatment strategies for bipolar depression.METHOD: From 2009 to 2012, bipolar depressed patients, confirmed by DSM-IV-TR-structured interview, were screened for AIM. An AIM+ case was defined as a manic/hypomanic episode within 60 days of starting or changing dose of antidepressant, while an AIM- ...
Li, PhD, J. J. Negative Emotionality Mediates the Association of 5-HTTLPR Genotype and Depression in Children With and Without ADHD. Li JJ, Lee SS. (2014) Negative emotionality mediates the association of 5-HTTLPR genotype and depression in …
We recently read Karg et al (2011) for a local reading group. It is one of the many of attempts to meta-analytically examine the idea that the 5-HTTLPR serotonin transporter polymorphism moderates the effect of stress on depression. It drove me batty. No, it drove me to apoplectia--a small country in my mind I occupy…
Vanderbilt University Medical Center investigators have found a surprising link between brain iron levels and serotonin, a neurotransmitter involved in neuropsychiatric conditions ranging from autism to major depression.. Appearing in the Proceedings of the National Academy of Sciences this week, the study by Randy Blakely, Ph.D., and colleagues also demonstrates the utility of a powerful in silico approach for discovering novel traits linked to subtle genetic variation.. The serotonin transporter protein (SERT) regulates serotonin availability in the brain and periphery, and variations in human SERT have been linked to many neurobehavioral disorders including alcoholism, depression, autism and obsessive-compulsive disorder. SERT is also a major target for medications like the selective serotonin reuptake inhibitors (SSRI) used for treating depression.. Thanks to a serendipitous mix-up in an animal order, Blakely and first author Ana Carnerio, Ph.D., discovered that a mouse strain they had ...
Changes in serotonin transporter (SERT) function have been implicated in autism. SERT function is influenced by the number of transporter molecules present at the cell surface, which is regulated by various cellular mechanisms including interactions with other proteins. Thus, we searched for novel SERT-binding proteins and investigated whether the expression of one such protein was affected in subjects with autism. Novel SERT-binding proteins were examined by a pull-down system. Alterations of SERT function and membrane expression upon knockdown of the novel SERT-binding protein were studied in HEK293-hSERT cells. Endogenous interaction of SERT with the protein was evaluated in mouse brains. Alterations in the mRNA expression of SERT (SLC6A4) and the SERT-binding protein in the post-mortem brains and the lymphocytes of autism patients were compared to nonclinical controls. N-ethylmaleimide-sensitive factor (NSF) was identified as a novel SERT-binding protein. NSF was co-localized with SERT at the plasma
Ishikawa, Hajime et al Association between Serotonin Transporter Gene Polymorphism and Smoking among Japanese Males. Cancer Epidemiology and Prevention Biomarkers 8.9 (1999): 831-833. Web. 13 June. 2021. ...
The serotonin transporter (5-HTT) is a suitable candidate gene to test for involvement in the pathogenesis of major psychiatric disorders. We used the method of family-based controls to test for association between disease and a variable number tandem repeat (VNTR) in intron 2 of the gene, which has received support for involvement in the pathogenesis of several psychiatric disorders. We analysed 413 proband-parent trios of Bulgarian origin: 266 had a schizophrenic proband, 103 had a bipolar proband and 44 had a schizoaffective proband. The results were analysed using the extended transmission disequilibrium test. Possible effects of different alleles on certain clinical variables were examined by correlation analysis. Three alleles were detected: STin2.9, STin2.10 and STin2.12. None of the three diagnostic samples showed preferential transmission of alleles that reached conventional levels of statistical significance. We could not confirm previous results that STin2.12 allele increases ...
RATIONALE: The 5-HT transporter (5-HTT) is implicated in the regulation of appetite. Expression of the 5-HTT varies in the human population, and this variation may determine both individual differences in feeding and abnormal feeding behaviours such as eating disorders. OBJECTIVES: The effects of 5-HTT expression on feeding and satiety were examined in a transgenic mouse model of 5-HTT overexpression. MATERIALS AND METHODS: We measured free-feeding food intake and observed the behavioural satiety sequence (BSS) after food deprivation in mice at baseline and after administration of the anorectic drug fenfluramine. RESULTS: 5-HTT overexpressing mice were both lighter and shorter than their wildtype littermates. Despite this size difference, food intake by transgenic and wildtype mice did not differ. There was no effect of genotype on the BSS or on food intake during the test at baseline. Increasing doses of fenfluramine reduced food intake in a similar manner in both transgenic and wildtype mice. After 0
Stress has been shown to influence neuroplasticity and is suspected to increase the risk for psychiatric disorders such as major depression and anxiety disorders. Additionally, the short variant of the human serotonin transporter (5-HTT) length polymorphism (5-HTTLPR) is suggested to increase the risk for the development of such disorders. While stress as well as serotonergic signaling are not only discussed to be involved in the development of psychiatric disorders, they are also known to influence hippocampal adult neurogenesis (aN). Therefore, it has long been suspected that aN is involved in the etiology of these illnesses. The exact role of aN in this context however, still remains to be clarified. In the present doctoral thesis, I am introducing two different studies, which had been carried out to assess possible changes in neuroplasticity and behavior as a result of 5-HTT genotype by stress interactions. In both studies, animals of the 5-HTT knock-out (5-HTT-/-) mouse line were used, ...
Estrogen-related changes in serotonergic neuronal transmission, including changes in the number of serotonin transporter (SERT) binding sites, have been cited as a possible cause for changes in mood, memory and sleep that occur during the menopausal transition. However, both aging and estradiol regulate SERT binding sites in the brain. The goal of this experiment was to determine how aging and est
Chakraborty, Subhankar and Chakraborty, Debapriyo and Mukherjee, Odity and Jain, Sanjeev and Ramakrishnan, Uma and Sinha, Anindya (2010) Genetic Polymorphism in the Serotonin Transporter Promoter Region and Ecological Success in Macaques. Behavior Genetics, 40 (5). pp. 672-679. ISSN 1573-3297 ...
The search for genes associated with bipolar disorder is further complicated by the overlap between genes that confer bipolar risk and genes that confer plasticity.. Plastic means changeable or shapeable. Plasticity genes allow individuals to respond more directly to environmental experience, to mold themselves to their environment and potential future environments based on past experience. These include the serotonin transporter gene (SERT), the gene for brain-derived neurotrophic factor (BDNF), and others.. The serotonin transporter (SERT) gene length difference has been extensively investigated in relation to mood and anxiety disorders. Youll find a full story about the SERT gene in the section entitled Depression is not a Moral Weakness. Reviewing briefly: the short version of the SERT gene is associated with an increased risk of depression in the face of life stresses, but only in the context of adverse childhood experiences. Benign childhoods appear to completely mask the gene length ...
Background Polymorphisms in the promoter region of the serotonin transporter gene (5-HTTLPR) and exposure to early childhood adversities (CA) are independently associated with individual differences in cognitive and emotional processing. Whether these two factors interact to influence cognitive and emotional processing is not known. Methodology and Principal Findings We used a sample of 238 adolescents from a community study characterised by the presence of the short allele of 5-HTTLPR (LL, LS, SS) and the presence or absence of exposure to CA before 6 years of age. We measured cognitive and emotional processing using a set of neuropsychological tasks selected predominantly from the CANTAB® battery. We found that adolescents homozygous for the short allele (SS) of 5-HTTLPR and exposed to CA were worse at classifying negative and neutral stimuli and made more errors in response to ambiguous negative feedback. In addition, cognitive and emotional processing deficits were associated with diagnoses of
TY - JOUR. T1 - Collaborative meta-Analysis finds no evidence of a strong interaction between stress and 5-HTTLPR genotype contributing to the development of depression. AU - Culverhouse, R. C.. AU - Saccone, N. L.. AU - Horton, A. C.. AU - Ma, Y.. AU - Anstey, K. J.. AU - Banaschewski, T.. AU - Burmeister, M.. AU - Cohen-Woods, S.. AU - Etain, B.. AU - Fisher, H. L.. AU - Goldman, N.. AU - Guillaume, S.. AU - Horwood, J.. AU - Juhasz, G.. AU - Lester, K. J.. AU - Mandelli, L.. AU - Middeldorp, C. M.. AU - Olié, E.. AU - Villafuerte, S.. AU - Air, T. M.. AU - Araya, R.. AU - Bowes, L.. AU - Burns, R.. AU - Byrne, E. M.. AU - Coffey, C.. AU - Coventry, W. L.. AU - Gawronski, K. A.B.. AU - Glei, D.. AU - Hatzimanolis, A.. AU - Hottenga, J. J.. AU - Jaussent, I.. AU - Jawahar, C.. AU - Jennen-Steinmetz, C.. AU - Kramer, J. R.. AU - Lajnef, M.. AU - Little, K.. AU - Zu Schwabedissen, H. M.. AU - Nauck, M.. AU - Nederhof, E.. AU - Petschner, P.. AU - Peyrot, W. J.. AU - Schwahn, C.. AU - Sinnamon, ...
As a member of the wwPDB, the RCSB PDB curates and annotates PDB data according to agreed upon standards. The RCSB PDB also provides a variety of tools and resources. Users can perform simple and advanced searches based on annotations relating to sequence, structure and function. These molecules are visualized, downloaded, and analyzed by users who range from students to specialized scientists.
Scientists have not identified a gene or a series of genes that cause depression. Rather, certain variations in genes, called polymorphisms, may increase risk for depression. Genes can predispose individuals to major depressive disorder in many ways. For example, genes help control the metabolism of neurotransmitters and their receptors, the numbers of particular types of neurons and their synaptic connections, the intracellular transduction of neuronal signals, and the speed with which all of these can change in response to environmental stressors.11 The serotonin transporter gene is the most studied in major depressive disorder (Figure 1).12 This gene is of interest because it contains a polymorphism that gives rise to 2 different alleles (long and short). People usually have 2 copies of each gene in their DNA; therefore, a person can be homozygous for the long allele, homozygous for the short allele or heterozygous (1 long and 1 short allele). The short allele slows down the synthesis of the ...
Previous studies have shown that appetitive motivation enhances episodic memory formation via a network including the substantia nigra / ventral tegmental area (SN/VTA), striatum and hippocampus. This functional magnetic resonance imaging (fMRI) study now contrasted the impact of aversive and appetitive motivation on episodic long-term memory. Cue pictures predicted monetary reward or punishment in alternating experimental blocks. One day later, episodic memory for the cue pictures was tested. We also investigated how the neural processing of appetitive and aversive motivation and episodic memory were modulated by dopaminergic mechanisms. To that end, participants were selected on the basis of their genotype for a variable number of tandem repeat polymorphism of the dopamine transporter (DAT) gene. The resulting groups were carefully matched for the 5-HTTLPR polymorphism of the serotonin transporter gene. Recognition memory for cues from both motivational categories was enhanced in participants
UCL Discovery is UCLs open access repository, showcasing and providing access to UCL research outputs from all UCL disciplines.
Neural and Behavioral Responses to Threatening Emotion Faces in Children as a Function of the Short Allele of the Serotonin Transporter ...
article{8be6ed91-fde0-42c0-8856-b5903bfbb308, abstract = {,p,CTLA-4 is important to down-regulating T cell responses and has been implicated in type 1 (insulin dependent) diabetes mellitus in both linkage and association studies. The aim of our study was to relate the polymorphic (AT)(n) microsatellite in the 3 untranslated sequence of the CTLA-4 gene to diabetes risk. We studied 616 consecutively diagnosed 0-34 year-old Swedish patients and 502 matched controls by PCR-based genotyping to determine the length of the 3-end (AT)(n)repeat region of the CTLA-4 gene and categorizing alleles as predominantly monomorphic short (S) or highly polymorphic (in length) long (L) alleles. The odds of type 1 diabetes of subjects with the L/L genotype was estimated to be 1.84 times that of subjects with the S/S genotype (95% CI 1.44-2.73, p=0.002). Further analysis of the long alleles, partitioned into intermediate (I) length and very long (VL) alleles, suggested that L alleles act recessively in conferring ...
We use cookies to ensure that we give you the best experience on our website. If you click Continue well assume that you are happy to receive all cookies and you wont see this message again. Click Find out more for information on how to change your cookie settings ...
Adverse life events have been shown to predict weight fluctuations and dietary restraint, as well as eating disorders during adolescence or early adulthood. Since the s-allele carriers of the 5-HTT gene-linked polymorphic region (5-HTTLPR) are biologically more reactive to stress related stimuli, we aimed to explore whether the eating disturbances are predicted by environmental stressors and moderated by the 5-HTTLPR genotype. The sample was based on the younger cohort of the Estonian Children Personality, Behaviour and Health Study and included those participating in its second and third wave. The history of stressful life events was self-reported at age 15. Data on eating behaviour and attitudes, anxiety, impulsivity and depressiveness were collected at age 18. The effect of the adverse life events on binge eating and on drive for thinness was found to be moderated by the 5-HTTLPR. Adolescent girls who at age 15 had reported a history of frequent adverse life events had elevated scores in ...
Female Fischer 344 (F344) rats have been shown to display increased serotonin transporter (5-HTT) gene expression in the dorsal raphe, compared to female Lewis (LEW) rats. Herein, we explored, by means of synaptosomal preparations and in vivo microdialysis, whether central, but also peripheral, 5-HTT protein expression/function differ between strains. Midbrain and hippocampal [3H]paroxetine binding at the 5-HTT and hippocampal [3H]serotonin (5-HT) reuptake were increased in male and female F344 rats, compared to their LEW counterparts, these strain differences being observed both in rats of commercial origin and in homebred rats. Moreover, in homebred rats, it was found that these strain differences extended to blood platelet 5-HTT protein expression and function. Saturation studies of midbrain and hippocampal [3H]paroxetine binding at the 5-HTT, and hippocampal and blood platelet [3H]5-HT reuptake, also revealed significant strain differences in Bmax and Vmax values. Although F344 and LEW rats ...
TY - JOUR. T1 - Serotonin transporter (5-HTTLPR) genotype and childhood trauma are associated with individual differences in decision making. AU - Stoltenberg, Scott F.. AU - Lehmann, Melissa K.. AU - Anderson, Cynthia. AU - Nag, Parthasarathi. AU - Anagnopoulos, Cheryl. PY - 2011/12/1. Y1 - 2011/12/1. N2 - The factors that influence individual differences in decision making are not yet fully characterized, but convergent evidence is accumulating that implicates serotonin (5-HT) system function. Therefore, both genes and environments that influence serotonin function are good candidates for association with risky decision making. In the present study we examined associations between common polymorphisms in the serotonin transporter gene (SLC6A4; 5-HTTLPR and rs25531), the experience of childhood trauma and decision making on the Iowa gambling task (IGT) in 391 (64.5% female) healthy Caucasian adults. Homozygosity for the 5-HTTLPR L allele was associated with riskier decision making in the first ...
TY - JOUR. T1 - Serotonin transporter gene, depressive symptoms,and interleukin-6. AU - Su, Shaoyong. AU - Zhao, Jinying. AU - Bremner, J. Douglas. AU - Andrew, H. Miller. AU - Bouzyk, Mark. AU - Snieder, Harold. AU - Novik, Olga. AU - Afzal, Nadeem. AU - Jack Goldberg, Goldberg. AU - Vaccarino, Viola. PY - 2009/12/1. Y1 - 2009/12/1. N2 - Background-We explored the relationship of genetic variants of the serotonin transporter gene SLC6A4, a key regulator of the serotonergic neurotransmission, with both depressive symptoms and plasma interleukin-6 (IL-6) levels.Methods and Results-We genotyped 20 polymorphisms in 360 male twins (mean age, 54 years) from the Vietnam Era Twin Registry. Current depressive symptoms were measured with the Beck Depression Inventory II. IL-6 was assessed using a commercially available ELISA kit. Genotype associations were analyzed using generalized estimating equations.To study how SLC6A4 genetic vulnerability influences the relationship between depressive symptoms and ...
In the current study, we sought to study SERT binding properties in the midbrain region in patients with epilepsy, and to determine whether SERT binding differed between depressed vs. non-depressed patients with epilepsy. Our results did not indicate any difference in SERT binding potential between these patient groups.. There could be several reasons for these negative results. Previous work with PET and SPET tracers for SERT in depressed patients has shown some conflicting results. The majority of reports show increased SERT binding in the thalamus and limbic regions of depressed patients compared to controls [30], but others have shown decreased SERT binding potential in the amygdala and midbrain of depressed patients [13-15]. Studies using 123I-ADAM SPET to measure SERT binding in major depressive disorder have also indicated decreased SERT binding in the midbrain, medial temporal lobe, and basal ganglia of depressed patients compared to controls [26, 27]. At the same time, however, reports ...
The serotonin transporter gene (SLC6A4, MIM 182138) is a candidate gene in autistic disorder based on neurochemical, neuroendocrine studies and the efficacy of potent serotonin transporter inhibitors in reducing ritualistic behaviors and related aggression. An insertion/deletion polymorphism (5-HTTL …
RATIONALE: A 44-base-pair insertion/deletion polymorphism in the promoter region of the human serotonin (5-HT) transporter (5-HTT) gene gives rise to a bi-allelic polymorphism designated long (l) and short (s). The s variant is associated with a lower expression of 5-HTT sites and a reduced efficiency of 5-HT reuptake. OBJECTIVE: The aim of the present study was to determine whether the increase in brain 5-HT function produced by acute 5-HT reuptake blockade is influenced by the 5-HTT promoter l/s polymorphism. METHODS: We measured the increase in plasma prolactin that follows acute administration of the tricyclic antidepressant clomipramine as an index of 5-HT neurotransmission in 14 healthy female subjects (7 with ss genotype and 7 with ll genotype) using a placebo-controlled crossover design. RESULTS: Clomipramine-induced prolactin release was significantly greater in subjects with the ll genotype. CONCLUSION: Our findings suggest that acute 5-HT reuptake blockade produces a greater increase in 5-HT
Several independent studies have reported association between serotonin transporter gene (SLC6A4) polymorphisms and attention deficit hyperactivity disorder (ADHD). Five studies found evidence for association between the long-allele of a 44-bp insertion/deletion polymorphism (5-HTTLPR) and ADHD. Another two studies corroborated this finding while a further six studies did not find such an association. For a second polymorphism within the gene, a variable number tandem repeat (VNTR) within intron 2, one study demonstrated that the 12/12 genotype was significantly less frequent in ADHD cases compared to controls, while a second study found that the 12-allele was preferentially transmitted to offspring affected with ADHD. To provide further clarification of the reported associations, we investigated the association of these two markers with ADHD in a sample of 1,020 families with 1,166 combined type ADHD cases for the International Multi-Centre ADHD Genetics project, using the Transmission ...
Mc Mahon B, Andersen SB, Madsen MK, Hjordt LV, Hageman I, Dam H, et al. Seasonal difference in brain serotonin transporter binding predicts symptom severity in patients with seasonal affective disorder. Brain : a journal of neurology. 2016.. Knudsen GM, Jensen PS, Erritzoe D, Baare WF, Ettrup A, Fisher PM, et al. The Center for Integrated Molecular Brain Imaging (Cimbi) database. NeuroImage. 2016;124(Pt B):1213-9.. Angstmann S, Madsen KS, Skimminge A, Jernigan TL, Baare WF, Siebner HR. Microstructural asymmetry of the corticospinal tracts predicts right-left differences in circle drawing skill in right-handed adolescents. Brain structure & function. 2016.. Schmock H, Vangkilde A, Larsen KM, Fischer E, Birknow MR, Jepsen JR, et al. The Danish 22q11 research initiative. BMC psychiatry. 2015;15:220.. Holm SK, Vestergaard M, Madsen KS, Baare WF, Hammer TB, Born AP, et al. Children and adolescents previously treated with glucocorticoids display lower verbal intellectual abilities. Acta paediatrica ...
Although pruritus may be the crucial symptom of atopic dermatitis that profoundly affect the individuals standard of living, controlling and administration of prurirtus even now remains as unmet needs due mainly to the unique multifactorial pathogenesis of pruritus in atopic dermatitis. receptors and serotonin transporter proteins are indicated on pores and skin cells such as for example keratinocytes, melanocytes, dermal fibroblasts, mast cells, T cells, organic killer cells, langerhans cells, and sensory nerve endings. It really is noteworthy that serotonergic medications, aswell as serotonin itself, demonstrated immune-modulating impact. Fenfluramine, fluoxetine and 2, 5-dimethoxy-4-iodoamphetamine considerably reduced lymphocyte proliferation. It really is still doubtful whether these serotonergic medications exert the immunosuppressive results via serotonin receptor or serotonin transporter. Each one of these scientific and experimental reviews suggest the chance that antipruritic ...
The primary aim of this research was to incorporate highly fluorescent semiconductor nanocrystals, or quantum dots (QDs), in various biological assays as an improved means of optically imaging membrane associated receptors. Initial imaging efforts utilized antibody conjugated QDs to fluorescently label interleukin-2 receptor (IL-2R) expression in activated populations of Jurkat T cells, ultimately permitting verification of the time-course associated with IL-2R translation and expression. The remainder of the research was focused on the development of a small molecule QD targeting strategy to generate fluorescent probes capable of specifically interacting with the serotonin transporter protein. Attempts to functionalize ampiphilic QDs with custom synthesized small molecule-polyethylene glycol derivatives possessing a hydrophobic terminus initially resulted in self assembly of these ligands to the QD surface in the absence of covalent coupling reagents. The artifactual fluorescent response caused ...
The gene that encodes the SERTs is SLC6A4. The promoter region of SLC6A4 has two well-known polymorphisms aptly named short and long corresponding to the number of repeats in the 5-HTT-linked polymorphic region (HTTLPR). The short variation of this promoter leads to less transcription of the SERT gene SLC6A4.[2] Further, studies have found that the short allele of HTTLPR is associated with changes in the brain structure such as reduced grey matter in the perigeniculate region surrounding Cg25 and in the amygdala, areas important for emotional processing and mood regulation.[3] Massive genetic analysis of autistic patients reveals that the S allele is present significantly more in patients with Autism than without.[4] Since the presence of the short-HTTLPR promoter results in fewer SERTs being produced, and SERTs function by reuptaking and thus limiting serotonin-induced signal transduction, it is not unexpected that over 30% of autistic individuals, who more commonly have the short-HTTLPR ...
Transcriptome analyses were performed in the anterior raphe area of mutant mice deficient in the serotonin transporter (5-HTT KO) or overexpressing this protein (5-HTT TG), which exhibit opposite changes in anxiety-related behavior. Among genes with altered expression, the gene encoding the neuropeptide urocortin 1 was down-regulated in 5-HTT KO and up-regulated in 5-HTT TG mice. Expression of the gene encoding cocaine-and-amphetamine-related-peptide, which colocalizes with urocortin 1, was also increased in 5-HTT TG mutants. Real-time RT-PCR confirmed these data and immunoautoradiographic labeling showed that parallel changes in neuropeptide levels were confined to the non-preganglionic Edinger-Westphal nucleus. Thus, 5-HTT expression correlates with that of urocortin 1, suggesting that this peptide can be involved in the behavioral changes observed in 5-HTT mutant mice.
When assayed in parallel using transfected mammalian cells, human and rat serotonin transporters (SERTs) exhibit consistent differences in potency for tricyclic antidepressants but not for 5-hydroxytryptamine, cocaine, or nontricyclic serotonin transporter-selective reuptake inhibitors. Previously, using chimeric proteins, we determined that domains or residues distal to transmembrane domain 11 (amino acid 531) dictate the increased sensitivity of human SERT to imipramine. Using an additional chimera and site-directed mutagenesis, we have determined that a single amino acid, F586, is responsible for increased sensitivity to imipramine, desipramine, and nortriptyline. Thus, mutation of wild-type rat SERT (V586) to the human SERT identity F586, but no other divergent amino acids between human and rat SERTs, selectively increased tricyclic antidepressant potency. A reciprocal reduction in potency was observed when human SERT F586 was converted to the cognate rat SERT residue (V586). Interactions ...
The aim of this study was to determine if variable number of tandem repeats (VNTR) in the second intron (STin2) of the serotonin transporter (SLC6A4) gene was associated with tobacco use disorder, successful smoking cessation, or smoking characteristics. In this case-control study, patients with current tobacco use disorder, diagnosed according to DSM IV criteria (n = 185), and never-smokers, diagnosed according to CDC criteria (n = 175), were recruited and received 52 weeks of combined pharmacotherapy and cognitive therapy. Successful smoking cessation was defined as exhaled carbon monoxide | 6 ppm. SLC6A4 gene STin2 VNTR polymorphism was assessed using a Multiplex-PCR-based method. At baseline, participants were evaluated using the Fagerström Test for Nicotine Dependence (FTND) and the ASSIST scale. The STin2.12 allele (OR = 2.45; 95% CI = 1.44-4.15, p | 0.001) was associated with an increased risk for tobacco use disorder, while the STin2.10/10 genotype (OR = 0.42; 95% CI 0.25-0.71, p | 0.001)
Lynette Espino. Introduction: Serotonin (SERT) plays a role in fetal brain development and mood regulation later in life.1 The use of Selective Serotonin Reuptake Inhibitors (SSRIs) increases anxiety and depression in mice exposed to SSRIs during an early postnatal period.1-4 However, children of women who experienced depression during pregnancy also experience behavioral problems and mood disorders.3 For this reason, it is important to understand the changes in fetal brain circuitry that result from SSRI use during pregnancy.4 Methods: SERT knockout mice were generated using homologous recombination of a lox-modified SERT gene in PTL1 embryonic stem cells and implanted into target embryonic stem cells in C57BL/6 blastocysts to evaluate the effects on somatosensory cortex.5 Mice were bred accordingly for the use of anterograde tracing and array tomography experiments, localization and RNA-sequencing, ontogenetic analysis of cortical projections, and to evaluate the role of cortical vs. raphe ...
Rao, H., Gillihan, S. J., Wang, J., Korczykowski, M., Sankoorikal, G. M. V., … Farah, M. J. (2007). Genetic variation in serotonin transporter alters resting brain function in healthy individuals. Biological Psychiatry, 62, 600-606.. ...
While many studies focus on the association between early life adversity and the later risk for psychopathology, few simultaneously explore diverse forms of environmental adversity. Moreover, those studies that examined the cumulative impact of early life adversity focus uniquely on postnatal influences. The objective of this study was to focus on the fetal period of development to construct and validate a cumulative prenatal adversity score in relation to a wide range of neurodevelopmental outcomes. We also examined the interaction of this adversity score with a biologically informed genetic score based on the serotonin transporter gene. Prenatal adversities were computed in two community birth cohorts using information on health during pregnancy, birth weight, gestational age, income, domestic violence/sexual abuse, marital strain, as well as maternal smoking, anxiety, and depression. A genetic score based on genes coexpressed with the serotonin transporter in the amygdala, hippocampus, and ...
For engineers that moonlight as artists and artists that moonlight as engineers * * * ************************************************************************************************************************************************** * * * CCC OOO L L IIIII SSS IIIII OOO N N l l t i * * C C O O L L I S S I O O NN N ll ll t * * C O O L L I S I O O N N N ccc ooo l l eee ccc ttttt i v v eee * * C O O L L I S I O O N N N c c o o l l e e c c t i v v e e * * C O O L L I S I O O N NN c o o l l eeeee c t i v v eeeee * * C C O O L L I S S I O O N N c c o o l l e c c t i v v e * * CCC OOO LLLLL LLLLL IIIII SSS IIIII OOO N N ccc ooo lll lll eee ccc tt iii v eee ...
Background Membrane proteins (MPs) play crucial roles in signal transduction. rhodopsin was not affected by the target MPs and both could coexist in the membrane stacks. Heterologous expression levels reached about 270 to 500 pmol/mg total MP, resulting in 0.2C0.4 mg purified target MP from 1 107390-08-9 supplier g of fly heads. The metabotropic glutamate receptor and human serotonin transporter - both involved in synaptic transmission - showed native pharmacological characteristics and could be purified to homogeneity as a prerequisite for further studies. Significance We demonstrate expression in PRCs as an efficient and inexpensive tool for the large scale production of functional eukaryotic MPs. The travel eye system offers a number of advantages over conventional expression systems and paves the way for in-depth analyses of eukaryotic MPs that have so far not been accessible to biochemical and biophysical studies. Introduction Membrane proteins (MPs) represent more than 30% of the cell ...
An interesting study published, by Elaine Fox and colleagues at the University of Essex, has provided tantalizing evidence that optimists literally do see the world differently than those with a more pessimistic or neutral disposition.. Evidence has accumulated over the years that suggests a link between variations in the serotonin transporter gene and a positive or negative affect, but how does this link to perception?. The current study was based on 111 healthy volunteers. The subjects were asked to quickly score positive, negative or neutral visual cues (dot probe paradigm).. The study participants were genotyped to determine their serotonin receptor promoter gene (5-HTTLPR) status. There are three possible genotypes for 5-HTTLPR, i.e. short-short, short-long or long-long.. Interestingly, the subjects with a long-long genotype had a markedly different response to the visual stimuli than the others. The long-long group had a significantly stronger vigilance for positive images and a ...
underlie how genetic variation in the serotonin transporter gene, a key gene that regulates mood and stress responses, can influence the way we respond to perceived threat.
Blazevic, Sofia; Horvaticek, Marina; Kesic, Maja; Zill, Peter; Hranilovic, Dubravka; Ivanisevic, Marina; Desoye, Gernot; Stefulj, Jasminka (2017): Epigenetic adaptation of the placental serotonin transporter gene (SLC6A4) to gestational diabetes mellitus. ...
Serotonin transporter Solute carrier family 6 (neurotransmitter transporter, serotonin), member 4 Identifiers Symbol(s) SLC6A4; HTT; 5-HTT; 5HTT; OCD1; SERT;
In a recent study (Tafet, Toister-Achituv, & Shinitzky, 2001), we demonstrated that cortisol induces an increase in the expression of the gene coding for the serotonin transporter, associated with a subsequent elevation in the uptake of serotonin. This stimulatory effect, produced upon incubatio …
This approach is based on the principle of delaying the release of the drug until it enters into the colon. Although gastric emptying tends to be highly variable, small intestinal transit time is relatively constant or little bit variation can be observed. The strategy in designing timed-released systems is to resist the acidic environment of the stomach and to undergo a lag time of predetermined span of time, after which release of drug take place. The lag time in this case is the time requires to transit from the mouth to colon. The first formulation introduced based on this principle was Pulsincap® (196). It is similar in appearance to hard gelatin capsule; the main body is made water insoluble (exposing the body to formaldehyde vapour which may be produced by the addition of trioxymethylene tablets or potassium permanganate to formalin or any other method). The contents are contained within a body by a hydrogel plug, which is covered by a water-soluble cap. The whole unit is coated with an ...
Contact Us. Tel:732-484-9848. Fax:888-484-5008. Email:[email protected]. Add:1 Deer Park Dr, Suite Q,. Monmouth Junction, NJ 08852, USA. ...
Contact Us. Tel:732-484-9848. Fax:888-484-5008. Email:[email protected]. Add:1 Deer Park Dr, Suite Q,. Monmouth Junction, NJ 08852, USA. ...
Previous studies have indicated that there is higher SERT ligand binding in various regions of the FH rat brain compared with control rat strains (Hulihan-Giblin et al., 1993; Chen and Lawrence, 2000). Here, we have shown that expression of SERT mRNA and [3H]citalopram binding sites was higher in the FH rat lung compared with the SD rat lung controls. When sections of lung were examined, SERT immunoreactivity was seen to be concentrated in the pulmonary arteries, with negligible immunoreactivity observed in other lung structures. In SD rat pulmonary arteries, immunoreactive SERT was localized to the cells at the medial/adventitial border, which is a similar distribution to that we have previously described in mouse (MacLean et al., 2004). However, in FH rat pulmonary arteries, the immunoreactivity extended further into the medial layer. SERT immunoreactivity is also concentrated in the pulmonary arteries in human, and this is increased in patients with both primary and secondary PAH. In these ...
L e s l e y T u r n b u l l Scottish & Australian Through photography - sequential, fragmented or otherwise, I am exploring transformative potential of landscapes and the ambiguity of gender. I am interested in the way photography and visual representation contributes to social and political understandings of identity and…
250 µCi quantities of [N-Methyl-3H]-Citalopram are available for your research. Application of [3H] Citalpram can be found in: binding to the 5-HT transporter from brain and platelets in molecular pharmacology, regional distribution of the serotonin transport complex in human brain in neuro-psychopharmacology, binding after antidepressant treatment in rat in pharmacology biochemistry, etc. ...
A m a z o n . c o m : M i l l , E l e c t r i c G r a i n D r y F e e d F l o u r M i l l i n g . . . T h i s s u i t a b l e b e a n c u r d , s t a r c h , r i c e f l o u r , c o r n a n d u s e d i n o t h e r . . . A m a z o n B u s i n e s s : b u s i n e s s - o n l y , q u a n t i t y d i s c o u n t s a n d F R E E S h i p p i n g . . . . D u e t o l o g i s t i c s , t h e a r r i v a l t i m e a l s o w i l l b e .. Read More ...
seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.7879. BsmI CviRI* , TaqI Tsp4CI* , , BccI \ \ \ \ ATGATTGGCAAACGGTTTTTCCAAACAACAAGTAAAAAGATTGCTTTTGCATTCGATATT 10 20 30 40 50 60 ----:----,----:----,----:----,----:----,----:----,----:----, TACTAACCGTTTGCCAAAAAGGTTTGTTGTTCATTTTTCTAACGAAAACGTAAGCTATAA / / / // Tsp4CI* , , ,BccI , , TaqI , CviRI* BsmI M I G K R F F Q T T S K K I A F A F D I * L A N G F S K Q Q V K R L L L H S I L D W Q T V F P N N K * K D C F C I R Y * ----:----,----:----,----:----,----:----,----:----,----:----, X I P L R N K W V V L L F I A K A N S I X S Q C V T K G F L L Y F S Q K Q M R Y H N A F P K E L C C T F L N S K C E I N CviJI , MfeI , TspEI , , PflMI , , BsiYI* , , , HgiCI* , , , , NlaIV , , , , , Cac8I , , , , , , MwoI , , , , , , , Hpy99I , , , , , , , , HgaI , , , , , , , , , AluI , , , , , , , , , CviJI , , , , , , , , , , SetI \ \ \ \ \ \ \ \ \ \ \ GATGGTGTGTTGTTCAGGGGCAAAAAGCCAATTGCTGGTGCCAGCGACGCATTGAAGCTG 70 80 90 100 110 120 ...
Pişirmə alətləri plastik qaşıq I CAKE MOLD-dan 5 dəst qaşıq rəng ölçülü qaşıq pulsuz çatdırılma - Bu məhsulu çatdırılma ilə sifariş edin.
Body Electrical, Lighting, Relays, and Switches and Ambient Air Temperature Sensor for BMW 2003 325i Base Sedan E46 2.5L L6 from KO Performance
Accessories and Fluids and Adhesive Syringe Nozzle for BMW 2011 335is Base Convertible E93 3.0L L6 from KO Performance
อ่านรีวิว Lasis Abalone Collagen Glycosaminoglycans จากผู้ใช้จริงทั่วประเทศ | V A N I L L A เว็บรีวิวเครื่องสำอางใหญ่ที่สุดในประเทศไทยจากผู้ใช้จริง มีทั้งหมด 331,832 รีวิว, 1,232 แบรนด์ และสินค้า 60,002 รายการ
El càlcio lè n elemènt chìmich enserìt endèla tàola periòdica dei elemèncc col sìmbol Ca. El gha nömer atòmich 20, che völ dì che l nùcleo de n àtom de càlcio el gha vint prutù. Lè un n metàl alcalì terùs, mulzì, de culùr gris, dopràt come agènt de ridusiù endèl procès de estrasiù minerària del torio, de lurànio e del zircònio. Lè l quint dei elemèncc de la grösta terèstre per abondànsa e lè n elemènt de mportànsa primària per el cìclo vitàl dei éser vivèncc. Se l tìra fò del fluoruro de calcio per mès de leletròlizi, e quan che l ciàpa föch el fà sö na fiàma de culùr zalt-aràncio; se l vé n contàt co lària el se òsida a la svèlta. el reagés co làiva e l fùrma lidròsido de calcio. I gös, i òs e le önge de töcc i animài i é furmàcc en bùna part de compòscc a bàze de càlcio e lè fàcil de troà n natüra sota fùrma de carbunàt de càlcio che lè l compòst principàl de töte le préde de ...
is a fatal genetic disorder that causes the progressive breakdown of nerve cells in the brain. It deteriorates a persons physical and mental abilities. Symptoms usually appear between the ages of 30 to 50, and worsen over a 10 to 25 year period and has no cure. Experts estimate that one in every 10,000 persons. Mutations in the HTT gene cause Huntington disease. The HTT gene provides instructions for making a protein called huntingtin. Although the function of this protein is unknown, it appears to play an important role in nerve cells (neurons) in the brain. At the moment no treatments can alter the course of Huntingtons disease. But medications can lessen some symptoms of movement and psychiatric disorders ...
In addition to natural methods of addressing serotonin deficiencies, there are some supplements that also work to improve the mood and health through enhancing serotonin levels in the body.
Serotonin Levels Test - free shipping on every order - easy & quick to use - certified laboratory - individual recommendations - find out more!
6-Nitroquipazine has been known as one of the most potent and selective inhibitors of serotonin transporter in vitro and in vivo… Expand ...
Human Transporter Database: Comprehensive Knowledge and Discovery Tools in the Human Transporter Genes. . Biblioteca virtual para leer y descargar libros, documentos, trabajos y tesis universitarias en PDF. Material universiario, documentación y tareas realizadas por universitarios en nuestra biblioteca. Para descargar gratis y para leer online.
Hormon (Yun. horman - sangkan ojah) hartina utusan kimiawi ti hiji sél (atawa sagolongan sél) ka sél lianna. Sakabéh organisme multisélular ngahasilkeun hormon (kaasup tutuwuhan - baca artikel fitohormon). Hormon nu paling dipikawanoh ti bangsa sasatoan (jeung manusa) nyaéta nu dihasilkeun ku kelenjar éndokrin vertebrata, padahal hormon téh dihasilkeun ku ampir unggal sistim organ jeung jaringan. Molekul hormon disékrésikeun (dikaluarkeun) langsung kana aliran getih, cairan awak lianna, atawa kana jaringan anu tangtu. Pindahna ku cara sirkulasi atawa difusi ka sél targétna, nu bisa baé sél nu padeukeut/natangga (aksi parakrin) dina jaringan nu sarua atawa sél nu ayana di organ séjén. Fungsi hormon nyaéta salaku sinyal/iber ka sél targét; peta hormon ditangtukeun ku pola sékrési jeung transduksi sinyal jaringan nu nampana. Hormon petana rupa-rupa, ngawengku stimulasi/pangrangsang atawa inhibisi/meungpeuk kamekaran, induksi atawa suprési apoptosis (program paéh sél), ...
Serotonin and its true nature has been highly misconstrued by the world of nutritional supplements and modern day science. Marketed as a feel good neurotransmitter, serotonin couldnt be further from it. The truth is, serotonin is an inflammatory mediator that rises with stress while also triggering a cascade of stre
To boost serotonin levels, try to get up early every day, as light exposure has been linked to higher serotonin levels.. Moreover make sure you get the needed amount of sleep every night, to refresh and rejuvenate the body, as well as the nervous system. If you take a nap during the day, it should not be longer than 30 to 45 minutes.. ...
François Brissette est professeur et chercheur à lÉTS et contribue à Substance, le site dactualité scientifique et dinnovation de lÉTS
... synaptic cleft by simultaneously reversing the direction of transport through the primary plasma membrane transport proteins ... serotonin, and histamine-from cellular cytosol into synaptic vesicles. In nigrostriatal pathway and mesolimbic pathway dopamine ... VMAT2 is an integral membrane protein that transports monoamines-particularly neurotransmitters such as dopamine, ... Play media The vesicular monoamine transporter 2 (VMAT2) also known as solute carrier family 18 member 2 (SLC18A2) is a protein ...
... cascade via protein kinases that results in the phosphorylation of monoamine transporters located at the plasma membrane (i.e ... Serotonin-norepinephrine releasing agent (SNRA) Serotonin-dopamine releasing agent (SDRA) Serotonin-norepinephrine-dopamine ... these transporters transport monoamines in reverse (i.e., they move monoamines from the neuronal cytoplasm into the synaptic ... They may enter the presynaptic neuron primarily via plasma membrane transporters, such as the dopamine transporter (DAT), ...
... s (MATs) are protein structures that function as integral plasma-membrane transporters to regulate ... serotonin, dopamine, norepinephrine). MATs are located just outside the synaptic cleft (peri-synaptically), transporting ... All MATs contain sites for protein kinase phosphorylation by cAMP-dependent protein kinase, protein kinase C (PKC) and Ca2+/ ... The ion concentration gradient generated by the plasma membrane Na+/K+ ATPase provides the driving force for the transporter- ...
The encoded protein contains twelve putative transmembrane domains and is a plasma integral membrane protein. OCT3 is widely ... Known substrates for transport include: histamine, serotonin, norepinephrine, dopamine and MPP+. Capacity for transport and ... 2007). "The organic cation transporters (OCT1, OCT2, EMT) and the plasma membrane monoamine transporter (PMAT) show ... Transport activity of OCT3 is inhibited by recreational and pharmaceutical drugs, including MDMA, phencyclidine (PCP), MK-801, ...
... glycine plasma membrane transport proteins MeSH D12.776.157.530.562.374.875 - serotonin plasma membrane transport proteins MeSH ... dopamine plasma membrane transport proteins MeSH D12.776.157.530.450.625.139 - gaba plasma membrane transport proteins MeSH ... gaba plasma membrane transport proteins MeSH D12.776.157.530.562.374.781 - glutamate plasma membrane transport proteins MeSH ... glycine plasma membrane transport proteins MeSH D12.776.157.530.450.625.186 - norepinephrine plasma membrane transport proteins ...
This protein is an integral membrane protein that transports the monoamine neurotransmitters (serotonin, dopamine, ... The plasma membrane monoamine transporter (PMAT) is a low-affinity monoamine transporter protein which in humans is encoded by ... Dahlin A, Xia L, Kong W, Hevner R, Wang J (May 2007). "Expression and immunolocalization of the plasma membrane monoamine ... Engel K, Wang J (Nov 2005). "Interaction of organic cations with a newly identified plasma membrane monoamine transporter". ...
... and cause an internal translocation so that the opening in the protein now faces the other side of the plasma membrane. The ... Serotonin transporter (SERT) Vesicular monoamine transporters (VMAT) Adenine nucleotide translocator (ANT) 2.B: Nonribosomally ... A membrane transport protein (or simply transporter) is a membrane protein involved in the movement of ions, small molecules, ... Unlike channel proteins which only transport substances through membranes passively, carrier proteins can transport ions and ...
... or serotonin transporter) to either stop transporting monoamines altogether (via transporter internalization) or transport ... Approximately 20% of amphetamine circulating in the bloodstream is bound to plasma proteins. Following absorption, amphetamine ... Despite the challenges in determining synaptic vesicle pH, the proton gradient across the vesicle membrane is of fundamental ... Transcription factors are proteins that increase or decrease the expression of specific genes. In simpler terms, this necessary ...
High affinity transport proteins found in the plasma membrane of presynaptic nerve terminals and glial cells are responsible ... Mutations in TnaT-D268S, in wild type TnaT and in a serotonin transporter (SERT; 2.A.22.1.1) provided direct evidence for the ... SLC6A20 APC superfamily Membrane transport proteins Rudnick, G; Krämer, R; Blakely, RD; Murphy, DL; Verrey, F (January 2014). " ... The majority of the transporters constitute an extensive family of homologous proteins that derive energy from the co-transport ...
This transport of serotonin by the SERT protein terminates the action of serotonin and recycles it in a sodium-dependent manner ... SERT spans the plasma membrane 12 times. It belongs to the NE, DA, SERT monoamine transporter family. Transporters are ... SERT is a type of monoamine transporter protein that transports serotonin from the synaptic cleft back to the presynaptic ... "SLC6A4 Gene (Protein Coding)". "SLC6A4 - Sodium-dependent serotonin transporter - Homo sapiens (Human) - SLC6A4 gene & protein ...
In addition to its effect on the plasma membrane monoamine transporters, methamphetamine inhibits synaptic vesicle function by ... and serotonin transporter (SERT). When methamphetamine binds to TAAR1, it triggers transporter phosphorylation via protein ... production and either completely inhibits or reverses the transport direction of the dopamine transporter (DAT), norepinephrine ... Transcription factors are proteins that increase or decrease the expression of specific genes. In simpler terms, this necessary ...
Because neurotransmitters are too large and hydrophilic to diffuse through the membrane, specific transport proteins are ... Reuptake is the reabsorption of a neurotransmitter by a neurotransmitter transporter located along the plasma membrane of an ... examined reuptake inhibitor selectivity among the rat serotonin reuptake protein (SERT) expressed in human embryonic kidney ... transporter proteins use transmembrane ion gradients and electrical potential to transport neurotransmitter across the membrane ...
... must enter the presynaptic neuron through a membrane transport protein or be able to diffuse across the presynaptic membrane in ... indicating that trace amine induced LLA does not act on receptors found on the plasma membrane but requires their transport to ... and serotonin neurons, the primary membrane transporters are DAT, NET, and SERT respectively. TAAR1-D2sh is a presynaptic ... In model cell systems, hTAAR1 has extremely poor membrane expression. A method to induce hTAAR1 membrane expression has been ...
It is involved in the trafficking of proteins to the plasma membrane and can be expressed on the cell surface as a receptor. ... P11's involvement with the cytoskeleton may aid the transport of other proteins throughout the cell and to the cell membrane. ... Thus, given protein p11's interaction with serotonin 5-HT receptors and the increasing evidence of the protein's correlation to ... P11 is an integral part of cellular structural scaffolding that interacts with plasma membrane proteins through its association ...
"Effects of calcium antagonists on serotonin-dependent aggregation and serotonin transport in platelets of patients with ... Once ingested, the substance is absorbed quite rapidly and reaches a peak plasma concentration in 1-3 hours post-administration ... "Lipophilic cationic drugs increase the permeability of lysosomal membranes in a cell culture system". Journal of Cellular ... "Effects of the calcium antagonists perhexiline and cinnarizine on vascular and cardiac contractile protein function". The ...
SRP recognizes and transports specific nascent proteins to the endoplasmic reticulum in eukaryotes and the plasma membrane in ... Kishore S, Stamm S (January 2006). "The snoRNA HBII-52 regulates alternative splicing of the serotonin receptor 2C". Science. ... expressed in mammalian testes and somatic cells form RNA-protein complexes with Piwi proteins. These piRNA complexes (piRCs) ... As with proteins, mutations or imbalances in the ncRNA repertoire within the body can cause a variety of diseases. Many ncRNAs ...
"Functional interaction between monoamine plasma membrane transporters and the synaptic PDZ domain-containing protein PICK1". ... transport, and degradation. The gene for DAT, known as DAT1, is located on chromosome 5p15. The protein encoding region of the ... In contrast, the human serotonin transporter (hSERT) and human norepinephrine transporter (hNET) do not contain zinc binding ... Apart from these innate protein-protein interactions, recent studies demonstrated that viral proteins such as HIV-1 Tat protein ...
... before transfer to the plasma membrane. The membrane invaginates and disks bud off internally, forming the tightly packed ... by incorporating proteins and lipids that are synthesized and transported from the inner segment. Discs mature along with their ... Circadian rhythms that use neuromodulators such as adenosine, dopamine, glutamate, serotonin, and melatonin, rhythmically ... Opsin is synthesized on the rough endoplasmic reticulum and is an integral membrane protein. Its signal peptide is at the N- ...
... serotonin, or membrane expression of lysosome-associated membrane protein 2 (LAMP2) or CD63 by flow cytometry. Other platelet ... Other soluble proteins and granule parts then bud off from the immature granule in a clathrin-coated transport vesicle. The ... α-Granule exocytosis is evaluated primarily by plasma membrane expression of P-selectin (CD62P) by flow cytometry or estimation ... They contain mainly proteins, both membrane-associated receptors (for example, αIIbβ3 and P-selectin) and soluble cargo (for ...
Approximately 20% of amphetamine circulating in the bloodstream is bound to plasma proteins. Following absorption, amphetamine ... Although the monoamine transport cycle has been resolved in considerable detail, kinetic knowledge on the molecular actions of ... Amphetamine affects serotonin via VMAT2 and, like norepinephrine, is thought to phosphorylate SERT via TAAR1. Like dopamine, ... Amphetamine can enter the presynaptic neuron either through DAT or by diffusing across the neuronal membrane directly. As a ...
... can also signal through a nonreceptor mechanism called serotonylation, in which serotonin modifies proteins. This ... The 5-HT receptors, the receptors for serotonin, are located on the cell membrane of nerve cells and other cell types in ... March 2010). "Patients with high-bone-mass phenotype owing to Lrp5-T253I mutation have low plasma levels of serotonin". Journal ... The PMAT also suggestively transports dopamine and norepinephrine, albeit at Km values even higher than that of 5-HT (330- ...
"Initial serotonin transport into viable platelets and imipramine binding to platelet membranes". J Neural Transm (Vienna). 109 ... Its plasma protein binding is approximately 80%. Dibenzepin was first introduced, in Switzerland and West Germany, in 1965. It ... The drug has weak or negligible effects on serotonin and dopamine reuptake. Unlike many other TCAs, dibenzepin has no ... generally occurring before the threshold for serotonin syndrome is reached. Due to this risk, TCAs are rarely selected as the ...
Membrane Transport and Signaling. 1 (5): 559-579. doi:10.1002/wmts.42. Leth-Petersen, Sebastian; Petersen, Ida N.; Jensen, ... plasma protein binding, and detectability in standard urine screening approaches studied by means of hyphenated mass ... They act as selective agonists of the serotonin 5-HT2A receptor. The 25-NB family is unique relative to other classes of ... Hansen M (2011). Design and Synthesis of Selective Serotonin Receptor Agonists for Positron Emission Tomography Imaging of the ...
Active G-protein open up calcium channels to let calcium ions enter the plasma membrane. The other product of phospholipase C, ... transporting Ca2+, another second messenger, into the cytoplasm. Ca2+ ultimately binds to many proteins, activating a cascade ... and serotonin. Because peptide hormones and neurotransmitters typically are biochemically hydrophilic molecules, these first ... from the plasma membrane into the intermembrane space where they can reach and regulate membrane-associated effector proteins. ...
... is a transport protein integrated into the membrane of synaptic vesicles of presynaptic neurons. It acts to transport monoamine ... Activated heterotrimeric G-protein Gαq downregulates VMAT2 mediated serotonin transport in blood platelets, but this is not the ... This can result in an increase in efflux of catecholamines through the plasma membrane, depleting catecholamine concentrations ... This conformation occurs after the transport of one proton across the membrane and into the vesicle; proton transport drives ...
Sarcolemma Sarcomere SecY protein Secondary active transport Secretory pathway Semipermeable membrane Sergei Kovalev Serotonin ... Phosphatidylglycerol Phosphatidylinositol Phosphatidylserine Physics of skiing Pink algae Plasma membrane monoamine transporter ... Membrane fluidity Membrane lipids Membrane nanotube Membrane potential Membrane protein Membrane topology Membrane transport ... IgSF CAM Inner membrane Inner mitochondrial membrane Insect wing Integral membrane protein Interbilayer forces in membrane ...
... membrane glycoprotein - Membrane protein - Membrane topology - Membrane transport - memory B cell - memory T cell - Mendelian ... plant protein - plasma membrane - plasmid - plasmin - plasminogen - platelet glycoprotein GPIb-IX complex - platelet membrane ... serotonin - serotonin receptor - serpin - sexual reproduction - SH3 domain - SI - sigma factor - signal peptide - signal ... protein - protein biosynthesis - Protein Data Bank - protein design - protein expression - protein folding - protein isoform - ...
In addition to the plasma membrane monoamine transporters, methamphetamine inhibits uptake and induces efflux of ... it triggers transporter phosphorylation via protein kinase A (PKA) and protein kinase C (PKC) signaling, ultimately resulting ... Cass WA, Smith MP, Peters LE (2006). "Calcitriol protects against the dopamine- and serotonin-depleting effects of neurotoxic ... TAAR1 activation also causes some of the dopamine transporters to move into the presynaptic neuron and cease transport (not ...
... the three transport mechanisms have been traced to the proteins and their genes since 1990. They now comprise the plasma ... the plasma membrane extraneuronal monoamine transporter or organic cation transporter 3 (EMT or SLC22A3), Iversen's uptake2; ... as well as noradrenaline and serotonin) from the brain. They concluded that ″dopamine is concerned with the function of the ... Membranes play a twofold role for catecholamines: catecholamines must pass through membranes and deliver their chemical message ...
GABA metabolism/transport modulators This membrane protein-related article is a stub. You can help Wikipedia by expanding it.. ... membrane. • synapse. • integral component of plasma membrane. • chloride channel complex. • cell junction. • plasma membrane. • ... ion transmembrane transport. • signal transduction. • chemical synaptic transmission. • regulation of membrane potential. • ... chloride transmembrane transport. • ion transport. • regulation of response to drug. • central nervous system development. • ...
positive regulation of non-membrane spanning protein tyrosine kinase activity. • transmembrane receptor protein tyrosine kinase ... Yoshii A, Constantine-Paton M (June 2007). "BDNF induces transport of PSD-95 to dendrites through PI3K-AKT signaling after NMDA ... Studies using human subjects have found that hippocampal volume decreases with decreasing plasma levels of BDNF.[91] Although ... Serotonin-norepinephrine-dopamine reuptake inhibitors. *Nefazodone. Monoamine oxidase inhibitors. *Phenelzine. *Tranylcypromine ...
postsynaptic membrane. • cell projection. • membrane. • plasma membrane. • synapse. • integral component of plasma membrane. • ... This membrane protein-related article is a stub. You can help Wikipedia by expanding it.. *v ... integral component of postsynaptic specialization membrane. Biological process. • ion transport. • synaptic transmission, ... chloride transport. • neuropeptide signaling pathway. • chloride transmembrane transport. • response to amino acid. • ...
integral component of membrane. • membrane. • endocytic vesicle. • integral component of plasma membrane. • plasma membrane. ... G-protein coupled receptor 120 is a protein that in humans is encoded by the GPR120 gene.[5][6] ... regulation of glucose transport. • negative regulation of inflammatory response. • fat cell differentiation. • signal ... "Entrez Gene: GPR120 G protein-coupled receptor 120".. *^ Oh DY, Talukdar S, Bae EJ, Imamura T, Morinaga H, Fan W, Li P, Lu WJ, ...
Most neurotransmitters are water-soluble and require transmembrane proteins to transport them across the cell membrane. The ... Fowler, Christopher J. (2013-05-01). "Transport of endocannabinoids across the plasma membrane and within the cell". FEBS ... Bojesen, Inge N.; Hansen, Harald S. (2005). "Membrane transport of anandamide through resealed human red blood cell membranes ... and its transport across bilayer membranes, suggest that besides putative anandamide protein-transporters, cholesterol could be ...
The membrane transport proteins that move melatonin across a membrane include, but are not limited to, glucose transporters, ... Serotonin is itself an important neurotransmitter, but is also converted into N-acetylserotonin by serotonin N- ... greatly exceeding the concentration of melatonin in blood plasma.[43][44][45] Due to its capacity for free radical scavenging, ... proteins, and cellular membranes. Melatonin has been described as a broadly protective, readily available, and orally self- ...
... parts of the protein that pass through the plasma membrane), proteins interacting with the subunit indicated that the N- ... Once AMPA receptors are transported to the perisynaptic region through PKA or SAP97 phosphorylation, receptors are then ... The conformation of the subunit protein in the plasma membrane caused controversy for some time. While the amino acid sequence ... consisting of a clathrin-coated pit underneath a section of AMPAR-containing plasma membrane and interacting proteins, is the ...
It was advised to consider the role of the organic cation transporters (OCT) and the plasma membrane monoamine transporter ( ... Two broad classes of theories have emerged: (1) Changes in protein phosphorylation, gene expression, and protein translation ... MATs are able to transport monoamines other than their "native" neurotransmitter. ... They are an extension of selective serotonin reuptake inhibitors (SSRIs) and serotonin-norepinephrine reuptake inhibitors ( ...
This precursor protein also includes the oxytocin carrier protein neurophysin I.[21] The inactive precursor protein is ... At least two uncontrolled studies have found increases in plasma oxytocin at orgasm - in both men and women.[103][104] Plasma ... Brownstein MJ, Russell JT, Gainer H (January 1980). "Synthesis, transport, and release of posterior pituitary hormones". ... Stancampiano R, Melis MR, Argiolas A (1991). "Proteolytic conversion of oxytocin by brain synaptic membranes: role of ...
integral component of membrane. • membrane. • plasma membrane. • integral component of plasma membrane. • slit diaphragm. • ... This membrane protein-related article is a stub. You can help Wikipedia by expanding it.. *v ... manganese ion transport. • cellular response to hypoxia. • calcium ion transport. • cellular response to hydrogen peroxide. • ... John's Wort, are hyperforin and adhyperforin.[9][10] These compounds are inhibitors of the reuptake of serotonin, ...
membrane. • focal adhesion. • melanosome. • receptor complex. • cell membrane. • integral component of plasma membrane. • ... regulation of protein localization. • regulation of serotonin uptake. Sources:Amigo / QuickGO. Orthologs. ... negative regulation of lipid transport. • cell-matrix adhesion. • GO:0022415 viral process. • regulation of bone resorption. • ... lamellipodium membrane. • cell nucleus. • microvillus membrane. • filopodium membrane. • alphav-beta3 integrin-IGF-1-IGF1R ...
G-protein coupled serotonin receptor activity. • serotonin binding. • neurotransmitter receptor activity. • protein binding. • ... membrane. • cell body fiber. • integral component of plasma membrane. • dendritic shaft. • axon. • neuronal cell body. • ... negative regulation of potassium ion transport. • positive regulation of ERK1 and ERK2 cascade. • artery smooth muscle ... plasma membrane. • dendrite. • glutamatergic synapse. • integral component of postsynaptic membrane. • integral component of ...
Plasma transport[edit]. Most of the thyroid hormone circulating in the blood is bound to "transport protein"s. Only a very ... Membrane transport[edit]. Contrary to common belief, thyroid[35] hormones cannot traverse cell membranes in a passive manner ... and regulates the amounts and activity of serotonin, norepinephrine, and γ-aminobutyric acid (GABA) in the brain. ... Hennemann G, Docter R, Friesema EC, de Jong M, Krenning EP, Visser TJ (Aug 2001). "Plasma membrane transport of thyroid ...
In plasma of T1D patients, levels of 26 cytokines are increased and of those, 16 are inhibited by GABA in the cell assays.[36] ... makes the voltage across the cell's membrane less negative), shunting (has no effect on the cell's membrane potential), or ... GABA enhanced the catabolism of serotonin into N-acetylserotonin (the precursor of melatonin) in rats.[56] It is thus suspected ... GABAB metabotropic receptors, which are G protein-coupled receptors that open or close ion channels via intermediaries (G ...
Affinities of endogenous steroids for SHBG and plasma protein binding[40] Steroid. SHBG affinity. Plasma protein binding in men ... "Sex hormone-binding globulin mediates steroid hormone signal transduction at the plasma membrane". The Journal of Steroid ... Pugeat MM, Dunn JF, Nisula BC (July 1981). "Transport of steroid hormones: interaction of 70 drugs with testosterone-binding ... Serotonin. Nonsteroidal. ,0.01. ,0.2. ,0.1. ,0.1 Spironolactone. Steroidal. 0.03. 0.37. ,0.1. ,0.1 ...
In Cannabis and driving: a review of the literature and commentary, the United Kingdom's Department for Transport reviewed data ... A signature of this type of receptor is the distinct pattern of how the receptor molecule spans the cell membrane seven times. ... The cannabinoid receptor is a typical member of the largest known family of receptors called a G protein-coupled receptor. ... Lukas, Scott E.; Orozco, Sara (2001). "Ethanol increases plasma Δ9-tetrahydrocannabinol (THC) levels and subjective effects ...
... a platelet alpha-granule membrane protein, is also synthesized by vascular endothelial cells and is localized in Weibel-Palade ... Leukocytes use the blood as a transport medium to reach the tissues of the body. Here is a brief summary of each of the four ... The mechanism for penetration is disputed, but may involve proteolytic digestion of the membrane, mechanical force, or both.[3] ... Transmigration of the leukocyte occurs as PECAM proteins, found on the leukocyte and endothelial cell surfaces, interact and ...
Manchester, KL (1964). "Sites of Hormonal Regulation of Protein Metabolism". In Allison, NH & Munro JB. Mammalian Protein ... An effect of increases in plasma cortisol within the physiologic range". The Journal of Clinical Investigation. 73 (2): 412-20 ... The serotonin receptor gene 5HTR2C is associated with increased cortisol production in men.[91] ... Sandle GI, Keir MJ, Record CO (1981). "The effect of hydrocortisone on the transport of water, sodium, and glucose in the ...
Relative to the plasma and extracellular fluid, the concentration of Na+ ions is much lower in sweat (~40 mM in sweat versus ~ ... and their fluidic transport to the skin surface.[23] Dissolved in the water are trace amounts of minerals, lactic acid, and ... The allergy is not due to the sweat itself but instead to an allergy-producing protein secreted by bacteria found on the skin.[ ... that are located on the apical membrane of epithelial cells that form the duct (see Fig. 9 of the reference).[2] ...
Plasma glucoseEdit. Plasma glucose is said to be maintained when there is an equal rate of glucose appearance (entry into the ... This causes cellular membrane depolarization, inexcitability, and so muscle weakness.[53] Ca2+ leakage from type 1 ryanodine ... Amann, M; Calbet, JA (2008). "Convective oxygen transport and fatigue". Journal of Applied Physiology. 104 (3): 861-70. doi: ... The creation of AMP resulting from this reaction stimulates AMP-activated protein kinase (AMP kinase) which is the energy ...
The encoded protein contains twelve putative transmembrane domains and is a plasma integral membrane protein. Two transcript ... norepinephrine transport. • epinephrine transport. • organic cation transport. • dopamine transport. • protein ... serotonin transporter (SERT), vesicular monoamine transporter (VMAT2) and organic cation transporters (OCT1, 2 and EMT) in ... membrane. • plasma membrane. • integral component of plasma membrane. • basolateral plasma membrane. Biological process. • ...
protein binding. Cellular component. • integral component of membrane. • membrane. • integral component of plasma membrane. • ... positive regulation of ion transport. • positive regulation of smooth muscle contraction. • signal transduction. • positive ... plasma membrane. Biological process. • intestine smooth muscle contraction. • positive regulation of acetylcholine secretion, ... G-protein coupled receptor activity. • substance K receptor activity. • signal transducer activity. • ...
Specific transporter proteins called monoamine transporters that transport monoamines in or out of a cell exist. These are the ... dopamine transporter (DAT), serotonin transporter (SERT), and the norepinephrine transporter (NET) in the outer cell membrane ... Clinical studies report increased β-PEA plasma levels in patients suffering from acute schizophrenia [37] and elevated urinary ... dopamine and serotonin but their rates of synthesis are equivalent to those of noradrenaline and dopamine and they have a very ...
... has plasma protein binding of 85%.[124][119] Clonazepam passes through the blood-brain barrier easily, with blood ... Benzodiazepines, including clonazepam, bind to mouse glial cell membranes with high affinity.[112][113] Clonazepam decreases ... Varotto M; Roman G; Battistin L (30 April 1981). "[Pharmacological influences on the brain level and transport of GABA. I) ... serotonin) by neurons[106][107] and has been shown to bind tightly to central-type benzodiazepine receptors.[108] Because ...
The membrane transport proteins that move melatonin across a membrane include, but are not limited to, glucose transporters, ... "MetaCyc serotonin and melatonin biosynthesis".. *^ a b c d e Tordjman, S; Chokron, S; Delorme, R; Charrier, A; Bellissant, E; ... Melatonin occurs at high concentrations within mitochondrial fluid which greatly exceed the plasma concentration of melatonin.[ ... Serotonin is itself an important neurotransmitter, but is also converted into N-acetylserotonin by serotonin N- ...
January 2003) "Effects of normal meals rich in carbohydrates or proteins on plasma tryptophan and tyrosine ratios". The ... March 1988) "Serotonin precursor influenced by type of carbohydrate meal in healthy adults". The American Journal of Clinical ... August 1975) "Kinetic analysis of blood-brain barrier transport of amino acids". Biochimica et Biophysica Acta 401 (1): 128-36 ... kompetisie by die groot neutrale aminosuur transportproteïen wat aminosure met vertakte en aromatiese sykettings oor membrane ...
... delivery of newly synthesized membrane proteins that are incorporated in the plasma membrane after the fusion of the transport ... 4. Synapse with neurotransmitter released (serotonin) 5. Postsynaptic receptors activated by neurotransmitter (induction of a ... Proteins embedded in the vesicle membrane are now part of the plasma membrane. The side of the protein that was facing the ... Exocytosis (/ˌɛksoʊsaɪˈtoʊsɪs/[1][2]) is a form of active transport and bulk transport in which a cell transports molecules (e. ...
Decreased plasma taurine concentration has been demonstrated to be associated with feline dilated cardiomyopathy.[57] Unlike ... Zackheim HS, Farber EM (May 1969). "Low-protein diet and psoriasis. A hospital study". Archives of Dermatology. 99 (5): 580-6. ... Tsuji A, Tamai I (1996). "Sodium- and chloride-dependent transport of taurine at the blood-brain barrier". Taurine 2. Advances ... Taurine has many biological roles, such as conjugation of bile acids, antioxidation, osmoregulation, membrane stabilization, ...
water transport. • cell-cell signaling. • negative regulation of apoptotic process. • protein kinase C signaling. • generation ... membrane organization. • regulation of receptor activity. • G-protein coupled receptor signaling pathway. • maternal aggressive ... A number of drugs has been associated with SIADH, such as certain antidepressants (serotonin reuptake inhibitors and tricyclic ... The physiologic stimulus for secretion of vasopressin is increased osmolality of the plasma, monitored by the hypothalamus. A ...
... so it enters monoamine neurons via these neuronal membrane transport proteins;[88] by acting as a monoamine transporter ... after which serotonin levels in the brain are depleted.[4] Serotonin levels typically return to normal within 24-48 hours.[4] ... Likewise, the plasma half-life of (R)-MDMA was significantly longer than that of the (S)-enantiomer (5.8 ± 2.2 hours vs 3.6 ± ... Activation of TAAR1 by MDMA triggers protein kinase A and protein kinase C signaling events which then phosphorylates the ...
... we demonstrated that cortisol induces an increase in the expression of the gene coding for the serotonin transporter, ... associated with a subsequent elevation in the uptake of serotonin. This stimulatory effect, produced upon incubatio … ... Membrane Transport Proteins * Nerve Tissue Proteins * SLC6A4 protein, human * Serotonin Plasma Membrane Transport Proteins ... Correlation between cortisol level and serotonin uptake in patients with chronic stress and depression Cogn Affect Behav ...
The serotonin transporter (SERT) is the primary regulator of serotonin levels in the brain and a key target for widely used ... Serotonin Plasma Membrane Transport Proteins / metabolism* * Serotonin Uptake Inhibitors / metabolism * Serotonin Uptake ... The serotonin transporter (SERT) is the primary regulator of serotonin levels in the brain and a key target for widely used ... Integrating the monoamine, neurotrophin and cytokine hypotheses of depression--a central role for the serotonin transporter? ...
SerotoninSerotonin Plasma Membrane Transport ProteinsSerotonin Receptor Agonists • Serotonin Uptake Inhibitors • Sex ... Protein Binding • Proteins • Proto-Oncogene Proteins • Pupa • Pyrrolidonecarboxylic Acid • Quantitative Trait Loci • ... Drosophila Proteins • Ecdysone • Ecdysterone • Ecology • Electric Stimulation • Electron Transport Complex IV • Embryonic and ... Carrier Proteins • Case-Control Studies • Cautery • cdc42 GTP-Binding Protein, Saccharomyces cerevisiae • Cell Count • Cell ...
SerotoninSerotonin Plasma Membrane Transport ProteinsSerotonin Receptor Agonists • Severity of Illness Index • Tritium • ... AA Patkar, P Mannelli, K Peindl, KP Hill, LT Wu, T Lee, C Kuhn, Relationship of the serotonin transporter with prolactin ... BACKGROUND: Preclinical evidence indicates that exposure to cocaine influences the activity of the serotonin transporter (5-HTT ... Disturbances in serotonin transporter binding and post-synaptic 5-HT receptor function seem to be associated in cocaine- ...
... serotonin transporter linked polymorphic region) in the promoter of the serotonin transporter gene (SLC6A4) moderates ... 0/SLC6A4 protein, human; 0/Serotonin Plasma Membrane Transport Proteins; 333DO1RDJY/Serotonin ... Serotonin / genetics*, physiology. Serotonin Plasma Membrane Transport Proteins / genetics*. Sex Characteristics. Social ... OBJECTIVE: To examine whether a polymorphism (5-HTTLPR: serotonin transporter linked polymorphic region) in the promoter of the ...
Serotonin Plasma Membrane Transport Proteins/genetics, Stress, Psychological/genetics",. author = "Brinksma, {Djuke M.} and ... symptoms and that this relationship is moderated by the serotonin transporter polymorphism (5-HTTLPR). It is less clear whether ... symptoms and that this relationship is moderated by the serotonin transporter polymorphism (5-HTTLPR). It is less clear whether ... symptoms and that this relationship is moderated by the serotonin transporter polymorphism (5-HTTLPR). It is less clear whether ...
Norepinephrine Plasma Membrane Transport Proteins); 0 (Propiophenones); 0 (Psychotropic Drugs); 0 (Serotonin Plasma Membrane ... 0 (4-fluoromethcathinone); 0 (4-methoxymethcathinone); 0 (Dopamine Plasma Membrane Transport Proteins); 0 (Methylamines); 0 ( ... 0 (Proto-Oncogene Proteins c-fos); 0 (Serotonin Uptake Inhibitors); 2DS058H2CF (Fenfluramine); 333DO1RDJY (Serotonin). ... Serotonin 5-HT2 Receptor Agonists); 0 (Serotonin Agents); 2DS058H2CF (Fenfluramine); 333DO1RDJY (Serotonin). ...
A serotonin receptor subtype found widely distributed in peripheral tissues where it mediates the contractile responses of ... Serotonin Plasma Membrane Transport Proteins (Serotonin Transporter) 6. sarpogrelate 7. Antipsychotic Agents (Antipsychotics) ... Proteins: 90489*Membrane Proteins: 5300*Cell Surface Receptors: 753*G-Protein-Coupled Receptors: 810*Serotonin Receptors: 535*5 ... Serotonin 2A; Serotonin 2A Receptors; 2A Receptor, Serotonin; 2A Receptors, Serotonin; Receptor, 5-HT2A; Receptors, Serotonin ...
Serotonin Plasma Membrane Transport Proteins. 1. 2016. 316. 0.600. Why? Memory, Short-Term. 3. 2019. 823. 0.580. Why? ...
SLC6A4 protein, human. 0. Serotonin Plasma Membrane Transport Proteins. EC Catechol O-Methyltransferase. ... Interaction of chronic stress with serotonin transporter and catechol-O-methyltransferase polymorphisms in predicting youth ... in depression have implicated a polymorphism in the promoter region of the serotonin transporter gene (5-HTTLPR) as a moderator ...
Serotonin Plasma Membrane Transport Proteins /genetics; Stress, Psychological /genetics ... Interaction between the serotonin transporter gene (5-HTTLPR), stressful life events, and risk of depression: a meta-analysis. ... To assess the relationship between the serotonin transporter gene (5-HTTLPR) and risk of depression. The authors also assessed ... This review concluded that there was no evidence that the serotonin transporter genotype alone, or in interaction with ...
Norepinephrine Plasma Membrane Transport Proteins Medicine & Life Sciences * Serotonin Plasma Membrane Transport Proteins ... Switch of activity toward the serotonin anti/or norepinephrine transporter. Together they form a unique fingerprint. * ... Its p-methoxy analogue 5c is a mixed inhibitor of norepinephrine and serotonin reuptake (K(i) = 187 nM at the NET and 56 nM at ... Its p-methoxy analogue 5c is a mixed inhibitor of norepinephrine and serotonin reuptake (K(i) = 187 nM at the NET and 56 nM at ...
Serotonin Plasma Membrane Transport Proteins * Birth Order Social Sciences. * adolescent * alcohol * young adult ...
Serotonin Plasma Membrane Transport Proteins * Sudden Infant Death * Haplotypes * African Americans * Alleles ... Fingerprint Dive into the research topics of Association of the serotonin transporter gene with sudden infant death syndrome: ... Association of the serotonin transporter gene with sudden infant death syndrome: A haplotype analysis. ...
Serotonin Plasma Membrane Transport Proteins Medicine & Life Sciences * environmental stress Earth & Environmental Sciences ... The short (s) variant of the serotonin transporter (5-HTT) gene linked functional polymorphic region (5-HTTLPR) is associated ... abstract = "The short (s) variant of the serotonin transporter (5-HTT) gene linked functional polymorphic region (5-HTTLPR) is ... N2 - The short (s) variant of the serotonin transporter (5-HTT) gene linked functional polymorphic region (5-HTTLPR) is ...
Serotonin Plasma Membrane Transport Proteins Medicine & Life Sciences * Psychological Extinction Medicine & Life Sciences ... and more prominently so in short-allele carriers of the serotonin transporter linked polymorphic region (5-HTTLPR). Serotonin ... and more prominently so in short-allele carriers of the serotonin transporter linked polymorphic region (5-HTTLPR). Serotonin ... and more prominently so in short-allele carriers of the serotonin transporter linked polymorphic region (5-HTTLPR). Serotonin ...
Serotonin Plasma Membrane Transport Proteins (Serotonin Transporter): 1 study in 3 results : IBA ... Dopamine Plasma Membrane Transport Proteins (Dopamine Transporter): 1 study in 7 results : IBA ... Membrane Proteins (Integral Membrane Proteins): 3 studies in 20 results : IBA. *Glycoproteins (Glycoprotein): 3 studies in 20 ... Ubiquitin-Protein Ligases (Ubiquitin-Protein Ligase): 13 results : IBA. *TATA-Box Binding Protein (TATA-Binding Protein): 13 ...
Serotonin Plasma Membrane Transport Proteins * Autism Spectrum Disorder * Autistic Disorder * Citalopram 6 Scopus citations ... Pharmacogenetic study of serotonin transporter and 5HT2A genotypes in autism. Najjar, F., Owley, T., Mosconi, M. W., Jacob, S. ... Plasma genetic and genomic abnormalities predict treatment response and clinical outcome in advanced prostate cancer. Xia, S., ...
Serotonin Plasma Membrane Transport Proteins * Sudden Infant Death * Fetal Death * Genes * Alleles ... Sudden infant death syndrome: Is serotonin the key factor?. Weese-Mayer, D. E., Nov 1 2006, In : Journal of the American ... Medullary serotonin defects and respiratory dysfunction in sudden infant death syndrome. Paterson, D. S., Hilaire, G. & Weese- ... Sudden infant death syndrome: Rare mutation in the serotonin system FEV gene. Rand, C. M., Berry-Kravis, E. M., Zhou, L., Fan, ...
Serotonin and Noradrenaline Reuptake Inhibitors * Depression * Serotonin Plasma Membrane Transport Proteins * Major Depressive ...
Serotonin Plasma Membrane Transport Proteins / genetics* Actions. * Search in PubMed * Search in MeSH ... Association between serotonin transporter gene and borderline personality disorder. Ni X, Chan K, Bulgin N, Sicard T, Bismil R ... Association between the serotonin transporter gene and personality traits in borderline personality disorder patients evaluated ... Association analysis between gene variants of the tyrosine hydroxylase and the serotonin transporter in borderline personality ...
Serotonin Plasma Membrane Transport Proteins / genetics* Actions. * Search in PubMed * Search in MeSH ... Serotonin transporter gene (5-HTTLPR) polymorphism and efficacy of selective serotonin reuptake inhibitors--do we have ... Depression in patients with head and neck cancer and a functional genetic polymorphism of the serotonin transporter gene Jill ... Depression in patients with head and neck cancer and a functional genetic polymorphism of the serotonin transporter gene Jill ...
Serotonin Plasma Membrane Transport Proteins Malaysia Bipolar Disorder Ethnic Groups Genes Control Groups ... Mohamed Saini, S., Nik Jaafar, N. R., Sidi, H., Midin, M., Mohd Radzi, A., & Abdul Rahman, A. H. (2014). Serotonin transporter ... Mohamed Saini, S, Nik Jaafar, NR, Sidi, H, Midin, M, Mohd Radzi, A & Abdul Rahman, AH 2014, Serotonin transporter gene ... Serotonin transporter gene polymorphism and its association with bipolar disorder across different ethnic groups in Malaysia. ...
Serotonin Plasma Membrane Transport Proteins Bipolar Disorder Antidepressive Agents Genes Haplotypes Serotonin Uptake ... treated with a selective serotonin reuptake inhibitor (SSRI) or serotonin-norepinephrine reuptake inhibitor (SNRI) were used to ... treated with a selective serotonin reuptake inhibitor (SSRI) or serotonin-norepinephrine reuptake inhibitor (SNRI) were used to ... treated with a selective serotonin reuptake inhibitor (SSRI) or serotonin-norepinephrine reuptake inhibitor (SNRI) were used to ...
Serotonin Plasma Membrane Transport Proteins Meta-Analysis Alzheimer Disease Alleles Population Serotonin ... A novel study and meta-analysis of the genetic variation of the serotonin transporter promoter in the Italian population do not ... A novel study and meta-analysis of the genetic variation of the serotonin transporter promoter in the Italian population do not ... A novel study and meta-analysis of the genetic variation of the serotonin transporter promoter in the Italian population do not ...
Serotonin Gene Expression Tryptophan Hydroxylase Serotonin Plasma Membrane Transport Proteins Menstrual Cycle ... Bethea, C, Phu, K, Reddy, A & Cameron, JL 2013, The effect of short-term stress on serotonin gene expression in high and low ... Bethea, C., Phu, K., Reddy, A., & Cameron, J. L. (2013). The effect of short-term stress on serotonin gene expression in high ... The effect of short-term stress on serotonin gene expression in high and low resilient macaques. / Bethea, Cynthia; Phu, Kenny ...
Vesicular Monoamine Transport Proteins Serotonin Plasma Membrane Transport Proteins Membrane Transport Proteins ... in synaptic vesicles by expressing the plasma membrane serotonin transporter (5-HTT) and the vesicular monoamine transporter ( ... in synaptic vesicles by expressing the plasma membrane serotonin transporter (5-HTT) and the vesicular monoamine transporter ( ... in synaptic vesicles by expressing the plasma membrane serotonin transporter (5-HTT) and the vesicular monoamine transporter ( ...
Serotonin Plasma Membrane Transport Proteins Migraine Disorders Mood Disorders Comorbidity Genes Depression ... Genetic bases of comorbidity between mood disorders and migraine: Possible role of serotonin transporter gene. Neurological ... Genetic bases of comorbidity between mood disorders and migraine : Possible role of serotonin transporter gene. / Marino, Elena ... Genetic bases of comorbidity between mood disorders and migraine : Possible role of serotonin transporter gene. In: ...
Serotonin Plasma Membrane Transport Proteins * Dopamine Plasma Membrane Transport Proteins * Lead compounds ... serotonin, ≥1397) highly potent and selective serotonin re-uptake inhibitors were identified. Optimal features playing a ... serotonin, ≥1397) highly potent and selective serotonin re-uptake inhibitors were identified. Optimal features playing a ... serotonin, ≥1397) highly potent and selective serotonin re-uptake inhibitors were identified. Optimal features playing a ...
Serotonin Plasma Membrane Transport Proteins Fluoxetine Haplorhini Receptor, Serotonin, 5-HT1A Mothers ... Serotonin transporter (SERT) and serotonin 1A (5-HT1A) receptor. An equal number of monkeys separated from their mothers at ... Serotonin transporter (SERT) and serotonin 1A (5-HT1A) receptor. An equal number of monkeys separated from their mothers at ... Serotonin transporter (SERT) and serotonin 1A (5-HT1A) receptor. An equal number of monkeys separated from their mothers at ...
  • The expression of 3 genes pivotal to serotonin neural function was assessed in the 3 groups of monkeys (n. =4-5/group). (
  • Therefore, both genes and environments that influence serotonin function are good candidates for association with risky decision making. (
  • Here, we studied two candidate genes known to affect mood and aggression, the serotonin transporter (5-HTTLPR) and monoamine oxidase A (MAOA-VNTR) polymorphisms, in 50 males with FXS ages 8-24 years. (
  • Methods: Male Russian prisoners who were convicted for murder (n = 117) or theft (n = 77) were genotyped for variants of the serotonin transporter (5HTTLPR), tryptophan hydroxylase, tryptophan-2,3-dioxygenase, or type 2C (5-HT2C) receptor genes and compared with general-population male controls (n = 161). (
  • This study reports the expression of serotonin-related genes: tryptophan hydroxylase 2 (TPH2), serotonin reuptake transporter (SERT) and the serotonin 1A autoreceptor (5HT1A) using digoxigenin-ISH and image analysis. (
  • Objective: The purpose of this study was to determine whether polymorphisms in the serotonin transporter (SLC6A4) and serotonin-2A receptor (HTR2A) genes are associated with response to escitalopram in patients with autism spectrum disorder (ASD). (
  • In the present study, candidate polymorphisms of the serotonin transporter, the tryptophan hydroxylase 2 (TPH2) genes, as well as of the brain-derived neurotrophic factor BDNF, and the P2RX7 purinergic receptor genes were analyzed in Hungarian diabetic population. (
  • Nevertheless, suggestive associations are available for the 5HT2A receptor and the serotonin transporter genes. (
  • Existen reportes en los que se establecen asociaciones entre polimorfismos en estos genes y el TDM. (
  • El objetivo de nuestro trabajo fue analizar la posible asociación entre el TDM y polimorfismos en los genes HTR2A (receptor 5-hidroxitriptamina 2A), BDNF y APOE en una muestra de la población argentina previamente estudiada para 2 polimorfismos en el gen SLC6A4 (transportador soluble familia 6 miembro 4). (
  • The association differed based on the presence of sensitizing alleles in the dopamine receptor 2 and serotonin transporter genes. (
  • Although children with sensitizing alleles on the dopamine receptor 2 and serotonin transporter genes were at greater risk when not read to, they fared as well as children without these alleles when shared reading occurred. (
  • In a recent study (Tafet, Toister-Achituv, & Shinitzky, 2001), we demonstrated that cortisol induces an increase in the expression of the gene coding for the serotonin transporter, associated with a subsequent elevation in the uptake of serotonin. (
  • A polymorphism in the serotonin transporter gene moderates cardiovascular reactivity to psychosocial stress. (
  • OBJECTIVE: To examine whether a polymorphism (5-HTTLPR: serotonin transporter linked polymorphic region) in the promoter of the serotonin transporter gene (SLC6A4) moderates cardiovascular reactivity to social threat. (
  • Investigations of gene-environment interaction (GxE) in depression have implicated a polymorphism in the promoter region of the serotonin transporter gene (5-HTTLPR) as a moderator of the stress-depression relationship. (
  • To assess the relationship between the serotonin transporter gene (5-HTTLPR) and risk of depression. (
  • The short (s) variant of the serotonin transporter (5-HTT) gene linked functional polymorphic region (5-HTTLPR) is associated with depression. (
  • The purpose of the present study was to extend these findings to the tyrosine hydroxylase (TH) Val(81)Met single nucleotide polymorphism (SNP), the 5-HTTLPR S/L polymorphism incorporating the recently described functional A/G SNP within the long allele of the 5-HTTLPR (rs25531) as well as the variable number of tandem repeat (VNTR) polymorphism within intron 2 of the serotonin transporter gene (STin2). (
  • Interaction between gene variants of the serotonin transporter promoter region (5-HTTLPR) and catechol O-methyltransferase (COMT) in borderline personality disorder. (
  • Polymorphism of the serotonin transporter gene, 5-HTTLPR (short allele) has been associated with depression. (
  • Association of serotonin transporter promoter gene polymorphism (5-HTTLPR) with depression in Costa Rican schizophrenic patients. (
  • This preliminary study aims to determine the frequency of the serotonin transporter gene polymorphism (5-HTTLPR) in the three main ethnic groups in Malaysia and its association with bipolar disorder. (
  • This study examines serotonin-related gene expression in monkeys with different sensitivity to stress and exposed to 5. (
  • a well-studied polymorphic variant, in the promoter region of the gene (SERTPR), has been demonstrated to influence the availability of serotonin in the synaptic cleft. (
  • Functional polymorphism (5-HTTLPR) in the serotonin transporter gene is associated with subjective well-being: evidence from a US nationally representative sample. (
  • Variation in the promotor region of the serotonin transporter gene (5-HTTLPR) is a promising candidate for better understanding individual heterogeneity in subjective well-being or happiness, as measured by life satisfaction. (
  • A case-control association study on a representative sample of Americans (N=2574) finds that individuals with the transcriptionally more efficient version of the serotonin transporter gene, report significantly higher levels of life satisfaction (P=0.01). (
  • Individual scanpath characteristics were brought into register with the genotype for the serotonin transporter regulatory gene (5-HTTLPR) and with behavioral characteristics such as expression of anticipatory anxiety and impulsiveness/hesitation in approaching food in the presence of a potentially dangerous object. (
  • The present study investigated whether two types of early life stress, maternal and social aggression, and a serotonin transporter gene promoter polymorphism (rh5-HTTLPR) predicted lower post-stressor peripheral blood mononuclear cell (PBMC) 5-HTT expression in infant rhesus macaques. (
  • Modulations of serotonergic and noradrenergic systems are thought to be critical to the therapeutic effect of most antidepressants, and their efficacies have been shown to depend on a functional polymorphism within the promoter region of the serotonin transporter gene (5-HTTLPR). (
  • Ham, B-J Dec. 24 2018, Methylation rate of serotonin transporter gene promoter region for providing information about diagnosis of major depressive disorder , Patent No. 10-1933893. (
  • Background Allelic variations in TPH2, the gene encoding tryptophan hydroxylase 2, the rate-limiting enzyme for brain serotonin (5-HT) biosynthesis, may be genetic predictors of panic disorder and panic responses to panicogenic challenges in healthy volunteers. (
  • All rats were killed 3 days after the last intra-BL injection to analyze tph2 and slc6a4 (gene encoding the serotonin transporter, SERT) mRNAexpression in the dorsal raphe nucleus (DR), the main source of serotonergic projections to anxiety-related brain regions, using in situ hybridization histochemistry. (
  • We examined the relationship between a functional polymorphism of the serotonin transporter gene (5-HTTLPR) and individual differences in emotional reactivity in two laboratory studies. (
  • Background-We explored the relationship of genetic variants of the serotonin transporter gene SLC6A4, a key regulator of the serotonergic neurotransmission, with both depressive symptoms and plasma interleukin-6 (IL-6) levels.Methods and Results-We genotyped 20 polymorphisms in 360 male twins (mean age, 54 years) from the Vietnam Era Twin Registry. (
  • Further bivariate modeling revealed that 10% of the correlation between Beck Depression Inventory and IL-6 could be explained by the SLC6A4 gene.Conclusions-Genetic vulnerability involving the SLC6A4 gene is significantly associated with both increased depressive symptoms and elevated IL-6 plasma levels. (
  • Past research investigating the role of the serotonin transporter gene in OCD has produced mixed findings. (
  • There were no differences in allelic frequencies on the serotonin transporter gene between the panic disordered group, the OCPD group, and the non-disordered control group. (
  • A polymorphism in the serotonin transporter gene (5-HTTLPR) is frequently studied for association with antidepressant treatment response, different personality traits, and psychiatric disorders. (
  • In this study, we sought to define the effects of androgens and aromatase inhibition on serotonin-related gene expression in the dorsal raphe, as well as serotonergic innervation of the LC. (
  • This suggested that androgen activity increased TPH2 and SERT gene expression but, aromatase activity, and neural production of estradiol (E), may subserve axonal serotonin and determination of the compartment acted upon by fenfluramine. (
  • In summary, androgens stimulated serotonin-related gene expression, but aromatase inhibition dissociated gene expression from the serotonin innervation of the LC terminal field and fenfluramine-stimulated prolactin secretion. (
  • It is concluded that tyrosine phosphorylation is an essential component in the signaling pathways participating in the regulation of the human serotonin transporter gene expression. (
  • The serotonin transporter gene, 5-HTTLPR, was assayed in a sample of 388 nontwin sibling pairs from the United States to determine the contribution of the serotonin transporter locus to the covariation between the Neuroticism and Agreeableness scales. (
  • In all four samples, genetic influences contributed to the covariance of Neuroticism and Agreeableness, with the serotonin transporter gene accounting for 10% of the relationship between these domains. (
  • Hamer, Dean H. / Covariance structure of neuroticism and agreeableness : A twin and molecular genetic analysis of the role of the serotonin transporter gene . (
  • We used observed parenting behaviors, along with genetic variants and haplotypes of the serotonin transporter gene (SLC6A4), as predictors of children's ego-resiliency during early childhood (N= 153). (
  • Furthermore, although individual genetic variants of the serotonin transporter gene (LPR, STin2) were not associated with ego-resiliency, the S10 haplotype (that combines information from these two variants) was negatively associated with initial levels of ego-resiliency. (
  • An association of the level of personal anxiety with polymorphic variants of the gene encoding serotonin transporter (5-HTT) in 57 Russian residents of Siberia and 62 Tuvinians was studied. (
  • Serotonin gene polymorphisms and bipolar I disorder: focus on the serotonin transporter. (
  • Genetic studies have proposed that polymorphisms in the promoter region of the serotonin transporter gene and in the catechol-O-methyltransferase gene are related to aggression. (
  • A functional polymorphism in the serotonin transporter gene (5HTTLPR) has previously been associated with insomnia, although results are mixed. (
  • Play media The vesicular monoamine transporter 2 (VMAT2) also known as solute carrier family 18 member 2 (SLC18A2) is a protein that in humans is encoded by the SLC18A2 gene. (
  • The serotonin transporter (SERT) is the primary regulator of serotonin levels in the brain and a key target for widely used antidepressant drugs, such as selective serotonin reuptake inhibitors (SSRIs). (
  • Its p-methoxy analogue 5c is a mixed inhibitor of norepinephrine and serotonin reuptake (K(i) = 187 nM at the NET and 56 nM at the SERT). (
  • Tryptophan hydroxylase 2 (TPH2), the serotonin reuptake transporter (SERT), and the 5HT1A autoreceptor mRNAs expression were determined at 4 morphological levels of the dorsal raphe nucleus with in situ hybridization (ISH) using digoxigenin-incorporated riboprobes. (
  • Objective: This study examined the longterm effects of fluoxetine administered to juvenile rhesus monkeys who, as young adults, were imaged with positron emission tomography for two serotonergic markers: Serotonin transporter (SERT) and serotonin 1A (5-HT1A) receptor. (
  • UWA-101, a dual, equipotent inhibitor of dopamine (DAT) and serotonin (SERT) transporters, has previously been shown to successfully extend duration of anti-parkinsonian benefit of l-DOPA (ON-time), without exacerbating dyskinesia, in the 1-methyl-4-phenyl-1,2,3,6- tetrahydropyridine (MPTP)-lesioned marmoset. (
  • The serotonin transporter, SERT, is reported as a key molecule that regulates serotonergic neurotransmission. (
  • Furthermore, oligomerization was found to be independent of SERT surface density, and oligomers remained stable over several minutes in the live cell plasma membrane. (
  • Together, the results indicate kinetic trapping of preformed SERT oligomers at the plasma membrane. (
  • The serotonin transporter (SERT) controls synaptic serotonin levels and is the primary target for antidepressants, including selective serotonin reuptake inhibitors (e.g. (
  • The data provide a mechanistic explanation for the allosteric action of antidepressants at SERT and suggest that the role of the vestibule is evolutionarily conserved among neurotransmitter:sodium symporter proteins as a binding pocket for small molecule ligands. (
  • Here, we demonstrate that, in M172 knock-in mice, basal SERT protein levels, 5-HT transport rates, and 5-HT levels are normal. (
  • Through a series of biochemical, electrophysiological, and behavioral assays, we demonstrate the unique properties of this model and establish directly that SERT is the sole protein responsible for selective 5-HT reuptake inhibitor-mediated alterations in 5-HT clearance, in 5-HT1A autoreceptor modulation of raphe neuron firing, and in behaviors used to predict the utility of antidepressants. (
  • Methods SPECT analysis using [ 99m Tc] TRODAT-1 to assess striatal dopamine transporter (DAT) availability and [ 123 I] ADAM to assess midbrain serotonin transporter (SERT) availability were performed. (
  • Methods SPECT analysis using [ 99mTc] TRODAT-1 to assess striatal dopamine transporter (DAT) availability and [ 123I] ADAM to assess midbrain serotonin transporter (SERT) availability were performed. (
  • Here, we have designed novel tools for atomic force microscopy that directly measure the interaction forces between the serotonin transporter (SERT) and the S- and R-enantiomers of citalopram on the single molecule level. (
  • They may enter the presynaptic neuron primarily via plasma membrane transporters, such as the dopamine transporter (DAT), norepinephrine transporter (NET), and serotonin transporter (SERT). (
  • IC 50 ratios for human dopamine:serotonin or norepinephrine:serotonin, ≥1397) highly potent and selective serotonin re-uptake inhibitors were identified. (
  • A number of the most potent serotonin re-uptake inhibitors were tested in Balb/c mice in the forced-swim test (FST), a behavioral test used to measure the effects of antidepressant agents. (
  • Cashman, John R. / 2,5-Disubstituted tetrahydrofurans as selective serotonin re-uptake inhibitors . (
  • Regulates signal amplitude and duration at serotonergic synapses and is the site of action of the SEROTONIN UPTAKE INHIBITORS. (
  • The compounds were evaluated for their ability to compete with radiolabeled RTI-55 binding and to inhibit re-uptake of neurotransmitters at the human dopamine, serotonin and norepinephrine transporters. (
  • Serotonin transporters in ecstasy users. (
  • Furthermore, individuals with a low level of serotonin transporters in the dorsal raphe nucleus (DRN) are honest and trustful, and thus cannot tolerate unfairness, being candid in expressing their frustrations. (
  • Background: Serotonin transporters (SERTs) play a major role in modulating serotonergic neuronal function and are the target of many antidepressant drugs used in neuro-psychiatric disorders. (
  • Conclusion: In conjunction with a high SUR in MB, TH and ST, we speculate that 123 I-ADAM may be a potential radioligand for SPECT studies of serotonin transporters in humans. (
  • upon phosphorylation, these transporters transport monoamines in reverse (i.e., they move monoamines from the neuronal cytoplasm into the synaptic cleft). (
  • The differences in selectivity of these agents is the result of different affinities as substrates for the monoamine transporters, and thus differing ability to gain access into monoaminergic neurons and induce monoamine neurotransmitter release via the TAAR1 and VMAT2 proteins. (
  • They are different than SEROTONIN RECEPTORS, which signal cellular responses to SEROTONIN. (
  • We also report on our investigations of the serotonin transporter, SLC6A4 (17q11.1-q12). (
  • Si bien es necesario replicar estos hallazgos en una población más grande, nuestros resultados sugieren una posible interacción entre moléculas involucradas en la neurogénesis (BDNF y APOE), la neurotransmisión serotoninérgica (SLC6A4 y HTR2A) y la patogenia de la depresión mayor. (
  • This review concluded that there was no evidence that the serotonin transporter genotype alone, or in interaction with stressful life events, was associated with an elevated risk of depression. (
  • Studies that reported data on the association between the serotonin transporter linked polymorphic region (5-HTTLPR) genotype (either short-short (SS), short-long (SL) or long-long (LL)), number of stressful life events and a categorical measure of depression (as defined by the Diagnostic and Statistical Manual of Mental Disorders, 4th Edition, (DSM-IV) or the International Statistical Classification of Diseases, 10th Revision (ICD-10)) were eligible for inclusion. (
  • Gibboni, RR, Zimmerman, PE & Gothard, KM 2009, ' Individual differences in scanpaths correspond with serotonin transporter genotype and behavioral phenotype in rhesus monkeys (Macaca mulatta) ', Frontiers in Behavioral Neuroscience , vol. 3, no. (
  • Changes in mucosal 5‐HT (serotonin) signalling occur in animal models of colitis and in humans suffering from IBD. (
  • We computed serotonin (5-HT) seasonality values and performed an association analysis with the s/l alleles of the 5-HTTLPR. (
  • abstract = "Literature suggests that life stressors predict attention-deficit/hyperactivity disorder (ADHD) symptoms and that this relationship is moderated by the serotonin transporter polymorphism (5-HTTLPR). (
  • abstract = "The factors that influence individual differences in decision making are not yet fully characterized, but convergent evidence is accumulating that implicates serotonin (5-HT) system function. (
  • abstract = "Androgen administration to castrated individuals was purported to decrease activity in the serotonin system. (
  • abstract = "Serotonin and dopamine are speculated to subserve motivationally opponent functions, but this hypothesis has not been directly tested. (
  • abstract = "Brain serotonin (5-HT) modulates the neural and behavioral effects of ethanol in a manner that remains poorly understood. (
  • abstract = "The serotonin transporter promoter polymorphism (5-HTTLPR) has been linked to a number of human behavioral traits and disorders. (
  • abstract = "Introduction: Serotonin is implicated in the control of sleep-wake be- haviour. (
  • Thalamocortical neurons innervating the barrel cortex in neonatal rodents transiently store serotonin (5-HT) in synaptic vesicles by expressing the plasma membrane serotonin transporter (5-HTT) and the vesicular monoamine transporter (VMAT2). (
  • To precisely demonstrate the distribution of LymSERT mRNA-containing neurons, colocalization with serotonin immunoreactivity was also examined. (
  • The results showed that LymSERT mRNA was constitutively expressed and localized in the serotonin-containing neurons in the CNS. (
  • Sodium chloride-dependent neurotransmitter symporters located primarily on the PLASMA MEMBRANE of serotonergic neurons. (
  • Although many substituted amphetamines induce the release of neurotransmitters from vesicles through VMAT2 while inhibiting uptake through VMAT2, they facilitate the release of monoamine neurotransmitters into the synaptic cleft by simultaneously reversing the direction of transport through the primary plasma membrane transport proteins for monoamines (i.e., the dopamine transporter, norepinephrine transporter, and serotonin transporter) in monoamine neurons. (
  • Several selective SDRAs are known however, though these compounds also act as non-selective serotonin receptor agonists. (
  • The human serotonin transporter (hSERT) is responsible for the termination of synaptic serotonergic signaling. (
  • To examine the production of serotonin and the serotonergic innervation of a target area underlying arousal and vigilance, we measured the serotonin axon density entering the LC with ICC and image analysis. (
  • Interaction of chronic stress with serotonin transporter and catechol-O-methyltransferase polymorphisms in predicting youth depression. (
  • A significant increase in serotonin uptake (+37% + 14, M + SD) was observed in the control group, whereas neither the generalized anxiety disorder nor the major depression group exhibited changes in serotonin uptake upon incubation with cortisol. (
  • Research has identified changes in serotonin synthesis, serotonin receptor activation and serotonin uptake via the serotonin transporter in experimental and clinical pulmonary arterial hypertension. (
  • BACKGROUND: Preclinical evidence indicates that exposure to cocaine influences the activity of the serotonin transporter (5-HTT) as well as several 5-HT receptor subtypes. (
  • Treatment of the JAR human placental choriocarcinoma cells with herbimycin A, an inhibitor of tyrosine kinases, led to an increase in the activity of the serotonin transporter. (
  • polymorphism in the serotonin transporter-linked promoter region (5-HTTLPR). (
  • Seasonal variation of serotonin turnover in human cerebrospinal fluid, depressive symptoms and the role of the 5-HTTLPR. (
  • Life stress increases risk for developing post-traumatic stress disorder (PTSD), and more prominently so in short-allele carriers of the serotonin transporter linked polymorphic region (5-HTTLPR). (
  • Studies of monoaminergic seasonality and the influence of the serotonin-transporter-linked polymorphic region (5-HTTLPR) on serotonin seasonality have yielded conflicting results, possibly due to lack of power and absence of multi-year analyses. (
  • Integrating the monoamine, neurotrophin and cytokine hypotheses of depression--a central role for the serotonin transporter? (
  • Selective for one neurotransmitter Serotonin releasing agent (SRA) Norepinephrine releasing agent (NRA) Dopamine releasing agent (DRA) Non-selective, releasing two or more neurotransmitters Norepinephrine-dopamine releasing agent (NDRA) Serotonin-norepinephrine releasing agent (SNRA) Serotonin-dopamine releasing agent (SDRA) Serotonin-norepinephrine-dopamine releasing agent (SNDRA) MRAs cause the release of monoamine neurotransmitters by various complex mechanism of actions. (
  • Once inside the presynaptic neuron, they may inhibit the reuptake of monoamine neurotransmitters through vesicular monoamine transporter 2 (VMAT2) and release the neurotransmitters stores of synaptic vesicles into the cytoplasm by inducing reverse transport at VMAT2. (
  • VMAT2 is an integral membrane protein that transports monoamines-particularly neurotransmitters such as dopamine, norepinephrine, serotonin, and histamine-from cellular cytosol into synaptic vesicles. (
  • We assessed brain serotonin transporter (5-HTT) density in vivo with positron emission tomography (PET) in healthy individuals with high or low HA scores using an 'oversampling' study design. (
  • Background The psychobiological model of personality by Cloninger and colleagues originally hypothesized that interindividual variability in the temperament dimension 'harm avoidance' (HA) is explained by differences in the activity of the brain serotonin system. (
  • To establish a purification procedure for the human serotonin transporter (hSERT) we expressed in Sf9 insect cells an epitope-tagged version of the transporter containing a FLAG epitope at the N-terminus and a polyhistidine tail at the C-terminus (FLAG-hSERT-12H). (
  • CONCLUSIONS: Disturbances in serotonin transporter binding and post-synaptic 5-HT receptor function seem to be associated in cocaine-dependent subjects. (
  • There was no increase in the steady-state levels of the serotonin transporter mRNA when cells were treated with herbimycin A in the presence of actinomycin D. The herbimycin A-induced increase in the transporter activity was abolished by genistein, another inhibitor of tyrosine kinases. (
  • Treatment of cells with herbimycin A resulted in an increase in the tyrosine phosphorylation of specific cellular proteins, suggesting that herbimycin A directly or indirectly activates specific tyrosine kinases. (
  • It is likely that under chronic stress or depression, the capacity for increase in serotonin transporter has reached its limit due to the chronically elevated blood cortisol level. (
  • CONCLUSIONS: The 5-HTTLPR moderates cardiovascular reactivity to stress in a threatening evaluative social context, which suggests that the serotonin system may be involved in the processes by which stressful, conflict-ridden social environments affect risk for cardiovascular-related health outcomes. (
  • Serotonin transporter (5-HTT) expression patterns may contribute to the risk for adverse psychological outcomes following early life stress. (
  • Serotonin [i.e., 5-hydroxytryptamine (5-HT)]-targeted antidepressants are in wide use for the treatment of mood disorders, although many patients do not show a response or experience unpleasant side effects. (
  • Enhancement of 5-hydroxytryptamine (5-HT, serotonin) neurotransmission is a viable means of treating depression. (