The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.
The sequential correspondence of nucleotides in one nucleic acid molecule with those of another nucleic acid molecule. Sequence homology is an indication of the genetic relatedness of different organisms and gene function.
The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.
The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.
The degree of similarity between sequences. Studies of AMINO ACID SEQUENCE HOMOLOGY and NUCLEIC ACID SEQUENCE HOMOLOGY provide useful information about the genetic relatedness of genes, gene products, and species.
The arrangement of two or more amino acid or base sequences from an organism or organisms in such a way as to align areas of the sequences sharing common properties. The degree of relatedness or homology between the sequences is predicted computationally or statistically based on weights assigned to the elements aligned between the sequences. This in turn can serve as a potential indicator of the genetic relatedness between the organisms.
A category of nucleic acid sequences that function as units of heredity and which code for the basic instructions for the development, reproduction, and maintenance of organisms.
Widely used technique which exploits the ability of complementary sequences in single-stranded DNAs or RNAs to pair with each other to form a double helix. Hybridization can take place between two complimentary DNA sequences, between a single-stranded DNA and a complementary RNA, or between two RNA sequences. The technique is used to detect and isolate specific sequences, measure homology, or define other characteristics of one or both strands. (Kendrew, Encyclopedia of Molecular Biology, 1994, p503)
A deoxyribonucleotide polymer that is the primary genetic material of all cells. Eukaryotic and prokaryotic organisms normally contain DNA in a double-stranded state, yet several important biological processes transiently involve single-stranded regions. DNA, which consists of a polysugar-phosphate backbone possessing projections of purines (adenine and guanine) and pyrimidines (thymine and cytosine), forms a double helix that is held together by hydrogen bonds between these purines and pyrimidines (adenine to thymine and guanine to cytosine).
Single-stranded complementary DNA synthesized from an RNA template by the action of RNA-dependent DNA polymerase. cDNA (i.e., complementary DNA, not circular DNA, not C-DNA) is used in a variety of molecular cloning experiments as well as serving as a specific hybridization probe.
A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.
Enzymes that are part of the restriction-modification systems. They catalyze the endonucleolytic cleavage of DNA sequences which lack the species-specific methylation pattern in the host cell's DNA. Cleavage yields random or specific double-stranded fragments with terminal 5'-phosphates. The function of restriction enzymes is to destroy any foreign DNA that invades the host cell. Most have been studied in bacterial systems, but a few have been found in eukaryotic organisms. They are also used as tools for the systematic dissection and mapping of chromosomes, in the determination of base sequences of DNAs, and have made it possible to splice and recombine genes from one organism into the genome of another. EC 3.21.1.
Use of restriction endonucleases to analyze and generate a physical map of genomes, genes, or other segments of DNA.
The functional hereditary units of BACTERIA.
The degree of 3-dimensional shape similarity between proteins. It can be an indication of distant AMINO ACID SEQUENCE HOMOLOGY and used for rational DRUG DESIGN.
Regions of AMINO ACID SEQUENCE similarity in the SRC-FAMILY TYROSINE KINASES that fold into specific functional tertiary structures. The SH1 domain is a CATALYTIC DOMAIN. SH2 and SH3 domains are protein interaction domains. SH2 usually binds PHOSPHOTYROSINE-containing proteins and SH3 interacts with CYTOSKELETAL PROTEINS.
The parts of a macromolecule that directly participate in its specific combination with another molecule.
Extrachromosomal, usually CIRCULAR DNA molecules that are self-replicating and transferable from one organism to another. They are found in a variety of bacterial, archaeal, fungal, algal, and plant species. They are used in GENETIC ENGINEERING as CLONING VECTORS.
The restriction of a characteristic behavior, anatomical structure or physical system, such as immune response; metabolic response, or gene or gene variant to the members of one species. It refers to that property which differentiates one species from another but it is also used for phylogenetic levels higher or lower than the species.
A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.
The level of protein structure in which combinations of secondary protein structures (alpha helices, beta sheets, loop regions, and motifs) pack together to form folded shapes called domains. Disulfide bridges between cysteines in two different parts of the polypeptide chain along with other interactions between the chains play a role in the formation and stabilization of tertiary structure. Small proteins usually consist of only one domain but larger proteins may contain a number of domains connected by segments of polypeptide chain which lack regular secondary structure.
Models used experimentally or theoretically to study molecular shape, electronic properties, or interactions; includes analogous molecules, computer-generated graphics, and mechanical structures.
Proteins found in any species of bacterium.
The relationships of groups of organisms as reflected by their genetic makeup.
RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.
A sequence of successive nucleotide triplets that are read as CODONS specifying AMINO ACIDS and begin with an INITIATOR CODON and end with a stop codon (CODON, TERMINATOR).
Deoxyribonucleic acid that makes up the genetic material of bacteria.
The characteristic 3-dimensional shape of a protein, including the secondary, supersecondary (motifs), tertiary (domains) and quaternary structure of the peptide chain. PROTEIN STRUCTURE, QUATERNARY describes the conformation assumed by multimeric proteins (aggregates of more than one polypeptide chain).
The process in which substances, either endogenous or exogenous, bind to proteins, peptides, enzymes, protein precursors, or allied compounds. Specific protein-binding measures are often used as assays in diagnostic assessments.
Proteins prepared by recombinant DNA technology.
The biosynthesis of RNA carried out on a template of DNA. The biosynthesis of DNA from an RNA template is called REVERSE TRANSCRIPTION.
A large collection of DNA fragments cloned (CLONING, MOLECULAR) from a given organism, tissue, organ, or cell type. It may contain complete genomic sequences (GENOMIC LIBRARY) or complementary DNA sequences, the latter being formed from messenger RNA and lacking intron sequences.
A set of genes descended by duplication and variation from some ancestral gene. Such genes may be clustered together on the same chromosome or dispersed on different chromosomes. Examples of multigene families include those that encode the hemoglobins, immunoglobulins, histocompatibility antigens, actins, tubulins, keratins, collagens, heat shock proteins, salivary glue proteins, chorion proteins, cuticle proteins, yolk proteins, and phaseolins, as well as histones, ribosomal RNA, and transfer RNA genes. The latter three are examples of reiterated genes, where hundreds of identical genes are present in a tandem array. (King & Stanfield, A Dictionary of Genetics, 4th ed)
The sum of the weight of all the atoms in a molecule.
Established cell cultures that have the potential to propagate indefinitely.
A sequence of amino acids in a polypeptide or of nucleotides in DNA or RNA that is similar across multiple species. A known set of conserved sequences is represented by a CONSENSUS SEQUENCE. AMINO ACID MOTIFS are often composed of conserved sequences.
Transport proteins that carry specific substances in the blood or across cell membranes.
Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.
A characteristic feature of enzyme activity in relation to the kind of substrate on which the enzyme or catalytic molecule reacts.
Sequences of DNA or RNA that occur in multiple copies. There are several types: INTERSPERSED REPETITIVE SEQUENCES are copies of transposable elements (DNA TRANSPOSABLE ELEMENTS or RETROELEMENTS) dispersed throughout the genome. TERMINAL REPEAT SEQUENCES flank both ends of another sequence, for example, the long terminal repeats (LTRs) on RETROVIRUSES. Variations may be direct repeats, those occurring in the same direction, or inverted repeats, those opposite to each other in direction. TANDEM REPEAT SEQUENCES are copies which lie adjacent to each other, direct or inverted (INVERTED REPEAT SEQUENCES).
Any method used for determining the location of and relative distances between genes on a chromosome.
The functional hereditary units of VIRUSES.
In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships.
Recombinant proteins produced by the GENETIC TRANSLATION of fused genes formed by the combination of NUCLEIC ACID REGULATORY SEQUENCES of one or more genes with the protein coding sequences of one or more genes.
Partial proteins formed by partial hydrolysis of complete proteins or generated through PROTEIN ENGINEERING techniques.
A method (first developed by E.M. Southern) for detection of DNA that has been electrophoretically separated and immobilized by blotting on nitrocellulose or other type of paper or nylon membrane followed by hybridization with labeled NUCLEIC ACID PROBES.
Short sequences (generally about 10 base pairs) of DNA that are complementary to sequences of messenger RNA and allow reverse transcriptases to start copying the adjacent sequences of mRNA. Primers are used extensively in genetic and molecular biology techniques.
Linear POLYPEPTIDES that are synthesized on RIBOSOMES and may be further modified, crosslinked, cleaved, or assembled into complex proteins with several subunits. The specific sequence of AMINO ACIDS determines the shape the polypeptide will take, during PROTEIN FOLDING, and the function of the protein.
Detection of RNA that has been electrophoretically separated and immobilized by blotting on nitrocellulose or other type of paper or nylon membrane followed by hybridization with labeled NUCLEIC ACID PROBES.
The process of cumulative change over successive generations through which organisms acquire their distinguishing morphological and physiological characteristics.
The level of protein structure in which regular hydrogen-bond interactions within contiguous stretches of polypeptide chain give rise to alpha helices, beta strands (which align to form beta sheets) or other types of coils. This is the first folding level of protein conformation.
A species of the genus SACCHAROMYCES, family Saccharomycetaceae, order Saccharomycetales, known as "baker's" or "brewer's" yeast. The dried form is used as a dietary supplement.
Proteins which are found in membranes including cellular and intracellular membranes. They consist of two types, peripheral and integral proteins. They include most membrane-associated enzymes, antigenic proteins, transport proteins, and drug, hormone, and lectin receptors.
Electrophoresis in which a polyacrylamide gel is used as the diffusion medium.
Deoxyribonucleic acid that makes up the genetic material of viruses.
The spatial arrangement of the atoms of a nucleic acid or polynucleotide that results in its characteristic 3-dimensional shape.
Proteins which bind to DNA. The family includes proteins which bind to both double- and single-stranded DNA and also includes specific DNA binding proteins in serum which can be used as markers for malignant diseases.
Proteins found in any species of virus.
Members of the class of compounds composed of AMINO ACIDS joined together by peptide bonds between adjacent amino acids into linear, branched or cyclical structures. OLIGOPEPTIDES are composed of approximately 2-12 amino acids. Polypeptides are composed of approximately 13 or more amino acids. PROTEINS are linear polypeptides that are normally synthesized on RIBOSOMES.
Domesticated bovine animals of the genus Bos, usually kept on a farm or ranch and used for the production of meat or dairy products or for heavy labor.
Proteins found in plants (flowers, herbs, shrubs, trees, etc.). The concept does not include proteins found in vegetables for which VEGETABLE PROTEINS is available.
The rate dynamics in chemical or physical systems.
A test used to determine whether or not complementation (compensation in the form of dominance) will occur in a cell with a given mutant phenotype when another mutant genome, encoding the same mutant phenotype, is introduced into that cell.
The uptake of naked or purified DNA by CELLS, usually meaning the process as it occurs in eukaryotic cells. It is analogous to bacterial transformation (TRANSFORMATION, BACTERIAL) and both are routinely employed in GENE TRANSFER TECHNIQUES.
The study of crystal structure using X-RAY DIFFRACTION techniques. (McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)
The phenotypic manifestation of a gene or genes by the processes of GENETIC TRANSCRIPTION and GENETIC TRANSLATION.
DNA sequences which are recognized (directly or indirectly) and bound by a DNA-dependent RNA polymerase during the initiation of transcription. Highly conserved sequences within the promoter include the Pribnow box in bacteria and the TATA BOX in eukaryotes.
The relationship between the chemical structure of a compound and its biological or pharmacological activity. Compounds are often classed together because they have structural characteristics in common including shape, size, stereochemical arrangement, and distribution of functional groups.
A polynucleotide consisting essentially of chains with a repeating backbone of phosphate and ribose units to which nitrogenous bases are attached. RNA is unique among biological macromolecules in that it can encode genetic information, serve as an abundant structural component of cells, and also possesses catalytic activity. (Rieger et al., Glossary of Genetics: Classical and Molecular, 5th ed)
Genetically engineered MUTAGENESIS at a specific site in the DNA molecule that introduces a base substitution, or an insertion or deletion.
Biologically active DNA which has been formed by the in vitro joining of segments of DNA from different sources. It includes the recombination joint or edge of a heteroduplex region where two recombining DNA molecules are connected.
The functional hereditary units of FUNGI.
Proteins found in any species of fungus.
Multicellular, eukaryotic life forms of kingdom Plantae (sensu lato), comprising the VIRIDIPLANTAE; RHODOPHYTA; and GLAUCOPHYTA; all of which acquired chloroplasts by direct endosymbiosis of CYANOBACTERIA. They are characterized by a mainly photosynthetic mode of nutrition; essentially unlimited growth at localized regions of cell divisions (MERISTEMS); cellulose within cells providing rigidity; the absence of organs of locomotion; absence of nervous and sensory systems; and an alternation of haploid and diploid generations.
Discrete segments of DNA which can excise and reintegrate to another site in the genome. Most are inactive, i.e., have not been found to exist outside the integrated state. DNA transposable elements include bacterial IS (insertion sequence) elements, Tn elements, the maize controlling elements Ac and Ds, Drosophila P, gypsy, and pogo elements, the human Tigger elements and the Tc and mariner elements which are found throughout the animal kingdom.
Serological reactions in which an antiserum against one antigen reacts with a non-identical but closely related antigen.
A serine endopeptidase that is formed from TRYPSINOGEN in the pancreas. It is converted into its active form by ENTEROPEPTIDASE in the small intestine. It catalyzes hydrolysis of the carboxyl group of either arginine or lysine. EC 3.4.21.4.
Production of new arrangements of DNA by various mechanisms such as assortment and segregation, CROSSING OVER; GENE CONVERSION; GENETIC TRANSFORMATION; GENETIC CONJUGATION; GENETIC TRANSDUCTION; or mixed infection of viruses.
Cyanogen bromide (CNBr). A compound used in molecular biology to digest some proteins and as a coupling reagent for phosphoroamidate or pyrophosphate internucleotide bonds in DNA duplexes.
Compounds and molecular complexes that consist of very large numbers of atoms and are generally over 500 kDa in size. In biological systems macromolecular substances usually can be visualized using ELECTRON MICROSCOPY and are distinguished from ORGANELLES by the lack of a membrane structure.
Endogenous substances, usually proteins, which are effective in the initiation, stimulation, or termination of the genetic transcription process.
A theoretical representative nucleotide or amino acid sequence in which each nucleotide or amino acid is the one which occurs most frequently at that site in the different sequences which occur in nature. The phrase also refers to an actual sequence which approximates the theoretical consensus. A known CONSERVED SEQUENCE set is represented by a consensus sequence. Commonly observed supersecondary protein structures (AMINO ACID MOTIFS) are often formed by conserved sequences.
A process that includes the determination of AMINO ACID SEQUENCE of a protein (or peptide, oligopeptide or peptide fragment) and the information analysis of the sequence.
Ribonucleic acid that makes up the genetic material of viruses.
A multistage process that includes the determination of a sequence (protein, carbohydrate, etc.), its fragmentation and analysis, and the interpretation of the resulting sequence information.
Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control (induction or repression) of gene action at the level of transcription or translation.
Commonly observed structural components of proteins formed by simple combinations of adjacent secondary structures. A commonly observed structure may be composed of a CONSERVED SEQUENCE which can be represented by a CONSENSUS SEQUENCE.
Organic compounds that generally contain an amino (-NH2) and a carboxyl (-COOH) group. Twenty alpha-amino acids are the subunits which are polymerized to form proteins.
CELL LINES derived from the CV-1 cell line by transformation with a replication origin defective mutant of SV40 VIRUS, which codes for wild type large T antigen (ANTIGENS, POLYOMAVIRUS TRANSFORMING). They are used for transfection and cloning. (The CV-1 cell line was derived from the kidney of an adult male African green monkey (CERCOPITHECUS AETHIOPS).)
Synthetic or natural oligonucleotides used in hybridization studies in order to identify and study specific nucleic acid fragments, e.g., DNA segments near or within a specific gene locus or gene. The probe hybridizes with a specific mRNA, if present. Conventional techniques used for testing for the hybridization product include dot blot assays, Southern blot assays, and DNA:RNA hybrid-specific antibody tests. Conventional labels for the probe include the radioisotope labels 32P and 125I and the chemical label biotin.
In bacteria, a group of metabolically related genes, with a common promoter, whose transcription into a single polycistronic MESSENGER RNA is under the control of an OPERATOR REGION.
Two-dimensional separation and analysis of nucleotides.
Common name for the species Gallus gallus, the domestic fowl, in the family Phasianidae, order GALLIFORMES. It is descended from the red jungle fowl of SOUTHEAST ASIA.
The biosynthesis of PEPTIDES and PROTEINS on RIBOSOMES, directed by MESSENGER RNA, via TRANSFER RNA that is charged with standard proteinogenic AMINO ACIDS.
Proteins obtained from the species SACCHAROMYCES CEREVISIAE. The function of specific proteins from this organism are the subject of intense scientific interest and have been used to derive basic understanding of the functioning similar proteins in higher eukaryotes.
Proteins found in the nucleus of a cell. Do not confuse with NUCLEOPROTEINS which are proteins conjugated with nucleic acids, that are not necessarily present in the nucleus.
The process of cumulative change at the level of DNA; RNA; and PROTEINS, over successive generations.
Family of RNA viruses that infects birds and mammals and encodes the enzyme reverse transcriptase. The family contains seven genera: DELTARETROVIRUS; LENTIVIRUS; RETROVIRUSES TYPE B, MAMMALIAN; ALPHARETROVIRUS; GAMMARETROVIRUS; RETROVIRUSES TYPE D; and SPUMAVIRUS. A key feature of retrovirus biology is the synthesis of a DNA copy of the genome which is integrated into cellular DNA. After integration it is sometimes not expressed but maintained in a latent state (PROVIRUSES).
A set of three nucleotides in a protein coding sequence that specifies individual amino acids or a termination signal (CODON, TERMINATOR). Most codons are universal, but some organisms do not produce the transfer RNAs (RNA, TRANSFER) complementary to all codons. These codons are referred to as unassigned codons (CODONS, NONSENSE).
Proteins obtained from ESCHERICHIA COLI.
The first continuously cultured human malignant CELL LINE, derived from the cervical carcinoma of Henrietta Lacks. These cells are used for VIRUS CULTIVATION and antitumor drug screening assays.
Deletion of sequences of nucleic acids from the genetic material of an individual.
Viruses parasitic on plants higher than bacteria.
Liquid chromatographic techniques which feature high inlet pressures, high sensitivity, and high speed.
Proteins that are present in blood serum, including SERUM ALBUMIN; BLOOD COAGULATION FACTORS; and many other types of proteins.
Characteristic restricted to a particular organ of the body, such as a cell type, metabolic response or expression of a particular protein or antigen.
The species Oryctolagus cuniculus, in the family Leporidae, order LAGOMORPHA. Rabbits are born in burrows, furless, and with eyes and ears closed. In contrast with HARES, rabbits have 22 chromosome pairs.
Process of generating a genetic MUTATION. It may occur spontaneously or be induced by MUTAGENS.
A group of adenine ribonucleotides in which the phosphate residues of each adenine ribonucleotide act as bridges in forming diester linkages between the ribose moieties.
The region of an enzyme that interacts with its substrate to cause the enzymatic reaction.
Genes which regulate or circumscribe the activity of other genes; specifically, genes which code for PROTEINS or RNAs which have GENE EXPRESSION REGULATION functions.
Deoxyribonucleic acid that makes up the genetic material of fungi.
A species of fruit fly much used in genetics because of the large size of its chromosomes.
Accumulation of a drug or chemical substance in various organs (including those not relevant to its pharmacologic or therapeutic action). This distribution depends on the blood flow or perfusion rate of the organ, the ability of the drug to penetrate organ membranes, tissue specificity, protein binding. The distribution is usually expressed as tissue to plasma ratios.
The most abundant form of RNA. Together with proteins, it forms the ribosomes, playing a structural role and also a role in ribosomal binding of mRNA and tRNAs. Individual chains are conventionally designated by their sedimentation coefficients. In eukaryotes, four large chains exist, synthesized in the nucleolus and constituting about 50% of the ribosome. (Dorland, 28th ed)
The relative amounts of the PURINES and PYRIMIDINES in a nucleic acid.
A subclass of PEPTIDE HYDROLASES that catalyze the internal cleavage of PEPTIDES or PROTEINS.
The facilitation of a chemical reaction by material (catalyst) that is not consumed by the reaction.
Identification of proteins or peptides that have been electrophoretically separated by blot transferring from the electrophoresis gel to strips of nitrocellulose paper, followed by labeling with antibody probes.
The outward appearance of the individual. It is the product of interactions between genes, and between the GENOTYPE and the environment.
A form of GENE LIBRARY containing the complete DNA sequences present in the genome of a given organism. It contrasts with a cDNA library which contains only sequences utilized in protein coding (lacking introns).
The process by which two molecules of the same chemical composition form a condensation product or polymer.
Any of the processes by which cytoplasmic or intercellular factors influence the differential control of gene action in bacteria.
Any member of the group of ENDOPEPTIDASES containing at the active site a serine residue involved in catalysis.
Conjugated protein-carbohydrate compounds including mucins, mucoid, and amyloid glycoproteins.
A group of deoxyribonucleotides (up to 12) in which the phosphate residues of each deoxyribonucleotide act as bridges in forming diester linkages between the deoxyribose moieties.
The intracellular transfer of information (biological activation/inhibition) through a signal pathway. In each signal transduction system, an activation/inhibition signal from a biologically active molecule (hormone, neurotransmitter) is mediated via the coupling of a receptor/enzyme to a second messenger system or to an ion channel. Signal transduction plays an important role in activating cellular functions, cell differentiation, and cell proliferation. Examples of signal transduction systems are the GAMMA-AMINOBUTYRIC ACID-postsynaptic receptor-calcium ion channel system, the receptor-mediated T-cell activation pathway, and the receptor-mediated activation of phospholipases. Those coupled to membrane depolarization or intracellular release of calcium include the receptor-mediated activation of cytotoxic functions in granulocytes and the synaptic potentiation of protein kinase activation. Some signal transduction pathways may be part of larger signal transduction pathways; for example, protein kinase activation is part of the platelet activation signal pathway.
Sequences of DNA in the genes that are located between the EXONS. They are transcribed along with the exons but are removed from the primary gene transcript by RNA SPLICING to leave mature RNA. Some introns code for separate genes.
A subfamily in the family MURIDAE, comprising the hamsters. Four of the more common genera are Cricetus, CRICETULUS; MESOCRICETUS; and PHODOPUS.
The functional hereditary units of PLANTS.
The parts of a transcript of a split GENE remaining after the INTRONS are removed. They are spliced together to become a MESSENGER RNA or other functional RNA.
Sites on an antigen that interact with specific antibodies.
Cells propagated in vitro in special media conducive to their growth. Cultured cells are used to study developmental, morphologic, metabolic, physiologic, and genetic processes, among others.
Mutagenesis where the mutation is caused by the introduction of foreign DNA sequences into a gene or extragenic sequence. This may occur spontaneously in vivo or be experimentally induced in vivo or in vitro. Proviral DNA insertions into or adjacent to a cellular proto-oncogene can interrupt GENETIC TRANSLATION of the coding sequences or interfere with recognition of regulatory elements and cause unregulated expression of the proto-oncogene resulting in tumor formation.
The complete genetic complement contained in a DNA or RNA molecule in a virus.
The introduction of a phosphoryl group into a compound through the formation of an ester bond between the compound and a phosphorus moiety.
Proteins to which calcium ions are bound. They can act as transport proteins, regulator proteins, or activator proteins. They typically contain EF HAND MOTIFS.
A field of biology concerned with the development of techniques for the collection and manipulation of biological data, and the use of such data to make biological discoveries or predictions. This field encompasses all computational methods and theories for solving biological problems including manipulation of models and datasets.
A serine endopeptidase secreted by the pancreas as its zymogen, CHYMOTRYPSINOGEN and carried in the pancreatic juice to the duodenum where it is activated by TRYPSIN. It selectively cleaves aromatic amino acids on the carboxyl side.
Processes involved in the formation of TERTIARY PROTEIN STRUCTURE.
A genus of gram-negative, aerobic, rod-shaped bacteria that activate PLANT ROOT NODULATION in leguminous plants. Members of this genus are nitrogen-fixing and common soil inhabitants.
Plants whose roots, leaves, seeds, bark, or other constituent parts possess therapeutic, tonic, purgative, curative or other pharmacologic attributes, when administered to man or animals.
A broad category of carrier proteins that play a role in SIGNAL TRANSDUCTION. They generally contain several modular domains, each of which having its own binding activity, and act by forming complexes with other intracellular-signaling molecules. Signal-transducing adaptor proteins lack enzyme activity, however their activity can be modulated by other signal-transducing enzymes
A transferase that catalyzes the addition of aliphatic, aromatic, or heterocyclic FREE RADICALS as well as EPOXIDES and arene oxides to GLUTATHIONE. Addition takes place at the SULFUR. It also catalyzes the reduction of polyol nitrate by glutathione to polyol and nitrite.
A molecule that binds to another molecule, used especially to refer to a small molecule that binds specifically to a larger molecule, e.g., an antigen binding to an antibody, a hormone or neurotransmitter binding to a receptor, or a substrate or allosteric effector binding to an enzyme. Ligands are also molecules that donate or accept a pair of electrons to form a coordinate covalent bond with the central metal atom of a coordination complex. (From Dorland, 27th ed)
A genetic rearrangement through loss of segments of DNA or RNA, bringing sequences which are normally separated into close proximity. This deletion may be detected using cytogenetic techniques and can also be inferred from the phenotype, indicating a deletion at one specific locus.
The lipid- and protein-containing, selectively permeable membrane that surrounds the cytoplasm in prokaryotic and eukaryotic cells.
A large lobed glandular organ in the abdomen of vertebrates that is responsible for detoxification, metabolism, synthesis and storage of various substances.
A species of gram-positive bacteria that is a common soil and water saprophyte.
Structurally related forms of an enzyme. Each isoenzyme has the same mechanism and classification, but differs in its chemical, physical, or immunological characteristics.
Any of various animals that constitute the family Suidae and comprise stout-bodied, short-legged omnivorous mammals with thick skin, usually covered with coarse bristles, a rather long mobile snout, and small tail. Included are the genera Babyrousa, Phacochoerus (wart hogs), and Sus, the latter containing the domestic pig (see SUS SCROFA).
A genus of small, two-winged flies containing approximately 900 described species. These organisms are the most extensively studied of all genera from the standpoint of genetics and cytology.
The reformation of all, or part of, the native conformation of a nucleic acid molecule after the molecule has undergone denaturation.
Glycoproteins found on the membrane or surface of cells.
Cells grown in vitro from neoplastic tissue. If they can be established as a TUMOR CELL LINE, they can be propagated in cell culture indefinitely.
The commonest and widest ranging species of the clawed "frog" (Xenopus) in Africa. This species is used extensively in research. There is now a significant population in California derived from escaped laboratory animals.
A species of CERCOPITHECUS containing three subspecies: C. tantalus, C. pygerythrus, and C. sabeus. They are found in the forests and savannah of Africa. The African green monkey (C. pygerythrus) is the natural host of SIMIAN IMMUNODEFICIENCY VIRUS and is used in AIDS research.
A change from planar to elliptic polarization when an initially plane-polarized light wave traverses an optically active medium. (McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)
Amino acid sequences found in transported proteins that selectively guide the distribution of the proteins to specific cellular compartments.
Analysis of PEPTIDES that are generated from the digestion or fragmentation of a protein or mixture of PROTEINS, by ELECTROPHORESIS; CHROMATOGRAPHY; or MASS SPECTROMETRY. The resulting peptide fingerprints are analyzed for a variety of purposes including the identification of the proteins in a sample, GENETIC POLYMORPHISMS, patterns of gene expression, and patterns diagnostic for diseases.
Sequential operating programs and data which instruct the functioning of a digital computer.
Within a eukaryotic cell, a membrane-limited body which contains chromosomes and one or more nucleoli (CELL NUCLEOLUS). The nuclear membrane consists of a double unit-type membrane which is perforated by a number of pores; the outermost membrane is continuous with the ENDOPLASMIC RETICULUM. A cell may contain more than one nucleus. (From Singleton & Sainsbury, Dictionary of Microbiology and Molecular Biology, 2d ed)
Warm-blooded vertebrate animals belonging to the class Mammalia, including all that possess hair and suckle their young.
A plant genus of the family BRASSICACEAE that contains ARABIDOPSIS PROTEINS and MADS DOMAIN PROTEINS. The species A. thaliana is used for experiments in classical plant genetics as well as molecular genetic studies in plant physiology, biochemistry, and development.
The process of cleaving a chemical compound by the addition of a molecule of water.
Proteins isolated from the outer membrane of Gram-negative bacteria.
Enzymes that catalyze the hydrolysis of ester bonds within RNA. EC 3.1.-.
Species- or subspecies-specific DNA (including COMPLEMENTARY DNA; conserved genes, whole chromosomes, or whole genomes) used in hybridization studies in order to identify microorganisms, to measure DNA-DNA homologies, to group subspecies, etc. The DNA probe hybridizes with a specific mRNA, if present. Conventional techniques used for testing for the hybridization product include dot blot assays, Southern blot assays, and DNA:RNA hybrid-specific antibody tests. Conventional labels for the DNA probe include the radioisotope labels 32P and 125I and the chemical label biotin. The use of DNA probes provides a specific, sensitive, rapid, and inexpensive replacement for cell culture techniques for diagnosing infections.
Immunologic method used for detecting or quantifying immunoreactive substances. The substance is identified by first immobilizing it by blotting onto a membrane and then tagging it with labeled antibodies.
The large family of plants characterized by pods. Some are edible and some cause LATHYRISM or FAVISM and other forms of poisoning. Other species yield useful materials like gums from ACACIA and various LECTINS like PHYTOHEMAGGLUTININS from PHASEOLUS. Many of them harbor NITROGEN FIXATION bacteria on their roots. Many but not all species of "beans" belong to this family.
Chromatography on non-ionic gels without regard to the mechanism of solute discrimination.
Proteins found in any species of insect.
A thiol-containing non-essential amino acid that is oxidized to form CYSTINE.
Proteins that originate from insect species belonging to the genus DROSOPHILA. The proteins from the most intensely studied species of Drosophila, DROSOPHILA MELANOGASTER, are the subject of much interest in the area of MORPHOGENESIS and development.
A variation of the PCR technique in which cDNA is made from RNA via reverse transcription. The resultant cDNA is then amplified using standard PCR protocols.
Serologic tests in which a positive reaction manifested by visible CHEMICAL PRECIPITATION occurs when a soluble ANTIGEN reacts with its precipitins, i.e., ANTIBODIES that can form a precipitate.
Partial cDNA (DNA, COMPLEMENTARY) sequences that are unique to the cDNAs from which they were derived.
DNA sequences encoding RIBOSOMAL RNA and the segments of DNA separating the individual ribosomal RNA genes, referred to as RIBOSOMAL SPACER DNA.
Cell lines whose original growing procedure consisted being transferred (T) every 3 days and plated at 300,000 cells per plate (J Cell Biol 17:299-313, 1963). Lines have been developed using several different strains of mice. Tissues are usually fibroblasts derived from mouse embryos but other types and sources have been developed as well. The 3T3 lines are valuable in vitro host systems for oncogenic virus transformation studies, since 3T3 cells possess a high sensitivity to CONTACT INHIBITION.
A technique that localizes specific nucleic acid sequences within intact chromosomes, eukaryotic cells, or bacterial cells through the use of specific nucleic acid-labeled probes.
Proteins that share the common characteristic of binding to carbohydrates. Some ANTIBODIES and carbohydrate-metabolizing proteins (ENZYMES) also bind to carbohydrates, however they are not considered lectins. PLANT LECTINS are carbohydrate-binding proteins that have been primarily identified by their hemagglutinating activity (HEMAGGLUTININS). However, a variety of lectins occur in animal species where they serve diverse array of functions through specific carbohydrate recognition.
The class of all enzymes catalyzing oxidoreduction reactions. The substrate that is oxidized is regarded as a hydrogen donor. The systematic name is based on donor:acceptor oxidoreductase. The recommended name will be dehydrogenase, wherever this is possible; as an alternative, reductase can be used. Oxidase is only used in cases where O2 is the acceptor. (Enzyme Nomenclature, 1992, p9)
The normality of a solution with respect to HYDROGEN ions; H+. It is related to acidity measurements in most cases by pH = log 1/2[1/(H+)], where (H+) is the hydrogen ion concentration in gram equivalents per liter of solution. (McGraw-Hill Dictionary of Scientific and Technical Terms, 6th ed)
Enzyme systems containing a single subunit and requiring only magnesium for endonucleolytic activity. The corresponding modification methylases are separate enzymes. The systems recognize specific short DNA sequences and cleave either within, or at a short specific distance from, the recognition sequence to give specific double-stranded fragments with terminal 5'-phosphates. Enzymes from different microorganisms with the same specificity are called isoschizomers. EC 3.1.21.4.
Proteins secreted by the epididymal epithelium. These proteins are both tissue- and species-specific. They are important molecular agents in the process of sperm maturation.
Cell surface proteins that bind signalling molecules external to the cell with high affinity and convert this extracellular event into one or more intracellular signals that alter the behavior of the target cell (From Alberts, Molecular Biology of the Cell, 2nd ed, pp693-5). Cell surface receptors, unlike enzymes, do not chemically alter their ligands.
An aquatic genus of the family, Pipidae, occurring in Africa and distinguished by having black horny claws on three inner hind toes.
Theoretical representations that simulate the behavior or activity of genetic processes or phenomena. They include the use of mathematical equations, computers, and other electronic equipment.
Proteins which are synthesized in eukaryotic organisms and bacteria in response to hyperthermia and other environmental stresses. They increase thermal tolerance and perform functions essential to cell survival under these conditions.
Presence of warmth or heat or a temperature notably higher than an accustomed norm.
A family of double-stranded DNA viruses infecting mammals (including humans), birds and insects. There are two subfamilies: CHORDOPOXVIRINAE, poxviruses of vertebrates, and ENTOMOPOXVIRINAE, poxviruses of insects.
Proteins which maintain the transcriptional quiescence of specific GENES or OPERONS. Classical repressor proteins are DNA-binding proteins that are normally bound to the OPERATOR REGION of an operon, or the ENHANCER SEQUENCES of a gene until a signal occurs that causes their release.
Chemical groups containing the covalent disulfide bonds -S-S-. The sulfur atoms can be bound to inorganic or organic moieties.
A chromatographic technique that utilizes the ability of biological molecules to bind to certain ligands specifically and reversibly. It is used in protein biochemistry. (McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)
Proteins that bind to RNA molecules. Included here are RIBONUCLEOPROTEINS and other proteins whose function is to bind specifically to RNA.
The naturally occurring or experimentally induced replacement of one or more AMINO ACIDS in a protein with another. If a functionally equivalent amino acid is substituted, the protein may retain wild-type activity. Substitution may also diminish, enhance, or eliminate protein function. Experimentally induced substitution is often used to study enzyme activities and binding site properties.
The interaction of two or more substrates or ligands with the same binding site. The displacement of one by the other is used in quantitative and selective affinity measurements.

Characterization of an amphioxus paired box gene, AmphiPax2/5/8: developmental expression patterns in optic support cells, nephridium, thyroid-like structures and pharyngeal gill slits, but not in the midbrain-hindbrain boundary region. (1/2913)

On the basis of developmental gene expression, the vertebrate central nervous system comprises: a forebrain plus anterior midbrain, a midbrain-hindbrain boundary region (MHB) having organizer properties, and a rhombospinal domain. The vertebrate MHB is characterized by position, by organizer properties and by being the early site of action of Wnt1 and engrailed genes, and of genes of the Pax2/5/8 subfamily. Wada and others (Wada, H., Saiga, H., Satoh, N. and Holland, P. W. H. (1998) Development 125, 1113-1122) suggested that ascidian tunicates have a vertebrate-like MHB on the basis of ascidian Pax258 expression there. In another invertebrate chordate, amphioxus, comparable gene expression evidence for a vertebrate-like MHB is lacking. We, therefore, isolated and characterized AmphiPax2/5/8, the sole member of this subfamily in amphioxus. AmphiPax2/5/8 is initially expressed well back in the rhombospinal domain and not where a MHB would be expected. In contrast, most of the other expression domains of AmphiPax2/5/8 correspond to expression domains of vertebrate Pax2, Pax5 and Pax8 in structures that are probably homologous - support cells of the eye, nephridium, thyroid-like structures and pharyngeal gill slits; although AmphiPax2/5/8 is not transcribed in any structures that could be interpreted as homologues of vertebrate otic placodes or otic vesicles. In sum, the developmental expression of AmphiPax2/5/8 indicates that the amphioxus central nervous system lacks a MHB resembling the vertebrate isthmic region. Additional gene expression data for the developing ascidian and amphioxus nervous systems would help determine whether a MHB is a basal chordate character secondarily lost in amphioxus. The alternative is that the MHB is a vertebrate innovation.  (+info)

Conserved domains and lack of evidence for polyglutamine length polymorphism in the chicken homolog of the Machado-Joseph disease gene product ataxin-3. (2/2913)

Ataxin-3 is a protein of unknown function which is mutated in Machado-Joseph disease by expansion of a genetically unstable CAG repeat encoding polyglutamine. By analysis of chicken ataxin-3 we were able to identify four conserved domains of the protein and detected widespread expression in chicken tissues. In the first such analysis in a non-primate species we found that in contrast to primates, the chicken CAG repeat is short and genetically stable.  (+info)

Sequence analysis and expression of a mouse homolog of human IkappaBL gene. (3/2913)

The family of transcriptional inhibitors, IkappaBLs, are critical to the regulation of cytokine and chemokine production. We have identified the complete cDNA sequence of the mouse IkappabL gene. The predicted 381-amino-acid sequence showed evidence of two ankyrin repeats characteristic of Ikappab family proteins and 92% identity to the IkappaBL human homolog. Although human IkappaBL has been reported to be ubiquitously expressed, here we show that mouse IkappaBL is transcribed in a more tissue-specific manner.  (+info)

Canine preprorelaxin: nucleic acid sequence and localization within the canine placenta. (4/2913)

Employing uteroplacental tissue at Day 35 of gestation, we determined the nucleic acid sequence of canine preprorelaxin using reverse transcription- and rapid amplification of cDNA ends-polymerase chain reaction. Canine preprorelaxin cDNA consisted of 534 base pairs encoding a protein of 177 amino acids with a signal peptide of 25 amino acids (aa), a B domain of 35 aa, a C domain of 93 aa, and an A domain of 24 aa. The putative receptor binding region in the N'-terminal part of the canine relaxin B domain GRDYVR contained two substitutions from the classical motif (E-->D and L-->Y). Canine preprorelaxin shared highest homology with porcine and equine preprorelaxin. Northern analysis revealed a 1-kilobase transcript present in total RNA of canine uteroplacental tissue but not of kidney tissue. Uteroplacental tissue from two bitches each at Days 30 and 35 of gestation were studied by in situ hybridization to localize relaxin mRNA. Immunohistochemistry for relaxin, cytokeratin, vimentin, and von Willebrand factor was performed on uteroplacental tissue at Day 30 of gestation. The basal cell layer at the core of the chorionic villi was devoid of relaxin mRNA and immunoreactive relaxin or vimentin but was immunopositive for cytokeratin and identified as cytotrophoblast cells. The cell layer surrounding the chorionic villi displayed specific hybridization signals for relaxin mRNA and immunoreactivity for relaxin and cytokeratin but not for vimentin, and was identified as syncytiotrophoblast. Those areas of the chorioallantoic tissue with most intense relaxin immunoreactivity were highly vascularized as demonstrated by immunoreactive von Willebrand factor expressed on vascular endothelium. The uterine glands and nonplacental uterine areas of the canine zonary girdle placenta were devoid of relaxin mRNA and relaxin. We conclude that the syncytiotrophoblast is the source of relaxin in the canine placenta.  (+info)

Cloning, sequencing, and localization of bovine estrogen receptor-beta within the ovarian follicle. (5/2913)

The potential role of estrogen receptor-beta (ERbeta) in normal ovarian folliculogenesis and in reproductive disorders such as ovarian follicular cysts has not been well defined. Therefore, we were interested in cloning, sequencing, and localizing ERbeta mRNA and protein within the bovine ovary. Bovine ERbeta (bERbeta) was amplified by reverse transcription-polymerase chain reaction (RT-PCR), then cloned and sequenced. Results showed that the open reading frame of bERbeta cDNA spanned 1584 nucleotides encoding a protein of 527 amino acids. The N-terminal region of bERbeta was found to be 80% homologous to human and mouse ERbeta and 79% homologous to rat ERbeta. Bovine ERbeta DNA-binding domain was 100% homologous to human, mouse, and rat ERbeta sequences. The C-terminal/ligand-binding domain of bERbeta was 89% homologous to human, 86% homologous to mouse, and 88% homologous to rat ERbeta. Human and bovine ERbeta amino acid sequences are similar in that their coding region extended farther 5' than initially reported for the published rat ERbeta sequence. Using in situ hybridization and immunohistochemistry, ERbeta mRNA and protein, respectively, were demonstrated to be present in granulosa cells of antral follicles in various stages of follicular growth. These findings suggest a role for bERbeta in ovarian follicular growth and maturation.  (+info)

X inactive-specific transcript (Xist) expression and X chromosome inactivation in the preattachment bovine embryo. (6/2913)

Expression of the X inactive-specific transcript (Xist) is thought to be essential for the initiation of X chromosome inactivation and dosage compensation during female embryo development. In the present study, we analyzed the patterns of Xist transcription and the onset of X chromosome inactivation in bovine preattachment embryos. Reverse transcription-polymerase chain reaction (RT-PCR) revealed the presence of Xist transcripts in all adult female somatic tissues evaluated. In contrast, among the male tissues examined, Xist expression was detected only in testis. No evidence for Xist transcription was observed after a single round of RT-PCR from pools of in vitro-derived embryos at the 2- to 4-cell stage. Xist transcripts were detected as a faint amplicon at the 8-cell stage initially, and consistently thereafter in all stages examined up to and including the expanded blastocyst stage. Xist transcripts, however, were subsequently detected from the 2-cell stage onward after nested RT-PCR. Preferential [3H]thymidine labeling indicative of late replication of one of the X chromosomes was noted in female embryos of different developmental ages as follows: 2 of 7 (28.5%) early blastocysts, 6 of 13 (46.1%) blastocysts, 8 of 11 (72.1%) expanded blastocysts, and 14 of 17 (77.7%) hatched blastocysts. These results suggest that Xist expression precedes the onset of late replication in the bovine embryo, in a pattern compatible with a possible role of bovine Xist in the initiation of X chromosome inactivation.  (+info)

Pre-mRNA splicing of IgM exons M1 and M2 is directed by a juxtaposed splicing enhancer and inhibitor. (7/2913)

Splicing of certain pre-mRNA introns is dependent on an enhancer element, which is typically purine-rich. It is generally thought that enhancers increase the use of suboptimal splicing signals, and one specific proposal is that enhancers stabilize binding of U2AF65 to weak polypyrimidine (Py) tracts. Here, we test this model using an IgM pre-mRNA substrate, which contains a well-characterized enhancer. Although the enhancer was required for in vitro splicing, we found it had no effect on U2AF65 binding. Unexpectedly, replacement of the natural IgM Py tract, branchpoint, and 5' splice site with consensus splicing signals did not circumvent the enhancer requirement. These observations led us to identify a novel regulatory element within the IgM M2 exon that acts as a splicing inhibitor; removal of the inhibitor enabled splicing to occur in the absence of the enhancer. The IgM M2 splicing inhibitor is evolutionarily conserved, can inhibit the activity of an unrelated, constitutively spliced pre-mRNA, and acts by repressing splicing complex assembly. Interestingly, the inhibitor itself forms an ATP-dependent complex that contains U2 snRNP. We conclude that splicing of IgM exons M1 and M2 is directed by two juxtaposed regulatory elements-an enhancer and an inhibitor-and that a primary function of the enhancer is to counteract the inhibitor.  (+info)

Metabolic engineering of poly(3-hydroxyalkanoates): from DNA to plastic. (8/2913)

Poly(3-hydroxyalkanoates) (PHAs) are a class of microbially produced polyesters that have potential applications as conventional plastics, specifically thermoplastic elastomers. A wealth of biological diversity in PHA formation exists, with at least 100 different PHA constituents and at least five different dedicated PHA biosynthetic pathways. This diversity, in combination with classical microbial physiology and modern molecular biology, has now opened up this area for genetic and metabolic engineering to develop optimal PHA-producing organisms. Commercial processes for PHA production were initially developed by W. R. Grace in the 1960s and later developed by Imperial Chemical Industries, Ltd., in the United Kingdom in the 1970s and 1980s. Since the early 1990s, Metabolix Inc. and Monsanto have been the driving forces behind the commercial exploitation of PHA polymers in the United States. The gram-negative bacterium Ralstonia eutropha, formerly known as Alcaligenes eutrophus, has generally been used as the production organism of choice, and intracellular accumulation of PHA of over 90% of the cell dry weight have been reported. The advent of molecular biological techniques and a developing environmental awareness initiated a renewed scientific interest in PHAs, and the biosynthetic machinery for PHA metabolism has been studied in great detail over the last two decades. Because the structure and monomeric composition of PHAs determine the applications for each type of polymer, a variety of polymers have been synthesized by cofeeding of various substrates or by metabolic engineering of the production organism. Classical microbiology and modern molecular bacterial physiology have been brought together to decipher the intricacies of PHA metabolism both for production purposes and for the unraveling of the natural role of PHAs. This review provides an overview of the different PHA biosynthetic systems and their genetic background, followed by a detailed summation of how this natural diversity is being used to develop commercially attractive, recombinant processes for the large-scale production of PHAs.  (+info)

Ii. Was. On the nuva ring for two daysthe first two days. I had. Unprotected sex decided. That. I. Do want to become. Pregnant so I removed it two. Days later....two days after that I. Started.
As a busy, do-too-much, everyone-else-comes-first type of person, I learned the hard way that this kind of stress compromises both gut and health. It took ten years to perfect a healing approach that is less about food and more about how we manage our stress.... stress that impacts our digestion, and stress that we over-doers tend to bring on ourselves. We all need efficient and effective solutions that we can integrate today, so here are some simple tips of what to eat and do to bring enjoyment back to your eating and living!. ...
Large selection of options and best price offers on NUVA - M6 CABIN BLANCA (2019) from the owner of the vessel. Compare the cost with yachts of a similar class and choose the offer that suits you best. Price NUVA - M6 CABIN BLANCA (2019) in the YachtCharterInItalyYacht catalog from 334€ on Spain. Affordable yachts and motor boats for boat trips in the company of friends and comfortable family vacations
name: Add a Red Hat software channel community.general.rhn_channel: name: rhel-x86_64-server-v2vwin-6 sysname: server01 url: https://rhn.redhat.com/rpc/api user: rhnuser password: guessme delegate_to: localhost ...
Fingerprint Dive into the research topics of Cloning and characterization of a mouse brain calcitonin receptor complementary deoxyribonucleic acid and mapping of the calcitonin receptor gene. Together they form a unique fingerprint. ...
p>The checksum is a form of redundancy check that is calculated from the sequence. It is useful for tracking sequence updates.,/p> ,p>It should be noted that while, in theory, two different sequences could have the same checksum value, the likelihood that this would happen is extremely low.,/p> ,p>However UniProtKB may contain entries with identical sequences in case of multiple genes (paralogs).,/p> ,p>The checksum is computed as the sequence 64-bit Cyclic Redundancy Check value (CRC64) using the generator polynomial: x,sup>64,/sup> + x,sup>4,/sup> + x,sup>3,/sup> + x + 1. The algorithm is described in the ISO 3309 standard. ,/p> ,p class=publication>Press W.H., Flannery B.P., Teukolsky S.A. and Vetterling W.T.,br /> ,strong>Cyclic redundancy and other checksums,/strong>,br /> ,a href=http://www.nrbook.com/b/bookcpdf.php>Numerical recipes in C 2nd ed., pp896-902, Cambridge University Press (1993),/a>),/p> Checksum:i ...
Signal transductionRegulatory functionsDNA interactionstranscriptional regulator, Acidobacterial, PadR-family (TIGR03433; HMM-score: 14.4) ...
This material is exclusive to annual members of NutritionPro Mentor. If you are a member, please log in using the Log in tab in the top menu bar.. If you run into problems, please contact nutrition[at]marinarhn.ca.. Thank you.. ...
We are initiating our issuer credit rating for NuVasive NUVA at BBB-, reflecting its improving competitive position and cash flow trends. NuVasives Maximum
Oviduct-specific glycoprotein is a glycoprotein secreted by secretory epithelial cells of the oviduct (3) ; recently, we showed that it is ectopically expressed in ovarian cancer (9) . On the basis of the present study of normal, hyperplastic, and malignant endometrial tissues, it appears that a gain of oviduct-specific glycoprotein begins under conditions of unopposed estrogen exposure, which is a known risk factor for the development of endometrioid carcinoma.. Although oviduct-specific glycoprotein is not normally a secretory product of the normal endometrium, we observed focal staining of the stem cells in the basalis layer with some staining in adjacent glands in the functionalis layer (1) . The epithelial cells in the functionalis layer shed each month and regenerate during the next menstrual cycle through proliferation of epithelial cells in the intact basalis layer. It has been proposed that genetic alterations that induce endometrial cancer are acquired sequentially by the nonshedding ...
PubMed comprises more than 30 million citations for biomedical literature from MEDLINE, life science journals, and online books. Citations may include links to full-text content from PubMed Central and publisher web sites.
Thank you for sharing this Journal of Clinical Microbiology article.. NOTE: We request your email address only to inform the recipient that it was you who recommended this article, and that it is not junk mail. We do not retain these email addresses.. ...
1 Answer - Posted in: nuvaring, birth control, pregnancy - Answer: I think youll be okay ... if you are really worried do a pregnancy test ...
Kad jau grįžau savaitgaliui į Šakius, kad jau pagaliau nelyja ir lauke kažkas panašaus į vasarą, naudojuosi progą ir traukiu dviratį lauk. Kelinta diena nerimstu, kaip noooriu dviračių turo!. „Kautros klaidinančios reklamos paviliota. Iš pradžių susigundau, mano manymu, labai šaunia „Kautros akcija „Važiuok „Kautros tarpmiestiniu autobusu ir dviratį vežkis nemokamai . Tuoj susidėlioju maršrutą: autobusu nuvažiuoti iki Jurbarko, dviračiu pravažiuoti apie 50 km panemune Kauno kryptimi aplankant pilis, Vilkijoj persikelti keltu per Nemuną atgal į Šakių rajoną, dar 7 km numinti iki stotelės ir vėl autobusu grįžti į Šakius. Skamba šauniau nei šauniai! Nedelsdama patikrinu autobusų grafikus, įsitikinu, kad prie reikalingų maršrutų puikuojasi dviračių ženkliukai, ir jau trinu rankas įsivaizduodama, kaip bus smagu. Tik viena pastaba patraukia dėmesį: „Dviratininkai norintys važiuoti grupe, kur bus daugiau nei 3 dviračiai, pageidautina, ...
Talk Title: Pulse Azidohomoalanine (AHA) Labeling in Mammals (PALM) Analysis for Global Analysis of Newly-synthesized Proteins in Animal Models of Disease. VIEW MORE. ...
Detection of sequences that are homologous, i.e. descended from a common ancestor, is a fundamental task in computational biology. This task is confounded by low-complexity tracts (such as atatatatatat), which arise frequently and independently, causing strong similarities that are not homologies. There has been much research on identifying low-complexity tracts, but little research on how to treat them during homology search. We propose to find homologies by aligning sequences with
Adidas Stella Mccartney Fashion Shape BagThe adidas Stella Mccartney Fashion Shape Bag features adjustable, detachable straps. This gym bag has multiple zips and side pockets for optimal storage.FeaturesAdidas by Stella McCartney logo metal badgeDetachable, adjustable cross-body strapFront and side exterior zip pockets100% Polyester plain weaveZip main compartment
D-Cystine;CystineD-form;349-46-2;UNII-KX1RHN0Y0B;KX1RHN0Y0B;(S,S)-3,3-Dithiobis(2-aminopropionicacid);(2S,2S)-3,3-dithiobis(2-aminopropanoicacid);(2S,2S)-3,3-disulfanediylbis(2-aminopropanoicacid);Cystine,D-;C6H12N2O4S2;Cystine,d;(S)-Cystine;D-Cystine,freebase;AC1OAGSV;(H-D-Cys-OH)2;285463_ALDRICH;SCHEMBL5018669;30210_FLUKA;CHEBI:35494;CTK1C4557;BIC0670;LEVWYRKDKASIDU-QWWZWVQMSA-N;MolPort-003-929-217;ZINC1529200;EINECS206-486- ...
23 Old Bond Street celebrates the world of Stella, reflecting our approach to design, innovation and sustainability. The store captures the spirit of our
Find your adidas adidas by Stella McCartney - Tights - Apparel at adidas.com. All styles and colors available in the official adidas online store.
Stella & Chewys (S&C) 相信生肉含有最豐富的營養,只要在狗狗的餐單中加入生肉,無論份量多少,都對狗狗有正面的好處。除了美味的生肉糧外,S&C亦有推出各種產品,例如佐餐品、乾糧及濕糧等等,所有產品均選用以負責任方式取得的新鮮原材料。S&C致力推廣生肉糧的好處,希望世界各地的寵物家長都能更容易接觸到這些營養豐富,有助犬貓健康成長的產品!
A review of the literature on homology indicates that the theory does not provide evidence for evolutionary naturalism, and that the common examples of homology can be better explained by Creation.
A sz vz rej tulajdonk ppen egy t net, amit sz ven bel li s azon k v li betegs g egyar nt okozhat. Magukat a sz vz rejeket alapvet en aszerint lehet c
TY - JOUR. T1 - Novel patterns of gene expression in pituitary adenomas identified by complementary deoxyribonucleic acid microarrays and quantitative reverse transcription-polymerase chain reaction. AU - Evans, Chheng Orn. AU - Young, Andrew N.. AU - Brown, Milton R.. AU - Brat, Daniel J.. AU - Parks, John S.. AU - Neish, Andrew S.. AU - Oyesiku, Nelson M.. PY - 2001. Y1 - 2001. N2 - Pituitary adenomas account for approximately 10% of intracranial tumors, but little is known of the oncogenesis of these tumors. The identification of tumor-specific genes may further elucidate the pathways of tumor formation. We used complementary DNA microarrays to examine gene expression profiles in nonfunctioning, PRL, GH, and ACTH secreting adenomas, compared with normal pituitary. Microarray analysis showed that 128 of 7075 genes examined were differentially expressed. We then analyzed three genes with unique expression patterns and oncogenic importance by RT-real time quantitative PCR in 37 pituitaries. ...
Purified Recombinant Mouse CTTNBP2NL Protein from Creative Biomart. Recombinant Mouse CTTNBP2NL Protein can be used for research.
A free platform for explaining your research in plain language, and managing how you communicate around it - so you can understand how best to increase its impact.
NuVasive (NSDQ:NUVA) shares closed today on the downturn despite second-quarter results that beat the consensus forecast. The San Diego-based spine surgery technology developer posted losses of -$50 million, or -98¢ per share, on sales of $203.6 million for the three months ended June 30, 2020, for a bottom-line slide from profits of nearly $15 million year-over-year […]. ...
Product Details Stella Top comes in one colour only. Straps are adjustable. Pretty floral prints. Pair it with our flowey skirt or any bottoms as you wish. Size & Fit Please refer to our Size Guide to find your perfect fit. If you have any questions, our online customer service will be more than happy to assist you
Never pay full price for Trattoria Stella On Colfax delivery. Visit FoodBoss, compare 15+ delivery sites and find the best deal. Save up to 58% now!
McCartneys winter 2017 collection draws on her many worlds - including womens wear, the Beatles and her father Paul McCartney.
10 Απρ 2020 - Explore Stella Tiligadas board Ασκήσεις γραφής on Pinterest. See more ideas about ασκήσεις γραφής, προσχολική εκπαίδευση, σχολικές δραστηριότητες.
Low-complexity regions (LCRs) in proteins are tracts that are highly enriched in one or a few amino acids. Given their high abundance, and their capacity to expand in relatively short periods of time through replication slippage, they can greatly con
SAN DIEGO, Oct. 12, 2017 /PRNewswire/ -- NuVasive, Inc. (NASDAQ: NUVA), a leading medical device company focused on transforming spine surgery with minimally
isee systems inc. holds registered trademark rights over the following: iThink®, STELLA®, Stella®, isee systems® and claims the following trademarks; isee NetSim™, Stella Live™, Causal Lens™ and Stella Online™. Terms of Use. ...
For the love of God Isaacson, grow the fuck up, man up, grow some balls, and have a damn mind of your own. Must u always be in agreement with Stellas opinion?! Jeez. And dont tell me to use my blog ID. I wont. Youve kissed my ass a few times too. It was highly irritating ...
Find your adidas adidas by Stella McCartney - Ultraboost - Shoes at adidas.com. All styles and colors available in the official adidas online store.
I will describe a spectral sequence that starts at reduced odd Khovanov homology and converges to a version of instanton homology for double branched covers.. ...
1. Format Pencapaian Target Praktek 2. Proposal KTI Faktor-Faktor Yang Berhubungan Dengan Keputusan Ibu Menggunakan Metode Kontrasepsi Tubektomi Di Desa Sokaraja Tengah Kecamatan Sokaraja Kabupaten Banyumas Tahun 2010 Download 3. KTI Fix
Zespół Psychophobia powstał na przełomie lat 2002-2003. Początkowy skład tworzyli: Kom - bas, Rej - gitara, Kret - gitara i Paweł - bębny.
Madalakasvuline pinnakatja, taime kõrgus kuni 15cm. Vajab päikeselist kasvukohta. Eelistab kuivemat, vett hästi läbi laskvat pinnast. Liigniiskes pinnases võib juurekael mädanema minna ja taim hukkub. Istutada kohe alalisele kasvukohale, sest pika sammasjuure tõttu ei talu ümberistutamist. Õitseb juulist septembrini ...
Stella McCartney Fall/Winter 2015-2016 Collection - Paris Fashion Week Photos, Stella McCartney Fall/Winter 2015-2016 Collection - Paris Fashion Week Pictures, 2015 Stella McCartney Fall/Winter 2015-2016 Collection - Paris Fashion Week, Stella McCartney Fall/Winter 2015-2016 Collection - Paris Fashion Week Hot, Stella McCartney Fall/Winter 2015-2016 Collection - Paris Fashion Week New, Stella McCartney Fall/Winter 2015-2016 Collection - Paris Fashion Week Gallery, Stella McCartney Fall/Winter 2015-2016 Collection - Paris Fashion Week Photo Gallery, Stella McCartney Fall/Winter 2015-2016 Collection - Paris Fashion Week Picture Gallery, stella mccartney fall 2015,stella mccartney fall winter 2015 2016 collection,paris fashion week fall 2015,fashion week,paris fashion week,stella mccartney,fashion ...
Dr. Joy Jackson answered: There : There is no contraindication to using Clotrimazole vaginal cream ring while NuvaRing is in p...
Y-DNA SNP-based subclade predictor. Determine where your Genographic 2.0 or Full-Y result fits on the most extensive human Y phylogeny. Uncover novel SNPs.
Discovery the benefits of NMN and Resveratrol Supplements. Effective, Affordable, Great Reviews. The Best NAD+ Supplement! $50+ Ships Free. NAD+ ANTI-AGING SUPPORT. Types: NADH + CoQ10, NMN - NAD+ ...
We found 1 record for Stella Vanhorn in Texas. View Stellas age, home address, phone number & email address. Run a public records background check now.
Get Latest Stock Market news, UK share market news and share market trading, stock market investing advice. Uk.reuters.com provides latest share Market news, stock market advice, world market reports, UK Stock Exchange movements for NUVA.OQ
My story: In October 2013 I found out that I was pregnant. If we back track from there, I was a statistical marvel. The 0.01% chance that you can do everything right but still things go wrong. I had recently split with my boyfriend, but during our relationship I was on hormonal birth control (Nuva…
Expression of CTTNBP2 (C7orf8, CORTBP2, KIAA1758, Orf4) in kidney tissue. Antibody staining with HPA044654 and CAB009151 in immunohistochemistry.
Expression of CTTNBP2 (C7orf8, CORTBP2, KIAA1758, Orf4) in stomach 1 tissue. Antibody staining with HPA044654 and CAB009151 in immunohistochemistry.
‎Watch trailers, read customer and critic reviews and buy Angry Birds: Stella - Shorts Collection 1 directed by Eric Guaglione for S$ 4.98.
She keeps vomiting. Chihuahua. Kind of foamy. Not sure. Her name is Stella. I'm not really sure how old she is. Can't - Answered by a verified Dog Veterinarian
Discover the Unisexs Blue Horse Knit All In One at Stella McCartney. Free standard shipping is available on all orders. Shop online now.
Weve just moved into a house that has a playroom (approx 12ftx12ft). Weve painted it a pale grey but i would love to jazz it up with some kind of d
De Bibliotheek van het Instituut voor Tropische Geneeskunde te Antwerpen, een van de belangrijkste instellingen ter wereld voor onderwijs, onderzoek en dienstverlening in de tropische geneeskunde en de gezondheidszorg in de ontwikkelingslanden.
... is the biological homology between DNA, RNA, or protein sequences, defined in terms of shared ancestry in the ... Alignments of multiple sequences are used to indicate which regions of each sequence are homologous. The term "percent homology ... homology is the conclusion. Sequences are either homologous or not. This involves that the term "percent homology" is a ... "quantify the homology." Based on the definition of homology specified above this terminology is incorrect since sequence ...
Machesky LM, Insall RH, Volkman LE (2001). "WASP homology sequences in baculoviruses". Trends Cell Biol. 11 (7): 286-287. doi: ... The WH2 (WASP-Homology 2, or Wiskott-Aldrich homology 2) domain is an ~18 amino acids actin-binding motif. This domain was ... The WH2 motif or WH2 domain is an evolutionarily conserved sequence motif contained in proteins. It is found in WASP proteins ... The WH2 motif (for Wiskott-Aldrich syndrome homology region 2) has been shown in WAS and Scar1/WASF1 (mammalian homologue) to ...
Exact homomorphism sequences in homology theory "marks the first appearance in print of the term "exact sequence", now ... "Exact homomorphism sequences in homology theory". Ann. Math. 48 (3): 682-709. doi:10.2307/1969135. JSTOR 1969135. Steven H. ... known for early pioneering work on exact sequences and applying Morse theory to homotopy theory. Everett Pitcher grew up in ...
See Homology of sequences in genetics). It is important (but often difficult) to differentiate between paralogs and orthologs ... Resulting sequence usually lack introns and often contain poly, sequences that are also integrated into the genome. Many ... Paralogs can be identified in single genomes through a sequence comparison of all annotated gene models to one another. Such a ... However, many duplications are, in fact, not detrimental or beneficial, and these neutral sequences may be lost or may spread ...
Sequence homology with mucus proteinase inhibitor". Biol. Chem. Hoppe-Seyler. 372 (1): 13-21. doi:10.1515/bchm3.1991.372.1.13. ... Evidence of sequence homology and immunological cross-reactivity". Biol. Chem. Hoppe-Seyler. 373 (1): 27-33. doi:10.1515/ ... Purification, cDNA sequence, and evidence for transglutaminase cross-linking". J. Biol. Chem. 268 (16): 12028-32. doi:10.1016/ ... 1992). "Primary structure of the human elafin precursor preproelafin deduced from the nucleotide sequence of its gene and the ...
Complete amino acid sequence as revealed by protein and cDNA sequencing and structural homology to whey proteins and Red Sea ... Sequence homology with mucus proteinase inhibitor". Biological Chemistry Hoppe-Seyler. 372 (1): 13-21. doi:10.1515/bchm3.1991. ... Stetler G, Brewer MT, Thompson RC (Oct 1986). "Isolation and sequence of a human gene encoding a potent inhibitor of leukocyte ... Thompson RC, Ohlsson K (Sep 1986). "Isolation, properties, and complete amino acid sequence of human secretory leukocyte ...
They display significant amino acid sequence homology. Sixteen cysteine residues, forming 8 disulfide bonds, are strictly ... A sequence comparison of piscivorin and other CRISP family proteins suggests that the Glu186 residue is the crucial site for ... The nucleotide sequence of piscivorin cDNA spans 1323 bp, containing an open reading frame of 240 codons. Piscivorin has the ... following amino acid sequence. Piscivorin reduces high potassium-evoked smooth muscle contraction, but does not inhibit ...
Pearson, William R. (June 2013). "An Introduction to Sequence Similarity ('Homology') Searching". Current Protocols in ... There are sequences with high shared identity with the GXP_6044388 promoter sequence found on chromosomes 5,6,7,13,14,15,16,17, ... The protein sequence does not significantly deviate from average human proteins in its amino acid composition (Figure 20). The ... The 5'UTR of TMEM211 is conserved to a lesser degree than is the coding sequence (Figure 17). The 3'UTR is not conserved at all ...
Endicott, Patrick C; Smith, J Wolfgang (1980). "A homology spectral sequence for submersions" (PDF). Pacific Journal of ... Smith, J (1980). "Fiber homology and orientability of maps" (PDF). Pacific Journal of Mathematics. 89 (2): 453-70. doi:10.2140/ ... Smith, J. Wolfgang (1968). "An exact sequence for submersions" (PDF). Bulletin of the American Mathematical Society. 74 (2): ...
TBK1 is a non-canonical IKK kinase that phosphorylates the nuclear factor kB (NFkB). It shares sequence homology with canonical ...
... sequence homology with maurotoxin (MTX; α-KTx6.2). Most short-chain scorpion toxins contain three disulfide bridges, whereas ...
Innexins have no significant sequence homology with connexins. Though differing in sequence to connexins, innexins are similar ... ISBN 978-0-8153-3218-3.[page needed] The C. elegans Sequencing Consortium (Dec 11, 1998). "Genome sequence of the nematode C. ... Others have presented evidence based on genetic sequencing and overall functioning in tissues that pannexins should still be ... based on gene mapping and sequence similarity: A, B and C (for example, GJA1, GJC1). However, connexin genes do not code ...
However its gene sequence shows no sequence homology. In addition, casein kinase 1 epsilon does not completely rescue circadian ... Like dbt, shaggy is not a sequence homolog to casein kinase 1 epsilon. Conversely, Gsk3 is also found in mammals, and mutants ... In this manner, temporally sequenced phosphorylations of PER2 act to delay its degradation rate and may provide insight into ... "A noncanonical sequence phosphorylated by casein kinase 1 in beta-catenin may play a role in casein kinase 1 targeting of ...
Moreover, they share sequence homology with other viroids. Conditions for a viroid to infect its host include wounds on the ... This viroid has 64% sequence homology with the cadang-cadang viroid. There are other related viroids with the CCCVd, which are ... Tinangaja disease is caused by coconut trinangaja viroid (CTiVd), which has 64% sequence homology with CCCVd. This disease has ... CCCVd have a sequence of 246 nucleotides, 44 of which are common with most viroids. CCCVd can add a cytosine residue in the 197 ...
Sequence alignments of the gene cluster and previously functionally characterized glycyl radical enzymes as well as homology ... sequence alignments, homology modeling, and DNA annotation. A key accomplishment of the Balskus lab was the elucidation of the ... a sequence similarity network (SSN) is constructed to group together sequences of enzymes in clusters that share biological ... First an enzyme family of interest is identified (in this case, the GRE family) and the amino acid sequences of all the members ...
The spectral sequence formulates the calculation from knowledge of the homology of the remaining spaces. Samuel Eilenberg and ... The Eilenberg−Moore spectral sequence is a device which allows the computation of the (co)homology of the fiber product in ... the Eilenberg-Moore spectral sequence addresses the calculation of the homology groups of a pullback over a fibration. ... we have the following homology spectral sequence: E ∗ , ∗ 2 = Cotor ∗ , ∗ H ∗ ( B ) ( H ∗ ( X ) , H ∗ ( E ) ) ⇒ H ∗ ( E f ...
Viruses can encode proteins with sequence homology to cyclins. One much-studied example is K-cyclin (or v-cyclin) from Kaposi ... The consensus sequence for the phosphorylation site in the amino acid sequence of a CDK substrate is [S/T*]PX[K/R], where S/T* ... Although they lack cyclin sequence homology, crystal structures show that p35 folds in a similar way as the cyclins. However, ... Proteins with no homology to the cyclin family can be direct activators of CDKs. One family of such activators is the RINGO/ ...
Octapeptide sharing sequence homology with HIV envelope protein gp120. It may be useful as antiviral agent in AIDS therapy. The ... core pentapeptide sequence, TTNYT, consisting of amino acids 4-8 in peptide T, is the HIV envelope sequence required for ...
Marcus F, Gontero B, Harrsch PB, Rittenhouse J (Mar 1986). "Amino acid sequence homology among fructose-1,6-bisphosphatases". ... Fructose bisphosphatase deficiency Fructose Gluconeogenesis Metabolism Marcus F, Harrsch PB (May 1990). "Amino acid sequence of ... IMPase and FBPase share a sequence motif (Asp-Pro-Ile/Leu-Asp-Gly/Ser-Thr/Ser) which has been shown to bind metal ions and ... do not show any significant sequence similarity to the enzymes from other organisms. The Bacillus subtilis enzyme is inhibited ...
Sequence, chromosomal assignment, and homology to plasminogen activator-inhibitor". The Journal of Experimental Medicine. 166 ( ... spanning amino acids 379-383 and an N-terminal hydrophobic signal sequence. Despite their similar inhibitory targets, PAI-2 is ... as various mutations to the signal sequence can significantly enhance secretion efficiency. PAI-2 is undetectable in adult ... "Functional activity of eukaryotic signal sequences in Escherichia coli: the ovalbumin family of serine protease inhibitors". ...
It shares significant sequence homology with biglycan and decorin. Fibromodulin participates in the assembly of the collagen ... "Entrez Gene: FMOD fibromodulin". Antonsson P, Heinegård D, Oldberg A (1993). "Structure and deduced amino acid sequence of the ... to chromosome 1q32 and completion of the cDNA sequence". Genomics. 23 (3): 715-7. doi:10.1006/geno.1994.1567. PMID 7851907. " ...
"Intermediate sequences increase the detection of homology between sequences". Journal of Molecular Biology. 273 (1): 349-54. ... SCOP sequence searches, alignments and genome assignments". Nucleic Acids Research. 30 (1): 268-272. doi:10.1093/nar/30.1.268. ... With Julian Gough he created the Superfamily database which uses Hidden Markov models to identify protein sequences that are ... His certificate of election and candidature reads: Dr Chothia has shown how the amino sequences of proteins determine their ...
"Intermediate sequences increase the detection of homology between sequences". Journal of Molecular Biology. 273 (1): 349-54. ...
Other potential family members were identified by sequence homology. Chen et al. (2010) reviewed evidence for a new class of ...
Phospholipases A2 can be classified based on sequence homology. Increased levels of lp-PLA2 are associated with cardiac disease ...
De Novo sequencing and homology searching Molecular & Cellular Proteomics. 10.1074/mcp.O111.014902 (2011). Han, X.; He, L.; Xin ... SPIDER is a sequence tag based search tool within PEAKS, which deals with the possible overlaps between the de novo sequencing ... errors and the homology mutations. It reconstructs the real peptide sequence by combining both the de novo sequence tag and the ... PEAKS is commonly used for peptide identification (Protein ID) through de novo peptide sequencing assisted search engine ...
"Intermediate sequences increase the detection of homology between sequences". Journal of Molecular Biology. 273 (1): 349-54. ... Feb 2001). "Initial sequencing and analysis of the human genome" (PDF). Nature. 409 (6822): 860-921. Bibcode:2001Natur.409.. ... "Current status and new features of the Consensus Coding Sequence database". Nucleic Acids Research. 42 (Database issue): D865- ... A structural classification of proteins database for the investigation of sequences and structures" (PDF). Journal of Molecular ...
It was subsequently cloned and sequenced by Radhey Gupta and coworkers. The amino acid sequence showed a strong homology to ... Waldinger D, Eckerskorn C, Lottspeich F, Cleve H (1988). "Amino-acid sequence homology of a polymorphic cellular protein from ... The mitochondrial HSP60 sequence contains a series of G repeats at the C-terminal. The structure and function of this sequence ... The cytoplasmic HSP60 contains a signal sequence of 26 amino acids on the N terminus. This sequence is highly degenerate and is ...
The Leray-Serre spectral sequence connects the (co-)homology of the total space and the fiber with the (co-)homology of the ... there also exists a sequence of cofibrations. These two sequences are known as the Puppe sequences or the sequences of ... But under certain conditions, fibrations provide exact sequences in homology. For a fibration p : E → B {\displaystyle p\colon ... and an additive homology theory G ∗ {\displaystyle G_{*}} there exists a spectral sequence: H k ( B ; G q ( F ) ) ≅ E k , q 2 ...
Gene conversion acts on DNA sequence homology as its substrate. There is no requirement that the sequence homologies lie at the ... The effect of homogenizing DNA sequences is the same. Repetitive sequences play the role of uncoupling the gene conversion ... The homogenizing forces linking DNA sequences are thereby broken and the DNA sequences are free to evolve independently. This ... the interspersed repeats block gene conversion by inserting regions of non-homology within otherwise similar DNA sequences. ...
c-Src is made up of 6 functional regions: Src homology 4 domain (SH4 domain), unique region, SH3 domain, SH2 domain, catalytic ... Both the N-terminally attached myristic acid and the peptide sequences of the unique region are involved in the interaction. ...
A combinatorial version of knot Floer homology allows it to be computed (Manolescu, Ozsváth & Sarkar 2009). Khovanov homology ... Therefore, it is possible to determine whether a knot is the unknot by testing all sequences of Pachner moves of this length, ... Knot Floer homology of the knot detects the genus of the knot, which is 0 if and only if the knot is an unknot. ... The complexity of Khovanov homology at least as high as the #P-hard problem of computing the Jones polynomial, but it may be ...
TCAPs show structural homology to the CRF family molecule and appears to influence neurite outgrowth and some behaviours ... The primary structure, or amino acid sequence identity, of the proteins between paralogs is ~60% identical and between ... "Teneurin proteins possess a carboxy terminal sequence with neuromodulatory activity". Molecular Brain Research. 133 (2): 253-65 ...
Norman PJ, Carey BS, Stephens HA, Vaughan RW (June 2003). "DNA sequence variation and molecular genotyping of natural killer ... of a novel family of human Ig superfamily members that possess immunoreceptor tyrosine-based inhibition motifs and homology to ... "HLA class I allelic sequence and conformation regulate leukocyte Ig-like receptor binding". Journal of Immunology. 186 (5): ...
January 2003). "Sequence analysis of the granulysin and granzyme B genes in familial hemophagocytic lymphohistiocytosis". Human ... a human late T cell activation molecule with homology to small, lytic, granule proteins". Journal of Immunology. 158 (6): 2680- ...
This protein contains a single BCL2 homology domain 3 (BH3), and has been shown to bind BCL2 proteins and function as an ... 2004). "Complete sequencing and characterization of 21,243 full-length human cDNAs". Nat. Genet. 36 (1): 40-5. doi:10.1038/ ... 2003). "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences". Proc. Natl. Acad. Sci ...
A third, more modified paralog to these genes exists in the same region, HSPA1L, which shares a 90% homology with the other two ... HSPA1A and HSPA1B produce nearly identical proteins because the few differences in their DNA sequences are almost exclusively ...
Through DNA sequencing, Salvia was shown to not be monophyletic but to consist of three separate clades (Salvia clades I-III) ... Classen-Bockhoff R; Crone M; Baikova E (2004). "Stamen development in Salvia L.: Homology reinvestigated". International ...
Although USP53 is classified as a deubiquitinating enzyme based on sequence homology to other proteases from this group, it ... The complete sequences of 150 new cDNA clones from brain which code for large proteins in vitro". DNA Research. 7 (1): 65-73. ... Nagase T, Kikuno R, Ishikawa KI, Hirosawa M, Ohara O (February 2000). "Prediction of the coding sequences of unidentified human ...
Fonagy A, Henning D, Jhiang S, Haidar M, Busch RK, Larson R, Valdez B, Busch H (1989). "Cloning of the cDNA and sequence of the ... "A region of antisense RNA from human p120 cDNA with high homology to mouse p120 cDNA inhibits NIH 3T3 proliferation". Cancer ...
Once a genome is sequenced, it needs to be annotated to make sense of it. Genes in a eukaryotic genome can be annotated using ... A simple method of gene annotation relies on homology based search tools, like BLAST, to search for homologous genes in ... Genome annotation remains a major challenge for scientists investigating the human genome, now that the genome sequences of ... For DNA annotation, a previously unknown sequence representation of genetic material is enriched with information relating ...
Pendergast AM, Muller AJ, Havlik MH, Maru Y, Witte ON (July 1991). "BCR sequences essential for transformation by the BCR-ABL ... Wang B, Golemis EA, Kruh GD (July 1997). "ArgBP2, a multiple Src homology 3 domain-containing, Arg/Abl-interacting protein, is ... "Identification of a candidate human spectrin Src homology 3 domain-binding protein suggests a general mechanism of association ...
... which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. Sequence analysis identified ... 2003). "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences". Proc. Natl. Acad. Sci ... 1997). "Large-Scale Concatenation cDNA Sequencing". Genome Res. 7 (4): 353-8. doi:10.1101/gr.7.4.353. PMC 139146. PMID 9110174 ... Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical ...
1986). "Complete amino acid sequence of human thyroxine-binding globulin deduced from cloned DNA: close homology to the serine ... 1994). "Sequence of a variant thyroxine-binding globulin (TBG) in a family with partial TBG deficiency in Japanese (TBG-PDJ)". ... 1989). "Sequence of the variant thyroxine-binding globulin of Australian aborigines. Only one of two amino acid replacements is ... 1992). "Sequencing of the variant thyroxine-binding globulin (TBG)-San Diego reveals two nucleotide substitutions". Biochim. ...
... homology with pangolin SARS-CoV, and has 90% homology with the M protein of SARS-CoV; whereas, the similarity is only around 38 ... In January 2020, the SARS-CoV-2 genetic sequence data was shared through GISAID, and by March 2020, the global pharmaceutical ...
It is useful in homology modeling and protein design. A version of the plot (CPint) has also been built and made available to ... CP detects both local errors in atomic coordinates and also correctly matches an amino acid sequence to its native three ...
... is a receptor protein which is expressed on T cells and NK cells and shares sequence similarity with CD226 (also known as ... CD 96 has approximately 20% homology with CD226 and competed for binding to CD155 with CD226. The protein encoded by this gene ...
However, this protein is considered a member of the cytochrome P450 superfamily on the basis of sequence similarity rather than ... of TXA synthase due to the requirement of detergent treatment extraction from the membrane but they have utilized homology ... 1992). "Primary structure of human thromboxane synthase determined from the cDNA sequence". J. Biol. Chem. 267 (2): 789-93. doi ... "Primary Structure of the Human Thromboxane Synthase Determined from the cDNA Sequence". Journal of Biological Chemistry. 267 (2 ...
It was initially identified by a search of the draft human genome database by its sequence homology to ENTs (equilibrative ...
The gene sequence for H3 receptors expresses only about 22% and 20% homology with both H1 and H2 receptors respectively. There ...
SINEs are known to share sequence homology with LINES which gives a basis by which the LINE machinery can reverse transcribe ... For example, the 5' of the Alu sine is derived from 7SL RNA, a sequence transcribed by RNA Polymerase III which codes for the ... The body of SINEs possess an unknown origin but often share much homology with a corresponding LINE which thus allows SINEs to ... For example, LINEs and SINEs in rodents and primates show very strong homology at the insertion-site motif. Such evidence is a ...
Next to the ligand binding domain is an EGF precursor homology domain (EGFP domain). This shows approximately 30% homology with ... February 2015). "Exome sequencing identifies rare LDLR and APOA5 alleles conferring risk for myocardial infarction". Nature. ... The N-terminal domain of the LDL receptor, which is responsible for ligand binding, is composed of seven sequence repeats (~50 ... Exon 1 contains a signal sequence that localises the receptor to the endoplasmic reticulum for transport to the cell surface. ...
It shows no homology to other mammalian proteins but strikingly shares 30% sequence identity and 69% similarity with the ERG2 ...
... and ab initio prediction of protein tertiary structures based only on amino acid sequence. The experiment runs once every two ... in protein structure prediction that studies the performance of automated structure prediction webservers in homology modeling ...
... which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein that belongs to the L18P ... 2003). "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences". Proc. Natl. Acad. Sci ... 2001). "Toward a catalog of human genes and proteins: sequencing and analysis of 500 novel complete protein coding human cDNAs ... Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical ...
... including experimental methods using genomic sequences or modeling-based approaches based on sequence or structural homology to ... Completed genome sequences allow every open reading frame (ORF), the part of a gene that is likely to contain the sequence for ... The gene sequence of the target protein can also be compared to a known sequence and structural information can then be ... 30-50% sequence identity gives a model of intermediate-accuracy, and sequence identity below 30% gives low-accuracy models. It ...
UBLs that are capable of conjugation (sometimes known as Type I) have a characteristic sequence motif consisting of one to two ... Haas AL, Ahrens P, Bright PM, Ankel H (August 1987). "Interferon induces a 15-kilodalton protein exhibiting marked homology to ... The process of ubiquitination is a tightly regulated three-step sequence: activation, performed by ubiquitin-activating enzymes ... other proteins with sequence similarity to ubiquitin were occasionally reported in the literature, but the first shown to share ...
Stable Homology as an Indicator of Manifoldlikeness in Causal Set Theory, arXiv:0902.0434 (Continuum topology and homology) D.A ... A chain is a sequence of elements x 0 , x 1 , … , x n {\displaystyle x_{0},x_{1},\ldots ,x_{n}} such that x i ≺ x i + 1 {\ ...
The component protein, AbpA, shows homology, both at the sequence and structural level, to the bacterial protein TasA, a major ... Its circular genome sequence is 2,222,430 Bp in length and contains 2605 protein-encoding sequences (CDS). Under anaerobic ... The first of the Pyrobaculum species to be genetically sequenced, P. aerophilum (rod-shaped, 3-8 * 0.6 µm), has a rare ... The complete genome of this organism was sequenced (1.99 Mb, 58% G+C content), revealing numerous metabolic pathways for the ...
Sequential homology, Topol. Appl. 114 /2, 201-225, (2001). J.M. García-Calcines, M. García Pinillos and L.J. Hernández. Closed ... Exact sequences and closed model categories, Appl. Categ. Struct., 18, no. 4, 343-375 (2010). DOI 10.1007/s10485-008-9176-x ( ...
These putatively-specific sequences displayed enhanced homology and reduced diversity as compared to randomly sampled CDR3βs, ... The Peanut-Specific TCR Repertoire: A Statistical Approach to Define Homology Among CDR3β Sequences in Peanut-Allergic ... The Peanut-Specific TCR Repertoire: A Statistical Approach to Define Homology Among CDR3β Sequences in Peanut-Allergic ... we illustrated the local homology of the psCDR3s with a network analysis that clustered sequences based on the presence of ...
Sequence Homology, Amino Acid, Structural Homology, Protein",. author = "Durrant, {Jacob D.} and Amaro, {Rommie E.} and Lei Xie ... A multidimensional strategy to detect polypharmacological targets in the absence of structural and sequence homology. In: PLoS ... A multidimensional strategy to detect polypharmacological targets in the absence of structural and sequence homology. PLoS ... A multidimensional strategy to detect polypharmacological targets in the absence of structural and sequence homology. Research ...
Whole Genome Sequence Analysis and Homology Modelling of a 3C Like Peptidase and a Non-Structural Protein 3 of the SARS-CoV-2 ... In this study we did a complete bioinformatic analysis, sequence alignment, comparison of multiple sequences and homology ... Whole Genome Sequence Analysis and Homology Modelling of a 3C Like Peptidase and a Non-Structural Protein 3 of the SARS-CoV-2 ... Whole-genome sequence analysis and homology modelling of the main protease and non-structural protein 3 of SARS-CoV-2 reveal an ...
Homology of repeated DNA sequences in Vigna species. Indian Journal of Biochemistry & Biophysics. 1985 Dec; 22(6): 327-30. ...
Sequence Homology, Amino Acid. Spleen. Surface charge. Tumor necrosis factor-α. Tupaia - genetics. Tupaia - immunology. Tupaia ... Assessment of sequence homology and immunologic cross-reactivity between tree shrew (Tupaia belangeri) and human IL-21. Full ... Assessment of sequence homology and immunologic cross-reactivity between tree shrew (Tupaia belangeri) and human IL-21. Full ... Assessment of sequence homology and immunologic cross-reactivity between tree shrew (Tupaia belangeri) and human IL-21. ...
Muscle5: High-accuracy alignment ensembles enable unbiased assessments of sequence homology and phylogeny Multiple sequence ... This study uncovers high sequence diversity of the genes within a single species and discusses the contribution of selection in ... describe a super pangenome assembled from long-read sequences of 545 wild and domesticated silkworms. Naturally selected ( ... These translated small ORFs showed natural selection conserving micropeptide sequence and function. ...
We compute topological Hochschild homology of sufficiently structured forms of truncated Brown-Peterson spectra with ... A May-type spectral sequence for higher topological Hochschild homology. *Gabe Angelini-Knoll, A. Salch ... Topological Hochschild homology and integral p$p$-adic Hodge theory. *B. Bhatt, M. Morrow, P. Scholze ... we construct a spectral sequence analogous to the May spectral sequence whose input is the… Expand. ...
Improving Protein Coverage by de novo Sequence Homology Searching with SPIDER. ASMS. MPK 176. 03/06/2007. ... Peptide Sequence Reconstruction from de novo Sequences and their HomologuesThe diversity of bioactive proteins in Australian ... Improving Protein Coverage by de novo Sequence Homology Searching with SPIDER. 0 ...
Sequence homology, %. M73218. Burma. Human. 1a. 72.7. D10330. Burma. Human. 1a. 72.8. ... Nucleotide sequence identity between TLS25 (hepatitis virus E genotype 3f) and available full-length genomes ...
Complete DNA sequence plasmid comparisons. Bands of color indicate homology between sequences. Red lines show sequence in... ... Complete DNA sequence plasmid comparisons. Bands of color indicate homology between sequences. Red lines show sequence... ... We investigated novel genes by identifying regions of the pCT sequence absent from those plasmid sequences with most homology ... by using sequence data from pCT and other related sequenced plasmids. Resulting amplicons were sequenced by using BigDye ...
... for target genes in species with lacking sequence information but also the preparation of customized queries for homology ... Results: We introduce the maxAlike algorithm, which reconstructs a genomic sequence for a specific taxon based on sequence ... maxAlike: maximum likelihood-based sequence reconstruction with application to improved primer design for unknown sequences ... For this target species, the algorithm computes nucleotide probabilities at each sequence position. Consensus sequences are ...
The cDNA sequence of NS3-glycoprotein from brassica campestris and its homology to related proteins. Plant and Cell Physiology ... The cDNA sequence of NS3-glycoprotein from brassica campestris and its homology to related proteins. In: Plant and Cell ... The cDNA sequence of NS3-glycoprotein from brassica campestris and its homology to related proteins. / Yamakawa, Seiyei; ... The cDNA sequence of NS3-glycoprotein from brassica campestris and its homology to related proteins. ...
CRAC bears no channel homology, obviously, [and] no classical pore sequence, ... CRAC bears "no channel homology, obviously, [and] no classical pore sequence,. Kerry Grens. ... CRAC bears "no channel homology, obviously, [and] no classical pore sequence," which partially explains why identifying it was ...
... sequence homology: The antigen sequence used to produce this antibody shares 100% sequence homology with the species listed ... GR is released from the chaperone complex and translocates to the nucleus as a dimer to associate with specific DNA sequences ...
Amino acid sequence homology. A bioinformatic approach run to establish if a new protein is closely related to a known allergen ... amino acid sequence homology, and serum screening are currently the most popular methods to determine allergenicity [77] (Table ... A sequence of chain events establishes the probability of HGT posing a consumer health risk: an encounter between the recipient ...
We also construct a version of the Topological Cyclic Homology functor TC for cyclotomic complexes, and an equivariant homology ... the Hodge-to-de Rham spectral sequence degenerates. This has been conjectured by M. Kontsevich and Y. Soibelman arXiv:math/ ... we introduce a new version of periodic cyclic homology for DG agebras and DG categories. We call it co-periodic cyclic homology ... We show how one can twist the definition of Hochschild homology of an algebra or a DG algebra by inserting a possibly non- ...
The partial amino acid sequence of a murine Ia molecule - Lack of homology between murine I-Cγd and human P29. / Cook, Richard ... The partial amino acid sequence of a murine Ia molecule - Lack of homology between murine I-Cγd and human P29. Immunogenetics. ... The partial amino acid sequence of a murine Ia molecule - Lack of homology between murine I-Cγd and human P29. In: ... Cook, R, Vitetta, ES, Capra, JD & Uhr, JW 1977, The partial amino acid sequence of a murine Ia molecule - Lack of homology ...
Sequence similarity is a powerful tool for discovering biological function. Just as the ancient Greeks used comparative anatomy ... Understanding biological sequences. *. Sequence similarity, homology, scoring matrices, scores, and evolution. *. Sequence ... Sequence similarity is a powerful tool for discovering biological function. Just as the ancient Greeks used comparative anatomy ... It is one of the most important software packages used in sequence analysis and bioinformatics. Most users of BLAST, however, ...
On Null-homology and stationary sequences. (joint work with Gerold Alsmeyer), arXiv: 1910.07378 ...
... sequence homology is not the only determinant of ADA generation. Additional factors might include the biopharmaceutical ... modifications can be avoided by optimization of production and storage processes as well as by stabilizing sequence mutations.[ ...
Molecular cloning, sequencing, and expression of the 36 kDa protein present in pars planitis. Sequence homology with yeast ...
Sequence homology at the breakpoint and clinical phenotype of mitochondrial DNA deletion syndromes. PLoS One. 2010 Dec 20;5(12 ...
A spectral sequence from Khovanov homology to knot Floer homology. Nathan Dowlin, Department of Mathematics, Dartmouth College, ... Khovanov homology and the Fukaya category of the 3-punctured disc. Claudius Zibrowius, Mathematics Department, University of ...
NrichD database: sequence databases enriched with computationally designed protein-like sequences aid in remote homology ... Enriching the annotation of Mycobacterium tuberculosis H37Rv proteome using remote homology detection approaches: insights into ...
Fukutin is a putative glycosyltransferase and has sequence homologies to a bacterial glycosyltransferase, but its exact role ... FKRP protein is a putative glycotransferase based on its sequence homology to fukutin. FKRP deficiency causes hypoglycosylation ... Full sequencing testing may be cost-effective in all cases, as the gene is composed only of two small exons. ... Dysferlin protein is a large membrane protein with sequence analogy to the nematode protein fer-1, and is a member of the ...
They share limited regions of sequence homology and a common tertiary structure architecture.[5][6][7][8][9] This is an eight ... The sequences of most members of the family, the core or kernel lipocalins, are characterised by three short conserved ... Keen JN, Caceres I, Eliopoulos EE, Zagalsky PF, Findlay JB (April 1991). "Complete sequence and model for the A2 subunit of the ... Pervaiz S, Brew K (September 1987). "Homology and structure-function correlations between alpha 1-acid glycoprotein and serum ...
Sequence Alignment. 1. 2004. 2297. 0.010. Why? Sequence Homology, Amino Acid. 1. 2004. 2950. 0.010. Why? ...
DNA sequence analysis also showed that AMR in these strains was conferred mainly by two types of ICEs, i.e., ICETET (comprising ... DNA sequence analysis also showed that AMR in these strains was conferred mainly by two types of ICEs, i.e., ICETET (comprising ... and subsequently sequenced their conserved genes. Resistance to tetracycline, streptomycin and trimethoprim-sulfamethoxazole ... India during 2008-2015 for antibiotic susceptibility and the presence of ICEs and subsequently sequenced their conserved genes ...
  • Just as the ancient Greeks used comparative anatomy to understand the human body and linguists used the Rosetta stone to decipher Egyptian hieroglyphs, today we can use comparative sequence analysis to understand genomes. (oreilly.com)
  • The number of organisms with sequenced genomes is increasing rapidly, facilitating proteomic, transcriptomic and molecular studies. (biomedcentral.com)
  • Although, providing the massive amount of data by recent genome sequencing projects but many of these genomes are still not fully annotated as well as consist of genes/proteins with unknown function and structure. (avensonline.org)
  • When analyzing the polyketide gene clusters from the sequenced dermatophyte genomes 1 , 8 , we found an orthologous gene cluster, which is also conserved in pathogenic fungi Aspergillus fumigatus and Neosartorya fischeri 10 , 11 ( Figure 1 ). (cdc.gov)
  • Cardiocondyla obscurior has the smallest of the sequenced ant genomes and its structure suggests a fundamental role of transposable elements (TEs) in adaptive evolution. (wurmlab.com)
  • Homology modelling of these proteins with known templates offers the opportunity to discover ligand binding sites and explore the possible antiviral properties of these protein ligand complexes. (chemrxiv.org)
  • In this study we did a complete bioinformatic analysis, sequence alignment, comparison of multiple sequences and homology modelling of the SARS-CoV-2 whole genome sequences, the spike protein and the polyproteins for homology with known proteins, we also analysed receptor binding sites in these models for possible binding with ligands that exhibit antiviral properties. (chemrxiv.org)
  • The enzyme shows no significant amino acid sequence homology with other proteins. (rcsb.org)
  • This was then compared to the sequences of Pc1 proteins from various vertebrates, using the Multalin program. (xenbase.org)
  • Sequencing demonstrates both unique epitopes and sequences commonly found in other plant proteins. (cdc.gov)
  • The proteins encoded by members of the Dbl family share a common domain, presented in this entry, of about 200 residues (designated the Dbl homology or DH domain) that has been shown to encode a GEF activity specific for a number of Rho family members. (embl.de)
  • It does not share significant sequence homology with other subtypes of small G-protein GEF motifs such as the Cdc25 domain and the Sec7 domain, which specifically interact with Ras and ARF family small GTPases, respectively, nor with other Rho protein interactive motifs, indicating that the Dbl family proteins are evolutionarily unique. (embl.de)
  • Assignment of Homology to Genome Sequences using a Library of Hidden Markov Models that Represent all Proteins of Known Structure. (cam.ac.uk)
  • The input is a multiple sequence alignment and a phylogenetic tree that also contains the target species. (nih.gov)
  • For 37 out of 44 target species in a test dataset, we obtain a significant increase of the reconstruction accuracy compared to both the consensus sequence from the alignment and the sequence of the nearest phylogenetic neighbor. (nih.gov)
  • This method can be used for both global and local alignment, but it is most successful when sequences share only local homologies. (programmableweb.com)
  • There is an optional add-on bioinformatics activity where students use DNA sequence alignment data to confirm or modify their tree. (edu.au)
  • Bit-parallel sequence-to-graph alignment. (cdc.gov)
  • Multiple sequence alignment (MSA) was used to locate the conserved residues. (avensonline.org)
  • This study uncovers high sequence diversity of the genes within a single species and discusses the contribution of selection in the evolution of ribosomal RNA. (nature.com)
  • Applications include not only compensation for missing data in unsequenced genomic regions and the design of oligonucleotide primers for target genes in species with lacking sequence information but also the preparation of customized queries for homology searches. (nih.gov)
  • The improved sequence reconstruction also leads to an increase of the quality of PCR primer design for yet unsequenced genes: the differences between the expected T(m) and real T(m) of the primer-template duplex can be reduced by ~26% compared with other reconstruction approaches. (nih.gov)
  • We screened V. cholerae O1 strains isolated from cholera patients in Kolkata, India from 2008 to 2015 for antibiotic susceptibility and the presence of ICEs, and subsequently sequenced their conserved genes. (frontiersin.org)
  • Sequence homology of virus protein 1 genes suggested these strains belong to the SAFV-1 sublineage. (cdc.gov)
  • Because VP1 genes of 2 SAFV-positive samples could not be amplified in this way, a newly designed primer pair (cardioVP1Fn: TCAGAATGCCAATCTCCCCAAC and cardioVP1Rn: AAAGGTCCACCCGATACATTGA) was used in combination with cardioVP1-2F/3R to amplify the VP1 gene based on the sequences obtained from our positive samples. (cdc.gov)
  • To characterize the nucleotide sequences obtained from this study, we analyzed the 5′ UTR and VP1 genes of all SAFV isolates to determine the extent of homology among the genes and those documented in the GenBank database by using MEGA software ( 14 ). (cdc.gov)
  • Studies of AMINO ACID SEQUENCE HOMOLOGY and NUCLEIC ACID SEQUENCE HOMOLOGY provide useful information about the genetic relatedness of genes, gene products, and species. (bvsalud.org)
  • 90% identity between them) ( Table S3, Supplementary Information ), and the lower sequence homology to those in A. fumigatus and N. fischeri (~70% identity, Table S3 ), raise an interesting question as to whether these fungi produce similar compounds, and whether the presence of additional conserved genes may lead to further tailoring of the neosartoricin scaffold. (cdc.gov)
  • Sequence homology analysis of these genes with other species threonyl-tRNA synthetase showed that the shorter gene did not possess motif-2 and motif-3 of catalytic core that were conserved in class II aminoacyl-tRNA synthetases. (archive.org)
  • The expressed sequence tags (ESTs), hormones and genes responsible for regulating wood formation were identified in Populu s increasingly [7, 8, 9]. (researchsquare.com)
  • Analysis of the 18S rDNA sequences of Haliotis tuberculata tuberculata and H. t. coccinea subtaxa identified two different types of 18S rDNA genes and ITS1 regions. (archives-ouvertes.fr)
  • Our goal was to obtain tag sequences from the maximum number of possible genes and to deposit them in the publicly accessible database for ESTs (dbEST of the National Center for Biotechnology Information). (elsevier.com)
  • The EST sequencing data analysis showed 60 novel genes found only in this cDNA library after BLAST analysis against 3.0 million ESTs in NCBI's dbEST database. (elsevier.com)
  • The BLAST search also showed the identified ESTs that have close homology to known genes, which suggests that these may be newly recognized members of known gene families. (elsevier.com)
  • Ambler classification divides β-lactamases into four classes via amino acid sequence homology. (aacc.org)
  • Optimizing a Whole-Genome Sequencing Data Processing Pipeline for Precision Surveillance of Health Care-Associated Infections. (cdc.gov)
  • Amplified fragment length polymorphism and whole genome sequencing: a comparison of methods in the investigation of a nosocomial outbreak with vancomycin resistant enterococci. (cdc.gov)
  • Positive samples were further characterized by virus isolation and whole genome sequencing. (umnswinenews.com)
  • Viable LAIV was confirmed in vaccinated pigs by cell culture and whole genome sequencing. (umnswinenews.com)
  • The Human Genome Variation Society (HGVS) has established a sequence variant nomenclature , an international standard used to report variation in genomic, transcript and protein sequences. (ucsc.edu)
  • NNNNNNNNNNNNN") and the letter "X" in protein sequences (e.g. (nbrp.jp)
  • Using the protein sequences of these receptors as queries we identified overlapping expressed sequence tags which were predicted to encode an additional subtype. (ku.dk)
  • We introduce the maxAlike algorithm, which reconstructs a genomic sequence for a specific taxon based on sequence homologs in other species. (nih.gov)
  • Sequence similarity is a powerful tool for discovering biological function. (oreilly.com)
  • A significant amount of similarity was identified by comparing the striped bass genetic map with the genome sequence of a model fish, the three-spined stickleback. (usda.gov)
  • Amino-acids of two sequences can be aligned and we can easily count the number of identical residues (or use an index of similarity) as a measure of relatedness. (powershow.com)
  • The degree of similarity between sequences. (bvsalud.org)
  • Saci_0406 displays structural similarity, but low sequence homology, to bacterial type-I pilins. (diamond.ac.uk)
  • Sequence similarity was brought in through Protein Data Bank and non-redundant database using BLASTp program of NCBI and a search for templates revealed that yjaB shares 97% homology to a protein of Escherichia coli, indicating this protein is evolutionary conserved and was found with acetyltransfarase. (avensonline.org)
  • It is one of the most important software packages used in sequence analysis and bioinformatics. (oreilly.com)
  • The Marine Microbial Initiative by the Gordon and Betty Moore Foundation (FR) sponsored the sequencing, bioinformatics, and mathematical analyses. (plos.org)
  • We isolated and cloned genomic fragments corresponding to the amphibian homologue of PKD1 from a BAC library, and after sequencing the clones, we designed primers for the amplification of the transcript and sequenced 10 kb of ORF. (xenbase.org)
  • The sequence of the putative transcript was generated from overlapping RT-PCR fragments and translated to derive the putative protein sequence. (xenbase.org)
  • Returns transcript IDs, lengths, and sequences for the specified gene(s) from all annotated strains. (mousemine.org)
  • Nucleotide sequence and amino acid sequence of our carp growth hormone gene are the same as Koren's carp GH cDNA in the coded region. (nih.gov)
  • Compared with Chao's carp GH cDNA, the homology of nucleotide sequence and amino acid sequence for our carp growth hormone gene is 95.6% and 96.7%, respectively, in the coded region. (nih.gov)
  • blastn - Comparing a nucleotide query sequence against a nucleotide sequence database. (nbrp.jp)
  • Low complexity sequence found by a filter program is substituted using the letter "N" in nucleotide sequence (e.g. (nbrp.jp)
  • The nucleotide homology were 97%, 97% and 98% compared with those of DENV-1 strains of dengue fever outbreak in Cambodia, in 1997 and 1999 in China, respectively. (who.int)
  • DNA sequence analysis also showed that AMR in these strains was conferred mainly by two types of ICEs, i.e. (frontiersin.org)
  • Insights from the revised complete genome sequences of Acinetobacter baumannii strains AB307-0294 and ACICU belonging to global clones 1 and 2. (cdc.gov)
  • All of the four isolates were sequenced and confirmed to be vaccine strains with more than 92% homology between gene sequences. (umnswinenews.com)
  • DNA sequences may be stored in databases accessible over the internet, obviating the need for the exchange of reference strains. (biomedcentral.com)
  • Designed primers pBIB-RB-F, pBIB-RB-R, NOS 3'-Foward Nos3' reverse for sequencing the pBIB plant plasmid. (igem.org)
  • Fluorescence energy transfer dye-labeled primers for DNA sequencing and analysis. (akjournals.com)
  • The Adams spectral sequence for the stable homotopy of the spheres has been extensively studied since its introduction in 1958 [1]. (semanticscholar.org)
  • We performed a genome-wide survey of the millions of human tandem repeats using publicly available long read genome sequencing data from 21 humans. (researchsquare.com)
  • Sequence homology helps to explain the cross reactivity to a variety of foods experienced by latex allergic individuals. (cdc.gov)
  • This is the first paper to characterize a Nivulian-II of E. nivulia latex with respect to amino acid sequencing. (hindawi.com)
  • Specify the expected number of homologous sequences in the database. (nbrp.jp)
  • The task of reconstructing a genomic sequence from a particular species is gaining more and more importance in the light of the rapid development of high-throughput sequencing technologies and their limitations. (nih.gov)
  • Comparing an EST sequence with the human genomic sequence database enables assignment of an EST to a specific chromosomal region (a process called digital gene localization) and often enables immediate partial determination of intron/exon boundaries within the genomic structure. (elsevier.com)
  • Using this background we'll relate Khovanov homology to a version of instanton Floer homology and deduce that Khovanov homology detects the unknot from the corresponding result in the instanton theory. (au.dk)
  • We'll emphasize the parts of the theory important for setting Floer homology for three manifolds and also for links in three manifolds. (au.dk)
  • SIV isolates that have been molecularly cloned share approxi-mately 75% of their genomic sequences with HIV-II and approximately 30% with NIV-I (10). (cdc.gov)
  • Based on an investigation of 154 C. difficile isolates comprising 75 ribotypes, tandem repeat sequencing demonstrated excellent concordance with widely used PCR ribotyping and equal discriminatory power. (biomedcentral.com)
  • Moreover, tandem repeat sequences enabled the reconstruction of the isolates' largely clonal population structure and evolutionary history. (biomedcentral.com)
  • The homology among the tested isolates was determined by pulsed-field gel electrophoresis (PFGE). (biomedcentral.com)
  • Multilocus sequence typing (MLST) was used to determine the sequence types (STs) of the selected isolates. (biomedcentral.com)
  • We initiated the cloning strategy by creating an E. coli -yeast- Aspergillus shuttle vector, pYH-wA-pyrG, which consists of a ColE1 origin of replication from SuperCos1, a yeast centromere sequence (CEN) and an autonomously replicating sequence (ARS) 13 , 14 ( Table S1, Materials and Methods ). (cdc.gov)
  • In the current work, we introduce a multidimensional strategy for the identification of secondary targets of known small-molecule inhibitors in the absence of global structural and sequence homology with the primary target protein. (lancs.ac.uk)
  • We have developed an assay to evaluate the in vivo interaction between a fragment of ankyrin corresponding to this domain (ANK90) and two non-erythroid anion exchangers, AE2 and AE3, that share considerable structural homology with AE1. (elsevier.com)
  • IMSEAR at SEARO: Homology of repeated DNA sequences in Vigna species. (who.int)
  • For this target species, the algorithm computes nucleotide probabilities at each sequence position. (nih.gov)
  • We report on the utilization of these and other markers to construct a microsatellite linkage map of striped bass and to discover chromosome regions of conserved synteny between this species and a model teleost having a sequenced genome, the three-spined stickleback (Gasterosteus aculeatus). (usda.gov)
  • Sequencing of the 16S rDNA gene showed that strain AL585 T belonged to the genus Pyrococcus and was probably a new species. (microbiologyresearch.org)
  • AGenDA is a gene-prediction tool that is based on cross-species sequence comparison. (uni-bielefeld.de)
  • ITS1 type II is homologous with the ITS1 consensus sequences published for many abalone species, whereas ITS1 type I presented only minor homology with a unique database entry for H. iris ITS1. (archives-ouvertes.fr)
  • A C-terminal domain (residues 347-459) also with hemopexin homology. (en-academic.com)
  • DIALIGN is a program for aligning multiple protein or nucleic acid sequences. (programmableweb.com)
  • 1. An isolated and/or recombinant nucleic acid having at least 95% sequence identity to a nucleic acid sequence as depicted in table 3 or comprising a sequence having at least 99% sequence identity to a nucleic acid sequence as depicted in figure 19. (epo.org)
  • Identifying Clusters of High Confidence Homologies in Multiple Sequence Alignments. (cdc.gov)
  • Genome sequencing of numerous dermatophytes belonging to the Trichophyton and Arthroderma genera revealed that each genome encodes numerous SM clusters 1 , 8 . (cdc.gov)
  • Comparisons of our EST sequencing data with nonredundant human mRNA and protein databases showed that the ESTs represent 1860 gene clusters. (elsevier.com)
  • The N-terminal sequence (DFPPNTCCCICC) showed partial homology with those of other cysteine proteinases of biological origin. (hindawi.com)
  • siRNA sequences with partial homology to other targets may contribute to off-target activity. (thermofisher.com)
  • Gene profiling experiments have shown that duplexes with partial homology to other transcripts can cleave the target or act like a microRNA (miRNA), inhibiting translation of the target mRNA. (thermofisher.com)
  • This includes both Swiss-Prot (reviewed entries known to have experimental evidence) and TrEMBL (additional submitted sequences some of which may be partial) sequences. (mousemine.org)
  • Single-space axioms for homology theory, Proc. (ncatlab.org)
  • The exactness of Čech homology over a vector space, Proc. (ncatlab.org)
  • Complete functors in homology: I. Chain maps and endomorphisms, Proc. (ncatlab.org)
  • The exact homology sequence, Proc. (ncatlab.org)
  • Chain maps inducing zero homology maps, Proc. (ncatlab.org)
  • Enriching the annotation of Mycobacterium tuberculosis H37Rv proteome using remote homology detection approaches: insights into structure and function. (ncbs.res.in)
  • The PIT analysis also identified hotspots of incomplete genome annotation, and showed that poor sequence and assembly quality do not explain all annotation gaps. (biomedcentral.com)
  • The software tools CHAOS and DIALIGN are used to align a pair of syntenic genomic sequences, e.g. from human and mouse. (uni-bielefeld.de)
  • Given peanut is a polyantigenic stimulant, we illustrated the local homology of the psCDR3s with a network analysis that clustered sequences based on the presence of either an enriched motif, a low Levenshtein distance (distance = 1), or evidence of convergent recombination as defined by multiple nucleotide rearrangements that corresponded to the same amino acid sequence. (harvard.edu)
  • BLAST is the only comprehensive reference with detailed, accurate information on optimizing BLAST searches for high-throughput sequence analysis. (oreilly.com)
  • Why do protein sequence analysis? (powershow.com)
  • The result of the sequence analysis and the restriction map shows that an open reading frame of the carp growth hormone gene contains 630 base pairs which code for a polypeptide of 210 amino acids including 22 amino acids of the signal peptide and 188 amino acids of the nature growth hormone. (nih.gov)
  • We conclude that sequence analysis of the two repetitive loci introduced here may be highly useful for routine typing of C. difficile . (biomedcentral.com)
  • Initial sequencing and analysis of the human genome. (akjournals.com)
  • Fluorescence detection in automated DNA sequence analysis. (akjournals.com)
  • A phylogenetic analysis makes a clear separation between type I and type II ITS1 sequences and supports grouping H. t. tuberculata, H. t. coccinea and H. marmorata together. (archives-ouvertes.fr)
  • We used high-throughput DNA sequencing analysis to generate 4258 single-pass sequencing reactions (known as expressed sequence tags, or ESTs) obtained from the 5′ (97) and 3′ (4161) ends of human cDNA clones from a HBMSC cDNA library. (elsevier.com)
  • It is expected that high-throughput EST sequencing and data mining analysis will greatly promote our understanding of gene expression in these cells and of growth and development of the skeleton. (elsevier.com)
  • SignalP analysis not run for this sequence. (cornell.edu)
  • Light chains are divided into 2 major classes based on the amino acid sequence in the constant portion of the polypeptide chain and are designated as kappa and lambda. (medscape.com)
  • These are further divided into at least 10 subtypes (4 kappa and 6 lambda) based on the amino acid sequence in the variable region of the polypeptide chain. (medscape.com)
  • Conditions for first- and second-round PCR were 94°C for 3 min, followed by 40 cycles of 94°C for 30 sec, 48°C for 30 sec, and 72°C for 90 sec, and a final 10-min cycle at 72°C. All positive PCR amplicons were verified by sequencing after being cloned into the pMD18T vector (Takara Bio Inc., Dalian, China). (cdc.gov)
  • Complete DNA sequences can be used as a platform to develop rapid epidemiologic tools to identify and trace the spread of plasmids in clinically relevant pathogens, thus facilitating a better understanding of their distribution and ability to transfer between bacteria of humans and animals. (cdc.gov)
  • By qualitative dot-blot DNA-DNA hybridization and 16S rDNA sequence comparison, these spirochaetes form a distinct phylogenetic group, with Treponema maltophilum as its closest cultivable relative. (microbiologyresearch.org)
  • The two subtaxa do not show any significant differences between the homologous 18S rDNA sequences. (archives-ouvertes.fr)
  • Schematic representation of the putative domains of xPKD1, deduced from the cDNA sequence, and lettered from A to E. A: lectin C domain, B: LDL-A domain, C: PKD domains, D: REJ domain, E: transmembrane domains. (xenbase.org)
  • ARGOS P. Human oestrogen receptor cDNA: sequence, expression and homology to v-erb-A. Nature , Boston, v. 320, p. 134-139, 1986. (bvsalud.org)
  • The murine Β chain shows no homology with P29 (the putative human Β chain equivalent), the Β chain of guinea pig Ia. (elsevier.com)
  • The sequence of the putative protein clearly demonstrated that this gene is the homologue of human PKD1 . (xenbase.org)
  • blastp - Comparing an amino acid query sequence against a protein sequence database. (nbrp.jp)
  • blastx - Comparing a nucleotide query sequence translated in all reading frames aginst a protein sequence database. (nbrp.jp)
  • Novel TAms for use in these industries have been discovered using a range of approaches, including activity-guided methods and homologous sequence searches from cultured microorganisms to searches using key motifs and metagenomic mining of environmental DNA libraries. (qub.ac.uk)
  • TAm sequences are phylogenetically analyzed and compared to other discovery methods. (qub.ac.uk)
  • In this part of the wiki we present our results on different sequence based prediction methods. (tu-muenchen.de)
  • These putatively-specific sequences displayed enhanced homology and reduced diversity as compared to randomly sampled CDR3βs, which is consistent with independently published antigen-specific populations. (harvard.edu)
  • The advent of whole-community genome sequencing (i.e., metagenomics) is rapidly changing the way viral and microbial diversity are assayed. (plos.org)
  • In this study, we determined the bacterial diversity profile of the Mexico City metro by massive sequencing of the 16S rRNA gene. (nature.com)
  • Tandem repeat sequence typing resolves phylogenetic diversity to a level equivalent to PCR ribotypes. (biomedcentral.com)
  • The influence of the local sequence environment on RNA loop structures. (mpg.de)
  • Peptide Mass Fingerprinting and N-Terminal Amino Acid Sequencing of Glycosylated Cysteine Protease of Euphorbia nivulia Buch. (hindawi.com)
  • Recently, an attempt has been made on peptide sequencing of 31-kDa, Tubulin alpha-1 chain-like protein called nivulian-I, present in the latex of E. nivulia [ 8 ]. (hindawi.com)
  • This paper describes the biochemical characterization, of this cysteine like protease with respect to peptide fingerprinting and N-terminal amino acid sequencing. (hindawi.com)
  • The server filters your query sequence for low compositional complexity regions by default. (nbrp.jp)
  • The reference sequence was derived from M87661. (cdc.gov)
  • A 346bp fragment from RT-PCR product of every isolate was sequenced to compare with published sequences of other DENV-1 viruses. (who.int)
  • Characterization of High-Level Expression and Sequencing of the Escherichia Coli K-12 Cyns Gene Encoding Cyanase. (rcsb.org)
  • The gene expression profile of this cell type is revealed by analyzing both the frequency with which a message is encountered and the functional categorization of expressed sequences. (elsevier.com)
  • We provide a catalog of polymorphic tandem repeats across a variety of repeat unit lengths and sequences, from long read sequencing data. (researchsquare.com)
  • Low cost and massively parallel sequencing technologies have revolutionized the area of genomics research in last two decades. (jcbose.ac.in)