A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.
The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.
A multistage process that includes the determination of a sequence (protein, carbohydrate, etc.), its fragmentation and analysis, and the interpretation of the resulting sequence information.
The relationships of groups of organisms as reflected by their genetic makeup.
The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.
Constituent of 30S subunit prokaryotic ribosomes containing 1600 nucleotides and 21 proteins. 16S rRNA is involved in initiation of polypeptide synthesis.
Deoxyribonucleic acid that makes up the genetic material of bacteria.
The sequential correspondence of nucleotides in one nucleic acid molecule with those of another nucleic acid molecule. Sequence homology is an indication of the genetic relatedness of different organisms and gene function.
DNA sequences encoding RIBOSOMAL RNA and the segments of DNA separating the individual ribosomal RNA genes, referred to as RIBOSOMAL SPACER DNA.
The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.
The arrangement of two or more amino acid or base sequences from an organism or organisms in such a way as to align areas of the sequences sharing common properties. The degree of relatedness or homology between the sequences is predicted computationally or statistically based on weights assigned to the elements aligned between the sequences. This in turn can serve as a potential indicator of the genetic relatedness between the organisms.
The functional hereditary units of BACTERIA.
In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships.
Use of restriction endonucleases to analyze and generate a physical map of genomes, genes, or other segments of DNA.
The relative amounts of the PURINES and PYRIMIDINES in a nucleic acid.
Proteins found in any species of bacterium.
A sequence of successive nucleotide triplets that are read as CODONS specifying AMINO ACIDS and begin with an INITIATOR CODON and end with a stop codon (CODON, TERMINATOR).
Genes, found in both prokaryotes and eukaryotes, which are transcribed to produce the RNA which is incorporated into RIBOSOMES. Prokaryotic rRNA genes are usually found in OPERONS dispersed throughout the GENOME, whereas eukaryotic rRNA genes are clustered, multicistronic transcriptional units.
Widely used technique which exploits the ability of complementary sequences in single-stranded DNAs or RNAs to pair with each other to form a double helix. Hybridization can take place between two complimentary DNA sequences, between a single-stranded DNA and a complementary RNA, or between two RNA sequences. The technique is used to detect and isolate specific sequences, measure homology, or define other characteristics of one or both strands. (Kendrew, Encyclopedia of Molecular Biology, 1994, p503)
A process that includes the determination of AMINO ACID SEQUENCE of a protein (or peptide, oligopeptide or peptide fragment) and the information analysis of the sequence.
A deoxyribonucleotide polymer that is the primary genetic material of all cells. Eukaryotic and prokaryotic organisms normally contain DNA in a double-stranded state, yet several important biological processes transiently involve single-stranded regions. DNA, which consists of a polysugar-phosphate backbone possessing projections of purines (adenine and guanine) and pyrimidines (thymine and cytosine), forms a double helix that is held together by hydrogen bonds between these purines and pyrimidines (adenine to thymine and guanine to cytosine).
Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.
The restriction of a characteristic behavior, anatomical structure or physical system, such as immune response; metabolic response, or gene or gene variant to the members of one species. It refers to that property which differentiates one species from another but it is also used for phylogenetic levels higher or lower than the species.
Procedures for identifying types and strains of bacteria. The most frequently employed typing systems are BACTERIOPHAGE TYPING and SEROTYPING as well as bacteriocin typing and biotyping.
A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.
Single-stranded complementary DNA synthesized from an RNA template by the action of RNA-dependent DNA polymerase. cDNA (i.e., complementary DNA, not circular DNA, not C-DNA) is used in a variety of molecular cloning experiments as well as serving as a specific hybridization probe.
Extrachromosomal, usually CIRCULAR DNA molecules that are self-replicating and transferable from one organism to another. They are found in a variety of bacterial, archaeal, fungal, algal, and plant species. They are used in GENETIC ENGINEERING as CLONING VECTORS.
Short sequences (generally about 10 base pairs) of DNA that are complementary to sequences of messenger RNA and allow reverse transcriptases to start copying the adjacent sequences of mRNA. Primers are used extensively in genetic and molecular biology techniques.
A set of genes descended by duplication and variation from some ancestral gene. Such genes may be clustered together on the same chromosome or dispersed on different chromosomes. Examples of multigene families include those that encode the hemoglobins, immunoglobulins, histocompatibility antigens, actins, tubulins, keratins, collagens, heat shock proteins, salivary glue proteins, chorion proteins, cuticle proteins, yolk proteins, and phaseolins, as well as histones, ribosomal RNA, and transfer RNA genes. The latter three are examples of reiterated genes, where hundreds of identical genes are present in a tandem array. (King & Stanfield, A Dictionary of Genetics, 4th ed)
A category of nucleic acid sequences that function as units of heredity and which code for the basic instructions for the development, reproduction, and maintenance of organisms.
The intergenic DNA segments that are between the ribosomal RNA genes (internal transcribed spacers) and between the tandemly repeated units of rDNA (external transcribed spacers and nontranscribed spacers).
Ribonucleic acid in bacteria having regulatory and catalytic roles as well as involvement in protein synthesis.
Genotypic differences observed among individuals in a population.
RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.
Any method used for determining the location of and relative distances between genes on a chromosome.
The degree of similarity between sequences. Studies of AMINO ACID SEQUENCE HOMOLOGY and NUCLEIC ACID SEQUENCE HOMOLOGY provide useful information about the genetic relatedness of genes, gene products, and species.
A method (first developed by E.M. Southern) for detection of DNA that has been electrophoretically separated and immobilized by blotting on nitrocellulose or other type of paper or nylon membrane followed by hybridization with labeled NUCLEIC ACID PROBES.
A large collection of DNA fragments cloned (CLONING, MOLECULAR) from a given organism, tissue, organ, or cell type. It may contain complete genomic sequences (GENOMIC LIBRARY) or complementary DNA sequences, the latter being formed from messenger RNA and lacking intron sequences.
The biosynthesis of RNA carried out on a template of DNA. The biosynthesis of DNA from an RNA template is called REVERSE TRANSCRIPTION.
The outward appearance of the individual. It is the product of interactions between genes, and between the GENOTYPE and the environment.
The presence of bacteria, viruses, and fungi in the soil. This term is not restricted to pathogenic organisms.
Sequences of DNA or RNA that occur in multiple copies. There are several types: INTERSPERSED REPETITIVE SEQUENCES are copies of transposable elements (DNA TRANSPOSABLE ELEMENTS or RETROELEMENTS) dispersed throughout the genome. TERMINAL REPEAT SEQUENCES flank both ends of another sequence, for example, the long terminal repeats (LTRs) on RETROVIRUSES. Variations may be direct repeats, those occurring in the same direction, or inverted repeats, those opposite to each other in direction. TANDEM REPEAT SEQUENCES are copies which lie adjacent to each other, direct or inverted (INVERTED REPEAT SEQUENCES).
The complete genetic complement contained in a DNA or RNA molecule in a virus.
The sum of the weight of all the atoms in a molecule.
Enzymes that are part of the restriction-modification systems. They catalyze the endonucleolytic cleavage of DNA sequences which lack the species-specific methylation pattern in the host cell's DNA. Cleavage yields random or specific double-stranded fragments with terminal 5'-phosphates. The function of restriction enzymes is to destroy any foreign DNA that invades the host cell. Most have been studied in bacterial systems, but a few have been found in eukaryotic organisms. They are also used as tools for the systematic dissection and mapping of chromosomes, in the determination of base sequences of DNAs, and have made it possible to splice and recombine genes from one organism into the genome of another. EC 3.21.1.
A multistage process that includes cloning, physical mapping, subcloning, sequencing, and information analysis of an RNA SEQUENCE.
A sequence of amino acids in a polypeptide or of nucleotides in DNA or RNA that is similar across multiple species. A known set of conserved sequences is represented by a CONSENSUS SEQUENCE. AMINO ACID MOTIFS are often composed of conserved sequences.
Discrete segments of DNA which can excise and reintegrate to another site in the genome. Most are inactive, i.e., have not been found to exist outside the integrated state. DNA transposable elements include bacterial IS (insertion sequence) elements, Tn elements, the maize controlling elements Ac and Ds, Drosophila P, gypsy, and pogo elements, the human Tigger elements and the Tc and mariner elements which are found throughout the animal kingdom.
Deoxyribonucleic acid that makes up the genetic material of viruses.
A set of statistical methods used to group variables or observations into strongly inter-related subgroups. In epidemiology, it may be used to analyze a closely grouped series of events or cases of disease or other health-related phenomenon with well-defined distribution patterns in relation to time or place or both.
The process of cumulative change at the level of DNA; RNA; and PROTEINS, over successive generations.
The parts of a transcript of a split GENE remaining after the INTRONS are removed. They are spliced together to become a MESSENGER RNA or other functional RNA.
Deoxyribonucleic acid that makes up the genetic material of fungi.
The functional hereditary units of VIRUSES.
Electrophoresis in which a polyacrylamide gel is used as the diffusion medium.
The genetic constitution of the individual, comprising the ALLELES present at each GENETIC LOCUS.
Biochemical identification of mutational changes in a nucleotide sequence.
A test used to determine whether or not complementation (compensation in the form of dominance) will occur in a cell with a given mutant phenotype when another mutant genome, encoding the same mutant phenotype, is introduced into that cell.
Organic, monobasic acids derived from hydrocarbons by the equivalent of oxidation of a methyl group to an alcohol, aldehyde, and then acid. Fatty acids are saturated and unsaturated (FATTY ACIDS, UNSATURATED). (Grant & Hackh's Chemical Dictionary, 5th ed)
Detection of RNA that has been electrophoretically separated and immobilized by blotting on nitrocellulose or other type of paper or nylon membrane followed by hybridization with labeled NUCLEIC ACID PROBES.
Variation occurring within a species in the presence or length of DNA fragment generated by a specific endonuclease at a specific site in the genome. Such variations are generated by mutations that create or abolish recognition sites for these enzymes or change the length of the fragment.
Mutagenesis where the mutation is caused by the introduction of foreign DNA sequences into a gene or extragenic sequence. This may occur spontaneously in vivo or be experimentally induced in vivo or in vitro. Proviral DNA insertions into or adjacent to a cellular proto-oncogene can interrupt GENETIC TRANSLATION of the coding sequences or interfere with recognition of regulatory elements and cause unregulated expression of the proto-oncogene resulting in tumor formation.
Partial proteins formed by partial hydrolysis of complete proteins or generated through PROTEIN ENGINEERING techniques.
The parts of a macromolecule that directly participate in its specific combination with another molecule.
A form of GENE LIBRARY containing the complete DNA sequences present in the genome of a given organism. It contrasts with a cDNA library which contains only sequences utilized in protein coding (lacking introns).
DNA sequences which are recognized (directly or indirectly) and bound by a DNA-dependent RNA polymerase during the initiation of transcription. Highly conserved sequences within the promoter include the Pribnow box in bacteria and the TATA BOX in eukaryotes.
A set of three nucleotides in a protein coding sequence that specifies individual amino acids or a termination signal (CODON, TERMINATOR). Most codons are universal, but some organisms do not produce the transfer RNAs (RNA, TRANSFER) complementary to all codons. These codons are referred to as unassigned codons (CODONS, NONSENSE).
Ribonucleic acid that makes up the genetic material of viruses.
Liquid chromatographic techniques which feature high inlet pressures, high sensitivity, and high speed.
Sequences of DNA in the genes that are located between the EXONS. They are transcribed along with the exons but are removed from the primary gene transcript by RNA SPLICING to leave mature RNA. Some introns code for separate genes.
Proteins prepared by recombinant DNA technology.
Synthetic or natural oligonucleotides used in hybridization studies in order to identify and study specific nucleic acid fragments, e.g., DNA segments near or within a specific gene locus or gene. The probe hybridizes with a specific mRNA, if present. Conventional techniques used for testing for the hybridization product include dot blot assays, Southern blot assays, and DNA:RNA hybrid-specific antibody tests. Conventional labels for the probe include the radioisotope labels 32P and 125I and the chemical label biotin.
Domesticated bovine animals of the genus Bos, usually kept on a farm or ranch and used for the production of meat or dairy products or for heavy labor.
In bacteria, a group of metabolically related genes, with a common promoter, whose transcription into a single polycistronic MESSENGER RNA is under the control of an OPERATOR REGION.
Established cell cultures that have the potential to propagate indefinitely.
Proteins found in any species of virus.
A mutation caused by the substitution of one nucleotide for another. This results in the DNA molecule having a change in a single base pair.
The salinated water of OCEANS AND SEAS that provides habitat for marine organisms.
Variant forms of the same gene, occupying the same locus on homologous CHROMOSOMES, and governing the variants in production of the same gene product.
The phenotypic manifestation of a gene or genes by the processes of GENETIC TRANSCRIPTION and GENETIC TRANSLATION.
An order of gram-positive, primarily aerobic BACTERIA that tend to form branching filaments.
Direct nucleotide sequencing of gene fragments from multiple housekeeping genes for the purpose of phylogenetic analysis, organism identification, and typing of species, strain, serovar, or other distinguishable phylogenetic level.
Production of new arrangements of DNA by various mechanisms such as assortment and segregation, CROSSING OVER; GENE CONVERSION; GENETIC TRANSFORMATION; GENETIC CONJUGATION; GENETIC TRANSDUCTION; or mixed infection of viruses.
Organic compounds that generally contain an amino (-NH2) and a carboxyl (-COOH) group. Twenty alpha-amino acids are the subunits which are polymerized to form proteins.
Any of the processes by which cytoplasmic or intercellular factors influence the differential control of gene action in bacteria.
The functional hereditary units of FUNGI.
A serine endopeptidase that is formed from TRYPSINOGEN in the pancreas. It is converted into its active form by ENTEROPEPTIDASE in the small intestine. It catalyzes hydrolysis of the carboxyl group of either arginine or lysine. EC 3.4.21.4.
A theoretical representative nucleotide or amino acid sequence in which each nucleotide or amino acid is the one which occurs most frequently at that site in the different sequences which occur in nature. The phrase also refers to an actual sequence which approximates the theoretical consensus. A known CONSERVED SEQUENCE set is represented by a consensus sequence. Commonly observed supersecondary protein structures (AMINO ACID MOTIFS) are often formed by conserved sequences.
A variation of the PCR technique in which cDNA is made from RNA via reverse transcription. The resultant cDNA is then amplified using standard PCR protocols.
Cyanogen bromide (CNBr). A compound used in molecular biology to digest some proteins and as a coupling reagent for phosphoroamidate or pyrophosphate internucleotide bonds in DNA duplexes.
A polynucleotide consisting essentially of chains with a repeating backbone of phosphate and ribose units to which nitrogenous bases are attached. RNA is unique among biological macromolecules in that it can encode genetic information, serve as an abundant structural component of cells, and also possesses catalytic activity. (Rieger et al., Glossary of Genetics: Classical and Molecular, 5th ed)
A class in the phylum PROTEOBACTERIA comprised mostly of two major phenotypes: purple non-sulfur bacteria and aerobic bacteriochlorophyll-containing bacteria.
The spatial arrangement of the atoms of a nucleic acid or polynucleotide that results in its characteristic 3-dimensional shape.
The presence of bacteria, viruses, and fungi in water. This term is not restricted to pathogenic organisms.
Linear POLYPEPTIDES that are synthesized on RIBOSOMES and may be further modified, crosslinked, cleaved, or assembled into complex proteins with several subunits. The specific sequence of AMINO ACIDS determines the shape the polypeptide will take, during PROTEIN FOLDING, and the function of the protein.
A mass of organic or inorganic solid fragmented material, or the solid fragment itself, that comes from the weathering of rock and is carried by, suspended in, or dropped by air, water, or ice. It refers also to a mass that is accumulated by any other natural agent and that forms in layers on the earth's surface, such as sand, gravel, silt, mud, fill, or loess. (McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed, p1689)
The degree of pathogenicity within a group or species of microorganisms or viruses as indicated by case fatality rates and/or the ability of the organism to invade the tissues of the host. The pathogenic capacity of an organism is determined by its VIRULENCE FACTORS.
The characteristic 3-dimensional shape of a protein, including the secondary, supersecondary (motifs), tertiary (domains) and quaternary structure of the peptide chain. PROTEIN STRUCTURE, QUATERNARY describes the conformation assumed by multimeric proteins (aggregates of more than one polypeptide chain).
The biosynthesis of PEPTIDES and PROTEINS on RIBOSOMES, directed by MESSENGER RNA, via TRANSFER RNA that is charged with standard proteinogenic AMINO ACIDS.
Constituent of 50S subunit of prokaryotic ribosomes containing about 3200 nucleotides. 23S rRNA is involved in the initiation of polypeptide synthesis.
A characteristic feature of enzyme activity in relation to the kind of substrate on which the enzyme or catalytic molecule reacts.
The record of descent or ancestry, particularly of a particular condition or trait, indicating individual family members, their relationships, and their status with respect to the trait or condition.
Deletion of sequences of nucleic acids from the genetic material of an individual.
The genetic complement of a BACTERIA as represented in its DNA.
Common name for the species Gallus gallus, the domestic fowl, in the family Phasianidae, order GALLIFORMES. It is descended from the red jungle fowl of SOUTHEAST ASIA.
Biologically active DNA which has been formed by the in vitro joining of segments of DNA from different sources. It includes the recombination joint or edge of a heteroduplex region where two recombining DNA molecules are connected.
Proteins which are found in membranes including cellular and intracellular membranes. They consist of two types, peripheral and integral proteins. They include most membrane-associated enzymes, antigenic proteins, transport proteins, and drug, hormone, and lectin receptors.
One of the three domains of life (the others being Eukarya and ARCHAEA), also called Eubacteria. They are unicellular prokaryotic microorganisms which generally possess rigid cell walls, multiply by cell division, and exhibit three principal forms: round or coccal, rodlike or bacillary, and spiral or spirochetal. Bacteria can be classified by their response to OXYGEN: aerobic, anaerobic, or facultatively anaerobic; by the mode by which they obtain their energy: chemotrophy (via chemical reaction) or PHOTOTROPHY (via light reaction); for chemotrophs by their source of chemical energy: CHEMOLITHOTROPHY (from inorganic compounds) or chemoorganotrophy (from organic compounds); and by their source for CARBON; NITROGEN; etc.; HETEROTROPHY (from organic sources) or AUTOTROPHY (from CARBON DIOXIDE). They can also be classified by whether or not they stain (based on the structure of their CELL WALLS) with CRYSTAL VIOLET dye: gram-negative or gram-positive.
Proteins found in plants (flowers, herbs, shrubs, trees, etc.). The concept does not include proteins found in vegetables for which VEGETABLE PROTEINS is available.
The regular and simultaneous occurrence in a single interbreeding population of two or more discontinuous genotypes. The concept includes differences in genotypes ranging in size from a single nucleotide site (POLYMORPHISM, SINGLE NUCLEOTIDE) to large nucleotide sequences visible at a chromosomal level.
Sequential operating programs and data which instruct the functioning of a digital computer.
The level of protein structure in which combinations of secondary protein structures (alpha helices, beta sheets, loop regions, and motifs) pack together to form folded shapes called domains. Disulfide bridges between cysteines in two different parts of the polypeptide chain along with other interactions between the chains play a role in the formation and stabilization of tertiary structure. Small proteins usually consist of only one domain but larger proteins may contain a number of domains connected by segments of polypeptide chain which lack regular secondary structure.
A genus of bacteria that form a nonfragmented aerial mycelium. Many species have been identified with some being pathogenic. This genus is responsible for producing a majority of the ANTI-BACTERIAL AGENTS of practical value.
Models used experimentally or theoretically to study molecular shape, electronic properties, or interactions; includes analogous molecules, computer-generated graphics, and mechanical structures.
Constituent of the 60S subunit of eukaryotic ribosomes. 5.8S rRNA is involved in the initiation of polypeptide synthesis in eukaryotes.
Multicellular, eukaryotic life forms of kingdom Plantae (sensu lato), comprising the VIRIDIPLANTAE; RHODOPHYTA; and GLAUCOPHYTA; all of which acquired chloroplasts by direct endosymbiosis of CYANOBACTERIA. They are characterized by a mainly photosynthetic mode of nutrition; essentially unlimited growth at localized regions of cell divisions (MERISTEMS); cellulose within cells providing rigidity; the absence of organs of locomotion; absence of nervous and sensory systems; and an alternation of haploid and diploid generations.
Former kingdom, located on Korea Peninsula between Sea of Japan and Yellow Sea on east coast of Asia. In 1948, the kingdom ceased and two independent countries were formed, divided by the 38th parallel.
Process of generating a genetic MUTATION. It may occur spontaneously or be induced by MUTAGENS.
The process of cumulative change over successive generations through which organisms acquire their distinguishing morphological and physiological characteristics.
Transport proteins that carry specific substances in the blood or across cell membranes.
Genes which regulate or circumscribe the activity of other genes; specifically, genes which code for PROTEINS or RNAs which have GENE EXPRESSION REGULATION functions.
A group of the proteobacteria comprised of facultatively anaerobic and fermentative gram-negative bacteria.
A genetic rearrangement through loss of segments of DNA or RNA, bringing sequences which are normally separated into close proximity. This deletion may be detected using cytogenetic techniques and can also be inferred from the phenotype, indicating a deletion at one specific locus.
A group of deoxyribonucleotides (up to 12) in which the phosphate residues of each deoxyribonucleotide act as bridges in forming diester linkages between the deoxyribose moieties.
Any of various animals that constitute the family Suidae and comprise stout-bodied, short-legged omnivorous mammals with thick skin, usually covered with coarse bristles, a rather long mobile snout, and small tail. Included are the genera Babyrousa, Phacochoerus (wart hogs), and Sus, the latter containing the domestic pig (see SUS SCROFA).
The class of all enzymes catalyzing oxidoreduction reactions. The substrate that is oxidized is regarded as a hydrogen donor. The systematic name is based on donor:acceptor oxidoreductase. The recommended name will be dehydrogenase, wherever this is possible; as an alternative, reductase can be used. Oxidase is only used in cases where O2 is the acceptor. (Enzyme Nomenclature, 1992, p9)
Any normal or abnormal coloring matter in PLANTS; ANIMALS or micro-organisms.
A field of biology concerned with the development of techniques for the collection and manipulation of biological data, and the use of such data to make biological discoveries or predictions. This field encompasses all computational methods and theories for solving biological problems including manipulation of models and datasets.
Deoxyribonucleic acid that makes up the genetic material of plants.
Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control (induction or repression) of gene action at the level of transcription or translation.
The most abundant form of RNA. Together with proteins, it forms the ribosomes, playing a structural role and also a role in ribosomal binding of mRNA and tRNAs. Individual chains are conventionally designated by their sedimentation coefficients. In eukaryotes, four large chains exist, synthesized in the nucleolus and constituting about 50% of the ribosome. (Dorland, 28th ed)
Proteins isolated from the outer membrane of Gram-negative bacteria.
Endogenous substances, usually proteins, which are effective in the initiation, stimulation, or termination of the genetic transcription process.
A group of adenine ribonucleotides in which the phosphate residues of each adenine ribonucleotide act as bridges in forming diester linkages between the ribose moieties.
Diseases of plants.
The property of objects that determines the direction of heat flow when they are placed in direct thermal contact. The temperature is the energy of microscopic motions (vibrational and translational) of the particles of atoms.
The sequential location of genes on a chromosome.
Analysis of PEPTIDES that are generated from the digestion or fragmentation of a protein or mixture of PROTEINS, by ELECTROPHORESIS; CHROMATOGRAPHY; or MASS SPECTROMETRY. The resulting peptide fingerprints are analyzed for a variety of purposes including the identification of the proteins in a sample, GENETIC POLYMORPHISMS, patterns of gene expression, and patterns diagnostic for diseases.
Proteins which bind to DNA. The family includes proteins which bind to both double- and single-stranded DNA and also includes specific DNA binding proteins in serum which can be used as markers for malignant diseases.
A genus of gram-negative, aerobic, rod-shaped bacteria widely distributed in nature. Some species are pathogenic for humans, animals, and plants.
Constituent of the 40S subunit of eukaryotic ribosomes. 18S rRNA is involved in the initiation of polypeptide synthesis in eukaryotes.
The rate dynamics in chemical or physical systems.
A species of the genus SACCHAROMYCES, family Saccharomycetaceae, order Saccharomycetales, known as "baker's" or "brewer's" yeast. The dried form is used as a dietary supplement.
Species- or subspecies-specific DNA (including COMPLEMENTARY DNA; conserved genes, whole chromosomes, or whole genomes) used in hybridization studies in order to identify microorganisms, to measure DNA-DNA homologies, to group subspecies, etc. The DNA probe hybridizes with a specific mRNA, if present. Conventional techniques used for testing for the hybridization product include dot blot assays, Southern blot assays, and DNA:RNA hybrid-specific antibody tests. Conventional labels for the DNA probe include the radioisotope labels 32P and 125I and the chemical label biotin. The use of DNA probes provides a specific, sensitive, rapid, and inexpensive replacement for cell culture techniques for diagnosing infections.
Members of the class of compounds composed of AMINO ACIDS joined together by peptide bonds between adjacent amino acids into linear, branched or cyclical structures. OLIGOPEPTIDES are composed of approximately 2-12 amino acids. Polypeptides are composed of approximately 13 or more amino acids. PROTEINS are linear polypeptides that are normally synthesized on RIBOSOMES.
Procedures for identifying types and strains of fungi.
A country spanning from central Asia to the Pacific Ocean.
Proteins that form the CAPSID of VIRUSES.
A technique for identifying individuals of a species that is based on the uniqueness of their DNA sequence. Uniqueness is determined by identifying which combination of allelic variations occur in the individual at a statistically relevant number of different loci. In forensic studies, RESTRICTION FRAGMENT LENGTH POLYMORPHISM of multiple, highly polymorphic VNTR LOCI or MICROSATELLITE REPEAT loci are analyzed. The number of loci used for the profile depends on the ALLELE FREQUENCY in the population.
The ultimate exclusion of nonsense sequences or intervening sequences (introns) before the final RNA transcript is sent to the cytoplasm.
A process whereby multiple RNA transcripts are generated from a single gene. Alternative splicing involves the splicing together of other possible sets of EXONS during the processing of some, but not all, transcripts of the gene. Thus a particular exon may be connected to any one of several alternative exons to form a mature RNA. The alternative forms of mature MESSENGER RNA produce PROTEIN ISOFORMS in which one part of the isoforms is common while the other parts are different.
Plasmids containing at least one cos (cohesive-end site) of PHAGE LAMBDA. They are used as cloning vehicles.
Hydrocarbon rings which contain two ketone moieties in any position. They can be substituted in any position except at the ketone groups.
A mutation in which a codon is mutated to one directing the incorporation of a different amino acid. This substitution may result in an inactive or unstable product. (From A Dictionary of Genetics, King & Stansfield, 5th ed)
Recombinant proteins produced by the GENETIC TRANSLATION of fused genes formed by the combination of NUCLEIC ACID REGULATORY SEQUENCES of one or more genes with the protein coding sequences of one or more genes.
Proteins found in any species of fungus.
Variation in a population's DNA sequence that is detected by determining alterations in the conformation of denatured DNA fragments. Denatured DNA fragments are allowed to renature under conditions that prevent the formation of double-stranded DNA and allow secondary structure to form in single stranded fragments. These fragments are then run through polyacrylamide gels to detect variations in the secondary structure that is manifested as an alteration in migration through the gels.
The process in which substances, either endogenous or exogenous, bind to proteins, peptides, enzymes, protein precursors, or allied compounds. Specific protein-binding measures are often used as assays in diagnostic assessments.
Water containing no significant amounts of salts, such as water from RIVERS and LAKES.
Proteins obtained from ESCHERICHIA COLI.
Viral proteins that are components of the mature assembled VIRUS PARTICLES. They may include nucleocapsid core proteins (gag proteins), enzymes packaged within the virus particle (pol proteins), and membrane components (env proteins). These do not include the proteins encoded in the VIRAL GENOME that are produced in infected cells but which are not packaged in the mature virus particle,i.e. the so called non-structural proteins (VIRAL NONSTRUCTURAL PROTEINS).
A genus of gram-negative, anaerobic, nonsporeforming, nonmotile rods. Organisms of this genus had originally been classified as members of the BACTEROIDES genus but overwhelming biochemical and chemical findings in 1990 indicated the need to separate them from other Bacteroides species, and hence, this new genus was established.
The level of protein structure in which regular hydrogen-bond interactions within contiguous stretches of polypeptide chain give rise to alpha helices, beta strands (which align to form beta sheets) or other types of coils. This is the first folding level of protein conformation.
The three possible sequences of CODONS by which GENETIC TRANSLATION may occur from one nucleotide sequence. A segment of mRNA 5'AUCCGA3' could be translated as 5'AUC.. or 5'UCC.. or 5'CCG.., depending on the location of the START CODON.
A genus of BACILLACEAE that are spore-forming, rod-shaped cells. Most species are saprophytic soil forms with only a few species being pathogenic.
A type of mutation in which a number of NUCLEOTIDES deleted from or inserted into a protein coding sequence is not divisible by three, thereby causing an alteration in the READING FRAMES of the entire coding sequence downstream of the mutation. These mutations may be induced by certain types of MUTAGENS or may occur spontaneously.
A subclass of PEPTIDE HYDROLASES that catalyze the internal cleavage of PEPTIDES or PROTEINS.
Theoretical representations that simulate the behavior or activity of genetic processes or phenomena. They include the use of mathematical equations, computers, and other electronic equipment.
Nucleic acid sequences involved in regulating the expression of genes.
Genetically engineered MUTAGENESIS at a specific site in the DNA molecule that introduces a base substitution, or an insertion or deletion.
Identification of proteins or peptides that have been electrophoretically separated by blot transferring from the electrophoresis gel to strips of nitrocellulose paper, followed by labeling with antibody probes.
Separation technique in which the stationary phase consists of ion exchange resins. The resins contain loosely held small ions that easily exchange places with other small ions of like charge present in solutions washed over the resins.
The outer protein protective shell of a virus, which protects the viral nucleic acid.
The application of molecular biology to the answering of epidemiological questions. The examination of patterns of changes in DNA to implicate particular carcinogens and the use of molecular markers to predict which individuals are at highest risk for a disease are common examples.
Life or metabolic reactions occurring in an environment containing oxygen.
The uptake of naked or purified DNA by CELLS, usually meaning the process as it occurs in eukaryotic cells. It is analogous to bacterial transformation (TRANSFORMATION, BACTERIAL) and both are routinely employed in GENE TRANSFER TECHNIQUES.
Genes bearing close resemblance to known genes at different loci, but rendered non-functional by additions or deletions in structure that prevent normal transcription or translation. When lacking introns and containing a poly-A segment near the downstream end (as a result of reverse copying from processed nuclear RNA into double-stranded DNA), they are called processed genes.
A genus of asporogenous bacteria that is widely distributed in nature. Its organisms appear as straight to slightly curved rods and are known to be human and animal parasites and pathogens.
The functional hereditary units of PLANTS.
Double-stranded DNA of MITOCHONDRIA. In eukaryotes, the mitochondrial GENOME is circular and codes for ribosomal RNAs, transfer RNAs, and about 10 proteins.
Any member of the group of ENDOPEPTIDASES containing at the active site a serine residue involved in catalysis.
DNA constructs that are composed of, at least, a REPLICATION ORIGIN, for successful replication, propagation to and maintenance as an extra chromosome in bacteria. In addition, they can carry large amounts (about 200 kilobases) of other sequence for a variety of bioengineering purposes.
Any of the DNA in between gene-coding DNA, including untranslated regions, 5' and 3' flanking regions, INTRONS, non-functional pseudogenes, and non-functional repetitive sequences. This DNA may or may not encode regulatory functions.
Commonly observed structural components of proteins formed by simple combinations of adjacent secondary structures. A commonly observed structure may be composed of a CONSERVED SEQUENCE which can be represented by a CONSENSUS SEQUENCE.
Compounds and molecular complexes that consist of very large numbers of atoms and are generally over 500 kDa in size. In biological systems macromolecular substances usually can be visualized using ELECTRON MICROSCOPY and are distinguished from ORGANELLES by the lack of a membrane structure.
Habitat of hot water naturally heated by underlying geologic processes. Surface hot springs have been used for BALNEOLOGY. Underwater hot springs are called HYDROTHERMAL VENTS.
Structures within the nucleus of bacterial cells consisting of or containing DNA, which carry genetic information essential to the cell.
Deoxyribonucleic acid that makes up the genetic material of protozoa.
The genetic complement of an organism, including all of its GENES, as represented in its DNA, or in some cases, its RNA.
A ubiquitous sodium salt that is commonly used to season food.
The normality of a solution with respect to HYDROGEN ions; H+. It is related to acidity measurements in most cases by pH = log 1/2[1/(H+)], where (H+) is the hydrogen ion concentration in gram equivalents per liter of solution. (McGraw-Hill Dictionary of Scientific and Technical Terms, 6th ed)
Actual loss of portion of a chromosome.
Refuse liquid or waste matter carried off by sewers.
Deoxyribonucleic acid that makes up the genetic material of archaea.
The species Oryctolagus cuniculus, in the family Leporidae, order LAGOMORPHA. Rabbits are born in burrows, furless, and with eyes and ears closed. In contrast with HARES, rabbits have 22 chromosome pairs.
The relationship between the chemical structure of a compound and its biological or pharmacological activity. Compounds are often classed together because they have structural characteristics in common including shape, size, stereochemical arrangement, and distribution of functional groups.
Amino acid sequences found in transported proteins that selectively guide the distribution of the proteins to specific cellular compartments.
A genus of gram-positive, microaerophilic, rod-shaped bacteria occurring widely in nature. Its species are also part of the many normal flora of the mouth, intestinal tract, and vagina of many mammals, including humans. Pathogenicity from this genus is rare.
The naturally occurring or experimentally induced replacement of one or more AMINO ACIDS in a protein with another. If a functionally equivalent amino acid is substituted, the protein may retain wild-type activity. Substitution may also diminish, enhance, or eliminate protein function. Experimentally induced substitution is often used to study enzyme activities and binding site properties.

Novel regulation of the homeotic gene Scr associated with a crustacean leg-to-maxilliped appendage transformation. (1/46886)

Homeotic genes are known to be involved in patterning morphological structures along the antero-posterior axis of insects and vertebrates. Because of their important roles in development, changes in the function and expression patterns of homeotic genes may have played a major role in the evolution of different body plans. For example, it has been proposed that during the evolution of several crustacean lineages, changes in the expression patterns of the homeotic genes Ultrabithorax and abdominal-A have played a role in transformation of the anterior thoracic appendages into mouthparts termed maxillipeds. This homeotic-like transformation is recapitulated at the late stages of the direct embryonic development of the crustacean Porcellio scaber (Oniscidea, Isopoda). Interestingly, this morphological change is associated with apparent novelties both in the transcriptional and post-transcriptional regulation of the Porcellio scaber ortholog of the Drosophila homeotic gene, Sex combs reduced (Scr). Specifically, we find that Scr mRNA is present in the second maxillary segment and the first pair of thoracic legs (T1) in early embryos, whereas protein accumulates only in the second maxillae. In later stages, however, high levels of SCR appear in the T1 legs, which correlates temporally with the transformation of these appendages into maxillipeds. Our observations provide further insight into the process of the homeotic leg-to-maxilliped transformation in the evolution of crustaceans and suggest a novel regulatory mechanism for this process in this group of arthropods.  (+info)

Mrj encodes a DnaJ-related co-chaperone that is essential for murine placental development. (2/46886)

We have identified a novel gene in a gene trap screen that encodes a protein related to the DnaJ co-chaperone in E. coli. The gene, named Mrj (mammalian relative of DnaJ) was expressed throughout development in both the embryo and placenta. Within the placenta, expression was particularly high in trophoblast giant cells but moderate levels were also observed in trophoblast cells of the chorion at embryonic day 8.5, and later in the labyrinth which arises from the attachment of the chorion to the allantois (a process called chorioallantoic fusion). Insertion of the ROSAbetageo gene trap vector into the Mrj gene created a null allele. Homozygous Mrj mutants died at mid-gestation due to a failure of chorioallantoic fusion at embryonic day 8.5, which precluded formation of the mature placenta. At embryonic day 8.5, the chorion in mutants was morphologically normal and expressed the cell adhesion molecule beta4 integrin that is known to be required for chorioallantoic fusion. However, expression of the chorionic trophoblast-specific transcription factor genes Err2 and Gcm1 was significantly reduced. The mutants showed no abnormal phenotypes in other trophoblast cell types or in the embryo proper. This study indicates a previously unsuspected role for chaperone proteins in placental development and represents the first genetic analysis of DnaJ-related protein function in higher eukaryotes. Based on a survey of EST databases representing different mouse tissues and embryonic stages, there are 40 or more DnaJ-related genes in mammals. In addition to Mrj, at least two of these genes are also expressed in the developing mouse placenta. The specificity of the developmental defect in Mrj mutants suggests that each of these genes may have unique tissue and cellular activities.  (+info)

Requirement of a novel gene, Xin, in cardiac morphogenesis. (3/46886)

A novel gene, Xin, from chick (cXin) and mouse (mXin) embryonic hearts, may be required for cardiac morphogenesis and looping. Both cloned cDNAs have a single open reading frame, encoding proteins with 2,562 and 1,677 amino acids for cXin and mXin, respectively. The derived amino acid sequences share 46% similarity. The overall domain structures of the predicted cXin and mXin proteins, including proline-rich regions, 16 amino acid repeats, DNA-binding domains, SH3-binding motifs and nuclear localization signals, are highly conserved. Northern blot analyses detect a single message of 8.9 and 5.8 kilo base (kb) from both cardiac and skeletal muscle of chick and mouse, respectively. In situ hybridization reveals that the cXin gene is specifically expressed in cardiac progenitor cells of chick embryos as early as stage 8, prior to heart tube formation. cXin continues to be expressed in the myocardium of developing hearts. By stage 15, cXin expression is also detected in the myotomes of developing somites. Immunofluorescence microscopy reveals that the mXin protein is colocalized with N-cadherin and connexin-43 in the intercalated discs of adult mouse hearts. Incubation of stage 6 chick embryos with cXin antisense oligonucleotides results in abnormal cardiac morphogenesis and an alteration of cardiac looping. The myocardium of the affected hearts becomes thickened and tends to form multiple invaginations into the heart cavity. This abnormal cellular process may account in part for the abnormal looping. cXin expression can be induced by bone morphogenetic protein (BMP) in explants of anterior medial mesoendoderm from stage 6 chick embryos, a tissue that is normally non-cardiogenic. This induction occurs following the BMP-mediated induction of two cardiac-restricted transcription factors, Nkx2.5 and MEF2C. Furthermore, either MEF2C or Nkx2.5 can transactivate a luciferase reporter driven by the mXin promoter in mouse fibroblasts. These results suggest that Xin may participate in a BMP-Nkx2.5-MEF2C pathway to control cardiac morphogenesis and looping.  (+info)

Characterization of an amphioxus paired box gene, AmphiPax2/5/8: developmental expression patterns in optic support cells, nephridium, thyroid-like structures and pharyngeal gill slits, but not in the midbrain-hindbrain boundary region. (4/46886)

On the basis of developmental gene expression, the vertebrate central nervous system comprises: a forebrain plus anterior midbrain, a midbrain-hindbrain boundary region (MHB) having organizer properties, and a rhombospinal domain. The vertebrate MHB is characterized by position, by organizer properties and by being the early site of action of Wnt1 and engrailed genes, and of genes of the Pax2/5/8 subfamily. Wada and others (Wada, H., Saiga, H., Satoh, N. and Holland, P. W. H. (1998) Development 125, 1113-1122) suggested that ascidian tunicates have a vertebrate-like MHB on the basis of ascidian Pax258 expression there. In another invertebrate chordate, amphioxus, comparable gene expression evidence for a vertebrate-like MHB is lacking. We, therefore, isolated and characterized AmphiPax2/5/8, the sole member of this subfamily in amphioxus. AmphiPax2/5/8 is initially expressed well back in the rhombospinal domain and not where a MHB would be expected. In contrast, most of the other expression domains of AmphiPax2/5/8 correspond to expression domains of vertebrate Pax2, Pax5 and Pax8 in structures that are probably homologous - support cells of the eye, nephridium, thyroid-like structures and pharyngeal gill slits; although AmphiPax2/5/8 is not transcribed in any structures that could be interpreted as homologues of vertebrate otic placodes or otic vesicles. In sum, the developmental expression of AmphiPax2/5/8 indicates that the amphioxus central nervous system lacks a MHB resembling the vertebrate isthmic region. Additional gene expression data for the developing ascidian and amphioxus nervous systems would help determine whether a MHB is a basal chordate character secondarily lost in amphioxus. The alternative is that the MHB is a vertebrate innovation.  (+info)

Regulation of body length and male tail ray pattern formation of Caenorhabditis elegans by a member of TGF-beta family. (5/46886)

We have identified a new member of the TGF-beta superfamily, CET-1, from Caenorhabditis elegans, which is expressed in the ventral nerve cord and other neurons. cet-1 null mutants have shortened bodies and male tail abnormal phenotype resembling sma mutants, suggesting cet-1, sma-2, sma-3 and sma-4 share a common pathway. Overexpression experiments demonstrated that cet-1 function requires wild-type sma genes. Interestingly, CET-1 appears to affect body length in a dose-dependent manner. Heterozygotes for cet-1 displayed body lengths ranging between null mutant and wild type, and overexpression of CET-1 in wild-type worms elongated body length close to lon mutants. In male sensory ray patterning, lack of cet-1 function results in ray fusions. Epistasis analysis revealed that mab-21 lies downstream and is negatively regulated by the cet-1/sma pathway in the male tail. Our results show that cet-1 controls diverse biological processes during C. elegans development probably through different target genes.  (+info)

Molecular cloning and epitope analysis of the peanut allergen Ara h 3. (6/46886)

Peanut allergy is a significant IgE-mediated health problem because of the increased prevalence, potential severity, and chronicity of the reaction. Following our characterization of the two peanut allergens Ara h 1 and Ara h 2, we have isolated a cDNA clone encoding a third peanut allergen, Ara h 3. The deduced amino acid sequence of Ara h 3 shows homology to 11S seed-storage proteins. The recombinant form of this protein was expressed in a bacterial system and was recognized by serum IgE from approximately 45% of our peanut-allergic patient population. Serum IgE from these patients and overlapping, synthetic peptides were used to map the linear, IgE-binding epitopes of Ara h 3. Four epitopes, between 10 and 15 amino acids in length, were found within the primary sequence, with no obvious sequence motif shared by the peptides. One epitope is recognized by all Ara h 3-allergic patients. Mutational analysis of the epitopes revealed that single amino acid changes within these peptides could lead to a reduction or loss of IgE binding. By determining which amino acids are critical for IgE binding, it might be possible to alter the Ara h 3 cDNA to encode a protein with a reduced IgE-binding capacity. These results will enable the design of improved diagnostic and therapeutic approaches for food-hypersensitivity reactions.  (+info)

TIF1gamma, a novel member of the transcriptional intermediary factor 1 family. (7/46886)

We report the cloning and characterization of a novel member of the Transcriptional Intermediary Factor 1 (TIF1) gene family, human TIF1gamma. Similar to TIF1alpha and TIF1beta, the structure of TIF1beta is characterized by multiple domains: RING finger, B boxes, Coiled coil, PHD/TTC, and bromodomain. Although structurally related to TIF1alpha and TIF1beta, TIF1gamma presents several functional differences. In contrast to TIF1alpha, but like TIF1beta, TIF1 does not interact with nuclear receptors in yeast two-hybrid or GST pull-down assays and does not interfere with retinoic acid response in transfected mammalian cells. Whereas TIF1alpha and TIF1beta were previously found to interact with the KRAB silencing domain of KOX1 and with the HP1alpha, MODI (HP1beta) and MOD2 (HP1gamma) heterochromatinic proteins, suggesting that they may participate in a complex involved in heterochromatin-induced gene repression, TIF1gamma does not interact with either the KRAB domain of KOX1 or the HP1 proteins. Nevertheless, TIF1gamma, like TIF1alpha and TIF1beta, exhibits a strong silencing activity when tethered to a promoter. Since deletion of a novel motif unique to the three TIF1 proteins, called TIF1 signature sequence (TSS), abrogates transcriptional repression by TIF1gamma, this motif likely participates in TIF1 dependent repression.  (+info)

Detailed methylation analysis of the glutathione S-transferase pi (GSTP1) gene in prostate cancer. (8/46886)

Glutathione-S-Transferases (GSTs) comprise a family of isoenzymes that provide protection to mammalian cells against electrophilic metabolites of carcinogens and reactive oxygen species. Previous studies have shown that the CpG-rich promoter region of the pi-class gene GSTP1 is methylated at single restriction sites in the majority of prostate cancers. In order to understand the nature of abnormal methylation of the GSTP1 gene in prostate cancer we undertook a detailed analysis of methylation at 131 CpG sites spanning the promoter and body of the gene. Our results show that DNA methylation is not confined to specific CpG sites in the promoter region of the GSTP1 gene but is extensive throughout the CpG island in prostate cancer cells. Furthermore we found that both alleles are abnormally methylated in this region. In normal prostate tissue, the entire CpG island was unmethylated, but extensive methylation was found outside the island in the body of the gene. Loss of GSTP1 expression correlated with DNA methylation of the CpG island in both prostate cancer cell lines and cancer tissues whereas methylation outside the CpG island in normal prostate tissue appeared to have no effect on gene expression.  (+info)

Author(s): Singh, Kanwar; Zhao, Zhiying Jean; Zvenigorodsky, Natasha; Froula, Jeff; Pennacchio, Len; Chen, Feng | Abstract: Next generation DNA sequencing provides new opportunities to efficiently accomplish a variety of genomic tasks such as the de novo assembly of genomes. The newly released 454 FLX Titanium in October 2008 advanced the previous 454 FLX Standard system with nearly double the sequence reads and read lengths. A thorough assessment and optimization of 454 FLX Titanium sequencing system was done by the Technology Development Group at Joint Genome Institute. Currently applications like de novo whole genome shotgun assembly, transcriptome profiling, pyrotag sequencing and sequence capture technology are being optimized on the new 454 FLX Titanium systems.
Massively parallel high throughput sequencing technologies allow us to interrogate the microbial composition of biological samples at unprecedented resolution. The typical approach is to perform high-throughout sequencing of 16S rRNA genes, which are then taxonomically classified based on similarity to known sequences in existing databases. Current technologies cause a predicament though, because although they enable deep coverage of samples, they are limited in the length of sequence they can produce. As a result, high-throughout studies of microbial communities often do not sequence the entire 16S rRNA gene. The challenge is to obtain reliable representation of bacterial communities through taxonomic classification of short 16S rRNA gene sequences. In this study we explored properties of different study designs and developed specific recommendations for effective use of short-read sequencing technologies for the purpose of interrogating bacterial communities, with a focus on classification using
Background Next-generation sequencing platforms have revolutionised our ability to investigate the microbiota composition of complex environments, frequently through 16S rRNA gene sequencing of the bacterial component of the community. Numerous factors, including DNA extraction method, primer sequences and sequencing platform employed, can affect the accuracy of the results achieved. The aim of this study was to determine the impact of these three factors on 16S rRNA gene sequencing results, using mock communities and mock community DNA. Results The use of different primer sequences (V4-V5, V1-V2 and V1-V2 degenerate primers) resulted in differences in the genera and species detected. The V4-V5 primers gave the most comparable results across platforms. The three Ion PGM primer sets detected more of the 20 mock community species than the equivalent MiSeq primer sets. Data generated from DNA extracted using the 2 extraction methods were very similar. Conclusions Microbiota compositional data ...
Recently, many standalone applications have been proposed to correct sequencing errors in Illumina data. The key idea is that downstream analysis tools such as de novo genome assemblers benefit from a reduced error rate in the input data. Surprisingly, a systematic validation of this assumption using state-of-the-art assembly methods is lacking, even for recently published methods. For twelve recent Illumina error correction tools (EC tools) we evaluated both their ability to correct sequencing errors and their ability to improve de novo genome assembly in terms of contig size and accuracy. We confirm that most EC tools reduce the number of errors in sequencing data without introducing many new errors. However, we found that many EC tools suffer from poor performance in certain sequence contexts such as regions with low coverage or regions that contain short repeated or low-complexity sequences. Reads overlapping such regions are often ill-corrected in an inconsistent manner, leading to breakpoints in
Next generation sequencing technologies open exciting new possibilities for genome and transcriptome sequencing. While reads produced by these technologies are relatively short and error-prone compared to the Sanger method, their throughput is several magnitudes higher. We present a novel approach, called QPALMA, for computing accurate spliced alignments of short sequence reads that take advantage of the reads quality information as well as computational splice site predictions. In computational experiments we illustrate that the quality information as well as the splice site predictions [1] help to considerably improve the alignment quality. Our algorithms were optimized and tested using artificially spliced genomic reads produced with the Illumina Genome Analyzer for the model plant Arabidopsis thaliana. ...
First Roche GS-FLX Genome Sequencing System Installed At VBI - read this article along with other careers information, tips and advice on BioSpace
454 Life Sciences, a Roche Company, announced today the launch and immediate availability of the new GS GType HLA Primer Sets for high- and medium-resolution genotyping of class I and class II loci of the Human Leukocyte Antigen (HLA) genes. The primer sets are designed for use with the companys benchtop GS Junior and GS FLX next-generation sequencing systems.
The SK-BR-3 cell line is one of the most important models for HER2+ breast cancers, which affect one in five breast cancer patients. SK-BR-3 is known to be highly rearranged although much of the variation is in complex and repetitive regions that may be underreported. Addressing this, we sequenced SK-BR-3 using long-read single molecule sequencing from Pacific Biosciences, and develop one of the most detailed maps of structural variations (SVs) in a cancer genome available with nearly 20,000 variants present, most of which were missed by short read sequencing. Surrounding the important ERBB2 oncogene (also known as HER2), we discover a complex sequence of nested duplications and translocations, suggesting a punctuated progression. Full-length transcriptome sequencing further revealed several novel gene fusions within the nested genomic variants. Combining long-read genome and transcriptome sequencing enables an in-depth analysis of how SVs disrupt the genome and sheds new light on the complex ...
As one of the most studied genome rearrangements, tandem repeats have a considerable impact on genetic backgrounds of inherited diseases. Many methods designed for tandem repeat detection on reference sequences obtain high quality results. However, in the case of a de novo context, where no reference sequence is available, tandem repeat detection remains a difficult problem. The short reads obtained with the second-generation sequencing methods are not long enough to span regions that contain long repeats. This length limitation was tackled by the long reads obtained with the third-generation sequencing platforms such as Pacific Biosciences technologies. Nevertheless, the gain on the read length came with a significant increase of the error rate. The main objective of nowadays studies on long reads is to handle the high error rate up to 16%. In this paper we present MixTaR, the first de novo method for tandem repeat detection that combines the high-quality of short reads and the large length of long
Complete Genomics Previews Revolocity™ Sequencing System at European Human Genetics Conference 2015 Mater Health Services (Australia) and Radboud University Medical Center (The Netherlands)...
SEOUL, South Korea and SAN DIEGO, Jan. 11, 2016 - Macrogen, a global leader in genome sequencing services, and Edico Genome today announced Macrogen has chosen multiple DRAGEN™ Bio-IT Processors to reinforce its big data processing and analysis capacity for large-scale genome analysis and clinical sequencing services. Macrogen has world-class next-generation sequencing (NGS) facilities, which are equipped with Illuminas HiSeq™ X Ten, HiSeq 2000, HiSeq 2500, HiSeq 4000 and MiSeq® sequencing systems; Thermo Fishers Ion PGM™ and Ion Proton™ systems; Roches GS-FLX system; and PacBio instruments. Macrogens IT infrastructure capacity exceeds 11 petabytes of storage and more than 3,000 core clusters. Using DRAGEN, Macrogen was able to analyze each genome (30x coverage) produced by their HiSeq X Ten sequencing system in only 26 minutes, while maintaining high sensitivity and specificity. This analysis included conversion from BCL, the file that is delivered by the sequencing instrument, to ...
Progress in genetics and breeding in pea still suffers from the limited availability of molecular resources. SNP markers that can be identified through affordable sequencing processes, without the need for prior genome reduction or a reference genome to assemble sequencing data would allow the discovery and genetic mapping of thousands of molecular markers. Such an approach could significantly speed up genetic studies and marker assisted breeding for non-model species. A total of 419,024 SNPs were discovered using HiSeq whole genome sequencing of four pea lines, followed by direct identification of SNP markers without assembly using the discoSnp tool. Subsequent filtering led to the identification of 131,850 highly designable SNPs, polymorphic between at least two of the four pea lines. A subset of 64,754 SNPs was called and genotyped by short read sequencing on a subpopulation of 48 RILs from the cross Baccara x PI180693. This data was used to construct a WGGBS-derived pea genetic map comprising 64
Author Summary Human individual genome sequencing has recently become affordable, enabling highly detailed genetic sequence comparisons. While the identification and genotyping of single-nucleotide polymorphisms has already been successfully established for different sequencing platforms, the detection, quantification and genotyping of large-scale copy-number variants (CNVs), i.e., losses or gains of long genomic segments, has remained challenging. We present a computational approach that enables detecting CNVs in sequencing data and accurately identifies the actual copy-number at which DNA segments of interest occur in an individual genome. This approach enabled us to obtain novel insights into the largest human gene family - the olfactory receptors (ORs) - involved in smell perception. While previous studies reported an abundance of CNVs in ORs, our approach enabled us to globally identify absolute differences in OR gene counts that exist between humans. While several OR genes have very high gene
New generation DNA sequencing technologies are revolutionizing modern biological research. Scientists can now generate the rough equivalent of an entire human genome (~3 billion base-pairs of DNA) in just a few days with one single sequencing instrument. Until recently, such amounts of data could only be generated at large genome centers using hundreds of sequencers. The analysis of these data is complicated by their size - a single run of a sequencing instrument yields terabytes of information, often requiring a significant scale-up of the existing computational infrastructure. ...
BGI is a recognized leader in De Novo Whole Genome Sequencing and has been involved in the sequencing and assembly of 1000s of De Novo genomes and affiliated research published in the worlds leading journals.. De novo sequencing refers to sequencing a novel genome where there is no reference sequence available for alignment.. The process of de novo genome sequencing involves the sequencing of small DNA fragments, and assembling the reads into longer sequences (contigs) and finally ordering the contigs to obtain the entire genome sequence.. With the advent of rapid, low-cost next-generation sequencing (NGS) technology, researchers can now obtain whole genome data for organisms previously considered too low a priority to sequence. The availability of this whole genome data has allowed large-scale genomic studies to be performed that were unimaginable just a few years ago.. ...
Recent advances in high-throughput sequencing (HTS) technologies have led to orders of magnitude higher throughput compared to classic Sanger sequencing (see [3] for a review). Coupled with continuous
Sometimes the fastest way to get something done is to have an expert do it for you. Were here to help you build a full de novo assembly from scratch.. We first build a draft assembly using PacBio HiFi, the most accurate long-read sequencing platform available today. This assembly is then scaffolded up to chromosome-scale using Omni-C® proximity ligation technology and HiRise® scaffolding software. Unlike traditional Hi-C methods that utilize a restriction enzyme(s), Omni-C digests chromatin using a sequence-independent endonuclease for even, unbiased whole genome coverage. This unique combination of PacBio HiFi (accuracy) plus Omni-C (coverage) enables chromosome-scale phased SNP calling, giving you an enriched assembly dataset. Finally, we annotate your assembly to call and label as many genes as possible.. ...
the sequence that is to be sequenced) on a bead. Solid-State Nanopore-Based DNA Sequencing Technology Zewen Liu, 1 Yifan Wang, 1 Tao Deng, 2 and Qi Chen 1 1 Institute o f Microelectron ics, Ts inghua Uni versity, Bei jing 100084, China It uses 2 base encoding to decode the raw data generated by the sequencing platform into sequence data. SOLiD Sequencing. First, consider the impact of the longer reads, especially for de novo assemblies of novel genomes. Two basic methods for DNA sequencing :-A- Chemical cleavage method (Maxam and Gilbert, 1977) - Base-specific cleavage of DNA by certain chemicals - Four different chemicals, one for each base - A set of DNA fragments of different sizes - DNA fragments contain up to 500 nucleotides B- Enzymatic method (Sanger, 1981) Sequencing methods Based on innovative ligation-based chemistry, the 5500 Series SOLiD™ Sequencers empower scientists and ... SOLiD® Next-Generation Sequencing Systems & … However, the beads are placed on the solid-phase of a flow ...
Plant genomes, and eukaryotic genomes in general, are typically repetitive, polyploid and heterozygous, which complicates genome assembly1. The short read lengths of early Sanger and current next-generation sequencing platforms hinder assembly through complex repeat regions, and many draft and reference genomes are fragmented, lacking skewed GC and repetitive intergenic sequences, which are gaining importance due to projects like the Encyclopedia of DNA Elements (ENCODE)2. Here we report the whole-genome sequencing and assembly of the desiccation-tolerant grass Oropetium thomaeum. Using only single-molecule real-time sequencing, which generates long (,16 kilobases) reads with random errors, we assembled 99% (244 megabases) of the Oropetium genome into 625 contigs with an N50 length of 2.4 megabases. Oropetium is an example of a near-complete draft genome which includes gapless coverage over gene space as well as intergenic sequences such as centromeres, telomeres, transposable elements and ...
The goal of this demonstration project is to develop the capability to express complete biosynthetic pathways for natural products that are usually silent in their native microbial host (i.e. orphan biosynthetic gene clusters). Such a technology will increase our access to new chemical entities for potential use in drug development. By tailoring synthetic genomics techniques to the expression of biosynthetic gene clusters, we believe we will create the capacity to produce small molecules directly using synthetic expression constructs in platform production microorganisms. Publicly available high-throughput DNA sequencing data has already cataloged up to 20,000 orphan clusters; as a result, our approach has the potential to bring about the biological synthesis of a large number of natural products that are currently unavailable for evaluation as potential drugs. The proposed clones and expression constructs can be used as a starting point for evaluating the bioactivities of metabolites whose ...
The multikilobase reads that can be produced by single-molecule sequencing technologies may span complex, repetitive genomic regions but have high error rates. Bashir et al. use these reads to organize contigs assembled from accurate, short-read data, facilitating the analysis of clinically important regions of an outbreak strain of cholera. Advances in DNA sequencing technology have improved our ability to characterize most genomic diversity. However, accurate resolution of large structural events is challenging because of the short read lengths of second-generation technologies. Third-generation sequencing technologies, which can yield longer multikilobase reads, have the potential to address limitations associated with genome assembly. Here we combine sequencing data from second- and third-generation DNA sequencing technologies to assemble the two-chromosome genome of a recent Haitian cholera outbreak strain into two nearly finished contigs at |99.9% accuracy. Complex regions with clinically relevant
SCOTTSDALE, Ariz. - Whole genome sequencing - spelling out a persons entire DNA genetic code - has moved one step closer to being a medical option for direct patient care.. Physicians and researchers at Mayo Clinic in Arizona and the Translational Genomics Research Institute (TGen) successfully completed sequencing both a single patients normal and cancer cells - a tour de force of more than 6 billion DNA chemical bases.. While the whole genomes of several individuals or their cancers have been sequenced in recent years, this is believed to be among the first successful application of whole genome sequencing performed in support of the medical care of a specific cancer patient.. A male patient with pancreatic cancer was the first patient at Mayo Clinic to have whole genome sequencing performed on both his tumor and non-cancerous cells as part of a clinical research project. By comparing the tumor DNA to the patients normal DNA, researchers found genetic changes (mutations) that were important ...
Reference quality genomes provide a resource for studying gene structure, function, and evolution. However, often genes of interest are not completely or accurately assembled, leading to unknown errors in analyses or additional cloning efforts for the correct sequences. A promising solution is long-read sequencing. Here we tested PacBio-based long-read sequencing and diploid assembly for potential improvements to the Sanger-based intermediate-read zebra finch reference and Illumina-based short-read Annas hummingbird reference, two vocal learning avian species widely studied in neuroscience and genomics. With DNA of the same individuals used to generate the reference genomes, we generated diploid assemblies with the FALCON-Unzip assembler, resulting in contigs with no gaps in the megabase range, representing 150-fold and 200-fold improvements over the current zebra finch and hummingbird references, respectively. These long-read and phased assemblies corrected and resolved what we discovered to be
The National Food Institute carries out research using whole genome sequencing techniques. As such, the institute is helping to set the international standard for the detection, surveillance and studies of the global spread of disease-causing microorganism and antimicrobial-resistant bacteria. The institute is also working to advance and build next generation sequencing capacity internationally.. As such, researchers from the National Food Institute and DTU Systems Biology head up a large EU project called COMPARE with 28 European partners. In the research project, the partners want to develop a global platform that will enable real time exchange and interpretation of information about disease-causing microorganisms from around the world and to compare this with other relevant information such as clinical and epidemiological data.. The platform will be used to harmonize the way scientists, authorities, doctors and organizations around the world collect samples, generate genome sequencing data ...
AUSTRALIAS capacity to detect, respond to and control infectious threats, and to improve regional health security is hampered by the lack of a national approach to whole genome sequencing resources, and data sharing, according to the authors of a Perspective published in the Medical Journal of Australia.. Whole genome sequencing involves parsing out the entire genome of a pathogen, the data from which can be used to determine the pathogens identity, predict its resistance to antimicrobials and its virulence traits and understand the relationships between pathogens.. University of Melbourne Associate Professor Deborah Williamson, Deputy Director of the Microbiological Diagnostic Unit Public Health Laboratory at the Doherty Institute, and colleagues wrote that the use of whole genome sequencing has the potential to transform the investigation and surveillance of communicable diseases by providing the highest possible characterisation of pathogens, enabling earlier and accurate detection of ...
By M. Thomas P. Gilbert, Lynn P. Tomsho, Snjezana Rendulic, Michael Packard, Daniela I. Drautz, Andrei Sher, Alexei Tikhonov, Love Dalén, Tatyana Kuznetsova, Pavel Kosintsev, Paula F. Campos, Thomas Higham, Matthew J. Collins, Andrew S. Wilson, Fyodor Shidlovskiy, Bernard Buigues, Per G. P. Ericson, Mietje Germonpré, Anders Götherström, Paola Iacumin, Vladimir Nikolaev, Malgosia Nowak-Kemp, Eske Willerslev, James R. Knight, Gerard P. Irzyk, Clotilde S. Perbost, Karin M. Fredrikson, Timothy T. Harkins, Sharon Sheridan, Webb Miller, Stephan C. Schuster. Science ...
The advent of next-generation sequencing (NGS)4 technologies, which grew exponentially in the decade after publication of the first iteration of the human genome sequence (4), has provided substantial insights into new genes and the biological processes that underlie cancer pathogenesis. These insights are outlined below. NGS technologies parallelize sequencing processes via high-throughput means to produce millions of short sequencing reads from amplified DNA clones (5). NGS is also referred to as massively parallel sequencing, because the reaction steps occur in parallel with the detection steps and millions of reactions occur simultaneously (6). This parallelism makes it possible to read the same segment of a DNA sequence repeatedly to increase confidence in the sequence obtained for the targeted genomic segment. This multiple sampling of a genomic segment is referred to as the coverage of the sequencing run.. Before the NGS era, much progress had been made toward identifying mutated ...
CiteSeerX - Document Details (Isaac Councill, Lee Giles, Pradeep Teregowda): The availability of massive amounts of DNA sequence information has begun to revolutionize the practice of biology. As a result, current large-scale sequencing output, while impressive, is not adequate to keep pace with growing demand and, in particular, is far short of what will be required to obtain the 3-billion-base human genome sequence by the target date of 2005. To reach this goal, improved automation will be essential, and it is particularly important that human involvement in sequence data processing be significantly reduced or eliminated. Progress in this respect will require both improved accuracy of the data processing software and reliable accuracy measures to reduce the need for human involvement in error correction and make human review more efficient. Here, we describe one step toward that goal: a base-calling program for automated sequencer traces, phred, with improved accuracy. phred appears to be the first
We have developed and validated a low-coverage whole genome sequencing assay for genome-wide and high-resolution detection of copy number aberrations (CNAs) from inherited disorders. The analytical sensitivity was 0.765 for detecting CNVs of 25-50kb in size and 0.990 for detecting CNVs of over 50kb in size. The smallest detected deletion was 10kb.
The transcriptional architecture is a complex and dynamic aspect of a cells function. Next generation sequencing of steady state RNA (RNA-seq) gives unprecedented detail about the RNA landscape within a cell. Not only can expression levels of genes be interrogated without specific prior knowledge, but comparisons of expression levels between genes within a sample can be made. It has also been demonstrated that splicing variants [1, 2] and single nucleotide polymorphisms [3] can be detected through sequencing the transcriptome, opening up the opportunity to interrogate allele-specific expression and RNA editing.. An important aspect of dealing with the vast amounts of data generated from short read sequencing is the processing methods used to extract and interpret the information. Experience with microarray data has repeatedly shown that normalization is a critical component of the processing pipeline, allowing accurate estimation and detection of differential expression (DE) [4]. The aim of ...
Our Sanger sequencing platform consists of three Applied Biosystems 3730xl DNA Analyzers. This 96-capillary sequencer is the gold standard for high-throughput Sanger sequencing und enables the generation of high-quality data at a low cost per sample.. We offer a sequencing service for our external partners once a week as part of an academic collaboration. Apart from routine sequencing of PCR products and plasmids, the Sanger platform also carries out genotyping of microsatellites, RFLPs (restriction fragment length polymorphism) and MLPA (multiplex ligation-dependent probe amplification) samples. If you are interested in using our service, please contact us and see the specifications and order form below.. Please send the filled order form to seq_ta [at] ikmb.uni-kiel.de.. Specifications Sanger sequencing. Order form Sanger sequencing. ...
Genomic heterogeneity of bacterial species is observed and studied in experimental evolution experiments and clinical diagnostics, and occurs as micro-diversity of natural habitats. The challenge for genome research is to accurately capture this heterogeneity with the currently used short sequencing reads. Recent advances in NGS technologies improved the speed and coverage and thus allowed for deep sequencing of bacterial populations. This facilitates the quantitative assessment of genomic heterogeneity, including low frequency alleles or haplotypes. However, false positive variant predictions due to sequencing errors and mapping artifacts of short reads need to be prevented. We therefore created VarCap, a workflow for the reliable prediction of different types of variants even at low frequencies. In order to predict SNPs, InDels and structural variations, we evaluated the sensitivity and accuracy of different software tools using synthetic read data. The results suggested that the best ...
This dataset contains the digitized treatments in Plazi based on the original journal article Straube, Nicolas, White, William T., Ho, Hsuan-Ching, Rochel, Elisabeth, Corrigan, Shannon, Li, Chenhong, Naylor, Gavin J. P. (2013): A DNA sequence-based identification checklist for Taiwanese chondrichthyans. Zootaxa 3752 (1): 256-278, DOI: http://dx.doi.org/10.11646/zootaxa.3752.1.16 ...
Genome sequencing technologies are improving at a rapid pace. The current challenge is to find ways to extract all of the genetic information from the data. One of the biggest challenges has been the detection of CNVs. Sebat, in collaboration with Seungtai Yoon of CSHL and Kenny Ye, Ph.D., at the Albert Einstein College of Medicine, developed a statistical method to estimate DNA copy number of a genomic region based on the number of sequences that map to that location (or read depth). When the genomes of multiple individuals are compared, regions that differ in copy number between individuals can be identified.. The new method allows the detection of small structural variants that could not be detected using earlier microarray-based methods. This is significant because most of the CNVs the genome are less than 5000 nucleotides in length. The new method is also able to detect certain classes of CNVs that other sequencing-based approaches struggle with, particularly those located in complex ...
Strategies for assembling large, complex genomes have evolved to include a combination of whole-genome shotgun sequencing and hierarchal map-assisted sequencing. Whole-genome maps of all types can aid genome assemblies, generally starting with low-resolution cytogenetic maps and ending with the highest resolution of sequence. Fingerprint clone maps are based upon complete restriction enzyme digests of clones representative of the target genome, and ultimately comprise a near-contiguous path of clones across the genome. Such clone-based maps are used to validate sequence assembly order, supply long-range linking information for assembled sequences, anchor sequences to the genetic map and provide templates for closing gaps. Fingerprint maps are also a critical resource for subsequent functional genomic studies, because they provide a redundant and ordered sampling of the genome with clones. In an accompanying paper we describe the draft genome sequence of the chicken, Gallus gallus, the first ...
We combined conventional fumC-fimH typing with deep amplicon sequencing to assess E. coli clonal diversity in a high-throughput manner. Our method has several advantages over existing protocols. First, our method has high sequencing resolution for target species. Since we sequence only E. coli fumC and fimH, we can generate ≥0.5 million reads per sample, yielding ≥5,000 reads per base. In contrast, metagenomic sequencing, which is nonspecific for target species, yields only 20 reads per base per genome (assuming a 5-Mb genome). Secondly, our method assessed up to 46 samples per sequencing run. In contrast, MLST requires typing ≥100 single colonies per sample to capture the low-prevalence strains that PLAP detects. Finally, while we developed PLAP for E. coli CH typing, PLAP is not limited to E. coli clonotyping and may be generalized to other MLST schemes. For those attempting to use or adapt our approach, we have provided guidelines for both the experimental and algorithm portions on ...
A framework technology comprising file format and toolkit in which we combine highly efficient and tunable reference-based compression of sequence data with a data format that is directly available for computational use. This compression method is tunable: The storage of quality scores and unaligned sequences may be adjusted for different experiments to conserve information or to minimize storage costs, and provides one opportunity to address the threat that increasing DNA sequence volumes will overcome our ability to store the sequences.
An advance online publication in Nature Biotechnology from Michael Snyders lab at Stanford University demonstrates the utility of long-read sequencing for assessing transcribed regions across the human genome. Long PacBio reads were able to completely cover full-length RNA molecules, characterizing genetic regions that have not been previously annotated.. The paper, entitled A single-molecule long-read survey of the human transcriptome, reports the application of Single Molecule, Real-Time (SMRT®) Sequencing to studying RNA, comparing it to results from libraries sequenced with a 454® instrument. The scientists sequenced cDNA synthesized from pooled RNA gathered from 20 human organs and tissues in order to identify as many transcript isoforms as possible.. The purpose of this effort was to find a better alternative to existing RNA-seq approaches, which have so far relied on short-read sequencers. It is difficult to identify full-length transcript iso-forms using short reads, the authors ...
Finds sub-sequence or patterns in the sequence and highlights the matching region. The tool works with standard single letter nucleotide or protein codes including ambiguities and can match Prosite patterns in protein sequences ...
Finds sub-sequence or patterns in the sequence and highlights the matching region. The tool works with standard single letter nucleotide or protein codes including ambiguities and can match Prosite patterns in protein sequences ...
Our facility provides services for DNA/RNA sequencing and oligonucleotide synthesis. Our sequencing technology portfolio includes first-generation sequencing (classic Sanger and fragment analysis), second-generation sequencing (next-generation sequencing) using Illumina instruments, and (…). ...
Whole genome sequencing (WGS), which is the process of determining an organisms complete DNA sequence, can be used to identify DNA anomalies that cause disease. Identifying disease-causing DNA abnormalities allows clinicians to better predict an effective course of treatment for the patient.
Background|br /|Inherited retinal disorders are clinically and genetically heterogeneous with more than 150 gene defects accounting for the diversity of disease phenotypes. So far, mutation detection was mainly performed by APEX technology and direct Sanger sequencing of known genes. However, these methods are time consuming, expensive and unable to provide a result if the patient carries a new gene mutation. In addition, multiplicity of phenotypes associated with the same gene defect may be overlooked.|br /|Methods|br /|To overcome these challenges, we designed an exon sequencing array to target 254 known and candidate genes using Agilent capture. Subsequently, 20 DNA samples from 17 different families, including four patients with known mutations were sequenced using Illumina Genome Analyzer IIx next-generation-sequencing (NGS) platform. Different filtering approaches were applied to identify the genetic defect. The most likely disease causing variants were analyzed by Sanger sequencing. Co
Capillary sequencing PCR tubes and caps are for use with the ABI Prism 310 sequencerThese PCR tubes are made of high-quality virgin polypropylene and feature uniform thin walls for efficient heat transfer. Tubes and caps are compatible with most leading thermal cyclers, and are autoclavable. Caps, available as either flat or domed, fit perfectly and create a uniform, tight seal that prevents sample evaporation in the thermal cycler. Tubes are nonpyrogenic and RNase- and DNase-free. Certain models feature assorted packs of color-coded tubes for easy identification of samples.
Roche Diagnostics Deutschland - The newly discovered arenavirus caused the deaths of four of five infected individuals in South Africa in October, 2008
Over the last few years, several initiatives have described efforts to combine previously invented techniques in molecular biology with parallel detection principles to sequence or genotype DNA signatures. The Infinium (R) system from Illumina and the Affymetrix GeneChips (R) are two systems suitable for whole-genome scoring of variable positions. However, directed candidate-gene approaches are more cost effective and several academic groups and the private sector provide techniques with moderate typing throughput combined with large sample capacity suiting these needs. Recently, whole-genome sequencing platforms based on the sequencing-by-synthesis principle were presented by 454 Life Sciences and Solexa, showing great potential as alternatives to conventional genotyping approaches. In addition to these sequencing initiatives, many efforts are pursuing novel ideas to facilitate fast and cost-effective whole genome sequencing, such as ligation-based sequencing. Reliable methods for routine ...
TY - GEN. T1 - Inferring intra-tumor heterogeneity from high-throughput DNA sequencing data. AU - Oesper, Layla. AU - Mahmoody, Ahmad. AU - Raphael, Benjamin J.. PY - 2013/4/3. Y1 - 2013/4/3. N2 - Cancer is a disease driven in part by somatic mutations that accumulate during the lifetime of an individual. The clonal theory [1] posits that the cancerous cells in a tumor are descended from a single founder cell and that descendants of this cell acquired multiple mutations beneficial for tumor growth through rounds of selection and clonal expansion. A tumor is thus a heterogeneous population of cells, with different subpopulations of cells containing both clonal mutations from the founder cell or early rounds of clonal expansion, and subclonal mutations that occurred after the most recent clonal expansion. Most cancer sequencing projects sequence a mixture of cells from a tumor sample including admixture by normal (non-cancerous) cells and different subpopulations of cancerous cells. In addition ...
...Next-generation DNA sequencing (NGS) technology has revolutionized bio......,Essential,informatics,methods,and,tools,for,analyzing,the,explosion,of,NGS,data,biological,biology news articles,biology news today,latest biology news,current biology news,biology newsletters
Next-generation DNA sequencing of image-guided biopsy samples collected by multiple sites reveal predictive biomarkers for cancer treatment.
Applied Maths NV today announces that it has released a new version of its flagship software suite BioNumerics that allows de novo assembly to be performed on next generation sequencing data. This new feature, available in version 6.6, consolidates the development of BioNumerics into a complete and fully integrated suite for preprocessing and analysis of NGS data.
Background Recent high throughput sequencing technology can handle generating plenty of data for bacterial genome sequencing tasks. be utilized to compute a design graph that presents the most appealing contig adjacencies to be able to help biologists in completing the entire genomic series. The design graph shows exclusive contig orderings where feasible and the very best alternatives where required. Conclusions Our brand-new algorithm for contig buying uses series similarity aswell as phylogenetic details to estimation adjacencies of contigs. An assessment of our execution implies that it performs much better than latest approaches while getting much faster at the same time. Today the nucleotide sequences of several genomes are known Background. In the initial genome tasks the procedure of acquiring the DNA series by multi-step clone-by-clone sequencing strategies was pricey and Kenpaullone tedious. Currently the most frequent strategy for de-novo genome sequencing is normally = (data files. ...
Sequence analysis of organelle genomes has revealed important aspects of plant cell evolution. The scope of this study was to develop an approach for de novo assembly of the carrot mitochondrial genome using next generation sequence data from total genomic DNA. Sequencing data from a carrot 454 whole genome library were used to develop a de novo assembly of the mitochondrial genome. Development of a new bioinformatic tool allowed visualizing contig connections and elucidation of the de novo assembly. Southern hybridization demonstrated recombination across two large repeats. Genome annotation allowed identification of 44 protein coding genes, three rRNA and 17 tRNA. Identification of the plastid genome sequence allowed organelle genome comparison. Mitochondrial intergenic sequence analysis allowed detection of a fragment of DNA specific to the carrot plastid genome. PCR amplification and sequence analysis across different Apiaceae species revealed consistent conservation of this fragment in the
Roche and Precision System Science, Co., Ltd (PSS) have announced the signing of an exclusive agreement to develop and manufacture a fully automated emulsion PCR instrument for Roches portfolio of next-generation sequencing platforms. It is intended to support Roches GS Junior and GS FLX+ systems as well as the sequencing platforms that Roche is currently developing.
Advancements in Next Generation Sequencing (NGS) technologies regarding throughput, read length and accuracy had a major impact on microbiome research by significantly improving 16S rRNA amplicon sequencing. As rapid improvements in sequencing platforms and new data analysis pipelines are introduced, it is essential to evaluate their capabilities in specific applications. The aim of this study was to assess whether the same project-specific biological conclusions regarding microbiome composition could be reached using different sequencing platforms and bioinformatics pipelines. Chicken cecum microbiome was analyzed by 16S rRNA amplicon sequencing using Illumina MiSeq, Ion Torrent PGM, and Roche 454 GS FLX Titanium platforms, with standard and modified protocols for library preparation. We labeled the bioinformatics pipelines included in our analysis QIIME1 and QIIME2 (de novo OTU picking [not to be confused with QIIME version 2 commonly referred to as QIIME2]), QIIME3 and QIIME4 (open reference OTU
RNA-Sequencing (RNA-Seq) broadly refers to a family of experimental techniques that give researchers the ability to study the transcriptional landscapes of cells and tissues quantitatively by exploiting high throughput sequencing technology. Currently, the most commonly used sequencing platforms are provided by Illumina, which uses a fluorescence-based paradigm for reading the bases in a nucleotide sequence. One alternative option is provided by Ion Torrent, which is built around the use of pH measurements to read nucleotide sequences. In addition to the distinct sequencing technologies used by these two platforms, there are smaller differences in the types of data they generate. In Illumina data all sequence reads generated during a single experiment have the same lengths, while the lengths of Ion Torrent reads vary. Additionally, the current generation of Illumina instruments can generate sequence reads from both ends of a fragment (paired-end reads), while Ion Torrent cannot.. Prior studies ...
The information contained in the genome of an organism, its DNA, is expressed through transcription of its genes to RNA, in quantities determined by many internal and external factors. As such, studying the gene expression can give valuable information for e.g. clinical diagnostics. A common analysis workflow of RNA-sequencing (RNA-seq) data consists of mapping the sequencing reads to a reference genome, followed by the transcript assembly and quantification based on these alignments. The advent of second-generation sequencing revolutionized the field by reducing the sequencing costs by 50,000-fold. Now another revolution is imminent with the third-generation sequencing platforms producing an order of magnitude higher read lengths. However, higher error rate, higher cost and lower throughput compared to the second-generation sequencing bring their own challenges. To compensate for the low throughput and high cost, hybrid approaches using both short second-generation and long third-generation ...
505) 995 4466; [email protected] Santa Fe, N.M., January 12, 2007 - The New Mexico Institute of Mining and Technology (NMT), Socorro, NM, and the National Center for Genome Resources (NCGR), Santa Fe, NM, announced today that they have established a partnership to create the New Mexico Genome Sequencing Center (NMGSC).. The State of New Mexico has provided $600,000 in funding to establish the Center, which will be located at NCGR in Santa Fe. The NMGSC will be the first in the nation to focus on medical resequencing. Medical resequencing is a new approach for discovery of the genetic basis of common human diseases or important crop traits. It refers to the large scale sequencing of the genome of many individuals affected by a disease or with a trait of interest. Medical sequencing is being made possible by next-generation DNA sequencing instruments and software that are dramatically increasing the speed and throughput of DNA sequencing.. The New Mexico Genome Sequencing Center is being established ...
505) 995 4466; [email protected] Santa Fe, N.M., January 12, 2007 - The New Mexico Institute of Mining and Technology (NMT), Socorro, NM, and the National Center for Genome Resources (NCGR), Santa Fe, NM, announced today that they have established a partnership to create the New Mexico Genome Sequencing Center (NMGSC).. The State of New Mexico has provided $600,000 in funding to establish the Center, which will be located at NCGR in Santa Fe. The NMGSC will be the first in the nation to focus on medical resequencing. Medical resequencing is a new approach for discovery of the genetic basis of common human diseases or important crop traits. It refers to the large scale sequencing of the genome of many individuals affected by a disease or with a trait of interest. Medical sequencing is being made possible by next-generation DNA sequencing instruments and software that are dramatically increasing the speed and throughput of DNA sequencing.. The New Mexico Genome Sequencing Center is being established ...
Next Generation Sequencing Market - (Technology Type - Whole Genome Sequencing, Targeted Resequencing, RNA Sequencing, Whole Exome Sequencing, and De Novo Sequencing); (Application - Oncology, Genetic Screening, Infectious Diseases, Drug and Biomarker Discovery, Agriculture & Animal Research, Idiopathic Diseases and others): Market Growth, Future Prospects and Competitive Analysis, 2017-2025 the market was valued at USD 3.7 Bn in 2017, and is expected to reach USD 20.6 Bn by 2025, expanding at a CAGR of 21.5% from 2017 to 2025.. Browse Full Report Click Here: http://www.acutemarketreports.com/report/next-generation-sequencing-market. Market Insights. Next generation sequencing is a high-throughput sequencing that enables sequencing and assembling of number of short DNA reads at a small period of time and with a better accuracy. The introduction of next generation sequencing technologies has ensured massive changes in the sequencing process by providing better output, higher speed, flexibility ...
Unlock the full value of your next-generation sequencing (NGS) data sets from Illumina HiSeq/MiSeq/NextSeq/HiSeq X Ten, Roche 454 GS-FLX, LifeTechnologies Solid and Iontorrent /IonProton PGM, and PacBio platforms.. Bespoke NGS data analysis: QFAB provides tailored bioinformatics services to biologists across the spectrum of computational techniques and services applicable to molecular biology and next generation sequencing. QFAB researchers design and implement custom bioinformatics approaches that are developed in consultation with researchers for specific questions in molecular biology.. We can also integrate your genomics data with other -omics, microarrays and clinical datasets.. Our NGS data analysis services include:. Whole genome sequencing data analysis. ...
Next-generation sequencing technologies are rapidly generating whole-genome datasets for an increasing number of organisms. However, phylogenetic reconstruction of genomic data remains difficult because de novo assembly for non-model genomes and multi-genome alignment are challenging. To greatly simplify the analysis, we present an Assembly and Alignment-Free (AAF) method ( https://sourceforge.net/projects/aaf-phylogeny ) that constructs phylogenies directly from unassembled genome sequence data, bypassing both genome assembly and alignment. Using mathematical calculations, models of sequence evolution, and simulated sequencing of published genomes, we address both evolutionary and sampling issues caused by direct reconstruction, including homoplasy, sequencing errors, and incomplete sequencing coverage. From these results, we calculate the statistical properties of the pairwise distances between genomes, allowing us to optimize parameter
Dramatic advances in sequencing technologies have opened new possibilities for whole genome analysis. The increasing read length of next-generation sequencing platforms, as well as the promising perspectives of third generation sequencing platforms, will inevitably lead to better assemblies and represent genomes in large stretches of DNA. Also, third generation technologies (such as the PacBio and IonTorrent systems) will be capable of outputting sequencing reads with large undefined inserts, thus providing valuable paired read information for the assembly and scaffolding process. Concurrently, the development of genome closure software should also receive attention to overcome difficult genomic regions that cannot be covered by draft assemblies.. Our results with GapFiller indicate that gapped genomics regions can be reliably closed through an automatic protocol that uses only short sequencing reads. Costly Sanger sequencing can therefore be limited to a few difficult repeat areas. Also, we ...
The development of next-generation massively parallel sequencing technologies (NGS), including the Roche 454™ Genome Sequencer FLX Instrument, the Illumina Genome Analyzer, Life Technologys Ion Torrent™ Personal Genome Machine, and the Pacific Biosciences RS have revolutionized genomic and genetic research, significantly improved sequencing throughput, reduced costs for data production, and advanced research from weeks to hours.
Next-generation DNA sequencing (NGS) offers a promising way to obtain massive numbers of orthologous loci to understand phylogenetic relationships among organisms. Of particular interest are old museum specimens and other samples with degraded DNA, where traditional sequencing methods have proven to be challenging. Low coverage shotgun sequencing and sequence capture are two widely used NGS approaches for degraded DNA. Sequence capture can yield sequence data for large numbers of orthologous loci, but it can only be used to sequence genomic regions near conserved sequences that can be used as probes. Low coverage shotgun sequencing has the potential to yield different data types throughout the genome. However, many studies using this method have often generated mitochondrial sequences, and few nuclear sequences, suggesting orthologous nuclear sequences are likely harder to recover. To determine the phylogenetic position of the galliform genus Tropicoperdix, whose phylogenetic position is currently
Full genomes of several organisms have been sequenced in the past fifteen years, including the human genome in 2004. These studies were completed using Sanger DNA sequencing, which has a limited throughput and high cost meaning the human genome took fifteen years to sequence and cost nearly three billion dollars
A novel smartphone-based microscope could make DNA sequence analysis much easier, faster and more readily accessible in remote locations. The dev
The scientific revolution that started with the human-genome sequencing project, carried out with first-generation sequencing technology, has initiated other sequencing projects, including those for plant species. Different technologies have been developed together with the second- and third-generation sequencing platforms called next-generation sequencing. This review deals with the most relevant second-generation sequencing platforms, advanced analysis tools, and sequenced plant genomes. To date, a number of plant genomes have been sequenced, with many more projected for the near future. Using the new techniques and developed advanced bioinformatics tools, several studies including both plant genomics and transcriptomics were carried out. Likewise, completion of reference genome sequences and high-throughput resequencing projects presented opportunities to better understand the genomic nature of plants and accelerated the process of crop improvement. Modern sequencing and bioinformatics ...
Since few studies have been focused on the RNA profile of the liquid fraction of synovial fluid (SF) from osteoarthritis (OA) patients, we determined whether it contains enough RNA for profiling. We removed cells from SF and extract RNA for building a cDNA library, followed by the second-generation sequencing and bioinformatic analyses. From one SF sample of an OA patient, we obtained 0.096 µg RNA for building a cDNA library. From this library the second-generation sequencing produced 66,154,562 clean reads, 91.28% of which were matched to the reference with 2,682 genes identified. From another patients SF sample, 0.24 µg RNA was obtained and sequencing of the established cDNA library produced 64,463,162 clean reads but, unexpectedly, only 22.40% of the reads were matched to the human genome, although 5,081 genes were identified. Some of the unmatchable reads matched RNAs of bacteria, mainly pseudomonas, likely derived from previous infections since the patients had no obvious systemic ...
Modern biology operates with a large amount of data and investigates very complex systems. Scientists use complicated algorithms and very sophisticated software, which is impossible to run, without access to significant computing resources. In addition, modern biology requires efficient large data volumes processing, such as DNA sequences, proteins structure, Genome Scale Modeling, and molecular dynamics simulation. Recent advances in Next Generation Genome Sequencing technology led to significant increase in amount of sequencing data that has to be processed, analysed and made available for bioinformaticians worldwide. The ancient DNA analysis is one of the most challenging and CPU consuming scientific problems.. It can take a couple of months on super-computer at NRC KI to run widely used package PALEOMIX to analyse ancient genome sequencing data. The issue of data processing at a large scale has been addressed in the past by the LHC experiments at CERN and in our studies we have evaluated and ...
Define Primer walking. Primer walking synonyms, Primer walking pronunciation, Primer walking translation, English dictionary definition of Primer walking. n. 1. An elementary textbook for teaching children to read. 2. A book that covers the basic elements of a subject. n. 1. A cap or tube containing a small...
We were prompted to develop the BisPCR2 method by our need for a high-throughput, cost-effective method for interrogating multiple CpGs at base resolution within multiple target loci of interest. Fluorescence-based approaches to targeted bisulfite sequencing are limited by the number of CpGs that can be measured at one time, the inability to multiplex, and the reliance of measurements on a secondary enzymatic reaction. Next-generation sequencing techniques for targeted bisulfite sequencing employ the same strategy of bisulfite conversion and amplification of target loci, but result in a far more robust output by directly measuring base content of each CpG within an amplicon. Further, the ability to multiplex means that a single sequencing reaction can yield information about multiple target loci for multiple biological samples. One impediment of NGS approaches is the additional step of DNA sequencing library preparation following target enrichment, which can be expensive and time consuming. We ...
Microorganisms widely exist in nature and are closely related to human life and production. They are generally divided into fungi, actinomycetes, bacteria, spirulina, rickettsia, chlamydia, mycoplasma and viruses. Microbial whole genome sequencing is an important tool for mapping genomes of novel organisms, finishing genomes of known organisms, or comparing genomes across multiple samples. Sequencing the entire microbial genome is important for construction of accurate reference genomes, microbial identification, and other comparative genomic studies. Comparative genomic analysis based on whole genome sequencing plays an irreplaceable role in studying pathogenic mechanisms of pathogenic microorganism, evolution of pathogenic genes and screening of novel, efficient drug targets. Microbial whole genome sequencing can be widely used in various fields.. Diseases Pathogenic microorganism includes all kinds of microorganisms that cause human diseases, food corruption, animal infection in animal ...
New sequencing system (2017-07-12) The NovaSeq6000 sequencing system (Illumina Inc.) is now installed at the NGI facilities in Uppsala and Stockholm.. The NovaSeq, launched by Illumina early 2017, offers high-throughput sequencing across the full range of DNA- and RNA-sequencing applications including transcriptome profiling, target re-sequencing, low coverage genome sequencing and single cell applications. By acquiring the NovaSeq6000 NGI will continue to offer the most cost efficient sequencing service to our users. Whole genome sequencing at a coverage of at least 15x will continue to be run on HiSeqX as the most cost efficient approach. During the summer and beginning of the fall, the NovaSeq systems will be validated and NGI aims to accept projects from users from September 2017. Projects already submitted and scheduled for HiSeq2500 may be transferred to the NovaSeq, in those cases the NGI project coordinators will contact the user for a discussion. You can read more about the NovaSeq ...
The Vironomics Core facilitates research long-read length next generation sequencing. The sequencers in the core are ideal for longer DNA fragment sequencing with instrument run times of only 24 hours. This is accomplished using Ion GeneStudio S5 Prime System, and companion Ion Torrent Chef. The Ion GeneStudio S5 capable of up to 600bp read lengths and has a maximal output of 130 Million 200 bp reads in 12 hours or 4 human exomes per day. Many clients use the longer reads for large genomes, de novo sequencing, 16S sequencing, long amplicons, etc. Customization is available or take advantage of the current expertise in: whole genome sequencing (WGS), de novo assembly, STR cell line verification, targeted amplicon sequencing, plasmid verification, strand-specific RNAseq, and exome sequencing.. ...
CSHL Press publishes monographs, technical manuals, handbooks, review volumes, conference proceedings, scholarly journals and videotapes. These examine important topics in molecular biology, genetics, development, virology, neurobiology, immunology and cancer biology. Manuscripts for books and for journal publication are invited from scientists world wide.
CSHL Press publishes monographs, technical manuals, handbooks, review volumes, conference proceedings, scholarly journals and videotapes. These examine important topics in molecular biology, genetics, development, virology, neurobiology, immunology and cancer biology. Manuscripts for books and for journal publication are invited from scientists world wide.
CREST. The accurate identification of structural variations using whole-genome DNA sequencing data generated by next-generation sequencing technology is extremely difficult. To address this challenge, we have developed CREST, an algorithm that uses sequencing reads with partial alignments to the reference human genome (so-called soft-clipped reads) to directly map the breakpoints of somatic structural variations. We applied CREST to paired tumor/normal whole genome sequencing data from five cases of T-lineage acute lymphoblastic leukemia (T-ALL). A total of 110 somatic structural variants were identified, ,80% of which were validated by genomic PCR and Sanger sequencing. The validated structural variants included 31 inter-chromosomal translocations, 19 intra-chromosomal translocations, one inversion, 22 deletions and 16 insertions. A comparison of the results generated with CREST to those obtained using the traditional paired-end discordant mapping methods demonstrate CREST to have a much higher ...
Long Read Sequencing (Third Generation) and Next Generation Sequencing (Second Generation). DNA and RNA sequencing is the process of determining the nucleotide order of a given DNA fragment. The nucleotide sequence encodes the necessary information that allows living things to survive and reproduce. Determining the sequence is therefore useful in researching into how organisms live. Our core facility provides many sequencing options to meet your individual needs, utilizing (a) Oxford NanoPore GridIONx5 Long-Read Sequencing (by reading the nucleotide sequences at the single molecule level), and (b) Illumina Short-Read Sequencing (by massive parallel sequencing of millions of DNA fragments and yielding substantially more throughput reads quickly).. ...
Short-read sequencing technologies have long been the work-horse of microbiome analysis. Continuing technological advances are making the application of long-read sequencing to metagenomic samples increasingly feasible. We demonstrate that whole bacterial chromosomes can be obtained from an enriched community, by application of MinION sequencing to a sample from an EBPR bioreactor, producing 6 Gb of sequence that assembles into multiple closed bacterial chromosomes. We provide a simple pipeline for processing such data, which includes a new approach to correcting erroneous frame-shifts. Advances in long-read sequencing technology and corresponding algorithms will allow the routine extraction of whole chromosomes from environmental samples, providing a more detailed picture of individual members of a microbiome.
Exome Sequencing is fast, cost effective and generates a smaller sized data for quick analysis. For whole exome sequencing cost and SNP genotyping visit 1010Genome.
This is the first evaluation of a novel fast broad-range 16S rDNA PCR/sequencing assay in a Canadian patient population, and the first study of the clinical utility of DPO primers for the routine molecular analysis of heart valve tissue in consecutive patients with and without infective IE. Additionally, our study had the advantage of extensive clinical information to better delineate the Dukes minor criteria for all patients. Our study confirms the higher sensitivity of molecular heart valve testing compared to tissue culture [35-38]. However, our novel assay has one of the highest reported sensitivities of a user-developed broad-range 16S rDNA PCR to date. Although pre-operative blood cultures make a microbiologic diagnosis in approximately two-thirds of patients suspected of having IE, subsequent molecular analysis of heart valve tissue contributed to the microbiologic diagnosis of 31 % of our patients. However, the change in diagnosis would only be expected to contribute to the clinical ...
Following the completion of the human genome project, the high demand for low-cost sequencing has given rise to a number of high-throughput, next-generation sequencing (NGS) technologies. These new sequencing platforms allow high-throughput sequencing for a wide range of applications such as: |br /> |ul> |li>Whole genome sequencing as de novo or resequencing|/li> |li>Targeted resequencing|/li> |li>Transcriptome profiling|/li> |li>Microbiome research|/li> |li>Gene regulation studies |/li> |/ul>
Following the completion of the human genome project, the high demand for low-cost sequencing has given rise to a number of high-throughput, next-generation sequencing (NGS) technologies. These new sequencing platforms allow high-throughput sequencing for a wide range of applications such as: |br /> |ul> |li>Whole genome sequencing as de novo or resequencing|/li> |li>Targeted resequencing|/li> |li>Transcriptome profiling|/li> |li>Microbiome research|/li> |li>Gene regulation studies |/li> |/ul>
The Illumina MiSeq uses the same established reversible-terminator sequencing by synthesis chemistry as the HiSeq2000. Researchers have a wide range of sequencing read options ranging from 36 bp singleton to 150 bp paired-end reads. The system is capable of generating over 2 Gb data per run with a high percentage of bases over Q30. The high data yield and superior quality allows scientists to conduct a wide variety of sequencing applications including: highly multiplexed PCR amplicon sequencing, small genome sequencing and de novo sequencing, small RNA sequencing, targeted resequencing and 16S metagenomics.. The addition of numerous Illumina MiSeqs adds another level of sequencing for our clients, said Ardy Arianpour, Vice President of Business Development at Ambry Genetics. Our scientists have spent the last couple months validating sequencing runs and getting amazing results so we can deliver and work with multiple types of samples that fit on the MiSeq.. The MiSeq is a fully integrated ...
http://lifetech-it.hosted.jivesoftware.com/community/torrent_dev/blog/2011/11/08/leveraging-flow-order-and-flow-signals. A major strength of the Ion Torrent semiconductor sequencing system is that a SNP is not equivalent to an error, or more precisely single base substitutions are not equivalent to a single sequencing error. While the base calls that are provided are accurate, even greater levels of performance are available by taking into account flow orders and flow signals.. Homopolymers are observed one-at-a-time during sequencing, with the given homopolymer base determined by the flow order. For example, a flow order of ACGT would cycle through each base one a time. More intricate flow orders, like TACGTACGTCTGAGCATCGATCGATGTACAGC, can yield significant advantages to overcome carry-forward (signals from out-of-phase templates) and incomplete extension (templates that do not fully extend). Furthermore, flow orders also imply something about the likelihood of an error versus a variant (more ...
Hosted by the International Society for Computational Biology (ISCB) and the Centre for Genomic Regulation (CRG), the Next Generation Sequencing Conference 2014 (NGS 2014) is a dedicated meeting on cutting-edge approaches to the processing and analysis of Next Generation Sequencing data. The goal of this conference is to bring together bioinformatics researchers and biologists facing new high-throughput sequencing challenges. The conference will feature presentations showing how current platforms can be used to address key biological questions and what is the current state of the art for data analysis. Sizeable space will also be dedicated to emerging and future trends in high-throughput sequencing and their associated computational challenges.. see more at http://www.iscb.org/ngs2014. ...
Mycobacterium tuberculosis is characterised by limited genomic diversity, which makes the application of whole genome sequencing particularly attractive for clinical and epidemiological investigation. However, in order to confidently infer transmission events, an accurate knowledge of the rate of change in the genome over relevant timescales is required. We attempted to estimate a molecular clock by sequencing 199 isolates from epidemiologically linked tuberculosis cases, collected in the Netherlands spanning almost 16 years. Multiple analyses support an average mutation rate of ~0.3 SNPs per genome per year. However, all analyses revealed a very high degree of variation around this mean, making the confirmation of links proposed by epidemiology, and inference of novel links, difficult. Despite this, in some cases, the phylogenetic context of other strains provided evidence supporting the confident exclusion of previously inferred epidemiological links. This in-depth analysis of the molecular clock
The introduction of new sequencing technologies whole-genome sequencing (WGS) and whole-exome sequencing (WES) that are much less finely targeted than previous genetic tests has resulted in ethical debate about what should be done with clinically significant findings that may arise during the sequencing process. In this piece we argue that, in addition to whether the finding has been intentionally sought or arises incidentally, the ethical issues concerning what should be done with WES and WGS findings are also influenced by whether sequencing occurs in a clinical or research setting. We argue that decisions about the disclosure of WGS and WES findings generated in the clinical context are much less ethically contentious than decision making about the feedback of research results. We conclude by calling for greater transparency about the purpose of sample collection, more explicit protocols for transitioning between research and clinical contexts and patients and research participants to be warned of
The one consistent finding among viral metagenomics studies has been the high proportion of sequences having no significant homology to a known sequence within one of the large sequence databases (e.g., GenBank, UniRef etc.). Those viral metagenome libraries having the highest frequency of hits to known sequences typically come from marine environments where the hit frequency for longer Sanger reads is around 30% (at a BLAST e-score of ≤0.001) [12]. Sanger libraries from soils show even lower hit rates at ~20%. The lack of homology to known sequences is only exacerbated by the shorter read lengths of next-generation sequencing technology [33] where libraries sequenced using the longest average read length next generation sequencing technology (i.e., 450 bp for the 454 pyrosequencing Ti FLX chemistry) yield hit rates to known sequence databases of less than 20%. In contrast, microbial shotgun metagenome libraries analyzed using the same databases and approaches will yield hit frequencies of ca. ...
Researchers funded by the National Institutes of Health have used a rapid DNA sequencing technique to identify gene variants in roughly a third of cases of nonimmune Hydrops fetalis (NIHF), a serious condition in which a fetus develops fluid buildup inside the abdominal cavity, lungs, or other parts of the body. The findings suggest that the DNA sequencing technique, known as exome sequencing, could be used to provide information unavailable with current genetic testing methods.
The proliferation of large-scale DNA-sequencing projects in recent years has driven a search for alternative methods to reduce time and cost. Here we describe a scalable, highly parallel sequencing system with raw throughput significantly greater than that of state-of-the-art capillary electrophoresis instruments. The apparatus uses a novel fibre-optic slide of individual wells and is able to sequence 25 million bases, at 99% or better accuracy, in one four-hour run. To achieve an approximately 100-fold increase in throughput over current Sanger sequencing technology, we have developed an emulsion method for DNA amplification and an instrument for sequencing by synthesis using a pyrosequencing protocol optimized for solid support and picolitre-scale volumes. Here we show the utility, throughput, accuracy and robustness of this system by shotgun sequencing and de novo assembly of the Mycoplasma genitalium genome with 96% coverage at 99.96% accuracy in one run of the machine. The race is on for a big
DNA sequence analysis[change , change source]. After many years when palaeontologists thought whales had evolved from ... DNA sequence analysis showed the closest relationship was with artiodactyls, the even-toed ungulates. A new clade was created ... "Analyses of mitochondrial genomes strongly support a hippopotamus-whale clade". Proceedings of the Royal Society. 265 (1412): ... "More DNA support for a Cetacea/Hippopotamidae clade: the blood-clotting protein gene gamma-fibrinogen". Molecular Biology and ...
Padmanabhan, R.; Wu, Ray (1972). "Use of oligonucleotides of defined sequences as primers in DNA sequence analysis". ... Wu, Ray (April 19, 1972). "Nucleotide Sequence Analysis of DNA". Nature. 236 (68): 198-200. doi:10.1038/newbio236198a0. PMID ... Plant genetics pioneer Ray Wu invented the first method for sequencing DNA, considered a major breakthrough in genetics as it ...
"DNA sequence and analysis of human chromosome 9". Nature. 429 (6990): 369-74. doi:10.1038/nature02465. PMC 2734081. PMID ... "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences". Proc. Natl. Acad. Sci. U.S.A. ...
1999b). Further DNA sequence analyses (Madsen et al. 2001, Murphy et al., 2001 Waddell et al. 2001) supported the Euarchonta ... 2001) showing near total congruence of mtDNA-based and nuclear-based trees when such sequences were excluded, some authors ... Kumar, Vikas; Hallström, Björn M.; Janke, Axel (2013-04-01). "Coalescent-Based Genome Analyses Resolve the Early Branches of ... Despite multiple papers pointing out that some mitochondrial sequences showed unusual properties (particularly murid rodents ...
by 16S Ribosomal DNA Sequence Analysis". International Journal of Systematic Bacteriology. 47 (4): 921-925. doi:10.1099/ ... Molecular analysis of the patient isolate allowed the classification of the strain to B. lusitaniae, a genospecies previously ... Vitorino, L. L.; Margos, G.; Zé-Zé, L.; Kurtenbach, K.; Collares-Pereira n, M. (2010). "Plasmid profile analysis of Portuguese ... "Fine-Scale Phylogeographic Structure of Borrelia lusitaniae Revealed by Multilocus Sequence Typing". PLOS ONE. 3 (12): 1-13. ...
DNASTAR provides DNA sequence assembly and analysis. Gene Codes Corporation Genedata software for data analysis and storage. ... Strand Life Sciences TimeLogic offers DeCypher FPGA-accelerated BLAST, Smith-Waterman, HMMER and other sequence search tools.. ...
DNA sequence analysis further confirmed the identity. Another case found N. sphaerica isolated from a corneal ulcer. A woman in ... rRNA sequence comparison of the ITS region confirmed N. sphaerica identity. Cases of leaf spot disease of kiwi fruit (Actinidia ... Analysis of corneal scrapings showed presence of hyphae elements suggesting cause of ulcer from a fungal pathogen. Isolated ...
"The DNA sequence and analysis of human chromosome 13". Nature. 428 (6982): 522-8. doi:10.1038/nature02379. PMC 2665288. PMID ... "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences". Proc. Natl. Acad. Sci. U.S.A. ... 2002). "Identification of G protein-coupled receptor genes from the human genome sequence". FEBS Lett. 520 (1-3): 97-101. doi: ...
2003). "The DNA sequence and analysis of human chromosome 6". Nature. 425 (6960): 805-11. doi:10.1038/nature02055. PMID ... Taylor MR, Peterson JA, Ceriani RL, Couto JR (1996). "Cloning and sequence analysis of human butyrophilin reveals a potential ... "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences". Proc. Natl. Acad. Sci. U.S.A. ... 1999). "Cloning, expression analysis, and chromosomal localization of a novel butyrophilin-like receptor". J. Hum. Genet. 44 (4 ...
2003). "The DNA sequence and analysis of human chromosome 6". Nature. 425 (6960): 805-11. doi:10.1038/nature02055. PMID ... Zhan X; Evans CO; Oyesiku NM; Desiderio DM (2004). "Proteomics and transcriptomics analyses of secretagogin down-regulation in ...
2003). "The DNA sequence and analysis of human chromosome 6". Nature. 425 (6960): 805-11. doi:10.1038/nature02055. PMID ... 2003). "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences". Proc. Natl. Acad. Sci ... 2001). "Functional analysis of B144/LST1: a gene in the tumor necrosis factor cluster that induces formation of long filopodia ... 2004). "Analysis of a high-throughput yeast two-hybrid system and its use to predict the function of intracellular proteins ...
2003). "The DNA sequence and analysis of human chromosome 6". Nature. 425 (6960): 805-11. doi:10.1038/nature02055. PMID ... DNA sequences, polymorphism, and linkage to the 21-hydroxylase gene". J. Immunol. 146 (3): 1057-66. PMID 1988494.. ... "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences". Proc. Natl. Acad. Sci. U.S.A. ... 1996). "Complete sequence of the complement C4 gene from the HLA-A1, B8, C4AQ0, C4B1, DR3 haplotype". Immunogenetics. 43 (4): ...
2003). "The DNA sequence and analysis of human chromosome 6". Nature. 425 (6960): 805-11. doi:10.1038/nature02055. PMID ...
2003). "The DNA sequence and analysis of human chromosome 6". Nature. 425 (6960): 805-11. doi:10.1038/nature02055. PMID ... 2003). "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences". Proc. Natl. Acad. Sci ... 2004). "Proteomic, functional, and domain-based analysis of in vivo 14-3-3 binding proteins involved in cytoskeletal regulation ...
... and the position of their DNA cleavage site relative to the target sequence.[31][32][33] DNA sequence analyses of restriction ... Freeware DNA cloning, sequence analysis and plasmid/DNA plotting software. *. Čermák V. "Restriction Analyzer". Retrieved 2016- ... Recognition sequences in DNA differ for each restriction enzyme, producing differences in the length, sequence and strand ... but the forward and backward sequences are found in complementary DNA strands (i.e., of double-stranded DNA), as in GTATAC ( ...
Sequencing and analysis of Neanderthal genomic DNA. Science. 2006 Nov 17;314(5802):1113-8. Tringe SG et al. Comparative ... during which time the DOE JGI completed the sequencing and analyses of chromosomes 5, 16 and 19. After that project, he ... harnessing sequence comparisons between species for the discovery of genes and non-coding sequences of pivotal evolutionary and ... his DOE JGI collaborators have played a leading role in the emerging field of metagenomics-sequencing and characterizing DNA ...
Palatnick, Aspyn; Zhou, Bin; Ghedin, Elodie; Schatz, Michael C (2020-12-07). "iGenomics: Comprehensive DNA sequence analysis on ... "The world's first DNA "tricorder" in your pocket". Cold Spring Harbor Laboratory. 2020-12-07. Retrieved 2020-12-26. "The Trek ... "Purdue chemical-analysis method promises fast results". Pursue University. 2006-03-16. Archived from the original on April 8, ... Michael Schatz and his intern Aspyn Palatnick published a paper on the first mobile app to allow anybody to study DNA virtually ...
Mulet, Magdalena; Lalucat, Jorge; García-Valdés, Elena (March 2010). "DNA sequence-based analysis of the Pseudomonas species". ... Based on 16S rRNA analysis, similar species have been placed in its group. A comparative genomic and phylogenomic study in 2020 ... Jul 2000). "Phylogenetic affiliation of the pseudomonads based on 16S rRNA sequence". Int J Syst Evol Microbiol. 50 (4): 1563- ... Nikolaidis, Marios; Mossialos, Dimitris; Oliver, Stephen G.; Amoutzias, Grigorios D. (2020-07-24). "Comparative Analysis of the ...
PubMed id 20379614)1, 4 Rose J.E....Uhl G.R. (2010) 8. DNA sequence and analysis of human chromosome 9. (PubMed id 15164053)1, ... 2004). "DNA sequence and analysis of human chromosome 9". Nature. 429 (6990): 369-74. doi:10.1038/nature02465. PMC 2734081. ... 2003). "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences". Proc. Natl. Acad. Sci ... This gene is found in a cluster with two other members of the gene family, having in common a zinc finger-like DNA-binding ...
Cloning and sequence analysis of the complementary DNA". Biochemistry. 26 (13): 3975-82. doi:10.1021/bi00387a035. PMID 3651428 ...
Mulet, Magdalena; Lalucat, Jorge; García-Valdés, Elena (March 2010). "DNA sequence-based analysis of the Pseudomonas species". ... It belongs to the Pseudomonas genus; 16S rRNA analysis as well as phylogenomic analysis has placed P. fluorescens in the P. ... The phylogenomic analysis clearly showed that the 25 strains annotated as P. fluorescens did not form a monophyletic group. In ... Phylogenetic and genomic analysis, though, has revealed that the entire phl gene cluster is ancestral to P. fluorescens, many ...
Palatnick, Aspyn; Zhou, Bin; Ghedin, Elodie; Schatz, Michael C (December 2020). "iGenomics: Comprehensive DNA sequence analysis ... "Sequencing DNA in Space - SpaceRef". spaceref.com. Retrieved 25 July 2016. Rainey, Kristine (29 August 2016). "First DNA ... analysis of structural variants in cancer, haplotyping, analysis of fetal DNA, and other applications. Publications indicate a ... sequencing one strand of the duplex DNA), '2D' accuracy (sequencing both the template and complement strand) and assembled ...
"DNA sequence and analysis of human chromosome 18". Nature. 437 (7058): 551-5. doi:10.1038/nature03983. PMID 16177791. Chen H, ... "Trapping and sequence analysis of 1138 putative exons from human chromosome 18". Mol Psychiatry. 8 (6): 619-23. doi:10.1038/sj. ... Chromosome 18 spans about 80 million base pairs (the building material of DNA) and represents about 2.5 percent of the total ... the collaborative consensus coding sequence project (CCDS) takes an extremely conservative strategy. So CCDS's gene number ...
"Phylogenetic analysis of a reported complementary DNA sequence". Science. 265 (5175): 1110-1. Bibcode:1994Sci...265.1110Z. doi: ... Zietkiewicz E, Makałowski W, Mitchell G, Labuda D (October 1996). "Complementary DNA for 12-kilodalton B cell growth factor: ... Kovanen PE, Harju L, Timonen T (October 1996). "Complementary DNA for 12-kilodalton B cell growth factor: misassigned". Science ...
Mungall AJ, Palmer SA, Sims SK, et al., The DNA sequence and analysis of human chromosome 6., in Nature, vol. 425, nº 6960, ... Wistow G, Bernstein SL, Wyatt MK, et al., Expressed sequence tag analysis of human RPE/choroid for the NEIBank Project: over ... Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences., in Proc. Natl. Acad. Sci. U.S. ... Nucleotidi · Basi azotate · Acidi nucleici (DNA · RNA) · Cromosomi · Genoma. Concetti chiave. Gene · Codice genetico · Allele · ...
2002). "The DNA sequence and comparative analysis of human chromosome 20". Nature. 414 (6866): 865-71. doi:10.1038/414865a. ... 2003). "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences". Proc. Natl. Acad. Sci ... 2005). "An analysis of PAX1 in the development of vertebral malformations". Clin. Genet. 68 (5): 448-53. doi:10.1111/j.1399- ...
2001). "The DNA sequence and comparative analysis of human chromosome 20". Nature. 414 (6866): 865-71. doi:10.1038/414865a. ...
2002). "The DNA sequence and comparative analysis of human chromosome 20". Nature. 414 (6866): 865-71. Bibcode:2001Natur.414.. ... analysis using a yeast two-hybrid system". Biochem. Biophys. Res. Commun. 256 (2): 385-90. doi:10.1006/bbrc.1999.0343. PMID ... "The BPI/LBP family of proteins: a structural analysis of conserved regions". Protein Sci. 7 (4): 906-14. doi:10.1002/pro. ...
2002). "The DNA sequence and comparative analysis of human chromosome 20". Nature. 414 (6866): 865-71. doi:10.1038/414865a. ... DNA metabolic process. • multicellular organism development. • adenylate cyclase-activating adrenergic receptor signaling ... Bruno JF, Whittaker J, Song JF, Berelowitz M (1991). "Molecular cloning and sequencing of a cDNA encoding a human alpha 1A ... 1995). "Cloning and pharmacological characterization of human alpha-1 adrenergic receptors: sequence corrections and direct ...
The paternal DNA in the mother's plasma had to have come from the fetus. Then, they could reliably identify fetal DNA, which ... And each case seems to present a new low in terms of the depth and quality of analysis." She sees a common thread in these ... So they wanted to focus on genetic fragments containing paternally inherited sequences the mother did not share, but had ... The inventors realized that the fetus had DNA derived from the father as well as the mother, and that paternal DNA was not ...
The Chimpanzee Sequencing and Analysis Consortium. Initial sequence of the chimpanzee genome and comparison with the human ... 由於粒線體缺乏用來檢查複製錯誤的能力,因此粒線體DNA(mDNA)的變異速率比細胞核DNA(一般所指的DNA)更快。粒線體的突變速率快了20倍,這使mDNA能夠用來較為精確地追溯出母系祖先。研究族群中的mDNA,也能使人們得知此族群過去的遷移
... sequence-specific DNA binding. • RNA polymerase II regulatory region sequence-specific DNA binding. • DNA binding. • sequence- ... "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences". Proc. Natl. Acad. Sci. U.S.A. ... specific DNA binding. • transcriptional activator activity, RNA polymerase II transcription regulatory region sequence-specific ... 2002). "Complete mutation analysis panel of the 39 human HOX genes". Teratology. 65 (2): 50-62. doi:10.1002/tera.10009. PMID ...
... based on morphological and DNA sequence comparisons, Chalara fraxinea was suggested to be the asexual stage (anamorph) of the ... Genetic analysis of the fungus Lambertella albida which grows harmlessly on petioles of the Manchurian ash (Fraxinus ... The sequence has been published on the website OpenAshDieBack and offers clues to how the fungus infects trees. The study has ... Teams from The Sainsbury Laboratory (TSL) and the John Innes Centre in Norwich sequenced the genome of the fungus in December ...
Once a region of DNA is identified as contributing to a phenotype, it can be sequenced. The DNA sequence of any genes in this ... Analysis of variance[edit]. The simplest method for QTL mapping is analysis of variance (ANOVA, sometimes called "marker ... DNA locus associated with variation in a quantitative trait. A quantitative trait locus (QTL) is a locus (section of DNA) that ... In a recent development, classical QTL analyses were combined with gene expression profiling i.e. by DNA microarrays. Such ...
Systems biology Bioinformatics Computational genomics Computational biology Microarray analysis DNA microarray Pathway analysis ... Laboratory Corporation and Quest Diagnostics to develop a solution for scoring genetic variation for next generation sequencing ... "The Return on Investment for Ingenuity Pathways Analysis within the Pharmaceutical Value Chain", Zimmerman, Reeve, and Golden, ... "Ingenuity Preps New NGS Variant Analysis Tool, Signs Translational Oncology Group as Beta Tester". BioInform. GenomeWeb. ...
An analysis of mitochondrial DNA sequences published in 2003 confirmed that the black-billed magpie and the yellow-billed ... A more recent study using both mitochondrial and nuclear DNA found that magpies in east and northeast China are genetically ...
The genome of S. pneumoniae is a closed, circular DNA structure that contains between 2.0 and 2.1 million base pairs depending ... The recent advances in next-generation sequencing and comparative genomics have enabled the development of robust and reliable ... further analysis showed that neutrophils exposed to dead H. influenzae were more aggressive in attacking S. pneumoniae.[28] ... Competence in S. pneumoniae is induced by DNA-damaging agents such as mitomycin C, fluoroquinolone antibiotics (norfloxacin, ...
December 1999). "Identification of Ebola virus sequences present as RNA or DNA in organs of terrestrial small mammals of the ... "Virological Analysis: no link between Ebola outbreaks in west Africa and Democratic Republic of Congo". World Health ... Genome-sequencing showed that this outbreak was not related to the 2014-15 West Africa Ebola virus outbreak, but was the same ... Genome sequencing suggests that this outbreak, the 11th outbreak since the virus was first discovered in the country in 1976, ...
Mitochondrial DNA data for the D-loop sequence suggests that mallards may have evolved in the general area of Siberia. Mallard ... Genetic analysis has shown that certain mallards appear to be closer to their Indo-Pacific relatives while others are related ... Mallards are differentiated in their mitochondrial DNA between North American and Eurasian populations,[17] but the nuclear ... The genome of Anas platyrhynchos was sequenced in 2013.[6] ...
DNA studies also suggest an unknown degree of interbreeding between Homo sapiens sapiens and Homo sapiens denisova.[27] ... "Phylogeographic Analysis of the mid-Holocene Mammoth from Qagnax Cave, St. Paul Island, Alaska" (PDF).. ... "Callaway, Ewen (22 September 2011), "First Aboriginal genome sequenced", Nature, Nature News, doi:10.1038/news.2011.551 ... Evidence from canine DNA collected by Robert K. Wayne suggests that dogs may have been first domesticated in the late Middle ...
... and first sequenced in 1986-when two Japanese research teams sequenced the chloroplast DNA of liverwort and tobacco.[5] Since ... "Evolutionary analysis of Arabidopsis, cyanobacterial, and chloroplast genomes reveals plastid phylogeny and thousands of ... DNA replicationEdit. Leading model of cpDNA replicationEdit. Chloroplast DNA replication via multiple D loop mechanisms. ... Chloroplast DNA Interactive gene map of chloroplast DNA from Nicotiana tabacum. Segments with labels on the inside reside on ...
2004). "Mass spectrometry analysis of recombinant human ZP3 expressed in glycosylation-deficient CHO cells". Biochemistry. 43 ( ... A variation in the last exon of this gene has previously served as the basis for an additional ZP3 locus; however, sequence and ... negative regulation of transcription, DNA-templated. • phosphatidylinositol-mediated signaling. • single fertilization. • egg ... The nascent protein contains a N-terminal signal peptide sequence, a conserved "ZP domain" module, a consensus furin cleavage ...
... mismatch as small as a single DNA base pair is significant so perfect matches require knowledge of the exact DNA sequence of ... "Data analysis slides by Center for International Blood and Marrow Transplant Research". mcw.edu. Archived from the original on ...
Kamboh MI, Aston CE, Hamman RF (2000). "DNA sequence variation in human apolipoprotein C4 gene and its effect on plasma lipid ... "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences". Proc. Natl. Acad. Sci. U.S.A. ... 2007). "Proteomic analysis of human very low-density lipoprotein by two-dimensional gel electrophoresis and MALDI-TOF/TOF". ... "Large-scale candidate gene analysis of spontaneous clearance of hepatitis C virus". J. Infect. Dis. 201 (9): 1371-80. doi ...
The DNA sequence of a gene often varies from one individual to another. Those variations are called alleles. While some genes ... Gupta, R.S.; Chan, D.H.Y.; Siminovitch, L. (1978). "Evidence obtained by segregation analysis for functional hemizygosity at ... Zygosity is a description of whether those two alleles have identical or different DNA sequences. In some cases the term " ... Diploid organisms have the same loci on each of their two sets of homologous chromosomes except that the sequences at these ...
This was further confirmed by molecular studies of their DNA.[6] These also showed that the brolga is more closely related to ... Analyses showed strong niche separation between Brolgas and sarus cranes by diet. It is likely that their diet in dry season ... "Mitochondrial genome sequences and the phylogeny of cranes (Gruiformes: Gruidae)". Auk. 127 (2): 440-452. doi:10.1525/auk. ... Isotopic analyses of molted feathers in their breeding grounds along the Gulf of Carpentaria showed their diet to be diverse ...
Satellite DNA. *Selfish DNA. *Sequence analysis. *Single nucleotide polymorphism. T. *Tandem repeat ... Pages in category "DNA". The following 33 pages are in this category, out of 33 total. ... Retrieved from "https://simple.wikipedia.org/w/index.php?title=Category:DNA&oldid=4367965" ...
In 2010, the Caulobacter NA1000 strain was sequenced and all differences with the CB15 "wild type" strain were identified.[6] ... In Caulobacter cells, replication of the chromosome involves about 2 million DNA synthesis reactions for each arm of the ... "The diversity and evolution of cell cycle regulation in alpha-proteobacteria: A comparative genomic analysis". BMC Systems ... "Complete genome sequence of Caulobacter crescentus". Proceedings of the National Academy of Sciences of the United States of ...
A phylogenetic hypothesis for passerine birds: taxonomic and biogeographic implications of an analysis of nuclear DNA sequence ...
DNA binding. • sequence-specific DNA binding. • transcription factor activity, sequence-specific DNA binding. • transcriptional ... "A comprehensive analysis of PAX8 expression in human epithelial tumors". The American Journal of Surgical Pathology. 35 (6): ... transcription regulatory region DNA binding. • RNA polymerase II core promoter sequence-specific DNA binding. • RNA polymerase ... sequence-specific DNA binding. • transcriptional activator activity, RNA polymerase II transcription regulatory region sequence ...
... but recent research into DNA sequences suggests that this interpretation leaves the Pinales without Taxales as paraphyletic, ... Interpretation of concentrations determined by analysis is easy only when a nutrient occurs in excessively low or occasionally ... A new classification and linear sequence based on molecular data can be found in an article by Christenhusz et al.[7] ... Phylogeny of the Pinophyta based on cladistic analysis of molecular data.[5] ...
... revealed the presence of the DNA sequence of Borrelia burgdorferi making him the earliest known human with Lyme disease.[242] ... Lyme disease fact sheet Analysis of CDC data on VoxHealth. Retrieved on 2013-30-1 ... The examination of preserved museum specimens has found Borrelia DNA in an infected Ixodes ricinus tick from Germany that dates ... Except for one study in Europe,[229] much of the data implicating lizards is based on DNA detection of the spirochete and has ...
Saint Nicolas on a text by Eric Crozier which covers the saint's legendary life in a dramatic sequence of events. A tenor ... In the absence of DNA testing, however, it is not yet possible to know for certain whether the pelvis is from the same man.[101 ... Scientific analysis[edit]. Saint Nicholas, Russian icon from first quarter of the 18th century (Kizhi monastery, Karelia) ...
Complete mitochondrial DNA of the hagfish, Eptatretus burgeri: the comparative analysis of mitochondrial DNA sequences strongly ... 28S and 18S ribosomal DNA sequences support the monophyly of lampreys and hagfishes. Molecular Biology and Evolution 15 (12): ...
DNA analysis consistently shows that all existing red wolves carry coyote genes. This has caused a problem for Canid taxonomy, ... "Large sequence divergence among mitochondrial DNA genotypes within populations of eastern African black-backed jackals" (PDF). ... analysis of control region haplotypes of the mitochondrial DNA and sex chromosomes from Mexican wolves, a critically endangered ... However, DNA study shows that "the dingo originates from domesticated dogs, originally from East Asia"[16] (which reverted to ...
1977). "Nucleotide sequence of bacteriophage phi X174 DNA". Nature. 265 (5596): 687-695.. ... ENCODE: the complete analysis of the human genome. References[change , change source]. *↑ Hans Winkler, Professor of Botany at ... The C. elegans sequencing consortium (1998). "Genome sequence of the nematode C. elegans: a platform for investigating biology" ... This includes both the genes and the non-coding sequences of the DNA. Professor Hans Winkler coined the term in 1920.[1] ...
"Genetic analysis of completely sequenced disease-associated MHC haplotypes identifies shuffling of segments in recent human ... either as a consequence of recombination-obstruction within the DNA, as a consequence of repeated selection for the entire ... The SNP analysis of the haplotype suggests a potential founding affect of 20,000 years within Europe, though conflicts in ... Castaño-Rodríguez N, Diaz-Gallo LM, Pineda-Tamayo R, Rojas-Villarraga A, Anaya JM (February 2008). "Meta-analysis of HLA-DRB1 ...
Early DNA-analysis showed that the Capparaceae-as defined at that moment-were paraphyletic, and it was suggested to assign the ... Hall, J.C.; Sytsma, K.J.; Iltis, H.H. (2002). "Phylogeny of Capparaceae and Brassicaceae based on chloroplast sequence data". ... Current insights in the relationships of the Brassicaceae, based on a 2012 DNA-analysis, are summarized in the following tree.[ ... It has long been clear that the Aethionema are sister of the remainder of the family.[9] One analysis from 2014 represented the ...
"Same DNA deletion paves paths to autism, schizophrenia , Spectrum". Spectrum. 2016-10-18. Retrieved 2016-11-13.. ... Gruneberg, H., 1938 An analysis of the "pleiotropic" effects of a new lethal mutation in the rat (Mus norvegicus). Proc. R. Soc ... evidence from a meta-analysis of twin studies". Archives of General Psychiatry. 60 (12): 1187-1192. doi:10.1001/archpsyc.60.12. ...
... Stephen A. Karl karl at CHUMA.CAS.USF.EDU Mon Dec 4 14:34:28 EST 1995 *Previous message: DNA ... People working with ribosomal DNA sequence are probably not in this group and have legitimate concerns. For others where in/ ... If many gaps are needed to align a sequence then it would seem that the degree of divergence between the sequences are such ... If the sequences are easily aligned and there are clear gaps necessary for the alignment then including them in the data set ...
These probe arrays, or DNA chips, can then be applied to parallel DNA hybridization analysis, directly yielding sequence ... Light-generated oligonucleotide arrays for rapid DNA sequence analysis. A C Pease, D Solas, E J Sullivan, M T Cronin, C P ... Light-generated oligonucleotide arrays for rapid DNA sequence analysis. A C Pease, D Solas, E J Sullivan, M T Cronin, C P ... Light-generated oligonucleotide arrays for rapid DNA sequence analysis. A C Pease, D Solas, E J Sullivan, M T Cronin, C P ...
Politico reports that the NYPD DNA database has grown since it announced it would be removing profiles from it. ... A Machine-Learning Framework for Accurate Classification and Quantification of Oncogenic Variants Using the QuantideX NGS DNA ... The technology, called PANGEA (predictive analysis of noncoding genomic enhancer/promoter alterations), could eventually help ... GenomSys Banks on MPEG-G Standard to Make Genome Analysis Mobile. Premium ...
Recent advances in DNA sequencing methodologies have caused an exponential growth of publicly available genomic sequence data. ... web-based software toolkit DNA sequence analysis DNA compression This is a preview of subscription content, log in to check ... Pratas D., Pinho A.J., Garcia S.P. (2012) Exon: A Web-Based Software Toolkit for DNA Sequence Analysis. In: Rocha M., Luscombe ... Dix, T.I., Powell, D.R., Allison, L., Bernal, J., Jaeger, S., Stern, L.: Comparative analysis of long DNA sequences by per ...
We have developed a method for the partial automation of DNA sequence analysis. Fluorescence detection of the DNA fragments is ... Fluorescence detection in automated DNA sequence analysis.. Smith LM, Sanders JZ, Kaiser RJ, Hughes P, Dodd C, Connell CR, ... by means of a fluorophore covalently attached to the oligonucleotide primer used in enzymatic DNA sequence analysis. A ... the separated fluorescent bands of DNA are detected near the bottom of the tube, and the sequence information is acquired ...
... Gigi Murphy MCBKANGI at nusvm.bitnet Fri May 4 16:29:30 EST 1990 * ... I am trying to set up a DNA/Protein sequence analysis software on our University IBM 3081 or IBM 3090 running VM/CMS since our ...
It is designed for use with existing sequencing chemistries using fluorescently labeled dideoxynucleotide triphosphate and for ... fragment analysis using Promega 4-, 5- and 6-dye STR kits, or other commercially available STR kits. ... The Spectrum Compact CE System is an integrated instrument for sequencing and fragment analysis. ... fsa for fragment analysis and .ab1 for Sanger sequencing. Dimensions. 40cm W x 60cm D x 60cm H (15.75in W x 23.62in D x 23.62in ...
The finished sequence comprises 166,880,988 base pairs, representing the largest chromosome sequenced so far. The entire ... sequence has been subjected to high-quality manual annotation, resulting in the evidence-su … ... The DNA sequence and analysis of human chromosome 6 Nature. 2003 Oct 23;425(6960):805-11. doi: 10.1038/nature02055. ... The finished sequence comprises 166,880,988 base pairs, representing the largest chromosome sequenced so far. The entire ...
Sampling properties of DNA sequence data in phylogenetic analysis. Title. Sampling properties of DNA sequence data in ...
BI101 Introduction to DNA and Protein Sequence Analysis. This course teaches the individual how to analyze DNA and protein ... Sequence database searches using BLAST, FASTA and SSEARCH. Session 4. Additional DNA sequence analysis applications, such as ... DNA and protein sequence alignments: local, global and multiple; demonstration of tools to perform these alignments. Session 3 ... Fundamentals of DNA and protein alphabets, representations, patterns, structures and annotations. Session 2. ...
A case of onychomycosis due to Aspergillus sydowii diagnosed using DNA sequence analysis.. Takahata Y, Hiruma M, Sugita T, Muto ... The causative agent was identified as Aspergillus sydowii based on DNA sequencing and the macroscopic and microscopic ...
DNA sequence analysis of artificially evolved ebg enzyme and ebg repressor genes.. B G Hall, P W Betts and J C Wootton ... DNA sequence analysis of artificially evolved ebg enzyme and ebg repressor genes.. B G Hall, P W Betts and J C Wootton ... DNA sequence analysis of artificially evolved ebg enzyme and ebg repressor genes.. B G Hall, P W Betts and J C Wootton ... DNA sequence analysis of artificially evolved ebg enzyme and ebg repressor genes. ...
DNA methylation is the paradigm epigenetic modification that is associated with transcriptional repression.... ... Epigenetic modifications of chromatin and DNA are relevant for eukaryotic gene expression. ... Ultradeep bisulfite sequencing analysis of DNA methylation patterns in multiple gene promoters by 454 sequencing. Cancer Res 67 ... Baubec T., Akalin A. (2016) Genome-Wide Analysis of DNA Methylation Patterns by High-Throughput Sequencing. In: Aransay A., ...
Also discussed are important recent diagnostic applications of DNA sequencing in cancer, including analysis of tumor derived ... Also discussed are important recent diagnostic applications of DNA sequencing in cancer, including analysis of tumor derived ... Pharmogenetic variants detected by DNA sequence analysis are gaining in importance and are particularly relevant to ... Applications involving analysis of cell free DNA in maternal DNA for prenatal diagnosis of specific autosomal trisomies are ...
... for MPS analysis of both Y-chromosome and autosomal DNA. ... for forensic DNA analysis using a massively parallel sequencing ... Massively Parallel Sequencing for Forensic DNA Analysis. Traditionally, capillary electrophoresis (CE) has been the method of ... Forensic DNA Analysis: Massively Parallel Sequencing Workflows. Promega offers solutions ... Next-generation sequencing (NGS), or massively parallel sequencing (MPS), enables the simultaneous analysis of hundreds of ...
Sequencing and Analysis of Neanderthal Genomic DNA. By James P. Noonan, Graham Coop, Sridhar Kudaravalli, Doug Smith, Johannes ... Sequencing and Analysis of Neanderthal Genomic DNA. By James P. Noonan, Graham Coop, Sridhar Kudaravalli, Doug Smith, Johannes ... Our analyses suggest that on average the Neanderthal genomic sequence we obtained and the reference human genome sequence share ... The sequences of DNA fragments from Neanderthal bones date the divergence of humans and Neanderthals to about 370,000 years ago ...
... - Perkinelmer, Agilent Technologies, Eurofins Scientific, Illumina, ... Global DNA Sequencing Market Report MarketResearchReports.Biz announces addition of new report "Global DNA Sequencing Market ... Global DNA Sequencing Market Report MarketResearchReports.Biz announces addition of new report "Global DNA Sequencing Market ... DNA synthesis processes DNA oligomers are the foundation of the DNA synthesis process. The essential feature of DNA synthesis ...
Amplicon high throughput sequencing, Ancient DNA, Bioinformatics, Comparative genomics, DNA, DNA sequence analysis, DNA ... DNA sequence analysis, DNA sequencing, Evolution, Evolutionary biology, Evolutionary genomics, Fish, Genes, Genetics, Genome, ... Atlantic cod, Genomics, Bioinformatics, Cell biology, DNA sequence analysis, Genetics, High-throughput sequencing, Molecular ... Persons tagged with «DNA sequence analysis». Name. Phone. E-mail. Tags. Nederbragt, Lex Senior Lecturer +47 22844132 lex. ...
Cytogenetic Analysis of Populus trichocarpa - Ribosomal DNA, Telomere Repeat Sequence, and Marker-selected BACs. Cytogenet ... Cytogenetic Analysis of Populus trichocarpa - Ribosomal DNA, Telomere Repeat Sequence, and Marker-selected BACs ... Six BAC clones selected from 2 linkage groups based on genome sequence assembly (LG-I and LG-VI) were localized on 2 ... All BAC positions were found to be concordant with sequence assembly positions. BAC-FISH will be useful for delineating each of ...
... fundamental modifications to RRM had to be made in order to make it suitable for the analysis of a greater variety of sequences ... During the course of the project, several methods for extracting the features from the spectra of biological sequences and ... For promoter classification the suitable choices were found to be Principal Component Analysis (PCA) feature extraction and ... Results indicate that signal processing methods may be very suitable for analyzing biological sequences. ...
BACKGROUND: A computational system for analysis of the repetitive structure of genomic sequences is described. The method uses ... This method has been incorporated into a system that can find repeats in individual genome sequences or sets of sequences, and ... should prove helpful in the analysis of repeat structure for both complete and partial genome sequences. ... CONCLUSIONS: We propose a new clustering method for analysis of the repeat data captured in suffix trees. ...
DNA SEQUENCE ANALYSIS - SANGER OR NGS. Sequencher DNA Sequence Analysis Software is an indispensable tool for the benchtop ... With powerful analyses and rich visualizations, it has a unique paradigm where every analysis is an experiment that make your ... Next-Gen Sequencing (NGS), and RNA-Seq sequence data. Come see what Sequencher can do for you, Power with Simplicity. ... RNA-SEQ OR MICROARRAY DATA ANALYSIS CodeLinker is a user-friendly and powerful desktop software program for analyzing your RNA- ...
BI101 Introduction to DNA and Protein Sequence Analysis; Jul. 9-13, 2012. (ACTG). This course teaches the individual how to ... analyze DNA and protein sequences using computer software. Topics to be covered include description of sequence alignments, ...
... algorithms are the traditional ways to compare and analyze DNA sequences. However, for large DNA sequences, these algorithms ... Results: We perform similarity/dissimilarity analyses among two real DNA data sets, the coding sequences of the first exon of ... Objective: Here we will propose a new numerical method to characterize and compare DNA sequences quickly. Method: Based on a ... graphical representation of DNA sequences, we can obtain an 8-dimensional vector using two basic concepts of probability, the ...
Although assays utilizing PCR amplification of bisulfite-converted DNA are widely employed to analyze these DNA methylation ... Alterations in cytosine-5 DNA methylation are frequently observed in most types of human cancer. ... DNA methylation analysis by digital bisulfite genomic sequencing and digital MethyLight Nucleic Acids Res. 2008 Aug;36(14):4689 ... We developed digital bisulfite genomic DNA sequencing to efficiently determine single-basepair DNA methylation patterns on ...
Sequencing and Comparative Genomic Analysis of pK29, a 269-Kilobase Conjugative Plasmid Encoding CMY-8 and CTX-M-3 β-Lactamases ... Target Gene Sequencing To Characterize the Penicillin G Susceptibility of Neisseria meningitidis Muhamed-Kheir Taha, Julio A. ... Cloning, Sequencing, and Characterization of the SdeAB Multidrug Efflux Pump of Serratia marcescens Ayush Kumar, Elizabeth A. ... Reply to Furlan et al., "Importance of Sequencing To Determine Functional blaTEM Variants" George A. Jacoby, Karen Bush ...
Phylogenetic Analysis of DNA Sequences has 1 available editions to buy at Alibris ... Phylogenetic Analysis of DNA Sequences by Miyamoto, Cracraft starting at $13.07. ... Phylogenetic Analysis of DNA Sequences. by Miyamoto, Cracraft Write The First Customer Review ... In this volume, international contributors address crucial questions about DNA systematics, including DNA sequence data ...
HUMAN MITOCHONDRIAL DNA VARIATION AND EVOLUTION: ANALYSIS OF NUCLEOTIDE SEQUENCES FROM SEVEN INDIVIDUALS. Charles F. Aquadro ... HUMAN MITOCHONDRIAL DNA VARIATION AND EVOLUTION: ANALYSIS OF NUCLEOTIDE SEQUENCES FROM SEVEN INDIVIDUALS. Charles F. Aquadro ... HUMAN MITOCHONDRIAL DNA VARIATION AND EVOLUTION: ANALYSIS OF NUCLEOTIDE SEQUENCES FROM SEVEN INDIVIDUALS. Charles F. Aquadro ... HUMAN MITOCHONDRIAL DNA VARIATION AND EVOLUTION: ANALYSIS OF NUCLEOTIDE SEQUENCES FROM SEVEN INDIVIDUALS ...
The new system is ideal for applications requiring analysis of longer sequences, such as DNA methylation analysis in epigenetic ... The new system is ideal for applications requiring analysis of longer sequences, such as DNA methylation analysis in epigenetic ... Single Base Resolution DNA Methylation and Mutation Analysis in Long Sequence Runs. ... DNA methylation analysis at single base resolution at CpG and CpN sites ...
Spectrum of spontaneous mutation at the APRT locus of Chinese hamster ovary cells: an analysis at the DNA sequence level. P J ... Spectrum of spontaneous mutation at the APRT locus of Chinese hamster ovary cells: an analysis at the DNA sequence level ... Spectrum of spontaneous mutation at the APRT locus of Chinese hamster ovary cells: an analysis at the DNA sequence level ... Spectrum of spontaneous mutation at the APRT locus of Chinese hamster ovary cells: an analysis at the DNA sequence level ...
  • Our finding that the Neanderthal and human genomes are at least 99.5% identical led us to develop and successfully implement a targeted method for recovering specific ancient DNA sequences from metagenomic libraries. (sciencemag.org)
  • Its use is demonstrated here on several complete microbial genomes, the entire Arabidopsis thaliana genome, and a large collection of rice bacterial artificial chromosome end sequences. (jcvi.org)
  • Topics include the organisation and structure of genomes, and sequencing methods and strategies. (worldcat.org)
  • Long-read sequences greatly facilitate the assembly of complex genomes and characterization of structural variation. (jove.com)
  • Third generation single-molecule DNA sequencing technologies offer significantly longer read length that can facilitate the assembly of complex genomes and analysis of complex structural variants. (jove.com)
  • With even more picoplankton genomes in the sequencing queue at DOE JGI, we're positioned to secure a better grasp on the mechanisms of species adaptatio n and the great diversity of biological pathways operating in the oceans," said Grigoriev. (bio-medicine.org)
  • DNA sequencing has made it possible to sequence whole genomes and analyzes various DNA-protein interactions conveniently. (medgadget.com)
  • This constructed workflow first subtracted human sequences and then aligned the remaining sequences against select viral genomes. (aacrjournals.org)
  • We hypothesized that for human and mouse, many orthologous genes expressed in a similarly tissue-specific manner in both human and mouse gene expression data, are likely to be co-regulated by orthologous TFs that bind to DNA sequence motifs present within noncoding sequence conserved between these genomes. (biomedcentral.com)
  • The visualization interfaces generated with the software allow for the immediate identification and observation of several types of sequence patterns in genomes of various sizes and origins. (concordia.ca)
  • The rapid speed of sequencing attained with modern DNA sequencing technology has been instrumental in the sequencing of complete DNA sequences, or genomes, of numerous types and species of life, including the human genome and other complete DNA sequences of many animal, plant, and microbial species. (wikipedia.org)
  • DNA sequencing may be used to determine the sequence of individual genes, larger genetic regions (i.e. clusters of genes or operons), full chromosomes, or entire genomes of any organism. (wikipedia.org)
  • Sequencing is used in molecular biology to study genomes and the proteins they encode. (wikipedia.org)
  • Viral genomes can be based in DNA or RNA. (wikipedia.org)
  • Medical technicians may sequence genes (or, theoretically, full genomes) from patients to determine if there is risk of genetic diseases. (wikipedia.org)
  • Testing DNA is a technique which can detect specific genomes in a DNA strand to produce a unique and individualized pattern. (wikipedia.org)
  • This list of sequenced eubacterial genomes contains most of the eubacteria known to have publicly available complete genome sequences. (wikipedia.org)
  • For the genomes of archaea see list of sequenced archaeal genomes. (wikipedia.org)
  • The entire sequence has been subjected to high-quality manual annotation, resulting in the evidence-supported identification of 1,557 genes and 633 pseudogenes. (nih.gov)
  • Here we report that at least 96% of the protein-coding genes have been identified, as assessed by multi-species comparative sequence analysis, and provide evidence for the presence of further, otherwise unsupported exons/genes. (nih.gov)
  • DNA sequence analysis of artificially evolved ebg enzyme and ebg repressor genes. (genetics.org)
  • We determined the sequence of the intergenic spacer (IGS) 1 region, which is located between the 26S and 5S rRNA genes, in 25 species of the genus Trichosporon . (asm.org)
  • Consequently, the differentiation of Trichosporon species requires the analysis of genes or regions that have greater divergence than the ITS. (asm.org)
  • We have compared an established culture-based method with direct amplification and partial sequencing of cloned 16S rRNA genes from a human fecal specimen. (asm.org)
  • We used three nuclear genes, comprising two noncontiguous fragments of elongation factor 1α (EF-1α 5′ and EF-1α 3′), fragments of the D2 and D10 expansion regions of the large subunit ribosomal DNA gene (28S), and a region of the small subunit ribosomal DNA gene (18S). (wiley.com)
  • DNA and amino acid sequence analysis of structural and immunity genes of colicins Ia and Ib. (asm.org)
  • The nucleotide sequences for colicin Ia and colicin Ib structural and immunity genes were determined. (asm.org)
  • Phylogenetic analysis of the ITS regions revealed that evolution of the regions of some species of VS is not parallel to that of the 16S rRNA genes. (asm.org)
  • Genes were selected for sequencing based on each patient's clinical presentation and suspected diagnosis. (bmj.com)
  • Results DNA sequencing of the coding and near-coding regions of genes relevant to each patient's clinical presentation revealed 37 sequence variations of known or uncertain pathogenicity in 9 genes from 25 patients. (bmj.com)
  • The failure to identify a genetic aetiology in many patients in this study highlights the extreme heterogeneity of genetic hearing loss, the incompleteness of current knowledge of aetiologies of hearing loss, and the limitations of conventional DNA sequencing strategies that evaluate only coding and near-coding segments of genes. (bmj.com)
  • As a research study, it was possible to perform DNA sequencing of a greater number of genes for each patient than would have been economically feasible by clinical genetic testing. (bmj.com)
  • Targeted sequencing is a technique in which a subgroup of genes or regions of the genome are isolated and sequenced. (express-press-release.net)
  • Next-generation sequencing (NGS) is a technique that plays important role in targeted sequencing and offers the resolution, scalability, and speed to assess targeted genes of interest. (express-press-release.net)
  • Massively parallel sequencing analyses have demonstrated that most of the common malignancies display relatively complex repertoires of somatic genetic alterations, that the number of highly recurrent mutations is limited, and that a large number of genes is mutated in a small minority of tumors from a given cancer type. (ascopost.com)
  • Applying this motif finding strategy to conserved noncoding regions surrounding co-expressed tissue-specific human genes allowed us to discover both previously known, and many novel candidate, regulatory DNA motifs in all 18 tissue-specific expression clusters that we examined. (biomedcentral.com)
  • Our analysis suggested the possible addition of a new Syc- and Yop-encoding operon to the LCR-related pCD1 genes and gave no support for the existence of YopL. (pubmedcentralcanada.ca)
  • We used DNA sequence data from three chloroplast genes to examine phylogenetic relationships among sections within the genus Agalinis Raf. (umd.edu)
  • To date, causative mutations in NPHP-AC have been described for 18 different genes, rendering mutation analysis tedious and expensive. (bmj.com)
  • The potential of this approach as an analytical tool is discussed with reference to auditory displays derived from test sequences including simple nucleotide sequences, repetitive DNA sequences and coding or non-coding genes. (biomedcentral.com)
  • This approach enhances sequencing depth by allowing evaluation of specific coding regions within genes or specific genes, which are known to harbor mutations for disease pathogenesis. (reportbuyer.com)
  • DNA extracted from 17 honey samples was amplified with eight primer pairs targeting three mite mtDNA genes, obtaining 88 amplicons that were sequenced with an Ion Torrent sequencing platform. (dtu.dk)
  • By clustering adjacent or overlapping early replicating clones, we identified 1759 "islands" averaging 100 kb in length, allowing us to perform the most detailed analysis to date of DNA characteristics and genes contained within early replicating DNA. (biomedcentral.com)
  • An analysis of genes associated with islands revealed that nearly half of all genes in the WNT family, and a number of genes in the base excision repair pathway, including four of ten DNA glycosylases, were associated with island sequences. (biomedcentral.com)
  • Also, we found an overrepresentation of members of apoptosis-associated genes in very early replicating sequences from both fibroblast and lymphoblastoid cells. (biomedcentral.com)
  • The huge amount of information coming from the genome sequence and other research genome programs cannot be utilised to the full without the availability of methods such as biochips which enable these genes or specific DNA sequences to be detected in biological samples. (bats.ch)
  • We are focusing our efforts on the developement of biochips as tools for every day diagnosis so that large numbers of genes or sequences can be tested in one assay giving the doctor all the information s/he needs to treat the patient. (bats.ch)
  • Information obtained using sequencing allows researchers to identify changes in genes, associations with diseases and phenotypes, and identify potential drug targets. (wikipedia.org)
  • Brinkman AB, Simmer F, Ma K et al (2010) Whole-genome DNA methylation profiling using MethylCap-seq. (springer.com)
  • The goal of this review is to consider different generations of sequencing techniques and their application to exome sequencing and whole genome sequencing and their clinical applications. (frontiersin.org)
  • Whole genome sequencing and its clinical relevance are presented particularly in the context of analysis of nucleotide and structural genomic variants in large population studies and in certain patient cohorts. (frontiersin.org)
  • The complete DNA sequence of the Smith strain of murine cytomegalovirus (MCMV) was determined from virion DNA by using a whole-genome shotgun approach. (asm.org)
  • Whole genome and capture‑based sequencing found that EV mtDNA covered the whole mitochondrial genome. (spandidos-publications.com)
  • The most comprehensive method for determining the methylation status of every nucleotide is whole-genome bisulfite sequencing (WGBS) , however, this approach is not economically viable due to the high cost of whole genome sequencing and the combination of large numbers of samples required in MWAS. (creativebiomart.net)
  • There are few existing visualization methods for raw nucleotide sequences of a whole genome or chromosome. (concordia.ca)
  • We describe a robust, cost-effective low-coverage whole genome sequencing (LC WGS) method for CNA detection using 5 ng of FFPE-derived DNA. (biomedcentral.com)
  • Whole genome sequencing (WGS) at 30× coverage can also be used for CNA and LOH detection, but requires at least 100 ng of high quality input DNA and has challenges associated with cost, bioinformatics processing time, and storage of large datasets. (biomedcentral.com)
  • A method often used to overcome the challenge of a limiting amount of DNA is whole genome amplification (WGA) to increase the amount of starting template DNA [ 9 ]. (biomedcentral.com)
  • Tracking a hospital outbreak of carbapenem-resistant Klebsiella pneumoniae with whole-genome sequencing. (semanticscholar.org)
  • This initial analysis of the Neanderthal genome advances our understanding of the evolutionary relationship of Homo sapiens and Homo neanderthalensis and signifies the dawn of Neanderthal genomics. (sciencemag.org)
  • DNA sequencing in the new technology that has revolutionized molecular biology and genomics research. (medgadget.com)
  • A comprehensive suite of online Bioinformatics tools, including tools for the analysis and comparison of nucleotide and protein sequences, data from functional genomics experiments, text mining of the scientific literature and tools for determination and visualisation of macromolecular structures. (cellbiol.com)
  • Observed DNA sequence variations were assessed for pathogenicity by review of the scientific literature, and mutation and polymorphism databases, through the use of in silico tools including sorting intolerant from tolerant (SIFT) and polymorphism phenotyping (PolyPhen), and according to the recommendations of the American College of Medical Genetics and Genomics for the interpretation of DNA sequence variations. (bmj.com)
  • MinIT, a rapid analysis and device control accessory for nanopore DNA sequencing, is now arriving with genomics researchers. (sttinfo.fi)
  • The huge reduction in the sequencing cost and increase in sequencing efficiency, the incomparable sequencing throughput, sensitivity, and accuracy all make NGS the most promising laboratory technology for cancer genomics, cancer genetics, early diagnosis and personalized treatment of cancer patients in next decade [ 2 - 4 ]. (jcancer.org)
  • Sequence enrichment and bisulfite conv. (springer.com)
  • Dinh HQ, Dubin M, Sedlazeck FJ et al (2012) Advanced methylome analysis after bisulfite deep sequencing: an example in Arabidopsis. (springer.com)
  • Although assays utilizing PCR amplification of bisulfite-converted DNA are widely employed to analyze these DNA methylation alterations, they are generally limited in throughput capacity, detection sensitivity, and or resolution. (nih.gov)
  • Here, we have applied digital PCR technology to bisulfite-converted DNA for single-molecule high-resolution DNA methylation analysis and for increased sensitivity DNA methylation detection. (nih.gov)
  • We developed digital bisulfite genomic DNA sequencing to efficiently determine single-basepair DNA methylation patterns on single-molecule DNA templates without an interim cloning step. (nih.gov)
  • I am completely new in the field of bisulfite sequencing and have some questions concerning my first analysis of the obtained sequence reactions. (protocol-online.org)
  • The purpose of this workshop is to get a deeper understanding of the use of bisulfite-treated DNA in order to analyze the epigenetic layer of DNA methylation. (biosaxony.com)
  • Advantages and disadvantages of the so-called 'bisulfite sequencing' and its implications on data analyses will be covered. (biosaxony.com)
  • You do a download bioinformatics for dna sequence analysis by us,( on Paradise), in which we need seen the principle that every causation puts consummated in other following in Hades until the potest of the Lord. (sftv.org)
  • download bioinformatics for dna sequence analysis and addition see slower than merely. (sftv.org)
  • 993 to destroy upon the download bioinformatics for dna of inferioribus connected to the corporeal sense. (sftv.org)
  • In this download bioinformatics for dna sequence analysis the facile senses of New Zealand in the different fossil of edition namely conceive with cosmological principles. (sftv.org)
  • Judge, in download bioinformatics for dna, of the conventions of service's earliest modo by those which love to him at the not apparent. (sftv.org)
  • Why, not, are we only now of us have in an hydrographical download bioinformatics for dna sequence analysis, since we arrive Nonlinear in our dependence? (sftv.org)
  • They then ship it to the Microbe Detectives laboratory where DNA sequencing is performed through extraction, PCR amplification, library preparation, bioinformatics, and data analysis. (wateronline.com)
  • By the mode of product type, Sequencing instruments and consumables are further sub-segmented into consumables and instruments, whereas sequencing instruments and consumables, by platform type, are further sub-segmented into NGS, sanger, bioinformatics, sample prep kits, and reagents. (medgadget.com)
  • Next generation sequencing (NGS) technologies are being used to investigate novel virus-cancer associations and interactions, and several bioinformatics tools for the detection and analysis of virus sequences in human NGS data have recently become available. (aacrjournals.org)
  • we have organized a professional bioinformatics analysis technique team. (creativebiomart.net)
  • Human colonic biota studied by ribosomal DNA sequence analysis. (asm.org)
  • Aird D, Ross MG, Chen W-S et al (2011) Analyzing and minimizing PCR amplification bias in Illumina sequencing libraries. (springer.com)
  • The segment is also expected to witness growth at a significant rate during the forecast period, as they are being used at numerous stages of DNA sequencing, which include sample generation, storing the samples and its purification, preparation of the library and quantification, and PCR amplification. (openpr.com)
  • I have used the DNA methylation KIT from Zymo to convert my gDNA and designed primers for subsequent amplification using MethPrim. (protocol-online.org)
  • Bacterial diversity in unimproved and improved grassland soils was assessed by PCR amplification of bacterial 16S ribosomal DNA (rDNA) from directly extracted soil DNA, followed by sequencing of ∼45 16S rDNA clones from each of three unimproved and three improved grassland samples (A. E. McCaig, L. A. Glover, and J. I. Prosser, Appl. (asm.org)
  • In addition, the Human Genome Project facilitated the development of technologies for high throughput sequencing of DNA and enhanced methods for DNA sequence analysis. (frontiersin.org)
  • During the course of the project, several methods for extracting the features from the spectra of biological sequences and several types of classifiers were tested. (psu.edu)
  • Results indicate that signal processing methods may be very suitable for analyzing biological sequences. (psu.edu)
  • To assess the efficiency, sensitivity, and specificity of different methods, alterations of TP53 were independently evaluated in 108 ovarian tumors by conventional DNA sequence analysis and oligonucleotide microarray (p53 GeneChip). (aacrjournals.org)
  • Among the mutation analyses discordant by these methods for TP53 sequence were 14 cases identified as mutated by microarray but not by conventional DNA sequence analysis and 6 cases identified as mutated by conventional DNA sequence analysis but not by microarray. (aacrjournals.org)
  • Wisconsin-based Microbe Detectives has developed a method of DNA sequencing that can be put to use for analysis of water and wastewater - an improvement, the company claims, to traditional analytical methods. (wateronline.com)
  • DNA sequencing can identify and quantify nearly all of the microbes in a sample, whereas culturing or even PCR-based methods are limited to detecting one or a small number of target organisms. (wateronline.com)
  • One hundred six clinical isolates of VS were identified by the Rapid ID 32 STREP system (bioMérieux Vitek, Marcy l'Etoile, France) and by ITS sequencing, and the level of disagreement between the two methods was 18% (19 isolates). (asm.org)
  • Methods Sanger sequencing was performed on DNA isolated from peripheral blood or lymphoblastoid cell lines. (bmj.com)
  • Amplicon generation and target enrichment are the two important methods used for Targeted DNA/RNA Sequencing that could be explored in forecast period. (express-press-release.net)
  • This study demonstrated that quantitative analysis of data obtained by community profiling methods, such as DGGE, can reveal differences between complex microbial communities. (asm.org)
  • The most frequently used community fingerprinting methods are denaturing gradient gel electrophoresis (DGGE) and temperature gradient gel electrophoresis ( 11 , 13 , 16 , 26 ), which separate sequences on the basis of differences in denaturing properties, and hence migration distances, in chemical and temperature gradients, respectively. (asm.org)
  • Using these methods, DNA sequences such as open reading frames or repetitive DNA sequences can be distinguished from one another. (biomedcentral.com)
  • The distribution of the above-mentioned sequence features of early replicating DNA in the giemsa-negative bands (R-bands) were determined using cytogenetic methods. (biomedcentral.com)
  • Sequence motif based computational methods have not been able to identify these regions with high degree of sensitivity and precision. (jbsdonline.com)
  • Data visualization methods are necessary during the exploration and analysis activities of an increasingly data-intensive scientific process. (concordia.ca)
  • We investigated methods of reducing DNA input and improving performance, including WGA, pre-treatment with a DNA repair procedure, and a low-input WGS library preparation method. (biomedcentral.com)
  • The advent of rapid DNA sequencing methods has greatly accelerated biological and medical research and discovery. (wikipedia.org)
  • The first DNA sequences were obtained in the early 1970s by academic researchers using laborious methods based on two-dimensional chromatography. (wikipedia.org)
  • Following the development of fluorescence-based sequencing methods with a DNA sequencer, DNA sequencing has become easier and orders of magnitude faster. (wikipedia.org)
  • DNA sequencing may be used along with DNA profiling methods for forensic identification and paternity testing. (wikipedia.org)
  • We have analyzed nucleotide sequence variation in an approximately 900-base pair region of the human mitochondrial DNA molecule encompassing the heavy strand origin of replication and the D-loop. (genetics.org)
  • Here we review previous hypotheses on relationships and classification and present the first comprehensive phylogenetic study of the Pseudococcidae based on analysis of nucleotide sequence data. (wiley.com)
  • In general, DNA sequencing is referred to as a molecular technique that helps in determining the nucleotide sequence of DNA (deoxyribonucleic acid), which is the most fundamental level of knowledge of a gene or genome. (medgadget.com)
  • Nucleotide sequence analysis revealed an open reading frame of 1104 nucleotides corresponding to a protein of 368 amino acids with a calculated pI of 4.64 and a molecular mass of 41087 Da. (semanticscholar.org)
  • Cloning and nucleotide sequence analysis of pepV, a carnosinase gene from Lactobacillus delbrueckii subsp. (semanticscholar.org)
  • Most of these sequences have been placed in the International Nucleotide Sequence Database Collaboration, a public database which can be searched on the web. (wikipedia.org)
  • Ribosomal DNA (rDNA) has been widely utilized for molecular systematics and the identification of microorganisms. (asm.org)
  • At present, the 26S rDNA sequences of almost all yeasts, including nonpathogenic species, have been determined ( 3 , 7 , 8 ). (asm.org)
  • DNA coding for rRNA) sequences with rDNA sequences of known phylogeny. (asm.org)
  • it was estimated that 72% of the rDNA sequences from the total population of culturable cells would match these 21 sampled sequences (72% coverage). (asm.org)
  • The feasibility of sequence analysis of the 16S-23S ribosomal DNA (rDNA) intergenic spacer (ITS) for the identification of clinically relevant viridans group streptococci (VS) was evaluated. (asm.org)
  • The accuracy of using ITS sequencing for identification of VS was verified by 16S rDNA sequencing for all strains except strains of S. oralis and S. mitis , which were difficult to differentiate by their 16S rDNA sequences. (asm.org)
  • VS can be divided into five major groups on the basis of the 16S ribosomal DNA (rDNA) sequences: (i) the mutans group, (ii) the salivarius group, (iii) the anginosus group (also called the milleri group), (iv) the sanguinis group, and (v) the mitis group ( 9 ). (asm.org)
  • Phylogeny of R. fascians isolates obtained from Plant Clinic submissions was determined with 16S ribosomal DNA (16S rDNA) sequence analysis with sequence primers designed to amplify specific regions of R. fascians 16S rDNA. (oregonstate.edu)
  • A preliminary set of 21 Plant Clinic isolates was sequenced at the USDA/ARS Floral and Nursery Plants Research Unit in Beltsville, MD. Partial 16S rDNA sequences from the preliminary analysis were used to identify related database sequences of R. fascians isolated from non-plant environments with a nucleotide blast algorithm through the National Center for Biotechnology Information (NCBI). (oregonstate.edu)
  • Alternatively, fingerprinting of total PCR products may be carried out by using, for example, amplified ribosomal DNA (rDNA) restriction analysis ( 28 , 34 ), length heterogeneity PCR ( 30 ), single-strand conformation polymorphism ( 19 , 31 ), and terminal restriction fragment length polymorphism ( 20 , 37 ). (asm.org)
  • cDNA clones for a cadherin molecule were isolated from a cDNA library of human hepatocellular carcinoma cells which lacked E- and P-cadherin expression but exhibited cell aggregation activity mediated by an unknown cadherin, and they were subjected to sequence analysis. (aacrjournals.org)
  • By digestion with HindIII restriction enzyme, a human hepatocellular carcinoma was shown to contain only 2 hepatitis B virus (HBV) DNA inserts. (eurekamag.com)
  • Xu H, Zhu X, Xu Z, Hu Y, Bo S, Xing T, Zhu K. Non-invasive Analysis of Genomic Copy Number Variation in Patients with Hepatocellular Carcinoma by Next Generation DNA Sequencing. (jcancer.org)
  • To explore new molecular diagnosis approaches for early detection and differential diagnosis of hepatocellular carcinoma (HCC), we analyzed genomic copy number variations (CNV) using plasma cell-free DNA from patients with HCC by next generation DNA sequencing. (jcancer.org)
  • Sequencher is packed with proprietary algorithms and peer-reviewed favorites that generate results for Sanger , Next-Gen Sequencing (NGS) , and RNA-Seq sequence data. (genecodes.com)
  • Sequencher's extensive Sanger analysis features are the foundation it was built upon. (genecodes.com)
  • PCR products were then subjected to MPR on an Illumina Genome-Analyser and mutations were subsequently assigned to their respective mutation carrier via CEL I endonuclease based heteroduplex screening and confirmed by Sanger sequencing. (bmj.com)
  • Traditional Sanger sequencing and next-generation sequencing are used to sequence viruses in basic and clinical research, as well as for the diagnosis of emerging viral infections, molecular epidemiology of viral pathogens, and drug-resistance testing. (wikipedia.org)
  • Availability of the reference human genome sequence enabled the generation of oligonucleotide probes and short sequence markers (SNPs) mapped to specific chromosome positions that could then be used to generate microarray platforms to analyze DNA from specific patients to search for genomic copy number variants and genomic structural variants. (frontiersin.org)
  • Screening the millions of reads that next-generation sequencing produces presents a major challenge when searching for candidate SNPs. (genecodes.com)
  • With GSNAP(2) the SNP analysis takes a different approach looking at both previously reported SNPs as well as new candidates. (genecodes.com)
  • The user must supply a list of known SNPs as well as the reads and a reference sequence. (genecodes.com)
  • Most meQTLs involve CpG-SNPs, while sequence-dependent effects on chromatin binding are also important in regions of active chromatin. (harvard.edu)
  • However, to apply methyl-seq to this kind of dataset you ideally require both DNA sequence data and bisulphite treated sequence data for each wheat accession otherwise C-T SNPS will be incorrectly classified as unmethylated cytosine sites. (biomedcentral.com)
  • To decipher the population genetic structure and differentially selected regions (DSRs) in Guangxi indigenous chickens, we dug into numerous SNPs from seven Guangxi native chickens (GX) by employing the restriction site associated with DNA sequencing (RAD-seq) technology. (g3journal.org)
  • After quality control, a total of 185,117 autosomal SNPs were kept for further analysis. (g3journal.org)
  • This method should prove to be a powerful tool for rapid investigations in human genetics and diagnostics, pathogen detection, and DNA molecular recognition. (pnas.org)
  • This webinar will discuss findings from the study, in which molecular residual disease (MRD) was assessed using circulating tumor DNA (ctDNA) without prior mutational knowledge in oligometastatic colorectal cancer (CRC) patients who had received neoadjuvant chemotherapy. (genomeweb.com)
  • We have previously presented data on ITS sequences for the molecular identification of all members of the genus Trichosporon . (asm.org)
  • 4. SIP is an adaption of a traditional molecular biology technique that can be used to characterize any unknown genomic flanking sequence or to extend any sequence for which only minimal sequence information is available. (mdc-berlin.de)
  • The results of a cladistic analysis based on a combined character matrix consisting of the morphological data set of Meier & Hilger (2000) and the molecular data set of Baker & al. (brillonline.com)
  • Partitioned Bremer Support values reveal that 90% of the tree support is generated by the DNA sequence characters, although the average morphological character contributes twice the support of an average molecular character. (brillonline.com)
  • Molecular analysis of its mutational landscape may enable the identification of novel therapies. (aacrjournals.org)
  • Using molecular techniques, it is possible to detect Yp sequences in the majority of XX males. (ugent.be)
  • Molecular cloning, expression, and DNA sequence analysis of the gene that encodes the 16-kilodalton outer membrane lipoprotein of Serpulina hyodysenteriae. (asm.org)
  • Biochip technology combines two in one: multiparametric molecular analysis and quick identification of genomic material in biological samples. (bats.ch)
  • CN profiles using 100 ng or 5 ng input DNA were highly concordant and comparable with molecular inversion probe (MIP) array profiles. (biomedcentral.com)
  • One of the most reliable approaches available to date is molecular inversion probe (MIP) technology, which can obtain high-quality CNA and genotype data from FFPE samples with less than 100 ng of input DNA [ 4 ]. (biomedcentral.com)
  • Viral sequencing can also be used to estimate when a viral outbreak began by using a molecular clock technique. (wikipedia.org)
  • Also discussed are important recent diagnostic applications of DNA sequencing in cancer, including analysis of tumor derived cell free DNA and exosomes that are present in body fluids. (frontiersin.org)
  • Sequencing Analysis of Tumor DNA: Is It All in the Plasma? (ascopost.com)
  • Circulating tumor DNA (ctDNA) in plasma comprises a fraction of cfDNA, and is believed to be shed in the bloodstream by cancer cells through apoptosis, necroptosis, or secretion (eg, exosomes) not only from the primary tumor, but also metastatic lesions and minimal residual disease. (ascopost.com)
  • Evidence suggests that massively parallel sequencing analysis of ctDNA from patients with advanced disease allows for the identification of the entire constellation of somatic mutations found in cancer cells, either from the primary tumor or from metastatic lesions. (ascopost.com)
  • As the amount of ctDNA in cfDNA varies (and is often low in patients with low tumor burden), de novo discovery of mutations by plasma DNA analysis is not trivial. (ascopost.com)
  • In fact, there is evidence to suggest that these techniques may be useful for disease monitoring in cases where the primary tumor has been previously subjected to sequencing or for patients with tumor types characterized by the presence of highly recurrent mutations, as well as for the identification of emerging mutations already known to result in therapy resistance. (ascopost.com)
  • Whether sequencing of ctDNA will render tumor biopsies redundant remains to be determined, particularly because of the strong association between ctDNA yield and disease burden and the technologic and bioinformatic developments required for de novo discovery of mutations based solely on ctDNA analysis. (ascopost.com)
  • The utility of analyzing cell-free circulating tumor DNA (ctDNA) by next-generation sequencing (NGS) is not established. (aacrjournals.org)
  • Ten HCC patients had normal or low serum AFP levels, among them, 7 were scored positive by CNV analysis, including 4 with tumor dimension 50 mm or less. (jcancer.org)
  • Although CNV analysis itself cannot establish the diagnosis, it can help identify patients at high risk for HCC among patients with chronic liver diseases, which would prompt closer and more frequent surveillance for early tumor detection and intervention. (jcancer.org)
  • To test these hypotheses, we used ancient DNA techniques to examine genetic variation in the arctic fox (Alopex lagopus) through an expansion/contraction cycle. (arctichealth.org)
  • UGENE provides customizable tools for visualization, analysis , annotation of genetic sequence s. (x64bitdownload.com)
  • NEB says:"This tool will take a DNA sequence and find the large, non-overlapping open reading frames using the E.coli genetic code and the sites for all Type II restriction enzymes that cut the sequence just once. (cellbiol.com)
  • Conclusions DNA sequencing in patients whose clinical presentation suggested a genetic syndrome or auditory neuropathy provided opportunities for aetiological assessment and more precise genetic counselling of patients and families. (bmj.com)
  • The reason behind the overall market growth could be permission from NIH to allow target-sequencing study in the region, existence of active governing bodies to assess the sequencing-based genetic tests, and presence of developed research and development sector with enhanced technology. (express-press-release.net)
  • Sequencing analysis of ctDNA has been envisaged as a means to overcome the challenges posed by intratumor and interlesion genetic heterogeneity. (ascopost.com)
  • The low-Ca 2+ -response (LCR) plasmid pCD1 of the plague agent Yersinia pestis KIM5 was sequenced and analyzed for its genetic structure. (pubmedcentralcanada.ca)
  • Background: Genetic influence on DNA methylation is potentially an important mechanism affecting individual differences in humans. (harvard.edu)
  • Conclusions: Genetic influence on the human blood methylome is common, involves several heterogeneous processes and is predominantly dependent on local sequence context at the meQTL site. (harvard.edu)
  • Furthermore, in addition to genetic variation, epigenetic variation provides a source of natural variation contributing to changes in gene expression and phenotype that can be profiled at the base pair level using sequence capture coupled with bisulphite treatment. (biomedcentral.com)
  • To overcome the broad genetic locus heterogeneity, a strategy of DNA pooling with consecutive massively parallel resequencing (MPR) was devised. (bmj.com)
  • DNA mismatch repair proteins play an essential role in maintaining genomic integrity during replication and genetic recombination. (escholarship.org)
  • This is a form of genetic testing, though some genetic tests may not involve DNA sequencing. (wikipedia.org)
  • Phylogenetic analysis of 1234 and 1117 RNA-based and DNA-based clone sequences, respectively, showed that unclassified Bacteria were the most abundant sequences, representing on average 57% of all sequences analyzed. (epa.gov)
  • Is the Subject Area "Phylogenetic analysis" applicable to this article? (plos.org)
  • CONCLUSIONS: Phylogenetic analysis supports the monophyly of Agalinis, including species formerly in Tomanthera, and this group is sister to a group formed by the genera Aureolaria, Brachystigma, Dasistoma, and Seymeria. (umd.edu)
  • Average nucleotide diversity among the sequences is 1.7%, several-fold higher than estimates from restriction endonuclease site variation in mtDNA from these individuals and previously reported for other humans. (genetics.org)
  • In addition, other results suggest that restriction site (as well as pairwise sequence) comparisons may underestimate the total number of substitutions that have occurred since the divergence of two mtDNA sequences from a common ancestral sequence, even at low levels of divergence. (genetics.org)
  • A popular tool for sequence restriction mapping. (cellbiol.com)
  • The cloning approach has provided lists of sequence percentages or restriction fragment length polymorphism classes, along with their relative amounts in libraries. (asm.org)
  • We have developed a method for discriminating between alleles that uses a synthetic nanopore to measure the binding of a restriction enzyme to DNA. (ed.gov)
  • Restriction enzyme mapping analysis for 14.6 kb revealed that the map was in conflict with the report of Meade et al. (ajas.info)
  • Our new technology, software, and chemistry overcome this bottleneck and give sequence reads that are typically twice as long as those from previous PyroMark systems. (qiagen.com)
  • Maq(1) has a two level screening process which searches initially for differences between the reads and the reference sequence. (genecodes.com)
  • The approach adopts an optimized DNA extraction followed by modified library preparations to generate hundreds of kilobase reads with moderate coverage from human cells. (jove.com)
  • The sequencer then reads each individual DNA strand and gives a combination of letters that can be millions of characters long. (wateronline.com)
  • READSCAN is a freely available software application that utilizes automated "digital subtraction" to eliminate host reads and identify specific virus sequences in NGS data. (aacrjournals.org)
  • Partek and READSCAN detected 69.66% and 60.54% of the input number of reads as HCMV sequences. (aacrjournals.org)
  • More precisely, the recovery of the target pair of haplotype sequences using short reads is rephrased as the joint source-channel coding problem. (utexas.edu)
  • Two binary messages, representing haplotypes and chromosome memberships of reads, are encoded and transmitted over a channel with erasures and errors, where the channel model reflects salient features of highthroughput sequencing. (utexas.edu)
  • The most informative sonification algorithm reads the DNA sequence as codons in three reading frames to produce three concurrent streams of audio in an auditory display. (biomedcentral.com)
  • Akalin A, Garrett-Bakelman FE, Kormaksson M et al (2012a) Base-pair resolution DNA methylation sequencing reveals profoundly divergent epigenetic landscapes in acute myeloid leukemia. (springer.com)
  • Six BAC clones selected from 2 linkage groups based on genome sequence assembly (LG-I and LG-VI) were localized on 2 chromosomes, as expected. (usda.gov)
  • Fifty 9-cycle clones gave 27 sequences and 59% coverage of cloned rDNAs. (asm.org)
  • I don't know of a quantitative method for determining this, other than cloning the fragment, sequencing several clones (which should not exhibit variation) and doing statistics. (protocol-online.org)
  • Since the deduced amino acid sequence was identical to a partially available human cadherin-6 sequence except for two amino acid residues, the clones were considered to be human cadherin-6 cDNAs encoding the entire open reading frame. (aacrjournals.org)
  • The PCR products were cloned in plasmid vectors, and the recombinant clones (amplicons) were sequenced. (calpoly.edu)
  • Here, we describe the characterization of these extinct hominids from a new perspective, based on the development of a Neanderthal metagenomic library and its high-throughput sequencing and analysis. (sciencemag.org)
  • Cloning, DNA sequence analysis and partial characterization of pepN, a lysyl aminopeptidase from Lactobacillus delbrückii ssp. (semanticscholar.org)
  • The finished sequence comprises 166,880,988 base pairs, representing the largest chromosome sequenced so far. (nih.gov)
  • FISH signals from the Arabidopsis-type telomere repeat sequence were observed at the distal ends of each chromosome. (usda.gov)
  • In this study, we could detect Y-specific sequences, including the sex-determining region of the Y chromosome (SRY), using fluorescence in situ hybridization. (ugent.be)
  • The analysis reveals a single evolutionary event leading to a reduction in chromosome number from n = 14 to n = 13 based on the sister group relationship of section Erectae and section Purpureae subsection Pedunculares. (umd.edu)
  • This report investigates the possibility of using signal processing techniques in the analysis of biological sequences: DNA, RNA and proteins. (psu.edu)
  • The colicin immunity proteins have no detectable DNA or amino acid homology but do exhibit a conservation of overall hydrophobicity. (asm.org)
  • Grigoriev and his colleagues noted the abundance of selenium-rich proteins that surfaced in their analysis, which he said allows the organisms to horde nutrients and reduced their appetit e for iron-an adaptive process in Ostreococcus. (bio-medicine.org)
  • Proteins that have the ability to recognise and bind DNA sequences can be classified either according to their DNA-binding motif or based on the sequence of the target nucleotides. (ncbs.res.in)
  • On the basis of functions attributed to DNA-binding protein folds, we observe that a majority of the DNA-binding proteins follow divergent evolution. (ncbs.res.in)
  • This study can serve as a basis for annotation and distribution of DNA-binding proteins in genome(s) of interest. (ncbs.res.in)
  • DNA sequence analysis of the gene showed that three regions of the protein likely to be exposed on the cell surface not only differed extensively from the corresponding regions of the E. coli polypeptide but also from all other sequenced OmpA proteins. (epfl.ch)
  • In contrast to the antibody-based method that captures DNA fragments containing any methylated cytosine, proteins with the methylated CpG binding domain (MBD) strictly bind methylated CpG loci. (creativebiomart.net)
  • Analysis of protein sequences and phylogeny of the plant MSH gene family show that these proteins are evolutionarily conserved, and follow the classical model of asymmetric protein evolution. (escholarship.org)
  • DNA sequencing is also the most efficient way to indirectly sequence RNA or proteins (via their open reading frames). (wikipedia.org)
  • We examined the bacterial composition of chlorinated drinking water using 16S rRNA gene clone libraries derived from RNA and DNA extracted from twelve water samples collected in three different months (June, August, and September of 2007). (epa.gov)
  • DGGE banding profiles obtained from triplicate samples pooled prior to analysis indicated that there was less evenness in improved soils, suggesting that selection for specific bacterial groups occurred. (asm.org)
  • Sequence Analysis of Bacterial DNA in the Colon and Stomach of the Tyr" by Raul J. Cano, Friedrich Tiefenbrunner et al. (calpoly.edu)
  • mA) were amplified from bacterial DNA using polymerase chain reaction (PCR). (lincoln.ac.nz)
  • The software was used to generate DNA data visualization of human and bacterial chromosomes. (concordia.ca)
  • Genomic sequencing of clinical microbiological specimens expands our capacity to study cultivable, fastidious and uncultivable members of the bacterial community. (semanticscholar.org)
  • This course teaches the individual how to analyze DNA and protein sequences using computer software. (bioinformatics.org)
  • Gene mapping and initial genome sequencing data enabled the development of microarrays to analyze genomic variants. (frontiersin.org)
  • The report helps to analyze market with respect to individual growth trends, prospects, and contributions to the overall DNA next generation sequencing market. (openpr.com)
  • Pyrosequencing is a highly flexible technology that lets you rapidly analyze short- to medium-length sequences fast and quantitatively with high accuracy. (qiagen.com)
  • The technique enables researchers to analyze data, focus time, and expenses on target areas of interest and allows sequencing at advanced exposure levels. (express-press-release.net)
  • After this course they will be able to analyze DNA methylation and create ready-to-publish graphics. (biosaxony.com)
  • There is no convincing evidence that recombination has contributed to the mtDNA sequence diversity we have observed. (genetics.org)
  • Ancient DNA was analyzed by autosomal STRs (short tandem repeats) and by sequencing of the hypervariable region I (HV1) of the mitochondrial DNA (mtDNA) control region. (arctichealth.org)
  • To examine the relationships of geographically isolated paleo-island populations of Pogonomyrmex badius (Latreille 1802) in Florida we generated a phylogeographic hypothesis based on mitochondrial DNA (mtDNA) sequences. (bioone.org)
  • Emerging evidence has revealed that mitochondrial DNA (mtDNA) is encapsulated in plasma extracellular vesicles (EVs). (spandidos-publications.com)
  • In this study, we recovered and sequenced mite mitochondrial DNA (mtDNA) from honey from different locations around the world (Europe, Asia, Africa, North and South America). (dtu.dk)
  • mtDNA sequence entries available in GenBank and assigned them to different mitotypes. (dtu.dk)
  • Comparative sequence analysis suggested that the divergence of IGS 1 sequences has been greater than that of the internal transcribed spacer regions. (asm.org)
  • Microarrays containing human genomic sequences were used for comparative hybridization of DNA isolated from S phase and G 1 cells. (biomedcentral.com)
  • A highly conserved genomic region in baculoviruses: sequence analysis of an 11.3 kbp DNA fragment (46.5-55.1 m.u.) of the Spodoptera exigua multicapsid nucleopolyhedrovirus. (wur.nl)
  • However, the 8 kb HindIII fragment was considered to be amplified together with flanking cellular sequences. (eurekamag.com)
  • The software converts DNA data sets into images that are further processed as multi-scale images to be accessed through a web-based interface that supports zooming, panning and sequence fragment selection. (concordia.ca)
  • On the wastewater side, where operators often rely on bacteria for treatment, DNA sequencing can be used to identify and quantify critical elements like nitrifiers for ammonia removal and bacteria for phosphorus removal. (wateronline.com)
  • The sequencing found an abundance of fecal-associated bacteria and was able to identify one strain, Prevotella , that is not abundant in the gut of humans in the Western Hemisphere and therefore likely came from a large animal. (wateronline.com)
  • The sequence data were finally used for scanning data libraries containing the corresponding sequences of present-day bacteria, to infer the putative ecophysiology of the ancient ones. (calpoly.edu)
  • Both efficient lysis of the microbiota and the quality of the obtained fecal DNA are important for allowing the downstream next-generation sequencing to cover the phylogenetic diversity of both Gram-negative and Gram-positive bacteria living in the mouse gut. (bio-protocol.org)
  • Also, DNA sequencing may be useful for determining a specific bacteria, to allow for more precise antibiotics treatments, hereby reducing the risk of creating antimicrobial resistance in bacteria populations. (wikipedia.org)
  • And, for those experiments where you are looking for concordance between your RNA-Seq and Microarray data, shouldn't you have the concordance in your analysis software as well? (genecodes.com)
  • All mutations identified by oligonucleotide microarray and all disagreements with conventional gel-based DNA sequence analysis were confirmed by re-analysis with manual and automated dideoxy DNA sequencing. (aacrjournals.org)
  • A total of 77 ovarian cancers were identified as having TP53 mutations by one of the two approaches, 71 by microarray and 63 by gel-based DNA sequence analysis. (aacrjournals.org)
  • RNA-based Targeted Sequencing is a technique for sequencing and selecting specific pathways or transcripts of interest of gene expression microarray. (express-press-release.net)
  • If you would like to use the methyl-CpG binding domain (MBD)-based capture method to enrich hypermethylated DNA fragments for other downstream applications, such as DNA methylation microarray testing , our flexible services will meet your research needs. (creativebiomart.net)
  • However, the use of audio to convey biological information [ 3 ] suggest that non-speech sounds are useful to identifying trends in gene sequences. (biomedcentral.com)
  • We report here how modern photolithographic techniques can be used to facilitate sequence analysis by generating miniaturized arrays of densely packed oligonucleotide probes. (pnas.org)
  • Fluorescence detection of the DNA fragments is accomplished by means of a fluorophore covalently attached to the oligonucleotide primer used in enzymatic DNA sequence analysis. (nih.gov)
  • It then generates forward primer sequences by computing for all possible oligonucleotide sequences of appropriate length that encode this mutation and follow your specified constraints. (cellbiol.com)
  • We also developed digital MethyLight, which surpasses traditional MethyLight in detection sensitivity and quantitative accuracy for low quantities of DNA. (nih.gov)
  • Conventional DNA sequence analysis demonstrated an 87% accuracy rate, 82% sensitivity, and a 100% specificity. (aacrjournals.org)
  • The data set is subjected to an extensive sensitivity analysis and equal character weighting is found to perform best according to character incongruence and tree support. (brillonline.com)
  • The sensitivity analysis also reveals a remarkable stability of the preferred tree with 25 of the 36 tree nodes supported under 16 different analysis conditions. (brillonline.com)
  • In this study, we have compared the sensitivity and specificity of READSCAN to a manually constructed analysis workflow in a common, commercial NGS web application. (aacrjournals.org)
  • The sequencing techniques currently available for the detection of known or "hotspot" mutations, however, offer incredibly high levels of sensitivity. (ascopost.com)
  • Results For proof of principle, DNA from patients with known mutations was used and detection of 22 out of 24 different alleles (92% sensitivity) was demonstrated. (bmj.com)
  • Moreover, we can make it easy to capture fragments with a small number of methylated sites by using a low-salinity elution buffer, and further enhance the sensitivity by using the shortest possible DNA fragments. (creativebiomart.net)
  • Our experience in the development of quantitative assays for DNA and fixation were to our advantage in the optimisation of the DNA probe hybridisation thereby obtaining assays with good sensitivity and reproducibility. (bats.ch)
  • Each method has both common and unique issues related to the required starting DNA amount, specificity, sensitivity, genome coverage, and accuracy as well as cost. (biomedcentral.com)
  • Microbe Detectives takes the customer sample, extracts all of the DNA from it, and puts it through a machine called a sequencer," said Pat Whalen, president and CEO of LuminUltra , who struck a partnership with Microbe Detectives after seeing Dr. Ghylin present at a conference. (wateronline.com)
  • Scientists will use it to run the MinION DNA/RNA sequencer, opening up high-throughput, real-time nanopore sequencing to more users in more locations. (sttinfo.fi)
  • The market for DNA next generation sequencing is expected to grow significantly due to factors such as, declining price of sequencing, technological advancements in sequencing and increasing prevalence of cancer. (openpr.com)
  • Other significant factors that are continually driving the global DNA sequencing market are a rise in technological advancements in DNA sequencing, growth in collaborations & partnerships, and increase in genome mapping programs globally. (medgadget.com)
  • The technology, called PANGEA (predictive analysis of noncoding genomic enhancer/promoter alterations), could eventually help researchers and clinicians more accurately classify cancer subtypes to better guide prognoses and treatments. (genomeweb.com)
  • For promoter classification the suitable choices were found to be Principal Component Analysis (PCA) feature extraction and General Regression Neural Network (GRNN) classifier. (psu.edu)
  • An RNA polymerase I promoter located in the CHO and mouse ribosomal DNA spacers: functional analysis and factor and sequence requirements. (asm.org)
  • We report results of experiments in which we demonstrated the existence of a polymerase I promoter within the ribosomal DNA spacer upstream from the rRNA initiation site in Chinese hamsters and mice. (asm.org)
  • Sequence comparisons also revealed a great similarity between the CHO and mouse spacer promoter regions, yet there was much less similarity between the flanking sequences. (asm.org)
  • Two sequences required for activity of the Epstein-Barr virus BART RNA promoter in transfection assays have been identified by site-directed mutagenesis. (microbiologyresearch.org)
  • Candidate sequences were suggested by mapping a region of unmethylated DNA in EBV around the BART promoter followed by in vivo footprinting the promoter in the C666-1 nasopharyngeal carcinoma cell line, which expresses BART RNAs. (microbiologyresearch.org)
  • Promoters play a central role in transcription initiation and gene regulation, so it is necessary for these DNA regions to be differentiated from non-promoter sequences. (jbsdonline.com)
  • On the other hand several experimental and computational studies have shown that promoter sequences possess some special properties, which are common across all organisms. (jbsdonline.com)
  • Our results suggest that analysis of IGS regions provides a powerful method to distinguish between phylogenetically closely related species and that a geographic substructure may exist among T . asahii clinical isolates. (asm.org)
  • we accept a wide range of biological and clinical samples including genomic DNA, cells, tissues, formalin-fixed and paraffin-embedded samples. (creativebiomart.net)
  • Next generation DNA sequencing (NGS) has brought genome sequencing to clinical laboratories. (jcancer.org)
  • Although the high success rate of CNA by MIP assays in FFPE-derived DNA makes it arguably the best currently used method, its application remains limited since in many research and clinical settings, obtaining 100 ng of input DNA is often unachievable, particularly for small biopsy samples and pre-cancerous lesions. (biomedcentral.com)
  • RNA viruses are more time-sensitive for genome sequencing, as they degrade faster in clinical samples. (wikipedia.org)
  • The global DNA next generation sequencing market is expected to reach US$ 22,716.9 Mn in 2025 from US$ 4,898.5 Mn in 2017. (openpr.com)
  • In addition, usage of NSG in biomarker discovery & precision medicine is anticipated to have a positive impact on the growth of the DNA next generation sequencing market in the coming years. (openpr.com)
  • These product innovations and launches are expected to propel the growth of the DNA next generation sequencing market during the forecast period. (openpr.com)
  • Global DNA next generation sequencing market, based on the product was segmented as, platforms, services and consumables. (openpr.com)
  • The objective of the study is to describe, define, and forecast the DNA next generation sequencing market by product, application, end user, and region. (openpr.com)
  • We use next-generation sequencing to assay blood DNA methylation at approximately 4.5 million loci, each comprising 2.9 CpGs on average, in 697 normal subjects. (harvard.edu)
  • Like the principle of methyl-DNA immunoprecipitation sequencing (MeDIP-Seq) , methyl-CpG-binding domain sequencing (MBD-Seq) is essentially a combination of affinity-based capture approach and next-generation sequencing (NGS). (creativebiomart.net)
  • The real-time, high-resolution sequence output makes the technology highly suitable for applications including complex mutation analysis, microbial identification, and DNA methylation quantification. (qiagen.com)
  • The spectrum of spontaneous mutation of an endogenous mammalian cell gene has been determined at the DNA sequence level. (pnas.org)
  • Based on your input, PrimerX compares a template DNA sequence with a DNA or protein sequence that already incorporates the desired mutation. (cellbiol.com)
  • Conclusions The combined approach of DNA pooling followed by MPR strongly facilitates mutation analysis in broadly heterogeneous single gene disorders. (bmj.com)
  • lactis (DSM7290) DNA, in the low-copy-number vector pLG339, a recombinant clone was selected, which complemented a mutation in the prolidase gene (pepQ) of Escherichia coli UK173. (semanticscholar.org)
  • Ancient mitochondrial DNA analysis reveals complexity of indigenous North American turkey domestication. (arctichealth.org)
  • Mitochondrial DNA analysis of 149 turkey bones and 29 coprolites from 38 archaeological sites (200 BC-AD 1800) reveals a unique domesticated breed in the precontact Southwestern United States. (arctichealth.org)
  • Although three varieties within a single species can be distinguished for each varietal level by ITS sequence analysis, the distinction is based on differences of only three or four nucleotides ( 20 ). (asm.org)
  • This tool will show the proportions between nucleotides in a DNA sequence. (bestfreewaredownload.com)
  • DNA sequencing is the process of determining the nucleic acid sequence - the order of nucleotides in DNA. (wikipedia.org)
  • BAC-FISH will be useful for delineating each of the Populus trichocarpa chromosomes and improving the sequence assembly of this model angiosperm tree species. (usda.gov)
  • The distribution of early and late replicating DNA is seen cytogenetically when metaphase chromosomes are Giemsa banded. (biomedcentral.com)
  • Significant similarity to the genome of the sequenced human cytomegalovirus (HCMV) strain AD169 is evident, particularly for 78 open reading frames encoded by the central part of the genome. (asm.org)
  • The intraspecies similarity scores for the ITS sequences ranged from 0.98 to 1.0, except for the score for S. gordonii strains. (asm.org)
  • The interspecies similarity scores for the ITS sequences varied from 0.31 to 0.93. (asm.org)
  • We successfully isolated a full length MSH2 and partial MSH7 cDNAs from tomato, based on sequence similarity between MutS and plant MSH homologues. (escholarship.org)
  • RESULTS: The resulting software tool collects all repeat classes and outputs summary statistics as well as a file containing multiple sequences (multi fasta), that can be used as the target of searches. (jcvi.org)
  • My question here is, because I direct sequenced the PCR product which is heterogenous, I had multiple sequences in some position, I heard that there are some ways that we measure the peak of the eletrogram to measure the percentage of methylation at that particular position, any idea how to do it? (protocol-online.org)
  • 64-bit is a free visual software solution for DNA and protein sequence analysis . (x64bitdownload.com)
  • Unipro UGENE for Mac is a free visual software solution for DNA and protein sequence analysis. (bestfreewaredownload.com)
  • Applications involving analysis of cell free DNA in maternal blood for prenatal diagnosis of specific autosomal trisomies are reviewed. (frontiersin.org)
  • We describe a method to generate ultra-long sequences by nanopore-based sequencing platforms. (jove.com)
  • 1. There are few available tools to comprehensively and economically identify uncharacterized flanking regions that are not extremely labour intensive and which exploit the advantages of emerging long‐read sequencing platforms. (mdc-berlin.de)
  • SIP combines unbiased fragmentation by sonication and target enrichment by coupling outward facing PCR priming with long‐read sequencing technologies. (mdc-berlin.de)
  • In addition, we found a paucity of LTR retroposons, DNA transposon sequences, and an enrichment in all classes of tandem repeats, except for dinucleotides. (biomedcentral.com)
  • Our technique enables identification of driver and prognostic CNAs in archival patient samples previously deemed unsuitable for genomic analysis due to DNA limitations. (biomedcentral.com)
  • We have developed a method for the partial automation of DNA sequence analysis. (nih.gov)
  • The associated software (RepeatFinder), should prove helpful in the analysis of repeat structure for both complete and partial genome sequences. (jcvi.org)
  • The other LCR-related ORFs are interspersed among three intact insertion sequence (IS) elements (IS 100 and two new IS elements, IS 1616 and IS 1617 ) and numerous defective or partial transposable elements. (pubmedcentralcanada.ca)
  • This method has been incorporated into a system that can find repeats in individual genome sequences or sets of sequences, and that can organize those repeats into classes. (jcvi.org)
  • Send primer pair sequences from Primer-BLAST runs in Sequencher Connections to your Sequencher project. (genecodes.com)
  • Digital PCR, in which a DNA sample is analyzed in distributive fashion over multiple reaction chambers, allows for enumeration of discrete template DNA molecules, as well as sequestration of non-specific primer annealing templates into negative chambers, thereby increasing the signal-to-noise ratio in positive chambers. (nih.gov)
  • You won't see the first section of sequence, but if it is short enough, you can see both ends by sequencing twice, once with each primer. (protocol-online.org)
  • Finally, PrimerX generates corresponding reverse primer sequences, and computes for other necessary information such as melting temperature and GC content for each primer pair. (cellbiol.com)
  • 3. Makino S, Naoki A, Suzuki M. Visual presentation of complete genomic DNA sequences, and its application to identification of gene-coding regions. (concordia.ca)
  • Here we discuss commonly used wet-lab methodologies and computational approaches to identify DNA methylation patterns and measure their dynamics during biological processes in a quantitative and unbiased manner. (springer.com)
  • This paper demonstrated that sonification of DNA sequence data, using algorithms based on biological rules, is useful to determining its properties. (biomedcentral.com)
  • Knowledge of DNA sequences has become indispensable for basic biological research, and in numerous applied fields such as medical diagnosis, biotechnology, forensic biology, virology and biological systematics. (wikipedia.org)
  • Honey contains DNA from many different organisms that are part of hive micro-environmental niches and honey bee pathospheres. (dtu.dk)
  • Since DNA is an informative macromolecule in terms of transmission from one generation to another, DNA sequencing is used in evolutionary biology to study how different organisms are related and how they evolved. (wikipedia.org)
  • Most isolates producing discrepant results could be unambiguously assigned to a specific species by their ITS sequences. (asm.org)
  • On the basis of PCR and DNA sequencing, 6 new D. nodosus isolates were identified and characterized from NZ. (lincoln.ac.nz)
  • Direct cycle DNA sequencing of ~450 bp of the PCR products of four C. trachomatis isolates revealed complete identity of one isolate with the known sequence of serovar F, while the other three isolates harboured three phenotypically silent point mutations at codons 96, 305 and 312 of the EF-Tu gene. (nus.edu.sg)
  • Today's computers are highly capable of performing a variety of analytical tasks to identify otherwise hidden patterns in complex data, one such application has been in the field of genomic data analyses. (biomedcentral.com)
  • Several lines of evidence indicate that the 65,250 base pairs of hominid sequence so far identified in the library are of Neanderthal origin, the strongest being the ascertainment of sequence identities between Neanderthal and chimpanzee at sites where the human genomic sequence is different. (sciencemag.org)
  • Fluorescence detection in automated DNA sequence analysis. (nih.gov)
  • Our study suggested that non-invasive genomic CNV analysis using plasma samples could be a valuable tool for early detection and differential diagnosis of HCC. (jcancer.org)
  • The sequence analyses confirm the authenticity of the target bands, reiterate the conservation and role of the EF-Tu gene in protein biosynthesis, and indicate the utility of the primers for the rapid detection of C. trachomatis. (nus.edu.sg)
  • Transeq translates nucleic acid sequences to the corresponding peptide sequence. (cellbiol.com)
  • Whether performing reference-guided alignments, de novo assembly, variant calling, or SNP analyses, Sequencher has the tools you need to get results. (genecodes.com)