A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.
The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.
A multistage process that includes the determination of a sequence (protein, carbohydrate, etc.), its fragmentation and analysis, and the interpretation of the resulting sequence information.
The relationships of groups of organisms as reflected by their genetic makeup.
The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.
Constituent of 30S subunit prokaryotic ribosomes containing 1600 nucleotides and 21 proteins. 16S rRNA is involved in initiation of polypeptide synthesis.
Deoxyribonucleic acid that makes up the genetic material of bacteria.
The sequential correspondence of nucleotides in one nucleic acid molecule with those of another nucleic acid molecule. Sequence homology is an indication of the genetic relatedness of different organisms and gene function.
DNA sequences encoding RIBOSOMAL RNA and the segments of DNA separating the individual ribosomal RNA genes, referred to as RIBOSOMAL SPACER DNA.
The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.
The arrangement of two or more amino acid or base sequences from an organism or organisms in such a way as to align areas of the sequences sharing common properties. The degree of relatedness or homology between the sequences is predicted computationally or statistically based on weights assigned to the elements aligned between the sequences. This in turn can serve as a potential indicator of the genetic relatedness between the organisms.
The functional hereditary units of BACTERIA.
In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships.
Use of restriction endonucleases to analyze and generate a physical map of genomes, genes, or other segments of DNA.
The relative amounts of the PURINES and PYRIMIDINES in a nucleic acid.
Proteins found in any species of bacterium.
A sequence of successive nucleotide triplets that are read as CODONS specifying AMINO ACIDS and begin with an INITIATOR CODON and end with a stop codon (CODON, TERMINATOR).
Genes, found in both prokaryotes and eukaryotes, which are transcribed to produce the RNA which is incorporated into RIBOSOMES. Prokaryotic rRNA genes are usually found in OPERONS dispersed throughout the GENOME, whereas eukaryotic rRNA genes are clustered, multicistronic transcriptional units.
Widely used technique which exploits the ability of complementary sequences in single-stranded DNAs or RNAs to pair with each other to form a double helix. Hybridization can take place between two complimentary DNA sequences, between a single-stranded DNA and a complementary RNA, or between two RNA sequences. The technique is used to detect and isolate specific sequences, measure homology, or define other characteristics of one or both strands. (Kendrew, Encyclopedia of Molecular Biology, 1994, p503)
A process that includes the determination of AMINO ACID SEQUENCE of a protein (or peptide, oligopeptide or peptide fragment) and the information analysis of the sequence.
A deoxyribonucleotide polymer that is the primary genetic material of all cells. Eukaryotic and prokaryotic organisms normally contain DNA in a double-stranded state, yet several important biological processes transiently involve single-stranded regions. DNA, which consists of a polysugar-phosphate backbone possessing projections of purines (adenine and guanine) and pyrimidines (thymine and cytosine), forms a double helix that is held together by hydrogen bonds between these purines and pyrimidines (adenine to thymine and guanine to cytosine).
Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.
The restriction of a characteristic behavior, anatomical structure or physical system, such as immune response; metabolic response, or gene or gene variant to the members of one species. It refers to that property which differentiates one species from another but it is also used for phylogenetic levels higher or lower than the species.
Procedures for identifying types and strains of bacteria. The most frequently employed typing systems are BACTERIOPHAGE TYPING and SEROTYPING as well as bacteriocin typing and biotyping.
A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.
Single-stranded complementary DNA synthesized from an RNA template by the action of RNA-dependent DNA polymerase. cDNA (i.e., complementary DNA, not circular DNA, not C-DNA) is used in a variety of molecular cloning experiments as well as serving as a specific hybridization probe.
Extrachromosomal, usually CIRCULAR DNA molecules that are self-replicating and transferable from one organism to another. They are found in a variety of bacterial, archaeal, fungal, algal, and plant species. They are used in GENETIC ENGINEERING as CLONING VECTORS.
Short sequences (generally about 10 base pairs) of DNA that are complementary to sequences of messenger RNA and allow reverse transcriptases to start copying the adjacent sequences of mRNA. Primers are used extensively in genetic and molecular biology techniques.
A set of genes descended by duplication and variation from some ancestral gene. Such genes may be clustered together on the same chromosome or dispersed on different chromosomes. Examples of multigene families include those that encode the hemoglobins, immunoglobulins, histocompatibility antigens, actins, tubulins, keratins, collagens, heat shock proteins, salivary glue proteins, chorion proteins, cuticle proteins, yolk proteins, and phaseolins, as well as histones, ribosomal RNA, and transfer RNA genes. The latter three are examples of reiterated genes, where hundreds of identical genes are present in a tandem array. (King & Stanfield, A Dictionary of Genetics, 4th ed)
A category of nucleic acid sequences that function as units of heredity and which code for the basic instructions for the development, reproduction, and maintenance of organisms.
The intergenic DNA segments that are between the ribosomal RNA genes (internal transcribed spacers) and between the tandemly repeated units of rDNA (external transcribed spacers and nontranscribed spacers).
Ribonucleic acid in bacteria having regulatory and catalytic roles as well as involvement in protein synthesis.
Genotypic differences observed among individuals in a population.
RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.
Any method used for determining the location of and relative distances between genes on a chromosome.
The degree of similarity between sequences. Studies of AMINO ACID SEQUENCE HOMOLOGY and NUCLEIC ACID SEQUENCE HOMOLOGY provide useful information about the genetic relatedness of genes, gene products, and species.
A method (first developed by E.M. Southern) for detection of DNA that has been electrophoretically separated and immobilized by blotting on nitrocellulose or other type of paper or nylon membrane followed by hybridization with labeled NUCLEIC ACID PROBES.
A large collection of DNA fragments cloned (CLONING, MOLECULAR) from a given organism, tissue, organ, or cell type. It may contain complete genomic sequences (GENOMIC LIBRARY) or complementary DNA sequences, the latter being formed from messenger RNA and lacking intron sequences.
The biosynthesis of RNA carried out on a template of DNA. The biosynthesis of DNA from an RNA template is called REVERSE TRANSCRIPTION.
The outward appearance of the individual. It is the product of interactions between genes, and between the GENOTYPE and the environment.
The presence of bacteria, viruses, and fungi in the soil. This term is not restricted to pathogenic organisms.
Sequences of DNA or RNA that occur in multiple copies. There are several types: INTERSPERSED REPETITIVE SEQUENCES are copies of transposable elements (DNA TRANSPOSABLE ELEMENTS or RETROELEMENTS) dispersed throughout the genome. TERMINAL REPEAT SEQUENCES flank both ends of another sequence, for example, the long terminal repeats (LTRs) on RETROVIRUSES. Variations may be direct repeats, those occurring in the same direction, or inverted repeats, those opposite to each other in direction. TANDEM REPEAT SEQUENCES are copies which lie adjacent to each other, direct or inverted (INVERTED REPEAT SEQUENCES).
The complete genetic complement contained in a DNA or RNA molecule in a virus.
The sum of the weight of all the atoms in a molecule.
Enzymes that are part of the restriction-modification systems. They catalyze the endonucleolytic cleavage of DNA sequences which lack the species-specific methylation pattern in the host cell's DNA. Cleavage yields random or specific double-stranded fragments with terminal 5'-phosphates. The function of restriction enzymes is to destroy any foreign DNA that invades the host cell. Most have been studied in bacterial systems, but a few have been found in eukaryotic organisms. They are also used as tools for the systematic dissection and mapping of chromosomes, in the determination of base sequences of DNAs, and have made it possible to splice and recombine genes from one organism into the genome of another. EC 3.21.1.
A multistage process that includes cloning, physical mapping, subcloning, sequencing, and information analysis of an RNA SEQUENCE.
A sequence of amino acids in a polypeptide or of nucleotides in DNA or RNA that is similar across multiple species. A known set of conserved sequences is represented by a CONSENSUS SEQUENCE. AMINO ACID MOTIFS are often composed of conserved sequences.
Discrete segments of DNA which can excise and reintegrate to another site in the genome. Most are inactive, i.e., have not been found to exist outside the integrated state. DNA transposable elements include bacterial IS (insertion sequence) elements, Tn elements, the maize controlling elements Ac and Ds, Drosophila P, gypsy, and pogo elements, the human Tigger elements and the Tc and mariner elements which are found throughout the animal kingdom.
Deoxyribonucleic acid that makes up the genetic material of viruses.
A set of statistical methods used to group variables or observations into strongly inter-related subgroups. In epidemiology, it may be used to analyze a closely grouped series of events or cases of disease or other health-related phenomenon with well-defined distribution patterns in relation to time or place or both.
The process of cumulative change at the level of DNA; RNA; and PROTEINS, over successive generations.
The parts of a transcript of a split GENE remaining after the INTRONS are removed. They are spliced together to become a MESSENGER RNA or other functional RNA.
Deoxyribonucleic acid that makes up the genetic material of fungi.
The functional hereditary units of VIRUSES.
Electrophoresis in which a polyacrylamide gel is used as the diffusion medium.
The genetic constitution of the individual, comprising the ALLELES present at each GENETIC LOCUS.
Biochemical identification of mutational changes in a nucleotide sequence.
A test used to determine whether or not complementation (compensation in the form of dominance) will occur in a cell with a given mutant phenotype when another mutant genome, encoding the same mutant phenotype, is introduced into that cell.
Organic, monobasic acids derived from hydrocarbons by the equivalent of oxidation of a methyl group to an alcohol, aldehyde, and then acid. Fatty acids are saturated and unsaturated (FATTY ACIDS, UNSATURATED). (Grant & Hackh's Chemical Dictionary, 5th ed)
Detection of RNA that has been electrophoretically separated and immobilized by blotting on nitrocellulose or other type of paper or nylon membrane followed by hybridization with labeled NUCLEIC ACID PROBES.
Variation occurring within a species in the presence or length of DNA fragment generated by a specific endonuclease at a specific site in the genome. Such variations are generated by mutations that create or abolish recognition sites for these enzymes or change the length of the fragment.
Mutagenesis where the mutation is caused by the introduction of foreign DNA sequences into a gene or extragenic sequence. This may occur spontaneously in vivo or be experimentally induced in vivo or in vitro. Proviral DNA insertions into or adjacent to a cellular proto-oncogene can interrupt GENETIC TRANSLATION of the coding sequences or interfere with recognition of regulatory elements and cause unregulated expression of the proto-oncogene resulting in tumor formation.
Partial proteins formed by partial hydrolysis of complete proteins or generated through PROTEIN ENGINEERING techniques.
The parts of a macromolecule that directly participate in its specific combination with another molecule.
A form of GENE LIBRARY containing the complete DNA sequences present in the genome of a given organism. It contrasts with a cDNA library which contains only sequences utilized in protein coding (lacking introns).
DNA sequences which are recognized (directly or indirectly) and bound by a DNA-dependent RNA polymerase during the initiation of transcription. Highly conserved sequences within the promoter include the Pribnow box in bacteria and the TATA BOX in eukaryotes.
A set of three nucleotides in a protein coding sequence that specifies individual amino acids or a termination signal (CODON, TERMINATOR). Most codons are universal, but some organisms do not produce the transfer RNAs (RNA, TRANSFER) complementary to all codons. These codons are referred to as unassigned codons (CODONS, NONSENSE).
Ribonucleic acid that makes up the genetic material of viruses.
Liquid chromatographic techniques which feature high inlet pressures, high sensitivity, and high speed.
Sequences of DNA in the genes that are located between the EXONS. They are transcribed along with the exons but are removed from the primary gene transcript by RNA SPLICING to leave mature RNA. Some introns code for separate genes.
Proteins prepared by recombinant DNA technology.
Synthetic or natural oligonucleotides used in hybridization studies in order to identify and study specific nucleic acid fragments, e.g., DNA segments near or within a specific gene locus or gene. The probe hybridizes with a specific mRNA, if present. Conventional techniques used for testing for the hybridization product include dot blot assays, Southern blot assays, and DNA:RNA hybrid-specific antibody tests. Conventional labels for the probe include the radioisotope labels 32P and 125I and the chemical label biotin.
Domesticated bovine animals of the genus Bos, usually kept on a farm or ranch and used for the production of meat or dairy products or for heavy labor.
In bacteria, a group of metabolically related genes, with a common promoter, whose transcription into a single polycistronic MESSENGER RNA is under the control of an OPERATOR REGION.
Established cell cultures that have the potential to propagate indefinitely.
Proteins found in any species of virus.
A mutation caused by the substitution of one nucleotide for another. This results in the DNA molecule having a change in a single base pair.
The salinated water of OCEANS AND SEAS that provides habitat for marine organisms.
Variant forms of the same gene, occupying the same locus on homologous CHROMOSOMES, and governing the variants in production of the same gene product.
The phenotypic manifestation of a gene or genes by the processes of GENETIC TRANSCRIPTION and GENETIC TRANSLATION.
An order of gram-positive, primarily aerobic BACTERIA that tend to form branching filaments.
Direct nucleotide sequencing of gene fragments from multiple housekeeping genes for the purpose of phylogenetic analysis, organism identification, and typing of species, strain, serovar, or other distinguishable phylogenetic level.
Production of new arrangements of DNA by various mechanisms such as assortment and segregation, CROSSING OVER; GENE CONVERSION; GENETIC TRANSFORMATION; GENETIC CONJUGATION; GENETIC TRANSDUCTION; or mixed infection of viruses.
Organic compounds that generally contain an amino (-NH2) and a carboxyl (-COOH) group. Twenty alpha-amino acids are the subunits which are polymerized to form proteins.
Any of the processes by which cytoplasmic or intercellular factors influence the differential control of gene action in bacteria.
The functional hereditary units of FUNGI.
A serine endopeptidase that is formed from TRYPSINOGEN in the pancreas. It is converted into its active form by ENTEROPEPTIDASE in the small intestine. It catalyzes hydrolysis of the carboxyl group of either arginine or lysine. EC 3.4.21.4.
A theoretical representative nucleotide or amino acid sequence in which each nucleotide or amino acid is the one which occurs most frequently at that site in the different sequences which occur in nature. The phrase also refers to an actual sequence which approximates the theoretical consensus. A known CONSERVED SEQUENCE set is represented by a consensus sequence. Commonly observed supersecondary protein structures (AMINO ACID MOTIFS) are often formed by conserved sequences.
A variation of the PCR technique in which cDNA is made from RNA via reverse transcription. The resultant cDNA is then amplified using standard PCR protocols.
Cyanogen bromide (CNBr). A compound used in molecular biology to digest some proteins and as a coupling reagent for phosphoroamidate or pyrophosphate internucleotide bonds in DNA duplexes.
A polynucleotide consisting essentially of chains with a repeating backbone of phosphate and ribose units to which nitrogenous bases are attached. RNA is unique among biological macromolecules in that it can encode genetic information, serve as an abundant structural component of cells, and also possesses catalytic activity. (Rieger et al., Glossary of Genetics: Classical and Molecular, 5th ed)
A class in the phylum PROTEOBACTERIA comprised mostly of two major phenotypes: purple non-sulfur bacteria and aerobic bacteriochlorophyll-containing bacteria.
The spatial arrangement of the atoms of a nucleic acid or polynucleotide that results in its characteristic 3-dimensional shape.
The presence of bacteria, viruses, and fungi in water. This term is not restricted to pathogenic organisms.
Linear POLYPEPTIDES that are synthesized on RIBOSOMES and may be further modified, crosslinked, cleaved, or assembled into complex proteins with several subunits. The specific sequence of AMINO ACIDS determines the shape the polypeptide will take, during PROTEIN FOLDING, and the function of the protein.
A mass of organic or inorganic solid fragmented material, or the solid fragment itself, that comes from the weathering of rock and is carried by, suspended in, or dropped by air, water, or ice. It refers also to a mass that is accumulated by any other natural agent and that forms in layers on the earth's surface, such as sand, gravel, silt, mud, fill, or loess. (McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed, p1689)
The degree of pathogenicity within a group or species of microorganisms or viruses as indicated by case fatality rates and/or the ability of the organism to invade the tissues of the host. The pathogenic capacity of an organism is determined by its VIRULENCE FACTORS.
The characteristic 3-dimensional shape of a protein, including the secondary, supersecondary (motifs), tertiary (domains) and quaternary structure of the peptide chain. PROTEIN STRUCTURE, QUATERNARY describes the conformation assumed by multimeric proteins (aggregates of more than one polypeptide chain).
The biosynthesis of PEPTIDES and PROTEINS on RIBOSOMES, directed by MESSENGER RNA, via TRANSFER RNA that is charged with standard proteinogenic AMINO ACIDS.
Constituent of 50S subunit of prokaryotic ribosomes containing about 3200 nucleotides. 23S rRNA is involved in the initiation of polypeptide synthesis.
A characteristic feature of enzyme activity in relation to the kind of substrate on which the enzyme or catalytic molecule reacts.
The record of descent or ancestry, particularly of a particular condition or trait, indicating individual family members, their relationships, and their status with respect to the trait or condition.
Deletion of sequences of nucleic acids from the genetic material of an individual.
The genetic complement of a BACTERIA as represented in its DNA.
Common name for the species Gallus gallus, the domestic fowl, in the family Phasianidae, order GALLIFORMES. It is descended from the red jungle fowl of SOUTHEAST ASIA.
Biologically active DNA which has been formed by the in vitro joining of segments of DNA from different sources. It includes the recombination joint or edge of a heteroduplex region where two recombining DNA molecules are connected.
Proteins which are found in membranes including cellular and intracellular membranes. They consist of two types, peripheral and integral proteins. They include most membrane-associated enzymes, antigenic proteins, transport proteins, and drug, hormone, and lectin receptors.
One of the three domains of life (the others being Eukarya and ARCHAEA), also called Eubacteria. They are unicellular prokaryotic microorganisms which generally possess rigid cell walls, multiply by cell division, and exhibit three principal forms: round or coccal, rodlike or bacillary, and spiral or spirochetal. Bacteria can be classified by their response to OXYGEN: aerobic, anaerobic, or facultatively anaerobic; by the mode by which they obtain their energy: chemotrophy (via chemical reaction) or PHOTOTROPHY (via light reaction); for chemotrophs by their source of chemical energy: CHEMOLITHOTROPHY (from inorganic compounds) or chemoorganotrophy (from organic compounds); and by their source for CARBON; NITROGEN; etc.; HETEROTROPHY (from organic sources) or AUTOTROPHY (from CARBON DIOXIDE). They can also be classified by whether or not they stain (based on the structure of their CELL WALLS) with CRYSTAL VIOLET dye: gram-negative or gram-positive.
Proteins found in plants (flowers, herbs, shrubs, trees, etc.). The concept does not include proteins found in vegetables for which VEGETABLE PROTEINS is available.
The regular and simultaneous occurrence in a single interbreeding population of two or more discontinuous genotypes. The concept includes differences in genotypes ranging in size from a single nucleotide site (POLYMORPHISM, SINGLE NUCLEOTIDE) to large nucleotide sequences visible at a chromosomal level.
Sequential operating programs and data which instruct the functioning of a digital computer.
The level of protein structure in which combinations of secondary protein structures (alpha helices, beta sheets, loop regions, and motifs) pack together to form folded shapes called domains. Disulfide bridges between cysteines in two different parts of the polypeptide chain along with other interactions between the chains play a role in the formation and stabilization of tertiary structure. Small proteins usually consist of only one domain but larger proteins may contain a number of domains connected by segments of polypeptide chain which lack regular secondary structure.
A genus of bacteria that form a nonfragmented aerial mycelium. Many species have been identified with some being pathogenic. This genus is responsible for producing a majority of the ANTI-BACTERIAL AGENTS of practical value.
Models used experimentally or theoretically to study molecular shape, electronic properties, or interactions; includes analogous molecules, computer-generated graphics, and mechanical structures.
Constituent of the 60S subunit of eukaryotic ribosomes. 5.8S rRNA is involved in the initiation of polypeptide synthesis in eukaryotes.
Multicellular, eukaryotic life forms of kingdom Plantae (sensu lato), comprising the VIRIDIPLANTAE; RHODOPHYTA; and GLAUCOPHYTA; all of which acquired chloroplasts by direct endosymbiosis of CYANOBACTERIA. They are characterized by a mainly photosynthetic mode of nutrition; essentially unlimited growth at localized regions of cell divisions (MERISTEMS); cellulose within cells providing rigidity; the absence of organs of locomotion; absence of nervous and sensory systems; and an alternation of haploid and diploid generations.
Former kingdom, located on Korea Peninsula between Sea of Japan and Yellow Sea on east coast of Asia. In 1948, the kingdom ceased and two independent countries were formed, divided by the 38th parallel.
Process of generating a genetic MUTATION. It may occur spontaneously or be induced by MUTAGENS.
The process of cumulative change over successive generations through which organisms acquire their distinguishing morphological and physiological characteristics.
Transport proteins that carry specific substances in the blood or across cell membranes.
Genes which regulate or circumscribe the activity of other genes; specifically, genes which code for PROTEINS or RNAs which have GENE EXPRESSION REGULATION functions.
A group of the proteobacteria comprised of facultatively anaerobic and fermentative gram-negative bacteria.
A genetic rearrangement through loss of segments of DNA or RNA, bringing sequences which are normally separated into close proximity. This deletion may be detected using cytogenetic techniques and can also be inferred from the phenotype, indicating a deletion at one specific locus.
A group of deoxyribonucleotides (up to 12) in which the phosphate residues of each deoxyribonucleotide act as bridges in forming diester linkages between the deoxyribose moieties.
Any of various animals that constitute the family Suidae and comprise stout-bodied, short-legged omnivorous mammals with thick skin, usually covered with coarse bristles, a rather long mobile snout, and small tail. Included are the genera Babyrousa, Phacochoerus (wart hogs), and Sus, the latter containing the domestic pig (see SUS SCROFA).
The class of all enzymes catalyzing oxidoreduction reactions. The substrate that is oxidized is regarded as a hydrogen donor. The systematic name is based on donor:acceptor oxidoreductase. The recommended name will be dehydrogenase, wherever this is possible; as an alternative, reductase can be used. Oxidase is only used in cases where O2 is the acceptor. (Enzyme Nomenclature, 1992, p9)
Any normal or abnormal coloring matter in PLANTS; ANIMALS or micro-organisms.
A field of biology concerned with the development of techniques for the collection and manipulation of biological data, and the use of such data to make biological discoveries or predictions. This field encompasses all computational methods and theories for solving biological problems including manipulation of models and datasets.
Deoxyribonucleic acid that makes up the genetic material of plants.
Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control (induction or repression) of gene action at the level of transcription or translation.
The most abundant form of RNA. Together with proteins, it forms the ribosomes, playing a structural role and also a role in ribosomal binding of mRNA and tRNAs. Individual chains are conventionally designated by their sedimentation coefficients. In eukaryotes, four large chains exist, synthesized in the nucleolus and constituting about 50% of the ribosome. (Dorland, 28th ed)
Proteins isolated from the outer membrane of Gram-negative bacteria.
Endogenous substances, usually proteins, which are effective in the initiation, stimulation, or termination of the genetic transcription process.
A group of adenine ribonucleotides in which the phosphate residues of each adenine ribonucleotide act as bridges in forming diester linkages between the ribose moieties.
Diseases of plants.
The property of objects that determines the direction of heat flow when they are placed in direct thermal contact. The temperature is the energy of microscopic motions (vibrational and translational) of the particles of atoms.
The sequential location of genes on a chromosome.
Analysis of PEPTIDES that are generated from the digestion or fragmentation of a protein or mixture of PROTEINS, by ELECTROPHORESIS; CHROMATOGRAPHY; or MASS SPECTROMETRY. The resulting peptide fingerprints are analyzed for a variety of purposes including the identification of the proteins in a sample, GENETIC POLYMORPHISMS, patterns of gene expression, and patterns diagnostic for diseases.
Proteins which bind to DNA. The family includes proteins which bind to both double- and single-stranded DNA and also includes specific DNA binding proteins in serum which can be used as markers for malignant diseases.
A genus of gram-negative, aerobic, rod-shaped bacteria widely distributed in nature. Some species are pathogenic for humans, animals, and plants.
Constituent of the 40S subunit of eukaryotic ribosomes. 18S rRNA is involved in the initiation of polypeptide synthesis in eukaryotes.
The rate dynamics in chemical or physical systems.
A species of the genus SACCHAROMYCES, family Saccharomycetaceae, order Saccharomycetales, known as "baker's" or "brewer's" yeast. The dried form is used as a dietary supplement.
Species- or subspecies-specific DNA (including COMPLEMENTARY DNA; conserved genes, whole chromosomes, or whole genomes) used in hybridization studies in order to identify microorganisms, to measure DNA-DNA homologies, to group subspecies, etc. The DNA probe hybridizes with a specific mRNA, if present. Conventional techniques used for testing for the hybridization product include dot blot assays, Southern blot assays, and DNA:RNA hybrid-specific antibody tests. Conventional labels for the DNA probe include the radioisotope labels 32P and 125I and the chemical label biotin. The use of DNA probes provides a specific, sensitive, rapid, and inexpensive replacement for cell culture techniques for diagnosing infections.
Members of the class of compounds composed of AMINO ACIDS joined together by peptide bonds between adjacent amino acids into linear, branched or cyclical structures. OLIGOPEPTIDES are composed of approximately 2-12 amino acids. Polypeptides are composed of approximately 13 or more amino acids. PROTEINS are linear polypeptides that are normally synthesized on RIBOSOMES.
Procedures for identifying types and strains of fungi.
A country spanning from central Asia to the Pacific Ocean.
Proteins that form the CAPSID of VIRUSES.
A technique for identifying individuals of a species that is based on the uniqueness of their DNA sequence. Uniqueness is determined by identifying which combination of allelic variations occur in the individual at a statistically relevant number of different loci. In forensic studies, RESTRICTION FRAGMENT LENGTH POLYMORPHISM of multiple, highly polymorphic VNTR LOCI or MICROSATELLITE REPEAT loci are analyzed. The number of loci used for the profile depends on the ALLELE FREQUENCY in the population.
The ultimate exclusion of nonsense sequences or intervening sequences (introns) before the final RNA transcript is sent to the cytoplasm.
A process whereby multiple RNA transcripts are generated from a single gene. Alternative splicing involves the splicing together of other possible sets of EXONS during the processing of some, but not all, transcripts of the gene. Thus a particular exon may be connected to any one of several alternative exons to form a mature RNA. The alternative forms of mature MESSENGER RNA produce PROTEIN ISOFORMS in which one part of the isoforms is common while the other parts are different.
Plasmids containing at least one cos (cohesive-end site) of PHAGE LAMBDA. They are used as cloning vehicles.
Hydrocarbon rings which contain two ketone moieties in any position. They can be substituted in any position except at the ketone groups.
A mutation in which a codon is mutated to one directing the incorporation of a different amino acid. This substitution may result in an inactive or unstable product. (From A Dictionary of Genetics, King & Stansfield, 5th ed)
Recombinant proteins produced by the GENETIC TRANSLATION of fused genes formed by the combination of NUCLEIC ACID REGULATORY SEQUENCES of one or more genes with the protein coding sequences of one or more genes.
Proteins found in any species of fungus.
Variation in a population's DNA sequence that is detected by determining alterations in the conformation of denatured DNA fragments. Denatured DNA fragments are allowed to renature under conditions that prevent the formation of double-stranded DNA and allow secondary structure to form in single stranded fragments. These fragments are then run through polyacrylamide gels to detect variations in the secondary structure that is manifested as an alteration in migration through the gels.
The process in which substances, either endogenous or exogenous, bind to proteins, peptides, enzymes, protein precursors, or allied compounds. Specific protein-binding measures are often used as assays in diagnostic assessments.
Water containing no significant amounts of salts, such as water from RIVERS and LAKES.
Proteins obtained from ESCHERICHIA COLI.
Viral proteins that are components of the mature assembled VIRUS PARTICLES. They may include nucleocapsid core proteins (gag proteins), enzymes packaged within the virus particle (pol proteins), and membrane components (env proteins). These do not include the proteins encoded in the VIRAL GENOME that are produced in infected cells but which are not packaged in the mature virus particle,i.e. the so called non-structural proteins (VIRAL NONSTRUCTURAL PROTEINS).
A genus of gram-negative, anaerobic, nonsporeforming, nonmotile rods. Organisms of this genus had originally been classified as members of the BACTEROIDES genus but overwhelming biochemical and chemical findings in 1990 indicated the need to separate them from other Bacteroides species, and hence, this new genus was established.
The level of protein structure in which regular hydrogen-bond interactions within contiguous stretches of polypeptide chain give rise to alpha helices, beta strands (which align to form beta sheets) or other types of coils. This is the first folding level of protein conformation.
The three possible sequences of CODONS by which GENETIC TRANSLATION may occur from one nucleotide sequence. A segment of mRNA 5'AUCCGA3' could be translated as 5'AUC.. or 5'UCC.. or 5'CCG.., depending on the location of the START CODON.
A genus of BACILLACEAE that are spore-forming, rod-shaped cells. Most species are saprophytic soil forms with only a few species being pathogenic.
A type of mutation in which a number of NUCLEOTIDES deleted from or inserted into a protein coding sequence is not divisible by three, thereby causing an alteration in the READING FRAMES of the entire coding sequence downstream of the mutation. These mutations may be induced by certain types of MUTAGENS or may occur spontaneously.
A subclass of PEPTIDE HYDROLASES that catalyze the internal cleavage of PEPTIDES or PROTEINS.
Theoretical representations that simulate the behavior or activity of genetic processes or phenomena. They include the use of mathematical equations, computers, and other electronic equipment.
Nucleic acid sequences involved in regulating the expression of genes.
Genetically engineered MUTAGENESIS at a specific site in the DNA molecule that introduces a base substitution, or an insertion or deletion.
Identification of proteins or peptides that have been electrophoretically separated by blot transferring from the electrophoresis gel to strips of nitrocellulose paper, followed by labeling with antibody probes.
Separation technique in which the stationary phase consists of ion exchange resins. The resins contain loosely held small ions that easily exchange places with other small ions of like charge present in solutions washed over the resins.
The outer protein protective shell of a virus, which protects the viral nucleic acid.
The application of molecular biology to the answering of epidemiological questions. The examination of patterns of changes in DNA to implicate particular carcinogens and the use of molecular markers to predict which individuals are at highest risk for a disease are common examples.
Life or metabolic reactions occurring in an environment containing oxygen.
The uptake of naked or purified DNA by CELLS, usually meaning the process as it occurs in eukaryotic cells. It is analogous to bacterial transformation (TRANSFORMATION, BACTERIAL) and both are routinely employed in GENE TRANSFER TECHNIQUES.
Genes bearing close resemblance to known genes at different loci, but rendered non-functional by additions or deletions in structure that prevent normal transcription or translation. When lacking introns and containing a poly-A segment near the downstream end (as a result of reverse copying from processed nuclear RNA into double-stranded DNA), they are called processed genes.
A genus of asporogenous bacteria that is widely distributed in nature. Its organisms appear as straight to slightly curved rods and are known to be human and animal parasites and pathogens.
The functional hereditary units of PLANTS.
Double-stranded DNA of MITOCHONDRIA. In eukaryotes, the mitochondrial GENOME is circular and codes for ribosomal RNAs, transfer RNAs, and about 10 proteins.
Any member of the group of ENDOPEPTIDASES containing at the active site a serine residue involved in catalysis.
DNA constructs that are composed of, at least, a REPLICATION ORIGIN, for successful replication, propagation to and maintenance as an extra chromosome in bacteria. In addition, they can carry large amounts (about 200 kilobases) of other sequence for a variety of bioengineering purposes.
Any of the DNA in between gene-coding DNA, including untranslated regions, 5' and 3' flanking regions, INTRONS, non-functional pseudogenes, and non-functional repetitive sequences. This DNA may or may not encode regulatory functions.
Commonly observed structural components of proteins formed by simple combinations of adjacent secondary structures. A commonly observed structure may be composed of a CONSERVED SEQUENCE which can be represented by a CONSENSUS SEQUENCE.
Compounds and molecular complexes that consist of very large numbers of atoms and are generally over 500 kDa in size. In biological systems macromolecular substances usually can be visualized using ELECTRON MICROSCOPY and are distinguished from ORGANELLES by the lack of a membrane structure.
Habitat of hot water naturally heated by underlying geologic processes. Surface hot springs have been used for BALNEOLOGY. Underwater hot springs are called HYDROTHERMAL VENTS.
Structures within the nucleus of bacterial cells consisting of or containing DNA, which carry genetic information essential to the cell.
Deoxyribonucleic acid that makes up the genetic material of protozoa.
The genetic complement of an organism, including all of its GENES, as represented in its DNA, or in some cases, its RNA.
A ubiquitous sodium salt that is commonly used to season food.
The normality of a solution with respect to HYDROGEN ions; H+. It is related to acidity measurements in most cases by pH = log 1/2[1/(H+)], where (H+) is the hydrogen ion concentration in gram equivalents per liter of solution. (McGraw-Hill Dictionary of Scientific and Technical Terms, 6th ed)
Actual loss of portion of a chromosome.
Refuse liquid or waste matter carried off by sewers.
Deoxyribonucleic acid that makes up the genetic material of archaea.
The species Oryctolagus cuniculus, in the family Leporidae, order LAGOMORPHA. Rabbits are born in burrows, furless, and with eyes and ears closed. In contrast with HARES, rabbits have 22 chromosome pairs.
The relationship between the chemical structure of a compound and its biological or pharmacological activity. Compounds are often classed together because they have structural characteristics in common including shape, size, stereochemical arrangement, and distribution of functional groups.
Amino acid sequences found in transported proteins that selectively guide the distribution of the proteins to specific cellular compartments.
A genus of gram-positive, microaerophilic, rod-shaped bacteria occurring widely in nature. Its species are also part of the many normal flora of the mouth, intestinal tract, and vagina of many mammals, including humans. Pathogenicity from this genus is rare.
The naturally occurring or experimentally induced replacement of one or more AMINO ACIDS in a protein with another. If a functionally equivalent amino acid is substituted, the protein may retain wild-type activity. Substitution may also diminish, enhance, or eliminate protein function. Experimentally induced substitution is often used to study enzyme activities and binding site properties.

Novel regulation of the homeotic gene Scr associated with a crustacean leg-to-maxilliped appendage transformation. (1/46886)

Homeotic genes are known to be involved in patterning morphological structures along the antero-posterior axis of insects and vertebrates. Because of their important roles in development, changes in the function and expression patterns of homeotic genes may have played a major role in the evolution of different body plans. For example, it has been proposed that during the evolution of several crustacean lineages, changes in the expression patterns of the homeotic genes Ultrabithorax and abdominal-A have played a role in transformation of the anterior thoracic appendages into mouthparts termed maxillipeds. This homeotic-like transformation is recapitulated at the late stages of the direct embryonic development of the crustacean Porcellio scaber (Oniscidea, Isopoda). Interestingly, this morphological change is associated with apparent novelties both in the transcriptional and post-transcriptional regulation of the Porcellio scaber ortholog of the Drosophila homeotic gene, Sex combs reduced (Scr). Specifically, we find that Scr mRNA is present in the second maxillary segment and the first pair of thoracic legs (T1) in early embryos, whereas protein accumulates only in the second maxillae. In later stages, however, high levels of SCR appear in the T1 legs, which correlates temporally with the transformation of these appendages into maxillipeds. Our observations provide further insight into the process of the homeotic leg-to-maxilliped transformation in the evolution of crustaceans and suggest a novel regulatory mechanism for this process in this group of arthropods.  (+info)

Mrj encodes a DnaJ-related co-chaperone that is essential for murine placental development. (2/46886)

We have identified a novel gene in a gene trap screen that encodes a protein related to the DnaJ co-chaperone in E. coli. The gene, named Mrj (mammalian relative of DnaJ) was expressed throughout development in both the embryo and placenta. Within the placenta, expression was particularly high in trophoblast giant cells but moderate levels were also observed in trophoblast cells of the chorion at embryonic day 8.5, and later in the labyrinth which arises from the attachment of the chorion to the allantois (a process called chorioallantoic fusion). Insertion of the ROSAbetageo gene trap vector into the Mrj gene created a null allele. Homozygous Mrj mutants died at mid-gestation due to a failure of chorioallantoic fusion at embryonic day 8.5, which precluded formation of the mature placenta. At embryonic day 8.5, the chorion in mutants was morphologically normal and expressed the cell adhesion molecule beta4 integrin that is known to be required for chorioallantoic fusion. However, expression of the chorionic trophoblast-specific transcription factor genes Err2 and Gcm1 was significantly reduced. The mutants showed no abnormal phenotypes in other trophoblast cell types or in the embryo proper. This study indicates a previously unsuspected role for chaperone proteins in placental development and represents the first genetic analysis of DnaJ-related protein function in higher eukaryotes. Based on a survey of EST databases representing different mouse tissues and embryonic stages, there are 40 or more DnaJ-related genes in mammals. In addition to Mrj, at least two of these genes are also expressed in the developing mouse placenta. The specificity of the developmental defect in Mrj mutants suggests that each of these genes may have unique tissue and cellular activities.  (+info)

Requirement of a novel gene, Xin, in cardiac morphogenesis. (3/46886)

A novel gene, Xin, from chick (cXin) and mouse (mXin) embryonic hearts, may be required for cardiac morphogenesis and looping. Both cloned cDNAs have a single open reading frame, encoding proteins with 2,562 and 1,677 amino acids for cXin and mXin, respectively. The derived amino acid sequences share 46% similarity. The overall domain structures of the predicted cXin and mXin proteins, including proline-rich regions, 16 amino acid repeats, DNA-binding domains, SH3-binding motifs and nuclear localization signals, are highly conserved. Northern blot analyses detect a single message of 8.9 and 5.8 kilo base (kb) from both cardiac and skeletal muscle of chick and mouse, respectively. In situ hybridization reveals that the cXin gene is specifically expressed in cardiac progenitor cells of chick embryos as early as stage 8, prior to heart tube formation. cXin continues to be expressed in the myocardium of developing hearts. By stage 15, cXin expression is also detected in the myotomes of developing somites. Immunofluorescence microscopy reveals that the mXin protein is colocalized with N-cadherin and connexin-43 in the intercalated discs of adult mouse hearts. Incubation of stage 6 chick embryos with cXin antisense oligonucleotides results in abnormal cardiac morphogenesis and an alteration of cardiac looping. The myocardium of the affected hearts becomes thickened and tends to form multiple invaginations into the heart cavity. This abnormal cellular process may account in part for the abnormal looping. cXin expression can be induced by bone morphogenetic protein (BMP) in explants of anterior medial mesoendoderm from stage 6 chick embryos, a tissue that is normally non-cardiogenic. This induction occurs following the BMP-mediated induction of two cardiac-restricted transcription factors, Nkx2.5 and MEF2C. Furthermore, either MEF2C or Nkx2.5 can transactivate a luciferase reporter driven by the mXin promoter in mouse fibroblasts. These results suggest that Xin may participate in a BMP-Nkx2.5-MEF2C pathway to control cardiac morphogenesis and looping.  (+info)

Characterization of an amphioxus paired box gene, AmphiPax2/5/8: developmental expression patterns in optic support cells, nephridium, thyroid-like structures and pharyngeal gill slits, but not in the midbrain-hindbrain boundary region. (4/46886)

On the basis of developmental gene expression, the vertebrate central nervous system comprises: a forebrain plus anterior midbrain, a midbrain-hindbrain boundary region (MHB) having organizer properties, and a rhombospinal domain. The vertebrate MHB is characterized by position, by organizer properties and by being the early site of action of Wnt1 and engrailed genes, and of genes of the Pax2/5/8 subfamily. Wada and others (Wada, H., Saiga, H., Satoh, N. and Holland, P. W. H. (1998) Development 125, 1113-1122) suggested that ascidian tunicates have a vertebrate-like MHB on the basis of ascidian Pax258 expression there. In another invertebrate chordate, amphioxus, comparable gene expression evidence for a vertebrate-like MHB is lacking. We, therefore, isolated and characterized AmphiPax2/5/8, the sole member of this subfamily in amphioxus. AmphiPax2/5/8 is initially expressed well back in the rhombospinal domain and not where a MHB would be expected. In contrast, most of the other expression domains of AmphiPax2/5/8 correspond to expression domains of vertebrate Pax2, Pax5 and Pax8 in structures that are probably homologous - support cells of the eye, nephridium, thyroid-like structures and pharyngeal gill slits; although AmphiPax2/5/8 is not transcribed in any structures that could be interpreted as homologues of vertebrate otic placodes or otic vesicles. In sum, the developmental expression of AmphiPax2/5/8 indicates that the amphioxus central nervous system lacks a MHB resembling the vertebrate isthmic region. Additional gene expression data for the developing ascidian and amphioxus nervous systems would help determine whether a MHB is a basal chordate character secondarily lost in amphioxus. The alternative is that the MHB is a vertebrate innovation.  (+info)

Regulation of body length and male tail ray pattern formation of Caenorhabditis elegans by a member of TGF-beta family. (5/46886)

We have identified a new member of the TGF-beta superfamily, CET-1, from Caenorhabditis elegans, which is expressed in the ventral nerve cord and other neurons. cet-1 null mutants have shortened bodies and male tail abnormal phenotype resembling sma mutants, suggesting cet-1, sma-2, sma-3 and sma-4 share a common pathway. Overexpression experiments demonstrated that cet-1 function requires wild-type sma genes. Interestingly, CET-1 appears to affect body length in a dose-dependent manner. Heterozygotes for cet-1 displayed body lengths ranging between null mutant and wild type, and overexpression of CET-1 in wild-type worms elongated body length close to lon mutants. In male sensory ray patterning, lack of cet-1 function results in ray fusions. Epistasis analysis revealed that mab-21 lies downstream and is negatively regulated by the cet-1/sma pathway in the male tail. Our results show that cet-1 controls diverse biological processes during C. elegans development probably through different target genes.  (+info)

Molecular cloning and epitope analysis of the peanut allergen Ara h 3. (6/46886)

Peanut allergy is a significant IgE-mediated health problem because of the increased prevalence, potential severity, and chronicity of the reaction. Following our characterization of the two peanut allergens Ara h 1 and Ara h 2, we have isolated a cDNA clone encoding a third peanut allergen, Ara h 3. The deduced amino acid sequence of Ara h 3 shows homology to 11S seed-storage proteins. The recombinant form of this protein was expressed in a bacterial system and was recognized by serum IgE from approximately 45% of our peanut-allergic patient population. Serum IgE from these patients and overlapping, synthetic peptides were used to map the linear, IgE-binding epitopes of Ara h 3. Four epitopes, between 10 and 15 amino acids in length, were found within the primary sequence, with no obvious sequence motif shared by the peptides. One epitope is recognized by all Ara h 3-allergic patients. Mutational analysis of the epitopes revealed that single amino acid changes within these peptides could lead to a reduction or loss of IgE binding. By determining which amino acids are critical for IgE binding, it might be possible to alter the Ara h 3 cDNA to encode a protein with a reduced IgE-binding capacity. These results will enable the design of improved diagnostic and therapeutic approaches for food-hypersensitivity reactions.  (+info)

TIF1gamma, a novel member of the transcriptional intermediary factor 1 family. (7/46886)

We report the cloning and characterization of a novel member of the Transcriptional Intermediary Factor 1 (TIF1) gene family, human TIF1gamma. Similar to TIF1alpha and TIF1beta, the structure of TIF1beta is characterized by multiple domains: RING finger, B boxes, Coiled coil, PHD/TTC, and bromodomain. Although structurally related to TIF1alpha and TIF1beta, TIF1gamma presents several functional differences. In contrast to TIF1alpha, but like TIF1beta, TIF1 does not interact with nuclear receptors in yeast two-hybrid or GST pull-down assays and does not interfere with retinoic acid response in transfected mammalian cells. Whereas TIF1alpha and TIF1beta were previously found to interact with the KRAB silencing domain of KOX1 and with the HP1alpha, MODI (HP1beta) and MOD2 (HP1gamma) heterochromatinic proteins, suggesting that they may participate in a complex involved in heterochromatin-induced gene repression, TIF1gamma does not interact with either the KRAB domain of KOX1 or the HP1 proteins. Nevertheless, TIF1gamma, like TIF1alpha and TIF1beta, exhibits a strong silencing activity when tethered to a promoter. Since deletion of a novel motif unique to the three TIF1 proteins, called TIF1 signature sequence (TSS), abrogates transcriptional repression by TIF1gamma, this motif likely participates in TIF1 dependent repression.  (+info)

Detailed methylation analysis of the glutathione S-transferase pi (GSTP1) gene in prostate cancer. (8/46886)

Glutathione-S-Transferases (GSTs) comprise a family of isoenzymes that provide protection to mammalian cells against electrophilic metabolites of carcinogens and reactive oxygen species. Previous studies have shown that the CpG-rich promoter region of the pi-class gene GSTP1 is methylated at single restriction sites in the majority of prostate cancers. In order to understand the nature of abnormal methylation of the GSTP1 gene in prostate cancer we undertook a detailed analysis of methylation at 131 CpG sites spanning the promoter and body of the gene. Our results show that DNA methylation is not confined to specific CpG sites in the promoter region of the GSTP1 gene but is extensive throughout the CpG island in prostate cancer cells. Furthermore we found that both alleles are abnormally methylated in this region. In normal prostate tissue, the entire CpG island was unmethylated, but extensive methylation was found outside the island in the body of the gene. Loss of GSTP1 expression correlated with DNA methylation of the CpG island in both prostate cancer cell lines and cancer tissues whereas methylation outside the CpG island in normal prostate tissue appeared to have no effect on gene expression.  (+info)

Massively parallel high throughput sequencing technologies allow us to interrogate the microbial composition of biological samples at unprecedented resolution. The typical approach is to perform high-throughout sequencing of 16S rRNA genes, which are then taxonomically classified based on similarity to known sequences in existing databases. Current technologies cause a predicament though, because although they enable deep coverage of samples, they are limited in the length of sequence they can produce. As a result, high-throughout studies of microbial communities often do not sequence the entire 16S rRNA gene. The challenge is to obtain reliable representation of bacterial communities through taxonomic classification of short 16S rRNA gene sequences. In this study we explored properties of different study designs and developed specific recommendations for effective use of short-read sequencing technologies for the purpose of interrogating bacterial communities, with a focus on classification using
Background Next-generation sequencing platforms have revolutionised our ability to investigate the microbiota composition of complex environments, frequently through 16S rRNA gene sequencing of the bacterial component of the community. Numerous factors, including DNA extraction method, primer sequences and sequencing platform employed, can affect the accuracy of the results achieved. The aim of this study was to determine the impact of these three factors on 16S rRNA gene sequencing results, using mock communities and mock community DNA. Results The use of different primer sequences (V4-V5, V1-V2 and V1-V2 degenerate primers) resulted in differences in the genera and species detected. The V4-V5 primers gave the most comparable results across platforms. The three Ion PGM primer sets detected more of the 20 mock community species than the equivalent MiSeq primer sets. Data generated from DNA extracted using the 2 extraction methods were very similar. Conclusions Microbiota compositional data ...
Next generation sequencing technologies open exciting new possibilities for genome and transcriptome sequencing. While reads produced by these technologies are relatively short and error-prone compared to the Sanger method, their throughput is several magnitudes higher. We present a novel approach, called QPALMA, for computing accurate spliced alignments of short sequence reads that take advantage of the reads quality information as well as computational splice site predictions. In computational experiments we illustrate that the quality information as well as the splice site predictions [1] help to considerably improve the alignment quality. Our algorithms were optimized and tested using artificially spliced genomic reads produced with the Illumina Genome Analyzer for the model plant Arabidopsis thaliana. ...
First Roche GS-FLX Genome Sequencing System Installed At VBI - read this article along with other careers information, tips and advice on BioSpace
454 Life Sciences, a Roche Company, announced today the launch and immediate availability of the new GS GType HLA Primer Sets for high- and medium-resolution genotyping of class I and class II loci of the Human Leukocyte Antigen (HLA) genes. The primer sets are designed for use with the companys benchtop GS Junior and GS FLX next-generation sequencing systems.
The SK-BR-3 cell line is one of the most important models for HER2+ breast cancers, which affect one in five breast cancer patients. SK-BR-3 is known to be highly rearranged although much of the variation is in complex and repetitive regions that may be underreported. Addressing this, we sequenced SK-BR-3 using long-read single molecule sequencing from Pacific Biosciences, and develop one of the most detailed maps of structural variations (SVs) in a cancer genome available with nearly 20,000 variants present, most of which were missed by short read sequencing. Surrounding the important ERBB2 oncogene (also known as HER2), we discover a complex sequence of nested duplications and translocations, suggesting a punctuated progression. Full-length transcriptome sequencing further revealed several novel gene fusions within the nested genomic variants. Combining long-read genome and transcriptome sequencing enables an in-depth analysis of how SVs disrupt the genome and sheds new light on the complex ...
As one of the most studied genome rearrangements, tandem repeats have a considerable impact on genetic backgrounds of inherited diseases. Many methods designed for tandem repeat detection on reference sequences obtain high quality results. However, in the case of a de novo context, where no reference sequence is available, tandem repeat detection remains a difficult problem. The short reads obtained with the second-generation sequencing methods are not long enough to span regions that contain long repeats. This length limitation was tackled by the long reads obtained with the third-generation sequencing platforms such as Pacific Biosciences technologies. Nevertheless, the gain on the read length came with a significant increase of the error rate. The main objective of nowadays studies on long reads is to handle the high error rate up to 16%. In this paper we present MixTaR, the first de novo method for tandem repeat detection that combines the high-quality of short reads and the large length of long
Complete Genomics Previews Revolocity™ Sequencing System at European Human Genetics Conference 2015 Mater Health Services (Australia) and Radboud University Medical Center (The Netherlands)...
SEOUL, South Korea and SAN DIEGO, Jan. 11, 2016 - Macrogen, a global leader in genome sequencing services, and Edico Genome today announced Macrogen has chosen multiple DRAGEN™ Bio-IT Processors to reinforce its big data processing and analysis capacity for large-scale genome analysis and clinical sequencing services. Macrogen has world-class next-generation sequencing (NGS) facilities, which are equipped with Illuminas HiSeq™ X Ten, HiSeq 2000, HiSeq 2500, HiSeq 4000 and MiSeq® sequencing systems; Thermo Fishers Ion PGM™ and Ion Proton™ systems; Roches GS-FLX system; and PacBio instruments. Macrogens IT infrastructure capacity exceeds 11 petabytes of storage and more than 3,000 core clusters. Using DRAGEN, Macrogen was able to analyze each genome (30x coverage) produced by their HiSeq X Ten sequencing system in only 26 minutes, while maintaining high sensitivity and specificity. This analysis included conversion from BCL, the file that is delivered by the sequencing instrument, to ...
Progress in genetics and breeding in pea still suffers from the limited availability of molecular resources. SNP markers that can be identified through affordable sequencing processes, without the need for prior genome reduction or a reference genome to assemble sequencing data would allow the discovery and genetic mapping of thousands of molecular markers. Such an approach could significantly speed up genetic studies and marker assisted breeding for non-model species. A total of 419,024 SNPs were discovered using HiSeq whole genome sequencing of four pea lines, followed by direct identification of SNP markers without assembly using the discoSnp tool. Subsequent filtering led to the identification of 131,850 highly designable SNPs, polymorphic between at least two of the four pea lines. A subset of 64,754 SNPs was called and genotyped by short read sequencing on a subpopulation of 48 RILs from the cross Baccara x PI180693. This data was used to construct a WGGBS-derived pea genetic map comprising 64
Recent DNA sequencing technology, the so-called next-generation sequencing (NGS) technology, enables researchers to read a number of DNA sequences that is several orders of magnitudes bigger and at a cost that is several orders of magnitude smaller than the previous generation DNA sequencing technologies. The cost of determining the human genome was estimated at $2.7 billion for the IHGSC genome and at $300 million for the Celera genome. Recently several human genomes were sequenced in about 1.5 months at a cost that is around $1.5 million [1, 2].. Large-scale parallel pyrosequencing from 454/Roche generates hundreds of thousands sequenced DNA reads within a matter of hours [3]. The latest version of the sequencing technology (Titanium) enables a throughput of 0.4-0.6 gigabases per 10 h run [4]. The amount of data to be analyzed keeps growing at an increasing speed. Other NGS platforms such as Illuminas Genome Analyzer (San Diego, CA, USA), Applied Biosystems SOLiD (Foster City, CA, USA) and ...
Author Summary Human individual genome sequencing has recently become affordable, enabling highly detailed genetic sequence comparisons. While the identification and genotyping of single-nucleotide polymorphisms has already been successfully established for different sequencing platforms, the detection, quantification and genotyping of large-scale copy-number variants (CNVs), i.e., losses or gains of long genomic segments, has remained challenging. We present a computational approach that enables detecting CNVs in sequencing data and accurately identifies the actual copy-number at which DNA segments of interest occur in an individual genome. This approach enabled us to obtain novel insights into the largest human gene family - the olfactory receptors (ORs) - involved in smell perception. While previous studies reported an abundance of CNVs in ORs, our approach enabled us to globally identify absolute differences in OR gene counts that exist between humans. While several OR genes have very high gene
New generation DNA sequencing technologies are revolutionizing modern biological research. Scientists can now generate the rough equivalent of an entire human genome (~3 billion base-pairs of DNA) in just a few days with one single sequencing instrument. Until recently, such amounts of data could only be generated at large genome centers using hundreds of sequencers. The analysis of these data is complicated by their size - a single run of a sequencing instrument yields terabytes of information, often requiring a significant scale-up of the existing computational infrastructure. ...
BGI is a recognized leader in De Novo Whole Genome Sequencing and has been involved in the sequencing and assembly of 1000s of De Novo genomes and affiliated research published in the worlds leading journals.. De novo sequencing refers to sequencing a novel genome where there is no reference sequence available for alignment.. The process of de novo genome sequencing involves the sequencing of small DNA fragments, and assembling the reads into longer sequences (contigs) and finally ordering the contigs to obtain the entire genome sequence.. With the advent of rapid, low-cost next-generation sequencing (NGS) technology, researchers can now obtain whole genome data for organisms previously considered too low a priority to sequence. The availability of this whole genome data has allowed large-scale genomic studies to be performed that were unimaginable just a few years ago.. ...
Recent advances in high-throughput sequencing (HTS) technologies have led to orders of magnitude higher throughput compared to classic Sanger sequencing (see [3] for a review). Coupled with continuous
Plant genomes, and eukaryotic genomes in general, are typically repetitive, polyploid and heterozygous, which complicates genome assembly1. The short read lengths of early Sanger and current next-generation sequencing platforms hinder assembly through complex repeat regions, and many draft and reference genomes are fragmented, lacking skewed GC and repetitive intergenic sequences, which are gaining importance due to projects like the Encyclopedia of DNA Elements (ENCODE)2. Here we report the whole-genome sequencing and assembly of the desiccation-tolerant grass Oropetium thomaeum. Using only single-molecule real-time sequencing, which generates long (,16 kilobases) reads with random errors, we assembled 99% (244 megabases) of the Oropetium genome into 625 contigs with an N50 length of 2.4 megabases. Oropetium is an example of a near-complete draft genome which includes gapless coverage over gene space as well as intergenic sequences such as centromeres, telomeres, transposable elements and ...
The goal of this demonstration project is to develop the capability to express complete biosynthetic pathways for natural products that are usually silent in their native microbial host (i.e. orphan biosynthetic gene clusters). Such a technology will increase our access to new chemical entities for potential use in drug development. By tailoring synthetic genomics techniques to the expression of biosynthetic gene clusters, we believe we will create the capacity to produce small molecules directly using synthetic expression constructs in platform production microorganisms. Publicly available high-throughput DNA sequencing data has already cataloged up to 20,000 orphan clusters; as a result, our approach has the potential to bring about the biological synthesis of a large number of natural products that are currently unavailable for evaluation as potential drugs. The proposed clones and expression constructs can be used as a starting point for evaluating the bioactivities of metabolites whose ...
The multikilobase reads that can be produced by single-molecule sequencing technologies may span complex, repetitive genomic regions but have high error rates. Bashir et al. use these reads to organize contigs assembled from accurate, short-read data, facilitating the analysis of clinically important regions of an outbreak strain of cholera. Advances in DNA sequencing technology have improved our ability to characterize most genomic diversity. However, accurate resolution of large structural events is challenging because of the short read lengths of second-generation technologies. Third-generation sequencing technologies, which can yield longer multikilobase reads, have the potential to address limitations associated with genome assembly. Here we combine sequencing data from second- and third-generation DNA sequencing technologies to assemble the two-chromosome genome of a recent Haitian cholera outbreak strain into two nearly finished contigs at |99.9% accuracy. Complex regions with clinically relevant
SCOTTSDALE, Ariz. - Whole genome sequencing - spelling out a persons entire DNA genetic code - has moved one step closer to being a medical option for direct patient care.. Physicians and researchers at Mayo Clinic in Arizona and the Translational Genomics Research Institute (TGen) successfully completed sequencing both a single patients normal and cancer cells - a tour de force of more than 6 billion DNA chemical bases.. While the whole genomes of several individuals or their cancers have been sequenced in recent years, this is believed to be among the first successful application of whole genome sequencing performed in support of the medical care of a specific cancer patient.. A male patient with pancreatic cancer was the first patient at Mayo Clinic to have whole genome sequencing performed on both his tumor and non-cancerous cells as part of a clinical research project. By comparing the tumor DNA to the patients normal DNA, researchers found genetic changes (mutations) that were important ...
Reference quality genomes provide a resource for studying gene structure, function, and evolution. However, often genes of interest are not completely or accurately assembled, leading to unknown errors in analyses or additional cloning efforts for the correct sequences. A promising solution is long-read sequencing. Here we tested PacBio-based long-read sequencing and diploid assembly for potential improvements to the Sanger-based intermediate-read zebra finch reference and Illumina-based short-read Annas hummingbird reference, two vocal learning avian species widely studied in neuroscience and genomics. With DNA of the same individuals used to generate the reference genomes, we generated diploid assemblies with the FALCON-Unzip assembler, resulting in contigs with no gaps in the megabase range, representing 150-fold and 200-fold improvements over the current zebra finch and hummingbird references, respectively. These long-read and phased assemblies corrected and resolved what we discovered to be
AUSTRALIAS capacity to detect, respond to and control infectious threats, and to improve regional health security is hampered by the lack of a national approach to whole genome sequencing resources, and data sharing, according to the authors of a Perspective published in the Medical Journal of Australia.. Whole genome sequencing involves parsing out the entire genome of a pathogen, the data from which can be used to determine the pathogens identity, predict its resistance to antimicrobials and its virulence traits and understand the relationships between pathogens.. University of Melbourne Associate Professor Deborah Williamson, Deputy Director of the Microbiological Diagnostic Unit Public Health Laboratory at the Doherty Institute, and colleagues wrote that the use of whole genome sequencing has the potential to transform the investigation and surveillance of communicable diseases by providing the highest possible characterisation of pathogens, enabling earlier and accurate detection of ...
By M. Thomas P. Gilbert, Lynn P. Tomsho, Snjezana Rendulic, Michael Packard, Daniela I. Drautz, Andrei Sher, Alexei Tikhonov, Love Dalén, Tatyana Kuznetsova, Pavel Kosintsev, Paula F. Campos, Thomas Higham, Matthew J. Collins, Andrew S. Wilson, Fyodor Shidlovskiy, Bernard Buigues, Per G. P. Ericson, Mietje Germonpré, Anders Götherström, Paola Iacumin, Vladimir Nikolaev, Malgosia Nowak-Kemp, Eske Willerslev, James R. Knight, Gerard P. Irzyk, Clotilde S. Perbost, Karin M. Fredrikson, Timothy T. Harkins, Sharon Sheridan, Webb Miller, Stephan C. Schuster. Science ...
The advent of next-generation sequencing (NGS)4 technologies, which grew exponentially in the decade after publication of the first iteration of the human genome sequence (4), has provided substantial insights into new genes and the biological processes that underlie cancer pathogenesis. These insights are outlined below. NGS technologies parallelize sequencing processes via high-throughput means to produce millions of short sequencing reads from amplified DNA clones (5). NGS is also referred to as massively parallel sequencing, because the reaction steps occur in parallel with the detection steps and millions of reactions occur simultaneously (6). This parallelism makes it possible to read the same segment of a DNA sequence repeatedly to increase confidence in the sequence obtained for the targeted genomic segment. This multiple sampling of a genomic segment is referred to as the coverage of the sequencing run.. Before the NGS era, much progress had been made toward identifying mutated ...
CiteSeerX - Document Details (Isaac Councill, Lee Giles, Pradeep Teregowda): The availability of massive amounts of DNA sequence information has begun to revolutionize the practice of biology. As a result, current large-scale sequencing output, while impressive, is not adequate to keep pace with growing demand and, in particular, is far short of what will be required to obtain the 3-billion-base human genome sequence by the target date of 2005. To reach this goal, improved automation will be essential, and it is particularly important that human involvement in sequence data processing be significantly reduced or eliminated. Progress in this respect will require both improved accuracy of the data processing software and reliable accuracy measures to reduce the need for human involvement in error correction and make human review more efficient. Here, we describe one step toward that goal: a base-calling program for automated sequencer traces, phred, with improved accuracy. phred appears to be the first
We have developed and validated a low-coverage whole genome sequencing assay for genome-wide and high-resolution detection of copy number aberrations (CNAs) from inherited disorders. The analytical sensitivity was 0.765 for detecting CNVs of 25-50kb in size and 0.990 for detecting CNVs of over 50kb in size. The smallest detected deletion was 10kb.
The transcriptional architecture is a complex and dynamic aspect of a cells function. Next generation sequencing of steady state RNA (RNA-seq) gives unprecedented detail about the RNA landscape within a cell. Not only can expression levels of genes be interrogated without specific prior knowledge, but comparisons of expression levels between genes within a sample can be made. It has also been demonstrated that splicing variants [1, 2] and single nucleotide polymorphisms [3] can be detected through sequencing the transcriptome, opening up the opportunity to interrogate allele-specific expression and RNA editing.. An important aspect of dealing with the vast amounts of data generated from short read sequencing is the processing methods used to extract and interpret the information. Experience with microarray data has repeatedly shown that normalization is a critical component of the processing pipeline, allowing accurate estimation and detection of differential expression (DE) [4]. The aim of ...
Genomic heterogeneity of bacterial species is observed and studied in experimental evolution experiments and clinical diagnostics, and occurs as micro-diversity of natural habitats. The challenge for genome research is to accurately capture this heterogeneity with the currently used short sequencing reads. Recent advances in NGS technologies improved the speed and coverage and thus allowed for deep sequencing of bacterial populations. This facilitates the quantitative assessment of genomic heterogeneity, including low frequency alleles or haplotypes. However, false positive variant predictions due to sequencing errors and mapping artifacts of short reads need to be prevented. We therefore created VarCap, a workflow for the reliable prediction of different types of variants even at low frequencies. In order to predict SNPs, InDels and structural variations, we evaluated the sensitivity and accuracy of different software tools using synthetic read data. The results suggested that the best ...
This dataset contains the digitized treatments in Plazi based on the original journal article Straube, Nicolas, White, William T., Ho, Hsuan-Ching, Rochel, Elisabeth, Corrigan, Shannon, Li, Chenhong, Naylor, Gavin J. P. (2013): A DNA sequence-based identification checklist for Taiwanese chondrichthyans. Zootaxa 3752 (1): 256-278, DOI: http://dx.doi.org/10.11646/zootaxa.3752.1.16 ...
Genome sequencing technologies are improving at a rapid pace. The current challenge is to find ways to extract all of the genetic information from the data. One of the biggest challenges has been the detection of CNVs. Sebat, in collaboration with Seungtai Yoon of CSHL and Kenny Ye, Ph.D., at the Albert Einstein College of Medicine, developed a statistical method to estimate DNA copy number of a genomic region based on the number of sequences that map to that location (or read depth). When the genomes of multiple individuals are compared, regions that differ in copy number between individuals can be identified.. The new method allows the detection of small structural variants that could not be detected using earlier microarray-based methods. This is significant because most of the CNVs the genome are less than 5000 nucleotides in length. The new method is also able to detect certain classes of CNVs that other sequencing-based approaches struggle with, particularly those located in complex ...
Strategies for assembling large, complex genomes have evolved to include a combination of whole-genome shotgun sequencing and hierarchal map-assisted sequencing. Whole-genome maps of all types can aid genome assemblies, generally starting with low-resolution cytogenetic maps and ending with the highest resolution of sequence. Fingerprint clone maps are based upon complete restriction enzyme digests of clones representative of the target genome, and ultimately comprise a near-contiguous path of clones across the genome. Such clone-based maps are used to validate sequence assembly order, supply long-range linking information for assembled sequences, anchor sequences to the genetic map and provide templates for closing gaps. Fingerprint maps are also a critical resource for subsequent functional genomic studies, because they provide a redundant and ordered sampling of the genome with clones. In an accompanying paper we describe the draft genome sequence of the chicken, Gallus gallus, the first ...
We combined conventional fumC-fimH typing with deep amplicon sequencing to assess E. coli clonal diversity in a high-throughput manner. Our method has several advantages over existing protocols. First, our method has high sequencing resolution for target species. Since we sequence only E. coli fumC and fimH, we can generate ≥0.5 million reads per sample, yielding ≥5,000 reads per base. In contrast, metagenomic sequencing, which is nonspecific for target species, yields only 20 reads per base per genome (assuming a 5-Mb genome). Secondly, our method assessed up to 46 samples per sequencing run. In contrast, MLST requires typing ≥100 single colonies per sample to capture the low-prevalence strains that PLAP detects. Finally, while we developed PLAP for E. coli CH typing, PLAP is not limited to E. coli clonotyping and may be generalized to other MLST schemes. For those attempting to use or adapt our approach, we have provided guidelines for both the experimental and algorithm portions on ...
A framework technology comprising file format and toolkit in which we combine highly efficient and tunable reference-based compression of sequence data with a data format that is directly available for computational use. This compression method is tunable: The storage of quality scores and unaligned sequences may be adjusted for different experiments to conserve information or to minimize storage costs, and provides one opportunity to address the threat that increasing DNA sequence volumes will overcome our ability to store the sequences.
An advance online publication in Nature Biotechnology from Michael Snyders lab at Stanford University demonstrates the utility of long-read sequencing for assessing transcribed regions across the human genome. Long PacBio reads were able to completely cover full-length RNA molecules, characterizing genetic regions that have not been previously annotated.. The paper, entitled A single-molecule long-read survey of the human transcriptome, reports the application of Single Molecule, Real-Time (SMRT®) Sequencing to studying RNA, comparing it to results from libraries sequenced with a 454® instrument. The scientists sequenced cDNA synthesized from pooled RNA gathered from 20 human organs and tissues in order to identify as many transcript isoforms as possible.. The purpose of this effort was to find a better alternative to existing RNA-seq approaches, which have so far relied on short-read sequencers. It is difficult to identify full-length transcript iso-forms using short reads, the authors ...
Finds sub-sequence or patterns in the sequence and highlights the matching region. The tool works with standard single letter nucleotide or protein codes including ambiguities and can match Prosite patterns in protein sequences ...
Finds sub-sequence or patterns in the sequence and highlights the matching region. The tool works with standard single letter nucleotide or protein codes including ambiguities and can match Prosite patterns in protein sequences ...
Whole genome sequencing (WGS), which is the process of determining an organisms complete DNA sequence, can be used to identify DNA anomalies that cause disease. Identifying disease-causing DNA abnormalities allows clinicians to better predict an effective course of treatment for the patient.
Background|br /|Inherited retinal disorders are clinically and genetically heterogeneous with more than 150 gene defects accounting for the diversity of disease phenotypes. So far, mutation detection was mainly performed by APEX technology and direct Sanger sequencing of known genes. However, these methods are time consuming, expensive and unable to provide a result if the patient carries a new gene mutation. In addition, multiplicity of phenotypes associated with the same gene defect may be overlooked.|br /|Methods|br /|To overcome these challenges, we designed an exon sequencing array to target 254 known and candidate genes using Agilent capture. Subsequently, 20 DNA samples from 17 different families, including four patients with known mutations were sequenced using Illumina Genome Analyzer IIx next-generation-sequencing (NGS) platform. Different filtering approaches were applied to identify the genetic defect. The most likely disease causing variants were analyzed by Sanger sequencing. Co
Capillary sequencing PCR tubes and caps are for use with the ABI Prism 310 sequencerThese PCR tubes are made of high-quality virgin polypropylene and feature uniform thin walls for efficient heat transfer. Tubes and caps are compatible with most leading thermal cyclers, and are autoclavable. Caps, available as either flat or domed, fit perfectly and create a uniform, tight seal that prevents sample evaporation in the thermal cycler. Tubes are nonpyrogenic and RNase- and DNase-free. Certain models feature assorted packs of color-coded tubes for easy identification of samples.
Roche Diagnostics Deutschland - The newly discovered arenavirus caused the deaths of four of five infected individuals in South Africa in October, 2008
Over the last few years, several initiatives have described efforts to combine previously invented techniques in molecular biology with parallel detection principles to sequence or genotype DNA signatures. The Infinium (R) system from Illumina and the Affymetrix GeneChips (R) are two systems suitable for whole-genome scoring of variable positions. However, directed candidate-gene approaches are more cost effective and several academic groups and the private sector provide techniques with moderate typing throughput combined with large sample capacity suiting these needs. Recently, whole-genome sequencing platforms based on the sequencing-by-synthesis principle were presented by 454 Life Sciences and Solexa, showing great potential as alternatives to conventional genotyping approaches. In addition to these sequencing initiatives, many efforts are pursuing novel ideas to facilitate fast and cost-effective whole genome sequencing, such as ligation-based sequencing. Reliable methods for routine ...
Illumina, Inc. (NASDAQ:ILMN) today broke the sound barrier of human genomics by enabling the $1,000 genome. This achievement is made possible by the
Upon the establishment of the genome project at Celera in 1998, the company purchased and connected 700 CPUs and 70 terabites of hard drive space. This computing system was established to run the initial test of their algorithm code, which was used to sequence the genome of the Drosophilla fruit fly with a 13-fold coverage of the genome successfully in 1999. The most surprising thing about this approach was that it succeeded in coding the algorithm and sequencing the 120 Megabase pair genome of the fruit fly to that extent of completeness in just 11 months. Myers (Gene Myers, a professor of Computer Science at Berkeley) then modified the process so that the Whole Genome Shotgun Sequencing process would make a 5-fold coverage of the human genome, as he believed it would be adequate to provide a complete sequence of the human genome. In addition, Venter purchased 4 supercomputers referred to as the GeneMatcher from a company called Parcel Inc. Parcel Inc, a company that typically produces ...
Patient-derived tumor xenografts in mice are widely used in cancer research and have become important in developing personalized therapies. When these xenografts are subject to DNA sequencing, the samples could contain various amounts of mouse DNA. It has been unclear how the mouse reads would affect data analyses. We conducted comprehensive simulations to compare three alignment strategies at different mutation rates, read lengths, sequencing error rates, human-mouse mixing ratios and sequenced regions. We also sequenced a nasopharyngeal carcinoma xenograft and a cell line to test how the strategies work on real data. We found the filtering and combined reference strategies performed better than aligning reads directly to human reference in terms of alignment and variant calling accuracies. The combined reference strategy was particularly good at reducing false negative variants calls without significantly increasing the false positive rate. In some scenarios the performance gain of these two
Patient-derived tumor xenografts in mice are widely used in cancer research and have become important in developing personalized therapies. When these xenografts are subject to DNA sequencing, the samples could contain various amounts of mouse DNA. It has been unclear how the mouse reads would affect data analyses. We conducted comprehensive simulations to compare three alignment strategies at different mutation rates, read lengths, sequencing error rates, human-mouse mixing ratios and sequenced regions. We also sequenced a nasopharyngeal carcinoma xenograft and a cell line to test how the strategies work on real data. We found the filtering and combined reference strategies performed better than aligning reads directly to human reference in terms of alignment and variant calling accuracies. The combined reference strategy was particularly good at reducing false negative variants calls without significantly increasing the false positive rate. In some scenarios the performance gain of these two
2015. The Oxford Nanopore Technologies (ONT) MinION is a new sequencing technology that potentially offers read lengths of tens of kilobases (kb) limited only by the length of DNA molecules presented to it. The device has a low capital cost, is by far the most portable DNA sequencer available, and can produce data in real-time. It has numerous prospective applications including improving genome sequence assemblies and resolution of repeat-rich regions. Before such a technology is widely adopted, it is important to assess its performance and limitations in respect of throughput and accuracy. In this study we assessed the performance of the MinION by re-sequencing three bacterial genomes, with very different nucleotide compositions ranging from 28.6% to 70.7%; the high G. +. C strain was underrepresented in the sequencing reads. We estimate the error rate of the MinION (after base calling) to be 38.2%. Mean and median read lengths were 2. kb and 1. kb respectively, while the longest single read ...
Track 9: Gene Sequencing. DNA sequencing is the process of determining the precise order of nucleotides within a DNA molecule. It includes any method or technology that is used to determine the order of the four bases is: adenine, guanine, cytosine, and thymine, in a strand of DNA. The advent of rapid DNA sequencing methods has greatly accelerated biological and medical research and discovery. Knowledge of DNA sequences has become indispensable for basic biological research, and in numerous applied fields such as medical diagnosis, biotechnology, forensic biology, virology and biological systematics. The rapid speed of sequencing attained with modern DNA sequencing technology has been instrumental in the sequencing of complete DNA sequences, or genomes of numerous types and species of life, including the human genome and other complete DNA sequences of many animal, plants, and microbial species.. ...
In article ,4q6b5m$i9u at net.bio.net, jea at ukrv.de writes: ,From: jea at ukrv.de ,Subject: sequencing strategy 2 ,Date: 18 Jun 1996 06:32:38 -0700 ,I want to know if someone can help me to decide which sequencing strategy ,is the best one. I want to start sequencing on a ABI377. I want to ,sequence PCR-Products after cloning them in pUC18 (sureClone Kit, ,Pharmacia). Do you really need them cloned, or do you just want the sequence? If you just need the sequence its best not clone them (the possibility of PCR errors, you see), but rather cycle sequence the PCR fragments straight. , My question is: is it better to sequence plasmid DNA with the , cycle sequencing Kit or is it better to do solid phase sequencing , (Dynabeads) and use Sequenase? Cycle sequencing is easier and faster. In my experience using T7 is only really worth it if you are searching for heterozygotes or something in that vein. Ari-Matti -- *********************** Ari-Matti Saren ************************** * WORK: Institute of ...
Hi guys, I need to PCR amplify a gene from Sea Urchin cDNA for protein expression. This gene is ~1.9kb, GC%~41%. I sequenced the PCR products directly several weeks ago, and sent another tube of PCR products (from the same cDNA library from the same tube, but different enzyme, Ex Taq vs Phusion) for sequencing this week, but the results are quite different: though their size are the same, only 94% bases are identical. I think these two sequencing result might come from polymorphism, I searched the net and one paper said: The sea-urchin genome is highly polymorphic, meaning that the two copies of the genome in the diploid organism vary from each other by about 4 percent, or one difference in spelling every 25 letters ...
TY - GEN. T1 - Inferring intra-tumor heterogeneity from high-throughput DNA sequencing data. AU - Oesper, Layla. AU - Mahmoody, Ahmad. AU - Raphael, Benjamin J.. PY - 2013/4/3. Y1 - 2013/4/3. N2 - Cancer is a disease driven in part by somatic mutations that accumulate during the lifetime of an individual. The clonal theory [1] posits that the cancerous cells in a tumor are descended from a single founder cell and that descendants of this cell acquired multiple mutations beneficial for tumor growth through rounds of selection and clonal expansion. A tumor is thus a heterogeneous population of cells, with different subpopulations of cells containing both clonal mutations from the founder cell or early rounds of clonal expansion, and subclonal mutations that occurred after the most recent clonal expansion. Most cancer sequencing projects sequence a mixture of cells from a tumor sample including admixture by normal (non-cancerous) cells and different subpopulations of cancerous cells. In addition ...
...Next-generation DNA sequencing (NGS) technology has revolutionized bio......,Essential,informatics,methods,and,tools,for,analyzing,the,explosion,of,NGS,data,biological,biology news articles,biology news today,latest biology news,current biology news,biology newsletters
Next-generation DNA sequencing of image-guided biopsy samples collected by multiple sites reveal predictive biomarkers for cancer treatment.
Applied Maths NV today announces that it has released a new version of its flagship software suite BioNumerics that allows de novo assembly to be performed on next generation sequencing data. This new feature, available in version 6.6, consolidates the development of BioNumerics into a complete and fully integrated suite for preprocessing and analysis of NGS data.
Next generation sequencing technologies have revolutionized molecular biology by making whole genome sequencing projects possible for any species. Low coverage whole genome shotgun sequencing has proven a valuable approach for rapid and easy acquisition of a large amount of sequence data at relatively low cost. Low coverage data is useful for marker acquisition as well as the assembly of plastid genomes [20, 21, 31-33]. Despite its power, few examples of the application of NGS on de novo assembly of plant mitochondrial genomes have been reported. Recently Straub and colleagues [22] attempted to assemble the milkweed mitochondrial genome using Illumina data from unenriched whole genome DNA. The assembly resulted in a partial mitochondrial genome assembly of 115 contigs. Here we demonstrate how 454 data from whole genome DNA library can be used for a complete de novo assembly of the mitochondrial genome of Daucus carota. Adequate coverage, sufficient read length, and application of a ...
Roche and Precision System Science, Co., Ltd (PSS) have announced the signing of an exclusive agreement to develop and manufacture a fully automated emulsion PCR instrument for Roches portfolio of next-generation sequencing platforms. It is intended to support Roches GS Junior and GS FLX+ systems as well as the sequencing platforms that Roche is currently developing.
The information contained in the genome of an organism, its DNA, is expressed through transcription of its genes to RNA, in quantities determined by many internal and external factors. As such, studying the gene expression can give valuable information for e.g. clinical diagnostics. A common analysis workflow of RNA-sequencing (RNA-seq) data consists of mapping the sequencing reads to a reference genome, followed by the transcript assembly and quantification based on these alignments. The advent of second-generation sequencing revolutionized the field by reducing the sequencing costs by 50,000-fold. Now another revolution is imminent with the third-generation sequencing platforms producing an order of magnitude higher read lengths. However, higher error rate, higher cost and lower throughput compared to the second-generation sequencing bring their own challenges. To compensate for the low throughput and high cost, hybrid approaches using both short second-generation and long third-generation ...
505) 995 4466; [email protected] Santa Fe, N.M., January 12, 2007 - The New Mexico Institute of Mining and Technology (NMT), Socorro, NM, and the National Center for Genome Resources (NCGR), Santa Fe, NM, announced today that they have established a partnership to create the New Mexico Genome Sequencing Center (NMGSC).. The State of New Mexico has provided $600,000 in funding to establish the Center, which will be located at NCGR in Santa Fe. The NMGSC will be the first in the nation to focus on medical resequencing. Medical resequencing is a new approach for discovery of the genetic basis of common human diseases or important crop traits. It refers to the large scale sequencing of the genome of many individuals affected by a disease or with a trait of interest. Medical sequencing is being made possible by next-generation DNA sequencing instruments and software that are dramatically increasing the speed and throughput of DNA sequencing.. The New Mexico Genome Sequencing Center is being established ...
505) 995 4466; [email protected] Santa Fe, N.M., January 12, 2007 - The New Mexico Institute of Mining and Technology (NMT), Socorro, NM, and the National Center for Genome Resources (NCGR), Santa Fe, NM, announced today that they have established a partnership to create the New Mexico Genome Sequencing Center (NMGSC).. The State of New Mexico has provided $600,000 in funding to establish the Center, which will be located at NCGR in Santa Fe. The NMGSC will be the first in the nation to focus on medical resequencing. Medical resequencing is a new approach for discovery of the genetic basis of common human diseases or important crop traits. It refers to the large scale sequencing of the genome of many individuals affected by a disease or with a trait of interest. Medical sequencing is being made possible by next-generation DNA sequencing instruments and software that are dramatically increasing the speed and throughput of DNA sequencing.. The New Mexico Genome Sequencing Center is being established ...
Next Generation Sequencing Market - (Technology Type - Whole Genome Sequencing, Targeted Resequencing, RNA Sequencing, Whole Exome Sequencing, and De Novo Sequencing); (Application - Oncology, Genetic Screening, Infectious Diseases, Drug and Biomarker Discovery, Agriculture & Animal Research, Idiopathic Diseases and others): Market Growth, Future Prospects and Competitive Analysis, 2017-2025 the market was valued at USD 3.7 Bn in 2017, and is expected to reach USD 20.6 Bn by 2025, expanding at a CAGR of 21.5% from 2017 to 2025.. Browse Full Report Click Here: http://www.acutemarketreports.com/report/next-generation-sequencing-market. Market Insights. Next generation sequencing is a high-throughput sequencing that enables sequencing and assembling of number of short DNA reads at a small period of time and with a better accuracy. The introduction of next generation sequencing technologies has ensured massive changes in the sequencing process by providing better output, higher speed, flexibility ...
Unlock the full value of your next-generation sequencing (NGS) data sets from Illumina HiSeq/MiSeq/NextSeq/HiSeq X Ten, Roche 454 GS-FLX, LifeTechnologies Solid and Iontorrent /IonProton PGM, and PacBio platforms.. Bespoke NGS data analysis: QFAB provides tailored bioinformatics services to biologists across the spectrum of computational techniques and services applicable to molecular biology and next generation sequencing. QFAB researchers design and implement custom bioinformatics approaches that are developed in consultation with researchers for specific questions in molecular biology.. We can also integrate your genomics data with other -omics, microarrays and clinical datasets.. Our NGS data analysis services include:. Whole genome sequencing data analysis. ...
Dramatic advances in sequencing technologies have opened new possibilities for whole genome analysis. The increasing read length of next-generation sequencing platforms, as well as the promising perspectives of third generation sequencing platforms, will inevitably lead to better assemblies and represent genomes in large stretches of DNA. Also, third generation technologies (such as the PacBio and IonTorrent systems) will be capable of outputting sequencing reads with large undefined inserts, thus providing valuable paired read information for the assembly and scaffolding process. Concurrently, the development of genome closure software should also receive attention to overcome difficult genomic regions that cannot be covered by draft assemblies.. Our results with GapFiller indicate that gapped genomics regions can be reliably closed through an automatic protocol that uses only short sequencing reads. Costly Sanger sequencing can therefore be limited to a few difficult repeat areas. Also, we ...
The development of next-generation massively parallel sequencing technologies (NGS), including the Roche 454™ Genome Sequencer FLX Instrument, the Illumina Genome Analyzer, Life Technologys Ion Torrent™ Personal Genome Machine, and the Pacific Biosciences RS have revolutionized genomic and genetic research, significantly improved sequencing throughput, reduced costs for data production, and advanced research from weeks to hours.
Full genomes of several organisms have been sequenced in the past fifteen years, including the human genome in 2004. These studies were completed using Sanger DNA sequencing, which has a limited throughput and high cost meaning the human genome took fifteen years to sequence and cost nearly three billion dollars
A novel smartphone-based microscope could make DNA sequence analysis much easier, faster and more readily accessible in remote locations. The dev
Since few studies have been focused on the RNA profile of the liquid fraction of synovial fluid (SF) from osteoarthritis (OA) patients, we determined whether it contains enough RNA for profiling. We removed cells from SF and extract RNA for building a cDNA library, followed by the second-generation sequencing and bioinformatic analyses. From one SF sample of an OA patient, we obtained 0.096 µg RNA for building a cDNA library. From this library the second-generation sequencing produced 66,154,562 clean reads, 91.28% of which were matched to the reference with 2,682 genes identified. From another patients SF sample, 0.24 µg RNA was obtained and sequencing of the established cDNA library produced 64,463,162 clean reads but, unexpectedly, only 22.40% of the reads were matched to the human genome, although 5,081 genes were identified. Some of the unmatchable reads matched RNAs of bacteria, mainly pseudomonas, likely derived from previous infections since the patients had no obvious systemic ...
Modern biology operates with a large amount of data and investigates very complex systems. Scientists use complicated algorithms and very sophisticated software, which is impossible to run, without access to significant computing resources. In addition, modern biology requires efficient large data volumes processing, such as DNA sequences, proteins structure, Genome Scale Modeling, and molecular dynamics simulation. Recent advances in Next Generation Genome Sequencing technology led to significant increase in amount of sequencing data that has to be processed, analysed and made available for bioinformaticians worldwide. The ancient DNA analysis is one of the most challenging and CPU consuming scientific problems.. It can take a couple of months on super-computer at NRC KI to run widely used package PALEOMIX to analyse ancient genome sequencing data. The issue of data processing at a large scale has been addressed in the past by the LHC experiments at CERN and in our studies we have evaluated and ...
Define Primer walking. Primer walking synonyms, Primer walking pronunciation, Primer walking translation, English dictionary definition of Primer walking. n. 1. An elementary textbook for teaching children to read. 2. A book that covers the basic elements of a subject. n. 1. A cap or tube containing a small...
We were prompted to develop the BisPCR2 method by our need for a high-throughput, cost-effective method for interrogating multiple CpGs at base resolution within multiple target loci of interest. Fluorescence-based approaches to targeted bisulfite sequencing are limited by the number of CpGs that can be measured at one time, the inability to multiplex, and the reliance of measurements on a secondary enzymatic reaction. Next-generation sequencing techniques for targeted bisulfite sequencing employ the same strategy of bisulfite conversion and amplification of target loci, but result in a far more robust output by directly measuring base content of each CpG within an amplicon. Further, the ability to multiplex means that a single sequencing reaction can yield information about multiple target loci for multiple biological samples. One impediment of NGS approaches is the additional step of DNA sequencing library preparation following target enrichment, which can be expensive and time consuming. We ...
Microorganisms widely exist in nature and are closely related to human life and production. They are generally divided into fungi, actinomycetes, bacteria, spirulina, rickettsia, chlamydia, mycoplasma and viruses. Microbial whole genome sequencing is an important tool for mapping genomes of novel organisms, finishing genomes of known organisms, or comparing genomes across multiple samples. Sequencing the entire microbial genome is important for construction of accurate reference genomes, microbial identification, and other comparative genomic studies. Comparative genomic analysis based on whole genome sequencing plays an irreplaceable role in studying pathogenic mechanisms of pathogenic microorganism, evolution of pathogenic genes and screening of novel, efficient drug targets. Microbial whole genome sequencing can be widely used in various fields.. Diseases Pathogenic microorganism includes all kinds of microorganisms that cause human diseases, food corruption, animal infection in animal ...
New sequencing system (2017-07-12) The NovaSeq6000 sequencing system (Illumina Inc.) is now installed at the NGI facilities in Uppsala and Stockholm.. The NovaSeq, launched by Illumina early 2017, offers high-throughput sequencing across the full range of DNA- and RNA-sequencing applications including transcriptome profiling, target re-sequencing, low coverage genome sequencing and single cell applications. By acquiring the NovaSeq6000 NGI will continue to offer the most cost efficient sequencing service to our users. Whole genome sequencing at a coverage of at least 15x will continue to be run on HiSeqX as the most cost efficient approach. During the summer and beginning of the fall, the NovaSeq systems will be validated and NGI aims to accept projects from users from September 2017. Projects already submitted and scheduled for HiSeq2500 may be transferred to the NovaSeq, in those cases the NGI project coordinators will contact the user for a discussion. You can read more about the NovaSeq ...
The Vironomics Core facilitates research long-read length next generation sequencing. The sequencers in the core are ideal for longer DNA fragment sequencing with instrument run times of only 24 hours. This is accomplished using Ion Torrent PGM, Ion Torrent S5, and companion Ion Torrent Chef. The Ion Torrent PGM is capable of 200-400bp read lengths. The Ion Torrent S5 has the ability to increase that to 600bp and increases the number of reads/depth available, 10-90M reads. Many clients use the longer reads for large genomes, de novo sequencing, 16S sequencing, long amplicons, etc. Customization is available or take advantage of the current expertise in: whole genome sequencing (WGS), de novo assembly, STR cell line verification, targeted amplicon sequencing, plasmid verification, strand-specific RNAseq, and exome sequencing.. ...
CSHL Press publishes monographs, technical manuals, handbooks, review volumes, conference proceedings, scholarly journals and videotapes. These examine important topics in molecular biology, genetics, development, virology, neurobiology, immunology and cancer biology. Manuscripts for books and for journal publication are invited from scientists world wide.
CSHL Press publishes monographs, technical manuals, handbooks, review volumes, conference proceedings, scholarly journals and videotapes. These examine important topics in molecular biology, genetics, development, virology, neurobiology, immunology and cancer biology. Manuscripts for books and for journal publication are invited from scientists world wide.
CREST. The accurate identification of structural variations using whole-genome DNA sequencing data generated by next-generation sequencing technology is extremely difficult. To address this challenge, we have developed CREST, an algorithm that uses sequencing reads with partial alignments to the reference human genome (so-called soft-clipped reads) to directly map the breakpoints of somatic structural variations. We applied CREST to paired tumor/normal whole genome sequencing data from five cases of T-lineage acute lymphoblastic leukemia (T-ALL). A total of 110 somatic structural variants were identified, ,80% of which were validated by genomic PCR and Sanger sequencing. The validated structural variants included 31 inter-chromosomal translocations, 19 intra-chromosomal translocations, one inversion, 22 deletions and 16 insertions. A comparison of the results generated with CREST to those obtained using the traditional paired-end discordant mapping methods demonstrate CREST to have a much higher ...
Long Read Sequencing (Third Generation) and Next Generation Sequencing (Second Generation). DNA and RNA sequencing is the process of determining the nucleotide order of a given DNA fragment. The nucleotide sequence encodes the necessary information that allows living things to survive and reproduce. Determining the sequence is therefore useful in researching into how organisms live. Our core facility provides many sequencing options to meet your individual needs, utilizing (a) Oxford NanoPore GridIONx5 Long-Read Sequencing (by reading the nucleotide sequences at the single molecule level), and (b) Illumina Short-Read Sequencing (by massive parallel sequencing of millions of DNA fragments and yielding substantially more throughput reads quickly).. ...
Short-read sequencing technologies have long been the work-horse of microbiome analysis. Continuing technological advances are making the application of long-read sequencing to metagenomic samples increasingly feasible. We demonstrate that whole bacterial chromosomes can be obtained from an enriched community, by application of MinION sequencing to a sample from an EBPR bioreactor, producing 6 Gb of sequence that assembles into multiple closed bacterial chromosomes. We provide a simple pipeline for processing such data, which includes a new approach to correcting erroneous frame-shifts. Advances in long-read sequencing technology and corresponding algorithms will allow the routine extraction of whole chromosomes from environmental samples, providing a more detailed picture of individual members of a microbiome.
Exome Sequencing is fast, cost effective and generates a smaller sized data for quick analysis. For whole exome sequencing cost and SNP genotyping visit 1010Genome.
This is the first evaluation of a novel fast broad-range 16S rDNA PCR/sequencing assay in a Canadian patient population, and the first study of the clinical utility of DPO primers for the routine molecular analysis of heart valve tissue in consecutive patients with and without infective IE. Additionally, our study had the advantage of extensive clinical information to better delineate the Dukes minor criteria for all patients. Our study confirms the higher sensitivity of molecular heart valve testing compared to tissue culture [35-38]. However, our novel assay has one of the highest reported sensitivities of a user-developed broad-range 16S rDNA PCR to date. Although pre-operative blood cultures make a microbiologic diagnosis in approximately two-thirds of patients suspected of having IE, subsequent molecular analysis of heart valve tissue contributed to the microbiologic diagnosis of 31 % of our patients. However, the change in diagnosis would only be expected to contribute to the clinical ...
Following the completion of the human genome project, the high demand for low-cost sequencing has given rise to a number of high-throughput, next-generation sequencing (NGS) technologies. These new sequencing platforms allow high-throughput sequencing for a wide range of applications such as: |br /> |ul> |li>Whole genome sequencing as de novo or resequencing|/li> |li>Targeted resequencing|/li> |li>Transcriptome profiling|/li> |li>Microbiome research|/li> |li>Gene regulation studies |/li> |/ul>
Following the completion of the human genome project, the high demand for low-cost sequencing has given rise to a number of high-throughput, next-generation sequencing (NGS) technologies. These new sequencing platforms allow high-throughput sequencing for a wide range of applications such as: |br /> |ul> |li>Whole genome sequencing as de novo or resequencing|/li> |li>Targeted resequencing|/li> |li>Transcriptome profiling|/li> |li>Microbiome research|/li> |li>Gene regulation studies |/li> |/ul>
The Illumina MiSeq uses the same established reversible-terminator sequencing by synthesis chemistry as the HiSeq2000. Researchers have a wide range of sequencing read options ranging from 36 bp singleton to 150 bp paired-end reads. The system is capable of generating over 2 Gb data per run with a high percentage of bases over Q30. The high data yield and superior quality allows scientists to conduct a wide variety of sequencing applications including: highly multiplexed PCR amplicon sequencing, small genome sequencing and de novo sequencing, small RNA sequencing, targeted resequencing and 16S metagenomics.. The addition of numerous Illumina MiSeqs adds another level of sequencing for our clients, said Ardy Arianpour, Vice President of Business Development at Ambry Genetics. Our scientists have spent the last couple months validating sequencing runs and getting amazing results so we can deliver and work with multiple types of samples that fit on the MiSeq.. The MiSeq is a fully integrated ...
http://lifetech-it.hosted.jivesoftware.com/community/torrent_dev/blog/2011/11/08/leveraging-flow-order-and-flow-signals. A major strength of the Ion Torrent semiconductor sequencing system is that a SNP is not equivalent to an error, or more precisely single base substitutions are not equivalent to a single sequencing error. While the base calls that are provided are accurate, even greater levels of performance are available by taking into account flow orders and flow signals.. Homopolymers are observed one-at-a-time during sequencing, with the given homopolymer base determined by the flow order. For example, a flow order of ACGT would cycle through each base one a time. More intricate flow orders, like TACGTACGTCTGAGCATCGATCGATGTACAGC, can yield significant advantages to overcome carry-forward (signals from out-of-phase templates) and incomplete extension (templates that do not fully extend). Furthermore, flow orders also imply something about the likelihood of an error versus a variant (more ...
Hosted by the International Society for Computational Biology (ISCB) and the Centre for Genomic Regulation (CRG), the Next Generation Sequencing Conference 2014 (NGS 2014) is a dedicated meeting on cutting-edge approaches to the processing and analysis of Next Generation Sequencing data. The goal of this conference is to bring together bioinformatics researchers and biologists facing new high-throughput sequencing challenges. The conference will feature presentations showing how current platforms can be used to address key biological questions and what is the current state of the art for data analysis. Sizeable space will also be dedicated to emerging and future trends in high-throughput sequencing and their associated computational challenges.. see more at http://www.iscb.org/ngs2014. ...
Mycobacterium tuberculosis is characterised by limited genomic diversity, which makes the application of whole genome sequencing particularly attractive for clinical and epidemiological investigation. However, in order to confidently infer transmission events, an accurate knowledge of the rate of change in the genome over relevant timescales is required. We attempted to estimate a molecular clock by sequencing 199 isolates from epidemiologically linked tuberculosis cases, collected in the Netherlands spanning almost 16 years. Multiple analyses support an average mutation rate of ~0.3 SNPs per genome per year. However, all analyses revealed a very high degree of variation around this mean, making the confirmation of links proposed by epidemiology, and inference of novel links, difficult. Despite this, in some cases, the phylogenetic context of other strains provided evidence supporting the confident exclusion of previously inferred epidemiological links. This in-depth analysis of the molecular clock
The introduction of new sequencing technologies whole-genome sequencing (WGS) and whole-exome sequencing (WES) that are much less finely targeted than previous genetic tests has resulted in ethical debate about what should be done with clinically significant findings that may arise during the sequencing process. In this piece we argue that, in addition to whether the finding has been intentionally sought or arises incidentally, the ethical issues concerning what should be done with WES and WGS findings are also influenced by whether sequencing occurs in a clinical or research setting. We argue that decisions about the disclosure of WGS and WES findings generated in the clinical context are much less ethically contentious than decision making about the feedback of research results. We conclude by calling for greater transparency about the purpose of sample collection, more explicit protocols for transitioning between research and clinical contexts and patients and research participants to be warned of
The one consistent finding among viral metagenomics studies has been the high proportion of sequences having no significant homology to a known sequence within one of the large sequence databases (e.g., GenBank, UniRef etc.). Those viral metagenome libraries having the highest frequency of hits to known sequences typically come from marine environments where the hit frequency for longer Sanger reads is around 30% (at a BLAST e-score of ≤0.001) [12]. Sanger libraries from soils show even lower hit rates at ~20%. The lack of homology to known sequences is only exacerbated by the shorter read lengths of next-generation sequencing technology [33] where libraries sequenced using the longest average read length next generation sequencing technology (i.e., 450 bp for the 454 pyrosequencing Ti FLX chemistry) yield hit rates to known sequence databases of less than 20%. In contrast, microbial shotgun metagenome libraries analyzed using the same databases and approaches will yield hit frequencies of ca. ...
Researchers funded by the National Institutes of Health have used a rapid DNA sequencing technique to identify gene variants in roughly a third of cases of nonimmune Hydrops fetalis (NIHF), a serious condition in which a fetus develops fluid buildup inside the abdominal cavity, lungs, or other parts of the body. The findings suggest that the DNA sequencing technique, known as exome sequencing, could be used to provide information unavailable with current genetic testing methods.
The extent of human genomic structural variation suggests that there must be portions of the genome yet to be discovered, annotated and characterized at the sequence level. We present a resource and analysis of 2,363 new insertion sequences corresponding to 720 genomic loci. We found that a substantial fraction of these sequences are either missing, fragmented or misassigned when compared to recent de novo sequence assemblies from short-read next-generation sequence data. We determined that 18-37% of these new insertions are copy-number polymorphic, including loci that show extensive population stratification among Europeans, Asians and Africans. Complete sequencing of 156 of these insertions identified new exons and conserved noncoding sequences not yet represented in the reference genome. We developed a method to accurately genotype these new insertions by mapping next-generation sequencing datasets to the breakpoint, thereby providing a means to characterize copy-number status for regions ...
Eighteen strong tumor samples constructive for numerous mutations as detected beforehand by Ion PGM and Ion Proton had been chosen for research. Libraries had been ready using DNA (vary10-40ng) from micro-dissected formalin-fixed, paraffin-embedded (FFPE) specimens using the Ion Ampliseq Library Kit 2.zero for complete most cancers (CCP), oncomine complete most cancers (OCP) and most cancers hotspot panel v2 (CHPv2) panel as per producers directions.. The CHPv2 had been sequenced using Ion PGM whereas CCP and OCP had been sequenced using Ion Proton respectively. All the three libraries had been additional sequenced individually (S540) or multiplexed (S530) using Ion S5XL. For S5XL, Ion chef was used to automate template preparation, enrichment of ion spheres and chip loading. Data evaluation was carried out using Torrent Suite 4.6 software program on board S5XL and Ion Reporter.. A restrict of detection and reproducibility research was carried out using serially diluted DLD1 cell line.RESULTSA ...
In the fields of bioinformatics and computational biology, Genome Survey Sequences (GSS) are nucleotide sequences similar to ESTs that the only difference is that most of them are genomic in origin, rather than mRNA. Genome Survey Sequences are typically generated and submitted to NCBI by labs performing genome sequencing and are used, amongst other things, as a framework for the mapping and sequencing of genome size pieces included in the standard GenBank divisions. Genome survey sequencing is a new way to map the genome sequences since it is not dependent on mRNA. Current genome sequencing approaches are mostly high-throughput shotgun methods, and GSS is often used on the first step of sequencing. GSSs can provide an initial global view of a genome, which includes both coding and non-coding DNA and contain repetitive section of the genome unlike ESTs. For the estimation of repetitive sequences, GSS plays an important role in the early assessment of a sequencing project since these data can ...
Next Generation Sequencing (NGS) machines extract from a biological sample a large number of short DNA fragments (reads). These reads are then used for several applications, e.g., sequence reconstruction, DNA assembly, gene expression profiling, mutation analysis. We propose a method to evaluate the similarity between reads. This method does not rely on the alignment of the reads and it is based on the distance between the frequencies of their substrings of fixed dimensions (k-mers). We compare this alignment-free distance with the similarity measures derived from two alignment methods: Needleman-Wunsch and Blast. The comparison is based on a simple assumption: the most correct distance is obtained by knowing in advance the reference sequence. Therefore, we first align the reads on the original DNA sequence, compute the overlap between the aligned reads, and use this overlap as an ideal distance. We then verify how the alignment-free and the alignment-based distances reproduce this ideal distance. The
Deidre: Welcome to Seqing Knowledge a genomics podcast from The Sequencing Center. Im your host Deidre Casey, here at The Sequencing Center lab in Fort Collins, Colorado. Each week well take a look at genomics-related topics from current events to new ideas with the hope of inspiring fellow knowledge seekers like you. Today were joined by Ryan Casey, head of product and business development at The Sequencing Center to talk about the future of genetics in the clinical market. Welcome, Ryan!. Ryan: Thanks Deidre, Im really excited to be here.. Deidre: Im really curious, as the head of product at The Sequencing Center what is your vision for the future of genetics?. Ryan: Its a pretty interesting question and I think the reality is a lot of people think about it from one facet and a lot of that is just purely the future of sequencing. I think whats really interesting about the clinical market specifically is that we look at it from a holistic perspective. That includes everything from the ...
by 16S Ribosomal DNA Sequence Analysis". International Journal of Systematic Bacteriology. 47 (4): 921-925. doi:10.1099/ ... Molecular analysis of the patient isolate allowed the classification of the strain to B. lusitaniae, a genospecies previously ... Vitorino, L. L.; Margos, G.; Zé-Zé, L.; Kurtenbach, K.; Collares-Pereira n, M. (2010). "Plasmid profile analysis of Portuguese ... "Fine-Scale Phylogeographic Structure of Borrelia lusitaniae Revealed by Multilocus Sequence Typing". PLOS ONE. 3 (12): 1-13. ...
DNA sequence analysis further confirmed the identity. Another case found N. sphaerica isolated from a corneal ulcer. A woman in ... rRNA sequence comparison of the ITS region confirmed N. sphaerica identity. Cases of leaf spot disease of kiwi fruit (Actinidia ... Analysis of corneal scrapings showed presence of hyphae elements suggesting cause of ulcer from a fungal pathogen. Isolated ...
Oct 2003). "The DNA sequence and analysis of human chromosome 6". Nature. 425 (6960): 40-45. Bibcode:2003Natur.425..805M. doi: ... PSORT II analysis predicts that there is a coiled_coil_region from 88 to 117 with sequence MNYTNRVEFLEEHHRVLESRLGSVTREITD. ... The genomic DNA is 54,407 base pairs long, while the longest mRNA that it produces is 2,215 bp long. This protein is well ... PSORT II analysis trained on yeast data predicts that the subcellular location of this protein is most likely in the cytoplasm ...
2004). "DNA sequence and analysis of human chromosome 9". Nature. 429 (6990): 369-74. doi:10.1038/nature02465. PMC 2734081. ... The complete sequences of 100 new cDNA clones from brain which can code for large proteins in vitro". DNA Res. 4 (2): 141-50. ... 2003). "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences". Proc. Natl. Acad. Sci ... 2001). "The sequence of the human genome". Science. 291 (5507): 1304-51. doi:10.1126/science.1058040. PMID 11181995. Strausberg ...
2004). "DNA sequence and analysis of human chromosome 9". Nature. 429 (6990): 369-74. doi:10.1038/nature02465. PMC 2734081. ... Family with sequence similarity 120 member A FAM122a: encoding protein Family with sequence similarity 122A FBP1 Fructose-1,6- ... Chromosome 9 spans about 138 million base pairs of nucleic acids (the building blocks of DNA) and represents between 4.0 and ... the collaborative consensus coding sequence project (CCDS) takes an extremely conservative strategy. So CCDS's gene number ...
2004). "DNA sequence and analysis of human chromosome 9". Nature. 429 (6990): 369-74. Bibcode:2004Natur.429..369H. doi:10.1038/ ... 2003). "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences". Proc. Natl. Acad. Sci ...
2004). "DNA sequence and analysis of human chromosome 9". Nature. 429 (6990): 369-74. doi:10.1038/nature02465. PMC 2734081. ... 2003). "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences". Proc. Natl. Acad. Sci ... 2000). "Shotgun sequencing of the human transcriptome with ORF expressed sequence tags". Proc. Natl. Acad. Sci. U.S.A. 97 (7): ... 2004). "Complete sequencing and characterization of 21,243 full-length human cDNAs". Nat. Genet. 36 (1): 40-5. doi:10.1038/ ...
... an integrated sequence analysis program for the Macintosh". Olson SA. Methods Mol Biol. (1994) 25,195-201. "DNA Sequencing ... MacVector is a collection of sequence analysis algorithms linked to various sequence editors, including a single sequence ... Protein analysis. Contig assembly and chromatogram editing Aligning cDNA against genomic templates Creating dot plots of DNA to ... MacVector is a commercial sequence analysis application for Apple Macintosh computers running Mac OS X. It is intended to be ...
2003). "The DNA sequence and analysis of human chromosome 6". Nature. 425 (6960): 805-11. Bibcode:2003Natur.425..805M. doi: ... 2003). "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences". Proc. Natl. Acad. Sci ... 2004). "Complete sequencing and characterization of 21,243 full-length human cDNAs". Nat. Genet. 36 (1): 40-5. doi:10.1038/ ... 2003). "Humoral immunity to human breast cancer: antigen definition and quantitative analysis of mRNA expression". Cancer Immun ...
2004). "The DNA sequence and analysis of human chromosome 13". Nature. 428 (6982): 522-8. doi:10.1038/nature02379. PMC 2665288 ... 2003). "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences". Proc. Natl. Acad. Sci ...
2003). "The DNA sequence and analysis of human chromosome 6". Nature. 425 (6960): 805-11. Bibcode:2003Natur.425..805M. doi: ... 2003). "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences". Proc. Natl. Acad. Sci ... 2004). "Analysis of the gene-dense major histocompatibility complex class III region and its comparison to mouse". Genome Res. ... 2004). "Complete sequencing and characterization of 21,243 full-length human cDNAs". Nat. Genet. 36 (1): 40-5. doi:10.1038/ ...
The coding sequences of 40 new genes (KIAA0041-KIAA0080) deduced by analysis of cDNA clones from human cell line KG-1". DNA Res ... 2003). "The DNA sequence and analysis of human chromosome 6". Nature. 425 (6960): 805-11. Bibcode:2003Natur.425..805M. doi: ... 1997). "Generation and analysis of 280,000 human expressed sequence tags". Genome Res. 6 (9): 807-28. doi:10.1101/gr.6.9.807. ... 2003). "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences". Proc. Natl. Acad. Sci ...
2003). "The DNA sequence and analysis of human chromosome 6". Nature. 425 (6960): 805-11. Bibcode:2003Natur.425..805M. doi: ... 2003). "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences". Proc. Natl. Acad. Sci ... Kinetic analysis of the interaction between the Ca2+-bound and the Ca2+-free guanylyl cyclase activating proteins (GCAPs) and ...
2003). "The DNA sequence and analysis of human chromosome 6". Nature. 425 (6960): 805-11. Bibcode:2003Natur.425..805M. doi: ... 2003). "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences". Proc. Natl. Acad. Sci ...
1997). "Generation and analysis of 280,000 human expressed sequence tags". Genome Res. 6 (9): 807-28. doi:10.1101/gr.6.9.807. ... 2000). "The DNA sequence of human chromosome 21". Nature. 405 (6784): 311-9. Bibcode:2000Natur.405..311H. doi:10.1038/35012518 ... 2003). "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences". Proc. Natl. Acad. Sci ... 1997). "Genomic organization and complete nucleotide sequence of the human PWP2 gene on chromosome 21". Genomics. 42 (3): 528- ...
2004). "The DNA sequence and analysis of human chromosome 13". Nature. 428 (6982): 522-8. doi:10.1038/nature02379. PMC 2665288 ... 2003). "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences". Proc. Natl. Acad. Sci ... 2004). "Complete sequencing and characterization of 21,243 full-length human cDNAs". Nat. Genet. 36 (1): 40-5. doi:10.1038/ ...
2003). "The DNA sequence and analysis of human chromosome 6". Nature. 425 (6960): 805-11. Bibcode:2003Natur.425..805M. doi: ... 2003). "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences". Proc. Natl. Acad. Sci ... 2001). "Functional analysis of B144/LST1: a gene in the tumor necrosis factor cluster that induces formation of long filopodia ... 2004). "Analysis of a high-throughput yeast two-hybrid system and its use to predict the function of intracellular proteins ...
"The DNA sequence and comparative analysis of human chromosome 5". Nature. 431 (7006): 268-274. Bibcode:2004Natur.431..268S. doi ... 2004). The DNA sequence and comparative analysis of human chromosome 5. Nature, 431(7006), 268-74. https://dx.doi.org/10.1038/ ... PRDM16 binds to DNA and acts as a transcriptional regulator. It functions in the differentiation between white and brown ... Sequence identity refers to similar amino acids while similarity refers to amino acid match. Database, GeneCards Human Gene. " ...
2003). "The DNA sequence and analysis of human chromosome 6". Nature. 425 (6960): 805-11. Bibcode:2003Natur.425..805M. doi: ... The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro". DNA Res. 6 (5): 337-45. doi: ... 2001). "Toward a catalog of human genes and proteins: sequencing and analysis of 500 novel complete protein coding human cDNAs ... 2004). "Complete sequencing and characterization of 21,243 full-length human cDNAs". Nat. Genet. 36 (1): 40-5. doi:10.1038/ ...
2003). "The DNA sequence and analysis of human chromosome 6". Nature. 425 (6960): 805-11. doi:10.1038/nature02055. PMID ... 2002). "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences". Proc. Natl. Acad. Sci ... 2008). "Many sequence variants affecting diversity of adult human height". Nat. Genet. 40 (5): 609-15. doi:10.1038/ng.122. PMID ... 2009). "Genome-wide association study identifies sequence variants on 6q21 associated with age at menarche". Nat. Genet. 41 (6 ...
2002). "The DNA sequence and comparative analysis of human chromosome 20". Nature. 414 (6866): 865-71. doi:10.1038/414865a. ... The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro". DNA Res. 8 (2): 85-95. doi: ... 2003). "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences". Proc. Natl. Acad. Sci ... 2001). "Toward a Catalog of Human Genes and Proteins: Sequencing and Analysis of 500 Novel Complete Protein Coding Human cDNAs ...
2004). "The DNA sequence and comparative analysis of human chromosome 10". Nature. 429 (6990): 375-81. doi:10.1038/nature02462 ... 2003). "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences". Proc. Natl. Acad. Sci ... 2004). "Complete sequencing and characterization of 21,243 full-length human cDNAs". Nat. Genet. 36 (1): 40-5. doi:10.1038/ ... 2005). "Evolution of vertebrate genes related to prion and Shadoo proteins--clues from comparative genomic analysis". Mol. Biol ...
2004). "The DNA sequence and comparative analysis of human chromosome 10". Nature. 429 (6990): 375-81. doi:10.1038/nature02462 ... The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro". DNA Res. 6 (3): 197-205. doi: ... 2003). "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences". Proc. Natl. Acad. Sci ... 2004). "Complete sequencing and characterization of 21,243 full-length human cDNAs". Nat. Genet. 36 (1): 40-5. doi:10.1038/ ...
2004). "The DNA sequence and comparative analysis of human chromosome 10". Nature. 429 (6990): 375-81. doi:10.1038/nature02462 ... The complete sequences of 100 new cDNA clones from brain which can code for large proteins in vitro". DNA Res. 5 (1): 31-9. doi ... 2003). "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences". Proc. Natl. Acad. Sci ... Nagase T, Ishikawa K, Miyajima N, Tanaka A, Kotani H, Nomura N, Ohara O (Aug 1998). "Prediction of the coding sequences of ...
2004). "The DNA sequence and comparative analysis of human chromosome 10". Nature. 429 (6990): 375-81. doi:10.1038/nature02462 ...
2004). "The DNA sequence and comparative analysis of human chromosome 10". Nature. 429 (6990): 375-81. doi:10.1038/nature02462 ... 2003). "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences". Proc. Natl. Acad. Sci ... 2004). "Complete sequencing and characterization of 21,243 full-length human cDNAs". Nat. Genet. 36 (1): 40-5. doi:10.1038/ ... 2006). "Human plasma N-glycoproteome analysis by immunoaffinity subtraction, hydrazide chemistry, and mass spectrometry". J. ...
2001). "The DNA sequence and comparative analysis of human chromosome 20". Nature. 414 (6866): 865-71. doi:10.1038/414865a. ... 2002). "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences". Proc. Natl. Acad. Sci ... 2004). "Complete sequencing and characterization of 21,243 full-length human cDNAs". Nat. Genet. 36 (1): 40-5. doi:10.1038/ ...
Krause's focus is genetic analysis using DNA sequencing. His research interests include human evolution and historical ... The same year, for his co-authorship of the Science article A draft sequence and preliminary analysis of the Neandertal genome ... 2010). "A draft sequence and preliminary analysis of the Neandertal genome". Science. 328 (5979): 710-722. Bibcode:2010Sci... ... J. Krause, Q. Fu, J. M. Good, B. Viola, M. V. Shunkov, A. P. Derevianko, S. Pääbo (2010). "The complete mitochondrial DNA ...
"Pocket Science: New Mobile Application Enables DNA Analysis On The Go". "Setting sequencing free - A*STAR Research". "DNAApp - ... "New mobile application enables DNA analysis on the go". "DNA analysis in the pocket!". Gan, Samuel Ken-En; Lim, Keane Ming-Jie ... "Scientists use a gaming algorithm to enhance a DNA sequencing Android app". "Exploring open access publishing in Asia with ... "Android app to enhance a DNA sequencing through image processsing algorithm". Archived from the original on 2017-07-28. ...
Taxonomic and biogeographic implications of an analysis of nuclear DNA sequence data". Proc. R. Soc. Lond. B. 269 (1488): 295- ... DNA evidence has shown the Maluridae to be most closely related to the Meliphagidae and the Pardalotidae in the superfamily ...
... Stephen A. Karl karl at CHUMA.CAS.USF.EDU Mon Dec 4 14:34:28 EST 1995 *Previous message: DNA ... People working with ribosomal DNA sequence are probably not in this group and have legitimate concerns. For others where in/ ... If many gaps are needed to align a sequence then it would seem that the degree of divergence between the sequences are such ... If the sequences are easily aligned and there are clear gaps necessary for the alignment then including them in the data set ...
These probe arrays, or DNA chips, can then be applied to parallel DNA hybridization analysis, directly yielding sequence ... Light-generated oligonucleotide arrays for rapid DNA sequence analysis. A C Pease, D Solas, E J Sullivan, M T Cronin, C P ... Light-generated oligonucleotide arrays for rapid DNA sequence analysis. A C Pease, D Solas, E J Sullivan, M T Cronin, C P ... Light-generated oligonucleotide arrays for rapid DNA sequence analysis. A C Pease, D Solas, E J Sullivan, M T Cronin, C P ...
Politico reports that the NYPD DNA database has grown since it announced it would be removing profiles from it. ... A Machine-Learning Framework for Accurate Classification and Quantification of Oncogenic Variants Using the QuantideX NGS DNA ... The technology, called PANGEA (predictive analysis of noncoding genomic enhancer/promoter alterations), could eventually help ... GenomSys Banks on MPEG-G Standard to Make Genome Analysis Mobile. Premium ...
Recent advances in DNA sequencing methodologies have caused an exponential growth of publicly available genomic sequence data. ... web-based software toolkit DNA sequence analysis DNA compression This is a preview of subscription content, log in to check ... Pratas D., Pinho A.J., Garcia S.P. (2012) Exon: A Web-Based Software Toolkit for DNA Sequence Analysis. In: Rocha M., Luscombe ... Dix, T.I., Powell, D.R., Allison, L., Bernal, J., Jaeger, S., Stern, L.: Comparative analysis of long DNA sequences by per ...
We have developed a method for the partial automation of DNA sequence analysis. Fluorescence detection of the DNA fragments is ... Fluorescence detection in automated DNA sequence analysis.. Smith LM, Sanders JZ, Kaiser RJ, Hughes P, Dodd C, Connell CR, ... by means of a fluorophore covalently attached to the oligonucleotide primer used in enzymatic DNA sequence analysis. A ... the separated fluorescent bands of DNA are detected near the bottom of the tube, and the sequence information is acquired ...
... Gigi Murphy MCBKANGI at nusvm.bitnet Fri May 4 16:29:30 EST 1990 * ... I am trying to set up a DNA/Protein sequence analysis software on our University IBM 3081 or IBM 3090 running VM/CMS since our ...
It is designed for use with existing sequencing chemistries using fluorescently labeled dideoxynucleotide triphosphate and for ... fragment analysis using Promega 4-, 5- and 6-dye STR kits, or other commercially available STR kits. ... The Spectrum Compact CE System is an integrated instrument for sequencing and fragment analysis. ... fsa for fragment analysis and .ab1 for Sanger sequencing. Dimensions. 40cm W x 60cm D x 60cm H (15.75in W x 23.62in D x 23.62in ...
The finished sequence comprises 166,880,988 base pairs, representing the largest chromosome sequenced so far. The entire ... sequence has been subjected to high-quality manual annotation, resulting in the evidence-su … ... The DNA sequence and analysis of human chromosome 6 Nature. 2003 Oct 23;425(6960):805-11. doi: 10.1038/nature02055. ... The finished sequence comprises 166,880,988 base pairs, representing the largest chromosome sequenced so far. The entire ...
Sampling properties of DNA sequence data in phylogenetic analysis. Title. Sampling properties of DNA sequence data in ...
A case of onychomycosis due to Aspergillus sydowii diagnosed using DNA sequence analysis.. Takahata Y, Hiruma M, Sugita T, Muto ... The causative agent was identified as Aspergillus sydowii based on DNA sequencing and the macroscopic and microscopic ...
DNA sequence analysis of artificially evolved ebg enzyme and ebg repressor genes.. B G Hall, P W Betts and J C Wootton ... DNA sequence analysis of artificially evolved ebg enzyme and ebg repressor genes.. B G Hall, P W Betts and J C Wootton ... DNA sequence analysis of artificially evolved ebg enzyme and ebg repressor genes.. B G Hall, P W Betts and J C Wootton ... DNA sequence analysis of artificially evolved ebg enzyme and ebg repressor genes. ...
DNA methylation is the paradigm epigenetic modification that is associated with transcriptional repression.... ... Epigenetic modifications of chromatin and DNA are relevant for eukaryotic gene expression. ... Ultradeep bisulfite sequencing analysis of DNA methylation patterns in multiple gene promoters by 454 sequencing. Cancer Res 67 ... Baubec T., Akalin A. (2016) Genome-Wide Analysis of DNA Methylation Patterns by High-Throughput Sequencing. In: Aransay A., ...
Also discussed are important recent diagnostic applications of DNA sequencing in cancer, including analysis of tumor derived ... Also discussed are important recent diagnostic applications of DNA sequencing in cancer, including analysis of tumor derived ... Pharmogenetic variants detected by DNA sequence analysis are gaining in importance and are particularly relevant to ... Applications involving analysis of cell free DNA in maternal DNA for prenatal diagnosis of specific autosomal trisomies are ...
Sequencing and Analysis of Neanderthal Genomic DNA. By James P. Noonan, Graham Coop, Sridhar Kudaravalli, Doug Smith, Johannes ... Sequencing and Analysis of Neanderthal Genomic DNA. By James P. Noonan, Graham Coop, Sridhar Kudaravalli, Doug Smith, Johannes ... Our analyses suggest that on average the Neanderthal genomic sequence we obtained and the reference human genome sequence share ... The sequences of DNA fragments from Neanderthal bones date the divergence of humans and Neanderthals to about 370,000 years ago ...
... - Perkinelmer, Agilent Technologies, Eurofins Scientific, Illumina, ... Global DNA Sequencing Market Report MarketResearchReports.Biz announces addition of new report "Global DNA Sequencing Market ... Global DNA Sequencing Market Report MarketResearchReports.Biz announces addition of new report "Global DNA Sequencing Market ... DNA synthesis processes DNA oligomers are the foundation of the DNA synthesis process. The essential feature of DNA synthesis ...
Cytogenetic Analysis of Populus trichocarpa - Ribosomal DNA, Telomere Repeat Sequence, and Marker-selected BACs. Cytogenet ... Cytogenetic Analysis of Populus trichocarpa - Ribosomal DNA, Telomere Repeat Sequence, and Marker-selected BACs ... Six BAC clones selected from 2 linkage groups based on genome sequence assembly (LG-I and LG-VI) were localized on 2 ... All BAC positions were found to be concordant with sequence assembly positions. BAC-FISH will be useful for delineating each of ...
... fundamental modifications to RRM had to be made in order to make it suitable for the analysis of a greater variety of sequences ... During the course of the project, several methods for extracting the features from the spectra of biological sequences and ... For promoter classification the suitable choices were found to be Principal Component Analysis (PCA) feature extraction and ... Results indicate that signal processing methods may be very suitable for analyzing biological sequences. ...
BACKGROUND: A computational system for analysis of the repetitive structure of genomic sequences is described. The method uses ... This method has been incorporated into a system that can find repeats in individual genome sequences or sets of sequences, and ... should prove helpful in the analysis of repeat structure for both complete and partial genome sequences. ... CONCLUSIONS: We propose a new clustering method for analysis of the repeat data captured in suffix trees. ...
DNA SEQUENCE ANALYSIS - SANGER OR NGS. Sequencher DNA Sequence Analysis Software is an indispensable tool for the benchtop ... With powerful analyses and rich visualizations, it has a unique paradigm where every analysis is an experiment that make your ... Next-Gen Sequencing (NGS), and RNA-Seq sequence data. Come see what Sequencher can do for you, Power with Simplicity. ... RNA-SEQ OR MICROARRAY DATA ANALYSIS CodeLinker is a user-friendly and powerful desktop software program for analyzing your RNA- ...
Sanger DNA Analysis. Sequenchers extensive Sanger analysis features are the foundation it was built upon. Customizable from ... Easily use consensus sequences from the Project Window as a reference sequence for NGS alignments for hybrid sequencing ... NEXT-GENERATION DNA SEQUENCING (NGS). Sequencher empowers the benchtop scientist by bringing the latest peer-reviewed NGS ... Send primer pair sequences from Primer-BLAST runs in Sequencher Connections to your Sequencher project. ...
BI101 Introduction to DNA and Protein Sequence Analysis; Jul. 9-13, 2012. (ACTG). This course teaches the individual how to ... analyze DNA and protein sequences using computer software. Topics to be covered include description of sequence alignments, ...
... algorithms are the traditional ways to compare and analyze DNA sequences. However, for large DNA sequences, these algorithms ... Results: We perform similarity/dissimilarity analyses among two real DNA data sets, the coding sequences of the first exon of ... Objective: Here we will propose a new numerical method to characterize and compare DNA sequences quickly. Method: Based on a ... graphical representation of DNA sequences, we can obtain an 8-dimensional vector using two basic concepts of probability, the ...
Sequencing and Comparative Genomic Analysis of pK29, a 269-Kilobase Conjugative Plasmid Encoding CMY-8 and CTX-M-3 β-Lactamases ... Target Gene Sequencing To Characterize the Penicillin G Susceptibility of Neisseria meningitidis Muhamed-Kheir Taha, Julio A. ... Cloning, Sequencing, and Characterization of the SdeAB Multidrug Efflux Pump of Serratia marcescens Ayush Kumar, Elizabeth A. ... Reply to Furlan et al., "Importance of Sequencing To Determine Functional blaTEM Variants" George A. Jacoby, Karen Bush ...
... and Gordona and compared these sequences with previously published sequences. Three phylogenetic methods (the neighbor-joining ... We determined almost complete small-subunit ribosomal DNA sequences of 50 reference strains belonging to the genera ... Phylogeny of the genus Corynebacterium deduced from analyses of small-subunit ribosomal DNA sequences Int J Syst Bacteriol. ... We determined almost complete small-subunit ribosomal DNA sequences of 50 reference strains belonging to the genera ...
Phylogenetic Analysis of DNA Sequences has 1 available editions to buy at Alibris ... Phylogenetic Analysis of DNA Sequences by Miyamoto, Cracraft starting at $13.07. ... Phylogenetic Analysis of DNA Sequences. by Miyamoto, Cracraft Write The First Customer Review ... In this volume, international contributors address crucial questions about DNA systematics, including DNA sequence data ...
HUMAN MITOCHONDRIAL DNA VARIATION AND EVOLUTION: ANALYSIS OF NUCLEOTIDE SEQUENCES FROM SEVEN INDIVIDUALS. Charles F. Aquadro ... HUMAN MITOCHONDRIAL DNA VARIATION AND EVOLUTION: ANALYSIS OF NUCLEOTIDE SEQUENCES FROM SEVEN INDIVIDUALS. Charles F. Aquadro ... HUMAN MITOCHONDRIAL DNA VARIATION AND EVOLUTION: ANALYSIS OF NUCLEOTIDE SEQUENCES FROM SEVEN INDIVIDUALS. Charles F. Aquadro ... HUMAN MITOCHONDRIAL DNA VARIATION AND EVOLUTION: ANALYSIS OF NUCLEOTIDE SEQUENCES FROM SEVEN INDIVIDUALS ...
The new system is ideal for applications requiring analysis of longer sequences, such as DNA methylation analysis in epigenetic ... The new system is ideal for applications requiring analysis of longer sequences, such as DNA methylation analysis in epigenetic ... Single Base Resolution DNA Methylation and Mutation Analysis in Long Sequence Runs. ... DNA methylation analysis at single base resolution at CpG and CpN sites ...
Spectrum of spontaneous mutation at the APRT locus of Chinese hamster ovary cells: an analysis at the DNA sequence level. P J ... Spectrum of spontaneous mutation at the APRT locus of Chinese hamster ovary cells: an analysis at the DNA sequence level ... Spectrum of spontaneous mutation at the APRT locus of Chinese hamster ovary cells: an analysis at the DNA sequence level ... Spectrum of spontaneous mutation at the APRT locus of Chinese hamster ovary cells: an analysis at the DNA sequence level ...
His other research focus is using computers for DNA analysis to prevent disease.. More than 99 percent of the DNA in every ... Computer science graduate develops models for DNA sequence analysis ... Computer science graduate develops models for DNA sequence analysis ... Two broad areas that Hustons research focuses are developing computer models for cellular networks and performing DNA analysis ...
download bioinformatics for dna of Heterocyclic Compounds An golden tam of single quae and causes. ... Each download bioinformatics for dna runs a many understanding, with hands being 3,4-dimethyl-3-penten-2-one and certain ... download bioinformatics for dna sequence analysis of similar divisions thermodynamic esse of single ideas and parts. ... 2019; d objects of download bioinformatics for dna and resemblance. This download bioinformatics for dna sequence analysis of ...