Elongated, spindle-shaped, quiescent myoblasts lying in close contact with adult skeletal muscle. They are thought to play a role in muscle repair and regeneration.
A subtype of striated muscle, attached by TENDONS to the SKELETON. Skeletal muscles are innervated and their movement can be consciously controlled. They are also called voluntary muscles.
Large, multinucleate single cells, either cylindrical or prismatic in shape, that form the basic unit of SKELETAL MUSCLE. They consist of MYOFIBRILS enclosed within and attached to the SARCOLEMMA. They are derived from the fusion of skeletal myoblasts (MYOBLASTS, SKELETAL) into a syncytium, followed by differentiation.
Highly repetitive DNA sequences found in HETEROCHROMATIN, mainly near centromeres. They are composed of simple sequences (very short) (see MINISATELLITE REPEATS) repeated in tandem many times to form large blocks of sequence. Additionally, following the accumulation of mutations, these blocks of repeats have been repeated in tandem themselves. The degree of repetition is on the order of 1000 to 10 million at each locus. Loci are few, usually one or two per chromosome. They were called satellites since in density gradients, they often sediment as distinct, satellite bands separate from the bulk of genomic DNA owing to a distinct BASE COMPOSITION.
A paired box transcription factor that is involved in EMBRYONIC DEVELOPMENT of the CENTRAL NERVOUS SYSTEM and SKELETAL MUSCLE.
Contractile tissue that produces movement in animals.
Developmental events leading to the formation of adult muscular system, which includes differentiation of the various types of muscle cell precursors, migration of myoblasts, activation of myogenesis and development of muscle anchorage.
The non-neuronal cells that surround the neuronal cell bodies of the GANGLIA. They are distinguished from the perineuronal satellite oligodendrocytes (OLIGODENDROGLIA) found in the central nervous system.
The protein constituents of muscle, the major ones being ACTINS and MYOSINS. More than a dozen accessory proteins exist including TROPONIN; TROPOMYOSIN; and DYSTROPHIN.
The physiological renewal, repair, or replacement of tissue.
Small, linear single-stranded RNA molecules functionally acting as molecular parasites of certain RNA plant viruses. Satellite RNAs exhibit four characteristic traits: (1) they require helper viruses to replicate; (2) they are unnecessary for the replication of helper viruses; (3) they are encapsidated in the coat protein of the helper virus; (4) they have no extensive sequence homology to the helper virus. Thus they differ from SATELLITE VIRUSES which encode their own coat protein, and from the genomic RNA; (=RNA, VIRAL); of satellite viruses. (From Maramorosch, Viroids and Satellites, 1991, p143)
A myogenic regulatory factor that controls myogenesis. Though it is not clear how its function differs from the other myogenic regulatory factors, MyoD appears to be related to fusion and terminal differentiation of the muscle cell.
Embryonic (precursor) cells of the myogenic lineage that develop from the MESODERM. They undergo proliferation, migrate to their various sites, and then differentiate into the appropriate form of myocytes (MYOCYTES, SKELETAL; MYOCYTES, CARDIAC; MYOCYTES, SMOOTH MUSCLE).
A process leading to shortening and/or development of tension in muscle tissue. Muscle contraction occurs by a sliding filament mechanism whereby actin filaments slide inward among the myosin filaments.
Skeletal muscle fibers characterized by their expression of the Type II MYOSIN HEAVY CHAIN isoforms which have high ATPase activity and effect several other functional properties - shortening velocity, power output, rate of tension redevelopment. Several fast types have been identified.
Communications using an active or passive satellite to extend the range of radio, television, or other electronic transmission by returning signals to earth from an orbiting satellite.
Derangement in size and number of muscle fibers occurring with aging, reduction in blood supply, or following immobilization, prolonged weightlessness, malnutrition, and particularly in denervation.
Unstriated and unstriped muscle, one of the muscles of the internal organs, blood vessels, hair follicles, etc. Contractile elements are elongated, usually spindle-shaped cells with centrally located nuclei. Smooth muscle fibers are bound together into sheets or bundles by reticular fibers and frequently elastic nets are also abundant. (From Stedman, 25th ed)
Skeletal muscle fibers characterized by their expression of the Type I MYOSIN HEAVY CHAIN isoforms which have low ATPase activity and effect several other functional properties - shortening velocity, power output, rate of tension redevelopment.
A myogenic regulatory factor that controls myogenesis. Myogenin is induced during differentiation of every skeletal muscle cell line that has been investigated, in contrast to the other myogenic regulatory factors that only appear in certain cell types.
The resection or removal of the innervation of a muscle or muscle tissue.
Defective viruses which can multiply only by association with a helper virus which complements the defective gene. Satellite viruses may be associated with certain plant viruses, animal viruses, or bacteriophages. They differ from satellite RNA; (RNA, SATELLITE) in that satellite viruses encode their own coat protein.
A SKELETAL MUSCLE-specific transcription factor that contains a basic HELIX-LOOP-HELIX MOTIF. It plays an essential role in MUSCLE DEVELOPMENT.
A growth differentiation factor that is a potent inhibitor of SKELETAL MUSCLE growth. It may play a role in the regulation of MYOGENESIS and in muscle maintenance during adulthood.
Acquired, familial, and congenital disorders of SKELETAL MUSCLE and SMOOTH MUSCLE.
Mitochondria of skeletal and smooth muscle. It does not include myocardial mitochondria for which MITOCHONDRIA, HEART is available.
The nonstriated involuntary muscle tissue of blood vessels.
Progressive restriction of the developmental potential and increasing specialization of function that leads to the formation of specialized cells, tissues, and organs.
A strain of mice arising from a spontaneous MUTATION (mdx) in inbred C57BL mice. This mutation is X chromosome-linked and produces viable homozygous animals that lack the muscle protein DYSTROPHIN, have high serum levels of muscle ENZYMES, and possess histological lesions similar to human MUSCULAR DYSTROPHY. The histological features, linkage, and map position of mdx make these mice a worthy animal model of DUCHENNE MUSCULAR DYSTROPHY.
Precursor cells destined to differentiate into skeletal myocytes (MYOCYTES, SKELETAL).
Agents that have a damaging effect on the HEART. Such damage can occur from ALKYLATING AGENTS; FREE RADICALS; or metabolites from OXIDATIVE STRESS and in some cases is countered by CARDIOTONIC AGENTS. Induction of LONG QT SYNDROME or TORSADES DE POINTES has been the reason for viewing some drugs as cardiotoxins.
Cells propagated in vitro in special media conducive to their growth. Cultured cells are used to study developmental, morphologic, metabolic, physiologic, and genetic processes, among others.
Mature contractile cells, commonly known as myocytes, that form one of three kinds of muscle. The three types of muscle cells are skeletal (MUSCLE FIBERS, SKELETAL), cardiac (MYOCYTES, CARDIAC), and smooth (MYOCYTES, SMOOTH MUSCLE). They are derived from embryonic (precursor) muscle cells called MYOBLASTS.
A state arrived at through prolonged and strong contraction of a muscle. Studies in athletes during prolonged submaximal exercise have shown that muscle fatigue increases in almost direct proportion to the rate of muscle glycogen depletion. Muscle fatigue in short-term maximal exercise is associated with oxygen lack and an increased level of blood and muscle lactic acid, and an accompanying increase in hydrogen-ion concentration in the exercised muscle.
The long cylindrical contractile organelles of STRIATED MUSCLE cells composed of ACTIN FILAMENTS; MYOSIN filaments; and other proteins organized in arrays of repeating units called SARCOMERES .
The muscles that move the eye. Included in this group are the medial rectus, lateral rectus, superior rectus, inferior rectus, inferior oblique, superior oblique, musculus orbitalis, and levator palpebrae superioris.
General increase in bulk of a part or organ due to CELL ENLARGEMENT and accumulation of FLUIDS AND SECRETIONS, not due to tumor formation, nor to an increase in the number of cells (HYPERPLASIA).
The larger subunits of MYOSINS. The heavy chains have a molecular weight of about 230 kDa and each heavy chain is usually associated with a dissimilar pair of MYOSIN LIGHT CHAINS. The heavy chains possess actin-binding and ATPase activity.
A family of muscle-specific transcription factors which bind to DNA in control regions and thus regulate myogenesis. All members of this family contain a conserved helix-loop-helix motif which is homologous to the myc family proteins. These factors are only found in skeletal muscle. Members include the myoD protein (MYOD PROTEIN); MYOGENIN; myf-5, and myf-6 (also called MRF4 or herculin).
A heterogeneous group of inherited MYOPATHIES, characterized by wasting and weakness of the SKELETAL MUSCLE. They are categorized by the sites of MUSCLE WEAKNESS; AGE OF ONSET; and INHERITANCE PATTERNS.
Most abundant proteins in COBRA venom; basic polypeptides of 57 to 62 amino acids with four disulfide bonds and a molecular weight of less than 7000; causes skeletal and cardiac muscle contraction, interferes with neuromuscular and ganglionic transmission, depolarizes nerve, muscle and blood cell membranes, thus causing hemolysis.
Either of two extremities of four-footed non-primate land animals. It usually consists of a FEMUR; TIBIA; and FIBULA; tarsals; METATARSALS; and TOES. (From Storer et al., General Zoology, 6th ed, p73)
The quadriceps femoris. A collective name of the four-headed skeletal muscle of the thigh, comprised of the rectus femoris, vastus intermedius, vastus lateralis, and vastus medialis.
The species Oryctolagus cuniculus, in the family Leporidae, order LAGOMORPHA. Rabbits are born in burrows, furless, and with eyes and ears closed. In contrast with HARES, rabbits have 22 chromosome pairs.
RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.
Technique for limiting use, activity, or movement by immobilizing or restraining animal by suspending from hindlimbs or tails. This immobilization is used to simulate some effects of reduced gravity and study weightlessness physiology.
The pectoralis major and pectoralis minor muscles that make up the upper and fore part of the chest in front of the AXILLA.
A muscle protein localized in surface membranes which is the product of the Duchenne/Becker muscular dystrophy gene. Individuals with Duchenne muscular dystrophy usually lack dystrophin completely while those with Becker muscular dystrophy have dystrophin of an altered size. It shares features with other cytoskeletal proteins such as SPECTRIN and alpha-actinin but the precise function of dystrophin is not clear. One possible role might be to preserve the integrity and alignment of the plasma membrane to the myofibrils during muscle contraction and relaxation. MW 400 kDa.
Elements of limited time intervals, contributing to particular results or situations.
All of the processes involved in increasing CELL NUMBER including CELL DIVISION.
The gradual irreversible changes in structure and function of an organism that occur as a result of the passage of time.
Composition of images of EARTH or other planets from data collected during SPACE FLIGHT by remote sensing instruments onboard SPACECRAFT. The satellite sensor systems measure and record absorbed, emitted, or reflected energy across the spectra, as well as global position and time.
An intermediate filament protein found predominantly in smooth, skeletal, and cardiac muscle cells. Localized at the Z line. MW 50,000 to 55,000 is species dependent.
An X-linked recessive muscle disease caused by an inability to synthesize DYSTROPHIN, which is involved with maintaining the integrity of the sarcolemma. Muscle fibers undergo a process that features degeneration and regeneration. Clinical manifestations include proximal weakness in the first few years of life, pseudohypertrophy, cardiomyopathy (see MYOCARDIAL DISEASES), and an increased incidence of impaired mentation. Becker muscular dystrophy is a closely related condition featuring a later onset of disease (usually adolescence) and a slowly progressive course. (Adams et al., Principles of Neurology, 6th ed, p1415)
The intracellular transfer of information (biological activation/inhibition) through a signal pathway. In each signal transduction system, an activation/inhibition signal from a biologically active molecule (hormone, neurotransmitter) is mediated via the coupling of a receptor/enzyme to a second messenger system or to an ion channel. Signal transduction plays an important role in activating cellular functions, cell differentiation, and cell proliferation. Examples of signal transduction systems are the GAMMA-AMINOBUTYRIC ACID-postsynaptic receptor-calcium ion channel system, the receptor-mediated T-cell activation pathway, and the receptor-mediated activation of phospholipases. Those coupled to membrane depolarization or intracellular release of calcium include the receptor-mediated activation of cytotoxic functions in granulocytes and the synaptic potentiation of protein kinase activation. Some signal transduction pathways may be part of larger signal transduction pathways; for example, protein kinase activation is part of the platelet activation signal pathway.
A strain of albino rat developed at the Wistar Institute that has spread widely at other institutions. This has markedly diluted the original strain.
Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control (induction or repression) of gene action at the level of transcription or translation.
A vague complaint of debility, fatigue, or exhaustion attributable to weakness of various muscles. The weakness can be characterized as subacute or chronic, often progressive, and is a manifestation of many muscle and neuromuscular diseases. (From Wyngaarden et al., Cecil Textbook of Medicine, 19th ed, p2251)
Muscular contractions characterized by increase in tension without change in length.
A strain of albino rat used widely for experimental purposes because of its calmness and ease of handling. It was developed by the Sprague-Dawley Animal Company.
Non-striated, elongated, spindle-shaped cells found lining the digestive tract, uterus, and blood vessels. They are derived from specialized myoblasts (MYOBLASTS, SMOOTH MUSCLE).
One of two types of muscle in the body, characterized by the array of bands observed under microscope. Striated muscles can be divided into two subtypes: the CARDIAC MUSCLE and the SKELETAL MUSCLE.
Histochemical localization of immunoreactive substances using labeled antibodies as reagents.
Those hospitals which are extensions of a main hospital and are wholly or partly administered by that hospital.
That phase of a muscle twitch during which a muscle returns to a resting position.
A 51-amino acid pancreatic hormone that plays a major role in the regulation of glucose metabolism, directly by suppressing endogenous glucose production (GLYCOGENOLYSIS; GLUCONEOGENESIS) and indirectly by suppressing GLUCAGON secretion and LIPOLYSIS. Native insulin is a globular protein comprised of a zinc-coordinated hexamer. Each insulin monomer containing two chains, A (21 residues) and B (30 residues), linked by two disulfide bonds. Insulin is used as a drug to control insulin-dependent diabetes mellitus (DIABETES MELLITUS, TYPE 1).
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
The musculofibrous partition that separates the THORACIC CAVITY from the ABDOMINAL CAVITY. Contraction of the diaphragm increases the volume of the thoracic cavity aiding INHALATION.
A basic element found in nearly all organized tissues. It is a member of the alkaline earth family of metals with the atomic symbol Ca, atomic number 20, and atomic weight 40. Calcium is the most abundant mineral in the body and combines with phosphorus to form calcium phosphate in the bones and teeth. It is essential for the normal functioning of nerves and muscles and plays a role in blood coagulation (as factor IV) and in many enzymatic processes.
Devices, manned and unmanned, which are designed to be placed into an orbit about the Earth or into a trajectory to another celestial body. (NASA Thesaurus, 1988)
Relatively undifferentiated cells that retain the ability to divide and proliferate throughout postnatal life to provide progenitor cells that can differentiate into specialized cells.
The neck muscles consist of the platysma, splenius cervicis, sternocleidomastoid(eus), longus colli, the anterior, medius, and posterior scalenes, digastric(us), stylohyoid(eus), mylohyoid(eus), geniohyoid(eus), sternohyoid(eus), omohyoid(eus), sternothyroid(eus), and thyrohyoid(eus).
The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.
Laboratory mice that have been produced from a genetically manipulated EGG or EMBRYO, MAMMALIAN.
Skeletal muscle structures that function as the MECHANORECEPTORS responsible for the stretch or myotactic reflex (REFLEX, STRETCH). They are composed of a bundle of encapsulated SKELETAL MUSCLE FIBERS, i.e., the intrafusal fibers (nuclear bag 1 fibers, nuclear bag 2 fibers, and nuclear chain fibers) innervated by SENSORY NEURONS.
Progressive decline in muscle mass due to aging which results in decreased functional capacity of muscles.
These include the muscles of the DIAPHRAGM and the INTERCOSTAL MUSCLES.
Strains of mice in which certain GENES of their GENOMES have been disrupted, or "knocked-out". To produce knockouts, using RECOMBINANT DNA technology, the normal DNA sequence of the gene being studied is altered to prevent synthesis of a normal gene product. Cloned cells in which this DNA alteration is successful are then injected into mouse EMBRYOS to produce chimeric mice. The chimeric mice are then bred to yield a strain in which all the cells of the mouse contain the disrupted gene. Knockout mice are used as EXPERIMENTAL ANIMAL MODELS for diseases (DISEASE MODELS, ANIMAL) and to clarify the functions of the genes.
A satellite RNA (not a satellite virus) which has several types. Different cucumoviruses can act as helper viruses for different types.
Use of electric potential or currents to elicit biological responses.
Physical activity which is usually regular and done with the intention of improving or maintaining PHYSICAL FITNESS or HEALTH. Contrast with PHYSICAL EXERTION which is concerned largely with the physiologic and metabolic response to energy expenditure.
A transferase that catalyzes formation of PHOSPHOCREATINE from ATP + CREATINE. The reaction stores ATP energy as phosphocreatine. Three cytoplasmic ISOENZYMES have been identified in human tissues: the MM type from SKELETAL MUSCLE, the MB type from myocardial tissue and the BB type from nervous tissue as well as a mitochondrial isoenzyme. Macro-creatine kinase refers to creatine kinase complexed with other serum proteins.
A network of tubules and sacs in the cytoplasm of SKELETAL MUSCLE FIBERS that assist with muscle contraction and relaxation by releasing and storing calcium ions.
Expenditure of energy during PHYSICAL ACTIVITY. Intensity of exertion may be measured by rate of OXYGEN CONSUMPTION; HEAT produced, or HEART RATE. Perceived exertion, a psychological measure of exertion, is included.
Diet modification and physical exercise to improve the ability of animals to perform physical activities.
Conical muscular projections from the walls of the cardiac ventricles, attached to the cusps of the atrioventricular valves by the chordae tendineae.
The muscle tissue of the HEART. It is composed of striated, involuntary muscle cells (MYOCYTES, CARDIAC) connected to form the contractile pump to generate blood flow.
The developmental history of specific differentiated cell types as traced back to the original STEM CELLS in the embryo.
A primary source of energy for living organisms. It is naturally occurring and is found in fruits and other parts of plants in its free state. It is used therapeutically in fluid and nutrient replacement.
Muscles forming the ABDOMINAL WALL including RECTUS ABDOMINIS, external and internal oblique muscles, transversus abdominis, and quadratus abdominis. (from Stedman, 25th ed)
A family of transcription factors that control EMBRYONIC DEVELOPMENT within a variety of cell lineages. They are characterized by a highly conserved paired DNA-binding domain that was first identified in DROSOPHILA segmentation genes.
Identification of proteins or peptides that have been electrophoretically separated by blot transferring from the electrophoresis gel to strips of nitrocellulose paper, followed by labeling with antibody probes.
The rate dynamics in chemical or physical systems.
The measurement of an organ in volume, mass, or heaviness.
Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action during the developmental stages of an organism.
Common name for the species Gallus gallus, the domestic fowl, in the family Phasianidae, order GALLIFORMES. It is descended from the red jungle fowl of SOUTHEAST ASIA.
A well-characterized basic peptide believed to be secreted by the liver and to circulate in the blood. It has growth-regulating, insulin-like, and mitogenic activities. This growth factor has a major, but not absolute, dependence on GROWTH HORMONE. It is believed to be mainly active in adults in contrast to INSULIN-LIKE GROWTH FACTOR II, which is a major fetal growth factor.
The excitable plasma membrane of a muscle cell. (Glick, Glossary of Biochemistry and Molecular Biology, 1990)
The fission of a CELL. It includes CYTOKINESIS, when the CYTOPLASM of a cell is divided, and CELL NUCLEUS DIVISION.
The time span between the beginning of physical activity by an individual and the termination because of exhaustion.
A syndecan found at high levels in the developing LIMB BUDS. It may play a role in the regulation of MUSCULOSKELETAL DEVELOPMENT by modulating the effects of INTERCELLULAR SIGNALING PEPTIDES AND PROTEINS.
Established cell cultures that have the potential to propagate indefinitely.
A masticatory muscle whose action is closing the jaws.
Microscopy using an electron beam, instead of light, to visualize the sample, thereby allowing much greater magnification. The interactions of ELECTRONS with specimens are used to provide information about the fine structure of that specimen. In TRANSMISSION ELECTRON MICROSCOPY the reactions of the electrons that are transmitted through the specimen are imaged. In SCANNING ELECTRON MICROSCOPY an electron beam falls at a non-normal angle on the specimen and the image is derived from the reactions occurring above the plane of the specimen.
Filamentous proteins that are the main constituent of the thin filaments of muscle fibers. The filaments (known also as filamentous or F-actin) can be dissociated into their globular subunits; each subunit is composed of a single polypeptide 375 amino acids long. This is known as globular or G-actin. In conjunction with MYOSINS, actin is responsible for the contraction and relaxation of muscle.
A glucose transport protein found in mature MUSCLE CELLS and ADIPOCYTES. It promotes transport of glucose from the BLOOD into target TISSUES. The inactive form of the protein is localized in CYTOPLASMIC VESICLES. In response to INSULIN, it is translocated to the PLASMA MEMBRANE where it facilitates glucose uptake.
Theoretical representations that simulate the behavior or activity of biological processes or diseases. For disease models in living animals, DISEASE MODELS, ANIMAL is available. Biological models include the use of mathematical equations, computers, and other electronic equipment.
The introduction of a phosphoryl group into a compound through the formation of an ester bond between the compound and a phosphorus moiety.
A powerful flexor of the thigh at the hip joint (psoas major) and a weak flexor of the trunk and lumbar spinal column (psoas minor). Psoas is derived from the Greek "psoa", the plural meaning "muscles of the loin". It is a common site of infection manifesting as abscess (PSOAS ABSCESS). The psoas muscles and their fibers are also used frequently in experiments in muscle physiology.
The phenotypic manifestation of a gene or genes by the processes of GENETIC TRANSCRIPTION and GENETIC TRANSLATION.
The repeating contractile units of the MYOFIBRIL, delimited by Z bands along its length.
Recording of the changes in electric potential of muscle by means of surface or needle electrodes.
Endogenous substances, usually proteins, which are effective in the initiation, stimulation, or termination of the genetic transcription process.
Myosin type II isoforms found in skeletal muscle.
The mass or quantity of heaviness of an individual. It is expressed by units of pounds or kilograms.
A diverse superfamily of proteins that function as translocating proteins. They share the common characteristics of being able to bind ACTINS and hydrolyze MgATP. Myosins generally consist of heavy chains which are involved in locomotion, and light chains which are involved in regulation. Within the structure of myosin heavy chain are three domains: the head, the neck and the tail. The head region of the heavy chain contains the actin binding domain and MgATPase domain which provides energy for locomotion. The neck region is involved in binding the light-chains. The tail region provides the anchoring point that maintains the position of the heavy chain. The superfamily of myosins is organized into structural classes based upon the type and arrangement of the subunits they contain.
The rate at which oxygen is used by a tissue; microliters of oxygen STPD used per milligram of tissue per hour; the rate at which oxygen enters the blood from alveolar gas, equal in the steady state to the consumption of oxygen by tissue metabolism throughout the body. (Stedman, 25th ed, p346)
Enzyme that catalyzes the first step of the tricarboxylic acid cycle (CITRIC ACID CYCLE). It catalyzes the reaction of oxaloacetate and acetyl CoA to form citrate and coenzyme A. This enzyme was formerly listed as EC 4.1.3.7.
Respiratory muscles that arise from the lower border of one rib and insert into the upper border of the adjoining rib, and contract during inspiration or respiration. (From Stedman, 25th ed)
The number of CELLS of a specific kind, usually measured per unit volume or area of sample.
A variation of the PCR technique in which cDNA is made from RNA via reverse transcription. The resultant cDNA is then amplified using standard PCR protocols.
Muscles arising in the zygomatic arch that close the jaw. Their nerve supply is masseteric from the mandibular division of the trigeminal nerve. (From Stedman, 25th ed)
Muscles of facial expression or mimetic muscles that include the numerous muscles supplied by the facial nerve that are attached to and move the skin of the face. (From Stedman, 25th ed)
A tetrameric calcium release channel in the SARCOPLASMIC RETICULUM membrane of SMOOTH MUSCLE CELLS, acting oppositely to SARCOPLASMIC RETICULUM CALCIUM-TRANSPORTING ATPASES. It is important in skeletal and cardiac excitation-contraction coupling and studied by using RYANODINE. Abnormalities are implicated in CARDIAC ARRHYTHMIAS and MUSCULAR DISEASES.
Characteristic restricted to a particular organ of the body, such as a cell type, metabolic response or expression of a particular protein or antigen.
Naturally occurring or experimentally induced animal diseases with pathological processes sufficiently similar to those of human diseases. They are used as study models for human diseases.
Inflammation of a muscle or muscle tissue.
Different forms of a protein that may be produced from different GENES, or from the same gene by ALTERNATIVE SPLICING.
Multifunctional growth factor which regulates both cell growth and cell motility. It exerts a strong mitogenic effect on hepatocytes and primary epithelial cells. Its receptor is PROTO-ONCOGENE PROTEINS C-MET.
Diminished effectiveness of INSULIN in lowering blood sugar levels: requiring the use of 200 units or more of insulin per day to prevent HYPERGLYCEMIA or KETOSIS.
An adenine nucleotide containing three phosphate groups esterified to the sugar moiety. In addition to its crucial roles in metabolism adenosine triphosphate is a neurotransmitter.
The chemical reactions involved in the production and utilization of various forms of energy in cells.
Refers to animals in the period of time just after birth.
The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.
The non-genetic biological changes of an organism in response to challenges in its ENVIRONMENT.
A ubiquitously expressed syndecan that is found in all stages of embryonic development and in most adult tissues. Syndecan-4 is found localized to focal adhesion sites in fibronectin-adherent cells and may play a role the process of CELL MIGRATION and CELL PROLIFERATION.
Test for tissue antigen using either a direct method, by conjugation of antibody with fluorescent dye (FLUORESCENT ANTIBODY TECHNIQUE, DIRECT) or an indirect method, by formation of antigen-antibody complex which is then labeled with fluorescein-conjugated anti-immunoglobulin antibody (FLUORESCENT ANTIBODY TECHNIQUE, INDIRECT). The tissue is then examined by fluorescence microscopy.
An endogenous substance found mainly in skeletal muscle of vertebrates. It has been tried in the treatment of cardiac disorders and has been added to cardioplegic solutions. (Reynolds JEF(Ed): Martindale: The Extra Pharmacopoeia (electronic version). Micromedex, Inc, Englewood, CO, 1996)
Fusion of somatic cells in vitro or in vivo, which results in somatic cell hybridization.
A species of the family Ranidae occurring in a wide variety of habitats from within the Arctic Circle to South Africa, Australia, etc.
Within a eukaryotic cell, a membrane-limited body which contains chromosomes and one or more nucleoli (CELL NUCLEOLUS). The nuclear membrane consists of a double unit-type membrane which is perforated by a number of pores; the outermost membrane is continuous with the ENDOPLASMIC RETICULUM. A cell may contain more than one nucleus. (From Singleton & Sainsbury, Dictionary of Microbiology and Molecular Biology, 2d ed)
The synapse between a neuron and a muscle.
One of the minor protein components of skeletal muscle. Its function is to serve as the calcium-binding component in the troponin-tropomyosin B-actin-myosin complex by conferring calcium sensitivity to the cross-linked actin and myosin filaments.
Cell surface proteins that bind acetylcholine with high affinity and trigger intracellular changes influencing the behavior of cells. Cholinergic receptors are divided into two major classes, muscarinic and nicotinic, based originally on their affinity for nicotine and muscarine. Each group is further subdivided based on pharmacology, location, mode of action, and/or molecular biology.
The properties, processes, and behavior of biological systems under the action of mechanical forces.
The alpha subunits of integrin heterodimers (INTEGRINS), which mediate ligand specificity. There are approximately 18 different alpha chains, exhibiting great sequence diversity; several chains are also spliced into alternative isoforms. They possess a long extracellular portion (1200 amino acids) containing a MIDAS (metal ion-dependent adhesion site) motif, and seven 60-amino acid tandem repeats, the last 4 of which form EF HAND MOTIFS. The intracellular portion is short with the exception of INTEGRIN ALPHA4.
The outward appearance of the individual. It is the product of interactions between genes, and between the GENOTYPE and the environment.
A sport in which weights are lifted competitively or as an exercise.
A positive regulatory effect on physiological processes at the molecular, cellular, or systemic level. At the molecular level, the major regulatory sites include membrane receptors, genes (GENE EXPRESSION REGULATION), mRNAs (RNA, MESSENGER), and proteins.
Transference of cells within an individual, between individuals of the same species, or between individuals of different species.
The developmental entity of a fertilized chicken egg (ZYGOTE). The developmental process begins about 24 h before the egg is laid at the BLASTODISC, a small whitish spot on the surface of the EGG YOLK. After 21 days of incubation, the embryo is fully developed before hatching.
A highly variable species of the family Ranidae in Canada, the United States and Central America. It is the most widely used Anuran in biomedical research.
Genetically identical individuals developed from brother and sister matings which have been carried out for twenty or more generations or by parent x offspring matings carried out with certain restrictions. This also includes animals with a long history of closed colony breeding.
Intracellular signaling protein kinases that play a signaling role in the regulation of cellular energy metabolism. Their activity largely depends upon the concentration of cellular AMP which is increased under conditions of low energy or metabolic stress. AMP-activated protein kinases modify enzymes involved in LIPID METABOLISM, which in turn provide substrates needed to convert AMP into ATP.
The inferior part of the lower extremity between the KNEE and the ANKLE.
A particular zone of tissue composed of a specialized microenvironment where stem cells are retained in a undifferentiated, self-renewable state.
The flow of BLOOD through or around an organ or region of the body.
A purely physical condition which exists within any material because of strain or deformation by external forces or by non-uniform thermal expansion; expressed quantitatively in units of force per unit area.
Domesticated bovine animals of the genus Bos, usually kept on a farm or ranch and used for the production of meat or dairy products or for heavy labor.
Mice bearing mutant genes which are phenotypically expressed in the animals.
A type of strength-building exercise program that requires the body muscle to exert a force against some form of resistance, such as weight, stretch bands, water, or immovable objects. Resistance exercise is a combination of static and dynamic contractions involving shortening and lengthening of skeletal muscles.
An order of the class Amphibia, which includes several families of frogs and toads. They are characterized by well developed hind limbs adapted for jumping, fused head and trunk and webbed toes. The term "toad" is ambiguous and is properly applied only to the family Bufonidae.
A heterogenous group of inherited muscular dystrophy that can be autosomal dominant or autosomal recessive. There are many forms (called LGMDs) involving genes encoding muscle membrane proteins such as the sarcoglycan (SARCOGLYCANS) complex that interacts with DYSTROPHIN. The disease is characterized by progressing wasting and weakness of the proximal muscles of arms and legs around the HIPS and SHOULDERS (the pelvic and shoulder girdles).
Microscopy of specimens stained with fluorescent dye (usually fluorescein isothiocyanate) or of naturally fluorescent materials, which emit light when exposed to ultraviolet or blue light. Immunofluorescence microscopy utilizes antibodies that are labeled with fluorescent dye.
A family of transmembrane dystrophin-associated proteins that play a role in the membrane association of the DYSTROPHIN-ASSOCIATED PROTEIN COMPLEX.
The biosynthesis of RNA carried out on a template of DNA. The biosynthesis of DNA from an RNA template is called REVERSE TRANSCRIPTION.
An activity in which the body is propelled by moving the legs rapidly. Running is performed at a moderate to rapid pace and should be differentiated from JOGGING, which is performed at a much slower pace.
The farthest or outermost projections of the body, such as the HAND and FOOT.
A protein found in the thin filaments of muscle fibers. It inhibits contraction of the muscle unless its position is modified by TROPONIN.
The clear constricted portion of the chromosome at which the chromatids are joined and by which the chromosome is attached to the spindle during cell division.
These compounds stimulate anabolism and inhibit catabolism. They stimulate the development of muscle mass, strength, and power.
A purinergic P2X neurotransmitter receptor found at high levels in the BRAIN and IMMUNE SYSTEM.
The voltage differences across a membrane. For cellular membranes they are computed by subtracting the voltage measured outside the membrane from the voltage measured inside the membrane. They result from differences of inside versus outside concentration of potassium, sodium, chloride, and other ions across cells' or ORGANELLES membranes. For excitable cells, the resting membrane potentials range between -30 and -100 millivolts. Physical, chemical, or electrical stimuli can make a membrane potential more negative (hyperpolarization), or less negative (depolarization).
Activating transcription factors of the MADS family which bind a specific sequence element (MEF2 element) in many muscle-specific genes and are involved in skeletal and cardiac myogenesis, neuronal differentiation and survival/apoptosis.
A normal intermediate in the fermentation (oxidation, metabolism) of sugar. The concentrated form is used internally to prevent gastrointestinal fermentation. (From Stedman, 26th ed)
The outermost cytoplasmic layer of the SCHWANN CELLS covering NERVE FIBERS.
The restriction of the MOVEMENT of whole or part of the body by physical means (RESTRAINT, PHYSICAL) or chemically by ANALGESIA, or the use of TRANQUILIZING AGENTS or NEUROMUSCULAR NONDEPOLARIZING AGENTS. It includes experimental protocols used to evaluate the physiologic effects of immobility.
The physical state of supporting an applied load. This often refers to the weight-bearing bones or joints that support the body's weight, especially those in the spine, hip, knee, and foot.
A spherical RNA satellite virus which requires an obligatory helper TOBACCO MOSAIC VIRUS for replication.
Cell surface protein-tyrosine kinase receptors for HEPATOCYTE GROWTH FACTOR. They consist of an extracellular alpha chain which is disulfide-linked to the transmembrane beta chain. The cytoplasmic portion contains the catalytic domain and sites critical for the regulation of kinase activity. Mutations of the gene for PROTO-ONCOGENE PROTEINS C-MET are associated with papillary renal carcinoma and other neoplasia.
A group of muscle diseases associated with abnormal mitochondria function.
The domestic dog, Canis familiaris, comprising about 400 breeds, of the carnivore family CANIDAE. They are worldwide in distribution and live in association with people. (Walker's Mammals of the World, 5th ed, p1065)
Structurally related forms of an enzyme. Each isoenzyme has the same mechanism and classification, but differs in its chemical, physical, or immunological characteristics.
A methylxanthine naturally occurring in some beverages and also used as a pharmacological agent. Caffeine's most notable pharmacological effect is as a central nervous system stimulant, increasing alertness and producing agitation. It also relaxes SMOOTH MUSCLE, stimulates CARDIAC MUSCLE, stimulates DIURESIS, and appears to be useful in the treatment of some types of headache. Several cellular actions of caffeine have been observed, but it is not entirely clear how each contributes to its pharmacological profile. Among the most important are inhibition of cyclic nucleotide PHOSPHODIESTERASES, antagonism of ADENOSINE RECEPTORS, and modulation of intracellular calcium handling.
The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.
Study of intracellular distribution of chemicals, reaction sites, enzymes, etc., by means of staining reactions, radioactive isotope uptake, selective metal distribution in electron microscopy, or other methods.
A deoxyribonucleotide polymer that is the primary genetic material of all cells. Eukaryotic and prokaryotic organisms normally contain DNA in a double-stranded state, yet several important biological processes transiently involve single-stranded regions. DNA, which consists of a polysugar-phosphate backbone possessing projections of purines (adenine and guanine) and pyrimidines (thymine and cytosine), forms a double helix that is held together by hydrogen bonds between these purines and pyrimidines (adenine to thymine and guanine to cytosine).
The relationship between the dose of an administered drug and the response of the organism to the drug.
Specialized connective tissue composed of fat cells (ADIPOCYTES). It is the site of stored FATS, usually in the form of TRIGLYCERIDES. In mammals, there are two types of adipose tissue, the WHITE FAT and the BROWN FAT. Their relative distributions vary in different species with most adipose tissue being white.
Neurons which activate MUSCLE CELLS.
Observation and acquisition of physical data from a distance by viewing and making measurements from a distance or receiving transmitted data from observations made at distant location.
Proteins which bind to DNA. The family includes proteins which bind to both double- and single-stranded DNA and also includes specific DNA binding proteins in serum which can be used as markers for malignant diseases.
The amount of force generated by MUSCLE CONTRACTION. Muscle strength can be measured during isometric, isotonic, or isokinetic contraction, either manually or using a device such as a MUSCLE STRENGTH DYNAMOMETER.
Voltage-dependent cell membrane glycoproteins selectively permeable to calcium ions. They are categorized as L-, T-, N-, P-, Q-, and R-types based on the activation and inactivation kinetics, ion specificity, and sensitivity to drugs and toxins. The L- and T-types are present throughout the cardiovascular and central nervous systems and the N-, P-, Q-, & R-types are located in neuronal tissue.
Glucose in blood.
A masticatory muscle whose action is closing the jaws; its posterior portion retracts the mandible.
Removal and pathologic examination of specimens in the form of small pieces of tissue from the living body.
An isoenzyme of creatine kinase found in the MUSCLE.

Tristetraprolin and LPS-inducible CXC chemokine are rapidly induced in presumptive satellite cells in response to skeletal muscle injury. (1/526)

Myogenic precursor cells known as satellite cells persist in adult skeletal muscle and are responsible for its ability to regenerate after injury. Quiescent satellite cells are activated by signals emanating from damaged muscle. Here we describe the rapid activation of two genes in response to muscle injury; these transcripts encode LPS-inducible CXC chemokine (LIX), a neutrophil chemoattractant, and Tristetraprolin (TTP), an RNA-binding protein implicated in the regulation of cytokine expression. Using a synchronized cell culture model we show that C2C12 myoblasts arrested in G0 exhibit some molecular attributes of satellite cells in vivo: suppression of MyoD and Myf5 expression during G0 and their reactivation in G1. Synchronization also revealed cell cycle dependent expression of CD34, M-cadherin, HGF and PEA3, genes implicated in satellite cell biology. To identify other genes induced in synchronized C2C12 myoblasts we used differential display PCR and isolated LIX and TTP cDNAs. Both LIX and TTP mRNAs are short-lived, encode molecules implicated in inflammation and are transiently induced during growth activation in vitro. Further, LIX and TTP are rapidly induced in response to muscle damage in vivo. TTP expression precedes that of MyoD and is detected 30 minutes after injury. The spatial distribution of LIX and TTP transcripts in injured muscle suggests expression by satellite cells. Our studies suggest that in addition to generating new cells for repair, activated satellite cells may be a source of signaling molecules involved in tissue remodeling during regeneration.  (+info)

Myogenic specification of side population cells in skeletal muscle. (2/526)

Skeletal muscle contains myogenic progenitors called satellite cells and muscle-derived stem cells that have been suggested to be pluripotent. We further investigated the differentiation potential of muscle-derived stem cells and satellite cells to elucidate relationships between these two populations of cells. FACS(R) analysis of muscle side population (SP) cells, a fraction of muscle-derived stem cells, revealed expression of hematopoietic stem cell marker Sca-1 but did not reveal expression of any satellite cell markers. Muscle SP cells were greatly enriched for cells competent to form hematopoietic colonies. Moreover, muscle SP cells with hematopoietic potential were CD45 positive. However, muscle SP cells did not differentiate into myocytes in vitro. By contrast, satellite cells gave rise to myocytes but did not express Sca-1 or CD45 and never formed hematopoietic colonies. Importantly, muscle SP cells exhibited the potential to give rise to both myocytes and satellite cells after intramuscular transplantation. In addition, muscle SP cells underwent myogenic specification after co-culture with myoblasts. Co-culture with myoblasts or forced expression of MyoD also induced muscle differentiation of muscle SP cells prepared from mice lacking Pax7 gene, an essential gene for satellite cell development. Therefore, these data document that satellite cells and muscle-derived stem cells represent distinct populations and demonstrate that muscle-derived stem cells have the potential to give rise to myogenic cells via a myocyte-mediated inductive interaction.  (+info)

Targeted expression of IGF-1 transgene to skeletal muscle accelerates muscle and motor neuron regeneration. (3/526)

Currently, there is no known medical treatment that hastens the repair of damaged nerve and muscle. Using IGF-1 transgenic mice that specifically express human recombinant IGF-1 in skeletal muscle, we test the hypotheses that targeted gene expression of IGF-1 in skeletal muscle enhances motor nerve regeneration after a nerve crush injury. The IGF-1 transgene affects the initiation of the muscle repair process after nerve injury as shown by increased activation of SCA-1positive myogenic stem cells. Increased satellite cell differentiation and proliferation are observed in IGF-1 transgenic mice, shown by increased expression of Cyclin D1, MyoD, and myogenin. Expression of myogenin and nicotinic acetylcholine receptor subunits, initially increased in both wild-type and IGF-1 transgenic mice, are restored to normal levels at a faster rate in IGF-1 transgenic mice, which indicates a rescue of nerve-evoked muscle activity. Expression of the IGF-1 transgene in skeletal muscle results in accelerated recovery of saltatory nerve conduction, increased innervation as detected by neurofilament expression, and faster recovery of muscle mass. These studies demonstrate that local expression of IGF-1 augments the repair of injured nerve and muscle.  (+info)

Biological progression from adult bone marrow to mononucleate muscle stem cell to multinucleate muscle fiber in response to injury. (4/526)

Adult bone marrow-derived cells (BMDC) are shown to contribute to muscle tissue in a step-wise biological progression. Following irradiation-induced damage, transplanted GFP-labeled BMDC become satellite cells: membrane-ensheathed mononucleate muscle stem cells. Following a subsequent exercise-induced damage, GFP-labeled multinucleate myofibers are detected. Isolated GFP-labeled satellite cells are heritably myogenic. They express three characteristic muscle markers, are karyotypically diploid, and form clones that can fuse into multinucleate cells in culture or into myofibers after injection into mouse muscles. These results suggest that two temporally distinct injury-related signals first induce BMDC to occupy the muscle stem cell niche and then to help regenerate mature muscle fibers. The stress-induced progression of BMDC to muscle satellite cell to muscle fiber results in a contribution to as many as 3.5% of muscle fibers and is due to developmental plasticity in response to environmental cues.  (+info)

Affects of different access routes on autologous satellite cell implantation stimulating myocardial regeneration. (5/526)

OBJECTIVE: To study the effect of different access routes on autologous satellite cell implantation to stimulate myocardial regeneration. METHODS: Satellite cells were procured from skeletal muscle (gluteus max) of adult mongrel canine, cultured, proliferated and labeled with 4', 6-diamidino-2-phenylindone (DAPI) in vitro. The cells were autologously implanted into the site of acute myocardial infarction by local injection or perfusion through the ligated distal left anterior descending coronary artery. Specimens were harvested 2, 4 and 8 weeks later for histological study. RESULTS: The labeling efficiency of satellite cells with DAPI was close to 100%. Fluorescent cells were found at the infarcted zone, papillary muscle and local injection site. Some of these cells had progressively differentiated into striated muscle fibers connected to intercalated discs. The infant cells appeared different from the mature myocardium under an electron microscope. Satellite cells implanted by perfusion through the coronary artery were arranged in order of consistency with host myocardial fibers. The satellite cells, implanted by local injection, were found growing in a disordered way. CONCLUSION: Satellite cells, implanted by coronary artery perfusion, can progressively differentiate into striated muscle fibers, arranging in order and disseminating over the infarcted zone. This approach seems more favorable for the recovery of myocardial contractile function than that of local injection.  (+info)

Reactive oxygen species are important mediators of taurine release from skeletal muscle cells. (6/526)

The present study illustrates elements of the signal cascades involved in the activation of taurine efflux pathways in myotubes derived from skeletal muscle cells. Exposing primary skeletal muscle cells, loaded with (14)C-taurine, to 1) hypotonic media, 2) the phospholipase A(2) (PLA(2)) activator melittin, 3) anoxia, or 4) lysophosphatidyl choline (LPC) causes an increase in (14)C-taurine release and a concomitant production of reactive oxygen species (ROS). The antioxidants butulated hydroxy toluene and vitamin E inhibit the taurine efflux after cell swelling, anoxia, and addition of LPC. The muscle cells possess two separate taurine efflux pathways, i.e., a swelling- and melittin-induced pathway that requires 5-lipoxygenase activity for activation and a LPC-induced pathway. The two pathways are distinguished by their opposing sensitivity toward the anion channel blocker DIDS and cholesterol. These data provide evidence for PLA(2) products and ROS as key mediators of the signal cascade leading to taurine efflux in muscle.  (+info)

Activated satellite cells are present in uninjured extraocular muscles of mature mice. (7/526)

PURPOSE: We recently demonstrated that there is a continuous process of myonuclear addition into normal, uninjured adult myofibers in rabbit extraocular muscles (EOM). This phenomenon is not seen in skeletal muscles from normal, adult limbs. These features may explain the selective involvement of the EOM in progressive external ophthalmoplegia and oculopharyngeal muscular dystrophy due to an accumulation of damaged DNA in mitochondria and nuclei within the EOM as a result of repeated cycling of the muscle satellite cells. Many testable hypotheses flow from these observations. We investigated whether continuous myonuclear addition is present in normal mouse EOM so that mouse models of genetic disorders can be used to study the pathogenic mechanisms and to test potential therapies for human muscle disorders. METHODS: Bromodeoxyuridine (brdU) was injected intraperitoneally into C57 adult mice every 2 hours for 12 hours. Twenty-four hours later the animals were sacrificed, and the globes with the muscles attached were prepared for immunohistochemical localization of brdU-positive nuclei within the EOM. All cross sections were immunostained for both brdU and either dystrophin or laminin. RESULTS: All the rectus muscles from the mouse EOM examined contained both satellite cells and myonuclei that were positive for brdU. This demonstrates the division of satellite cells and the fusion of their daughter cells with existing adult EOM myofibers in mice. CONCLUSIONS: These data indicate that the process of continuous myonuclear addition is also active in mouse EOM. These findings will allow various mutant mouse models to be used to study the pathogenesis and treatment of various muscle disorders. The existence of continuous myonuclear addition in adult, uninjured EOM fundamentally changes the accepted notion that EOM myofibers are postmitotic.  (+info)

Myogenic cell cycle duration in Harpagifer species with sub-Antarctic and Antarctic distributions: evidence for cold compensation. (8/526)

In teleosts, the proliferation of myogenic progenitor cells is required for muscle growth and nuclear turnover. We measured the cell cycle and S-phase duration of myogenic cells in the fast myotomal muscle of two closely related Harpagifer species by cumulative S-phase labelling with 5-bromo-2'-deoxyuridine (BrdU). Harpagifer antarcticus is a stenothermal species from the Antarctic peninsula (experiencing temperatures of -2 degrees C to +1 degrees C) and Harpagifer bispinis is a eurythermal species from the Beagle Channel, Tierra del Fuego (living at +4 degrees C in winter and up to 11 degrees C in summer). Specific growth rates in the adult stages studied were not significantly different from zero. Myogenic progenitor cells were identified using an antibody against c-met. Seventy-five percent of the c-met(+ve) cells were in a proliferative state in both species. Cell cycle time was 150 h at 5 degrees C and 81.3 h at 10 degrees C in H. bispinis (Q(10)=3.4). Cell cycle duration was 35% shorter in H. antarcticus at 0 degrees C (111 h) than in H. bispinis at 5 degrees C. The predicted cell cycle time for H. bispinis at 0 degrees C (based on the Q(10) relationship) was 277 h, which was more than double that measured for the Antarctic species at this temperature. The results obtained are compatible with an evolutionary adjustment of cell cycle time for function at low temperature in the Antarctic species.  (+info)

MicroRNAs (miRNAs) play essential roles in muscle cell proliferation and differentiation. The muscle-specific miRNAs miR-1 and miR-206 have been shown to regulate muscle development and promote myogenic differentiation; however, it is likely that a number of other miRNAs play important roles in regulating myogenesis as well. microRNA-128 (miR-128) has been reported to be highly expressed in brain and skeletal muscle, and we found that miR-128 is also up-regulated during bovine skeletal muscle satellite cell differentiation using microarray analysis and qRT-PCR. However, little is known about the functions of miR-128 in bovine skeletal muscle satellite cell development. In this study, we investigated the biological functions of miR-128 in bovine skeletal muscle cell development. Using a dual-luciferase reporter assay, we confirmed that miR-128 regulates the Sp1 gene. Over-expression of miR-128 reduced Sp1 protein levels and inhibited muscle satellite cell proliferation and differentiation. ...
TY - THES. T1 - Evaluation of skeletal muscle satellite cell activity in rodent models depicting muscle hypertrophy and atrophy. AU - Sidique, Idris. N1 - Thesis supervisors: Billeter-Clark, R. and Greenhaff, P.L.. PY - 2013/5. Y1 - 2013/5. N2 - Satellite cells are muscle-specific progenitor cells involved in the routine maintenance of skeletal muscle homeostasis, growth and regeneration. They are activated by various stimuli (myotrauma, growth factors etc), undergo rounds of proliferation as skeletal muscle myoblasts, to differentiate and fuse with each other to generate new myotubes or onto existing myofibres to augment growth or repair damaged fibres. Satellite cells contribute to hypertrophy by facilitating nuclear addition, which maintains contractile protein synthetic capacity. Conversely, during atrophy the dysregulation of satellite cells (e.g., via myogenic suppression), causes an opposing deficit in nuclear supplementation/contractile protein synthesis. The activity status of ...
TY - JOUR. T1 - Desmin is present in proliferating rat muscle satellite cells but not in bovine muscle satellite cells. AU - Allen, Ronald E.. AU - Rankin, Lucinda L.. AU - Greene, Elizabeth A.. AU - Boxhorn, Linda K.. AU - Johnson, Sally E.. AU - Taylor, Richard G.. AU - Pierce, Paul R.. PY - 1991/12. Y1 - 1991/12. N2 - The presence of desmin was characterized in cultured rat and bovine satellite cells and its potential usefulness as a marker for identifying satellite cells in vitro was evaluated. In primary cultures, positive immunohistochemical staining for desmin and skeletal muscle myosin was observed in rat and bovine myotubes. A small number of mononucleated cells (20% of rat satellite cells and 5% of bovine satellite cells) were myosin‐positive, indicative of post‐mitotic differentiated myocytes. In bovine satellite cell cultures 13% of the mononucleated cells were desmin‐positive, while 84% of the mononucleated cells in rat satellite cell cultures were desmin‐positive. Rat ...
Asakura A, Komaki M and Rudnicki M (2001). Muscle satellite cells are multipotential stem cells that exhibit myogenic, osteogenic, and adipogenic differentiation. Differentiation. 68 (4-5): 245-53. Summary: Muscle satellite cells are believed to represent a committed stem cell population that is responsible for the postnatal growth and regeneration of skeletal muscle. However, the observation that cultured myoblasts differentiate into osteocytes or adipocytes following treatment with bone
Skeletal muscle satellite cells (SCs) are involved in remodeling and hypertrophy processes of skeletal muscle. However, little knowledge exists on extrinsic factors that influence the content of SCs in skeletal muscle. In a comparative human study, we investigated the muscle fiber type-specific association between emergence of satellite cells (SCs), muscle growth, and remodeling in response to 12 wk unilateral resistance training performed as eccentric (Ecc) or concentric (Conc) resistance training ± whey protein (Whey, 19.5 g protein + 19.5 g glucose) or placebo (Placebo, 39 g glucose) supplementation. Muscle biopsies (vastus lateralis) were analyzed for fiber type-specific SCs, myonuclei, and fiber cross-sectional area (CSA). Following training, SCs increased with Conc in both type I and type II fibers (P , 0.01) and exhibited a group difference from Ecc (P , 0.05), which did not increase. Myonuclei content in type I fibers increased in all groups (P , 0.01), while a specific accretion of ...
Satellite cell activity is necessary for postnatal skeletal muscle growth. Severe phosphate (PO4) deficiency can alter satellite cell activity, however the role of neonatal PO4 nutrition on satellite cell biology remains obscure. Twenty-one piglets (1 day of age, 1.8 ± 0.2 kg BW) were pair-fed liquid diets that were either PO4 adequate (0.9% total P), supra-adequate (1.2% total P) in PO4 requirement or deficient (0.7% total P) in PO4 content for 12 days. Body weight was recorded daily and blood samples collected every 6 days. At day 12, pigs were orally dosed with BrdU and 12 h later, satellite cells were isolated. Satellite cells were also cultured in vitro for 7 days to determine if PO4 nutrition alters their ability to proceed through their myogenic lineage. Dietary PO4 deficiency resulted in reduced (P | 0.05) sera PO4 and parathyroid hormone (PTH) concentrations, while supra-adequate dietary PO4 improved (P | 0.05) feed conversion efficiency as compared to the PO4 adequate group. In vivo satellite
Brown adipose tissue (BAT) is an energy-dispensing thermogenic tissue that plays an important role in balancing energy metabolism. Lineage-tracing experiments indicate that brown adipocytes are derived from myogenic progenitors during embryonic development. However, adult skeletal muscle stem cells (satellite cells) have long been considered uniformly determined toward the myogenic lineage. Here, we report that adult satellite cells give rise to brown adipocytes and that microRNA-133 regulates the choice between myogenic and brown adipose determination by targeting the 3UTR of Prdm16. Antagonism of microRNA-133 during muscle regeneration increases uncoupled respiration, glucose uptake, and thermogenesis in local treated muscle and augments whole-body energy expenditure, improves glucose tolerance, and impedes the development of diet-induced obesity. Finally, we demonstrate that miR-133 levels are downregulated in mice exposed to cold, resulting in de novo generation of satellite cell-derived ...
Skeletal muscle satellite cells located between the plasma membrane and the basal lamina of muscle fibres, could for many years, only be studied in situ by electron microscopy. The introduction of immunohistochemistry and the discovery of molecular markers of satellite cells then made them accessible for light microscopic studies and a wealth of information is today available. Satellite cells are myogenic stem cells that can be activated from a quiescent state to proliferate for self-renewal or differentiate into myogenic cells. The satellite cells are involved in muscle growth during fetal and postnatal development and play a key role in repair and regeneration of damaged muscle fibres. The satellite cells are also essential for muscle fibre hypertrophy and maintenance of muscle mass in the adult. When the present thesis was initiated, studies on satellite cells in human skeletal muscle relied on the neuronal cell adhesion molecule (NCAM) as a marker for satellite cell identification. The ...
Skeletal muscle is maintained and repaired by resident stem cells called muscle satellite cells, but there is a gradual failure of this process during the progressive skeletal muscle weakness and wasting that characterises muscular dystrophies. The pathogenic mutation causes muscle wasting, but in conditions including Duchenne muscular dystrophy, the mutant gene is not expressed in satellite cells, and so muscle maintenance/repair is not directly affected. The chronic muscle wasting, however, produces an increasingly hostile micro-environment in dystrophic muscle. This probably combines with excessive satellite cell use to eventually culminate in an indirect failure of satellite cell-mediated myofibre repair. By contrast, in disorders such as Emery-Dreifuss muscular dystrophy, the pathogenic mutation not only instigates muscle wasting, but could also directly compromise satellite cell function, leading to less effective muscle homeostasis. This may again combine with excessive use and a hostile ...
A recent study by Rudnicki and colleagues has sought to address the question of satellite-cell heterogeneity directly (Kuang et al., 2007). The authors have shown that ∼90% of satellite cells on myofibres of adult Myf5cre/+ mice had had a `myogenic experience and expressed Myf5 at some point (as shown by the presence of YFP from the recombined targeted ROSA locus). The remaining ∼10% of satellite cells were YFP-negative, and were able to produce further YFP-negative and YFP-positive cells both in vitro and in vivo. When grafted into Pax7-null mice, these YFP-negative cells gave rise to approximately three times more Pax7-positive satellite cells than the YFP-positive cells, and a quarter of these remained YFP-negative. It was proposed by the authors that these YFP-negative cells correspond to a dedicated subset of satellite cells that have more stem-cell-like characteristics (satellite `stem cells), and that the YFP-positive cells are their transit-amplifying progeny that can undergo ...
def: Any process that stops, prevents or reduces the frequency, rate or extent of satellite cell proliferation. [GO_REF:0000058, GOC:TermGenie, PMID:23212449 ...
The researchers suggested that the increase in skeletal muscle satellite cell numbers induced by whey protein supplementation may promote more favourable training adaptations over more prolonged periods.​. Other studies have also reported increases in satellite cell numbers in response to protein supplementation and strength training programmes of similar duration. Previous research has also suggested that increases in satellite cell numbers are a necessary precursor to increasing skeletal muscle mass.. However, more research is needed to clarify potential mechanisms and benefits of increased satellite cell numbers.. More data are needed to examine how increasing dietary protein intake mechanistically affects satellite cell turnover and if protein-induced increases in satellite cell number provide any added benefit to resistance-trained individuals (i.e., reducing recovery time between training bouts due to satellite cell-mediated recovery mechanisms),​ wrote the researchers.. The exact ...
Objective 1: Differentiate the effects of fetal versus postnatal maternal dietary protein restriction on satellite cell accretion and skeletal muscle mass. Sub-objective 1.A. Determine in vivo the number of skeletal muscle satellite cells undergoing division, apoptosis, and differentiation in term fetuses of mouse dams that are fed a protein-restricted (PR) or a control (C) diet ad libitum during gestation. Sub-objective 1.B. Determine in vivo the number of skeletal muscle satellite cells undergoing division, differentiation, and apoptosis in 21-d-old mouse pups that are suckled by dams fed either a PR or a C diet ad libitum from birth. Sub-objective 1.C. Determine satellite cell and myonuclear numbers, myofiber cross-sectional area, and muscle mass in the 15-wk-old and 18-mo-old offspring of dams fed a PR diet either during gestation or during the suckling period, and then refed from birth (suckled on C dams) or after weaning (C diet, ad libitum), respectively. Objective 2: Determine if ...
The ability to form a regeneration blastema, which leads to the epimorphic regeneration of complex body structures, is restricted to some amphibians and fish among vertebrates (Poss et al., 2003). A conundrum of regenerative biology is why mammals, with a few exceptions, do not form a blastema or a blastema-like structure despite the fact that they can functionally repair some tissues, such as skeletal muscle (Charge and Rudnicki, 2004) and liver (Fausto and Campbell, 2003). Of particular interest is whether the generation of progenitor cells during epimorphic regeneration in salamander and during mammalian tissue repair proceeds by the activation of different or overlapping mechanisms. A unique feature of blastema formation in salamanders is the process of dedifferentiation of stump tissues that follows appendage removal. The possibility to induce blastema formation and regeneration in mammals through the activation of a comparable dedifferentiation program has been proposed (Hughes, 2001; ...
Diet-induced obesity impairs muscle satellite cell activation and muscle repair through alterations in hepatocyte growth factor signaling Academic Article ...
The primary aim of our study was to validate the assessment of myonuclear and satellite cell number in biopsies from human skeletal muscle. We found that 25 type I and 25 type II fibers are sufficient to estimate the mean number of myonuclei per fiber. In contrast, the assessment of satellite cells improved when more fibers were included. Second, we report that small differences in counting satellite cells using CD56 and Pax7 antibodies can be attributed to the different staining profiles. Third, we provide support for the use of Ki67 in evaluating the proportion of active satellite cells. We observed very few (up to 1.3%) active satellite cells in healthy adult skeletal muscle at rest, but they increased significantly (up to 7-fold) following muscle activity. This study provides valuable tools to assess the behavior of satellite cells, both in pathological conditions and in response to physiological stimuli.. ...
Factors Influencing Satellite Cell Activity during Skeletal Muscle Development in Avian and Mammalian Species - Muscle Regeneration;Muscle Development;Mitogenic Factors;Meat Production;Poultry;Mammals;
BACKGROUND: Amyotrophic lateral sclerosis (ALS) is the most common adult-onset neurodegenerative disease characterized by ascending muscle weakness, atrophy
Abstract. Skeletal muscle stem cells from food-producing animals are of interest to agricultural life scientists seeking to develop a better understanding of the molecular regulation of lean tissue (skeletal muscle protein hypertrophy) and intramuscular fat (marbling) development. Enhanced understanding of muscle stem cell biology and function is essential for developing technologies and strategies to augment the metabolic efficiency and muscle hypertrophy of growing animals potentially leading to greater efficiency and reduced environmental impacts of animal production, while concomitantly improving product uniformity and consumer acceptance and enjoyment of muscle foods.. Keywords: Skeletal muscle stem cells, Satellite cells, Adipocytes, Adipofibroblasts, Embryogenesis, Postnatal myogenesis. ...
Monitoring Editor: Marianne Bronner-Fraser Genetically engineered mice (Myf5(nLacZ/+), Myf5(GFP-P/+)) allowing direct muscle satellite cell (SC) visualization indicate that, in addition to being located beneath myofiber basal laminae, SCs are strikingly close to capillaries. After GFP(+) bone marrow transplantation, blood-borne cells occupying SC niches previously depleted by irradiation, were similarly detected near vessels, thereby corroborating the anatomical stability of juxtavascular SC niches. BrdU pulse-chase experiments also localize quiescent and less quiescent SCs near vessels. SCs, and to a lesser extent myonuclei, were nonrandomly associated with capillaries in humans. Significantly, they were correlated with capillarisation of myofibers, regardless to their type, in normal muscle. They also varied in paradigmatic physiological and pathological situations associated with variations of capillary density, including amyopathic dermatomyositis, a unique condition in which muscle capillary loss
Development. 2015 May 1;142(9):1572-1581. Review Dumont NA1, Wang YX2, Rudnicki MA3. Abstract Muscle stem cells, termed satellite cells, are crucial for skeletal muscle growth and regeneration. In healthy adult muscle, satellite cells are quiescent but poised for activation. During muscle regeneration, activated satellite cells transiently re-enter the cell cycle to proliferate and subsequently exit the cell cycle to differentiate or self-renew. Recent studies have demonstrated that satellite cells are heterogeneous and that subpopulations of satellite stem cells are able to perform asymmetric divisions to generate myogenic progenitors or symmetric divisions to expand the satellite cell pool. Thus, a complex balance between extrinsic cues and intrinsic regulatory mechanisms is needed to tightly control satellite cell cycle progression and cell fate determination. Defects in satellite cell regulation or in their niche, as observed in degenerative conditions such as aging, can impair muscle ...
Satellite cells are skeletal muscle progenitor/stem cells that reside between the basal lamina and plasma membranes of skeletal fibers in vivo. These cells can give rise to both myogenic and adipogenic cells. Given the possible role for differentiation of satellite cells into adipocytes in marbling and in some pathological disorders like sarcopenia, knowledge of the proteins involved in such process remains obscure. Using two-dimensional polyacrylamide gel electrophoresis coupled with mass spectrometry, we investigated the proteins that are differentially expressed during adipogenic differentiation of satellite cells from bovine longissimus muscle. Our proteome mapping strategy to identify the differentially expressed intracellular proteins during adipogenic differentiation revealed a total of 25 different proteins. The proteins up-regulated during adipogenic differentiation of satellite cells like Cathepsin H precursor, Retinal dehydrogenase 1, Enoyl-CoA hydratase, Ubiquinol-cytochrome-c ...
Skeletal muscle undergoes a progressive age-related loss in mass and function. Preservation of muscle mass depends in part on satellite cells, the resident stem cells of skeletal muscle. Reduced satellite cell function may contribute to the age-associated decrease in muscle mass. Here, we focused on characterizing the effect of age on satellite cell migration. We report that aged satellite cells migrate at less than half the speed of young cells. In addition, aged cells show abnormal membrane extension and retraction characteristics required for amoeboid-based cell migration. Aged satellite cells displayed low levels of integrin expression. By deploying a mathematical model approach to investigate mechanism of migration, we have found that young satellite cells move in a random memoryless manner, whereas old cells demonstrate superdiffusive tendencies. Most importantly, we show that nitric oxide, a key regulator of cell migration, reversed the loss in migration speed and reinstated the ...
Sex steroids are known to be involved in skeletal muscle development (anabolic effect) and are frequently used in medicines. It has been known that pork contains a variety of steroids that are mainly synthesized in the gonads (testis and ovary). Thus, the present study was conducted to evaluate the effects of anabolic steroids of pork on the proliferation and differentiation of myogenic satellite cells (MSC). Three different methods (M1, M2, and M3) were developed for the isolation and purification of steroids from porcine tissues. Among three extraction methods that we developed, M3 was the best method with respect to the quantities of steroids and the induction of MSC proliferation. Hormonal analysis showed that the steroid hormone levels were the highest in muscle and fat of intact male than those of castrated males and females. In addition, the highest serum levels of nandrolone and testosterone were detected in intact males, whereas estrone and 17 beta-estradiol levels were similar in the ...
Omega-3 polyunsaturated fatty acids (n-3 PUFAs), which are commonly found in fish oil supplements, are known to possess anti-inflammatory properties and more recently alter skeletal musclefunction. In this review, we discuss novel findings related to how n-3 PUFAs modulate molecular signaling responsible for growth and hypertrophy as well as the activity of muscle stem cells. Muscle stem cells commonly known as satellite cells, are primarily responsible for driving the skeletal muscle repair process to potentially damaging stimuli, such as mechanical stress elicited by exercise contraction. To date, there is a paucity of human investigations related to the effects of n-3 PUFAs on satellite cell content and activity. Based on current in vitro investigations, this review focuses on novel mechanisms linking n-3 PUFAs to satellite cell activity and how they may improve muscle repair. Understanding the role of n-3 PUFAs during muscle growth and regeneration in association with exercise could lead to ...
Skeletal muscle fibres form by fusion of mesoderm progenitors called myoblasts. After birth, muscle fibres do not increase in number but continue to grow in size because of fusion of satellite cells, the postnatal myogenic cells, responsible for muscle growth and regeneration. Numerous studies suggest that, on transplantation, non-myogenic cells also may contribute to muscle regeneration. However, there is currently no evidence that such a contribution represents a natural developmental option of these non-myogenic cells, rather than a consequence of experimental manipulation resulting in cell fusion. Here we show that pericytes, transgenically labelled with an inducible Alkaline Phosphatase CreERT2, but not endothelial cells, fuse with developing myofibres and enter the satellite cell compartment during unperturbed postnatal development. This contribution increases significantly during acute injury or in chronically regenerating dystrophic muscle. These data show that pericytes, resident in ...
Under normal circumstances, mammalian adult skeletal muscle is a stable tissue with very little turnover of nuclei. However, upon injury, skeletal muscle has the remarkable ability to initiate a rapid and extensive repair process preventing the loss of muscle mass. Skeletal muscle repair is a highly synchronized process involving the activation of various cellular responses. The initial phase of muscle repair is characterized by necrosis of the damaged tissue and activation of an inflammatory response. This phase is rapidly followed by activation of myogenic cells to proliferate, differentiate, and fuse leading to new myofiber formation and reconstitution of a functional contractile apparatus. Activation of adult muscle satellite cells is a key element in this process. Muscle satellite cell activation resembles embryonic myogenesis in several ways including the de novo induction of the myogenic regulatory factors. Signaling factors released during the regenerating process have been identified, but their
Skeletal muscle stem cells from food-producing animals are of interest to agricultural life scientists seeking to develop a better understanding of the molecular regulation of lean tissue (skeletal muscle protein hypertrophy) and intramuscular fat (marbling) development. Enhanced understanding of muscle stem cell biology and function is essential for developing technologies and strategies to augment the metabolic efficiency and muscle hypertrophy of growing animals potentially leading to greater efficiency and reduced environmental impacts of animal production, while concomitantly improving product uniformity and consumer acceptance and enjoyment of muscle foods ...
Zeb1, a zinc finger E-box binding homeobox epithelial-mesenchymal (EMT) transcription factor, confers properties of stemness, such as self-renewal, in cancer. Yet little is known about the function of Zeb1 in adult stem cells. Here, we used the hematopoietic system, as a well-established paradigm of stem cell biology, to evaluate Zeb1 mediated regulation of adult stem cells. We employed a conditional genetic approach using the Mx1-Cre system to specifically knockout (KO) Zeb1 in adult hematopoietic stem cells (HSCs) and their downstream progeny. Acute genetic deletion of Zeb1 led to rapid onset thymic atrophy and apoptosis driven loss of thymocytes and T cells. A profound cell-autonomous self-renewal defect and multi-lineage differentiation block was observed in Zeb1 KO HSCs. Loss of Zeb1 in HSCs activated transcriptional programs of deregulated HSC maintenance and multi-lineage differentiation genes, and of cell polarity, consisting of cytoskeleton, lipid metabolism/lipid membrane and cell ...
Skeletal muscle stem cells, called satellite cells and defined by the transcription factor PAX7, are responsible for postnatal muscle growth, homeostasis and regeneration. Attempts to utilize the regenerative potential of muscle stem cells for therapeutic purposes so far failed. We previously established the existence of human PAX7-positive cell colonies with high regenerative potential. We now identified PAX7-negative human muscle-derived cell colonies also positive for the myogenic markers desmin and MYF5. These include cells from a patient with a homozygous PAX7 c.86-1G , A mutation (PAX7null). Single cell and bulk transcriptome analysis show high intra- and inter-donor heterogeneity and reveal the endothelial cell marker CLEC14A to be highly expressed in PAX7null cells. All PAX7-negative cell populations, including PAX7null, form myofibers after transplantation into mice, and regenerate muscle after reinjury. Transplanted PAX7neg cells repopulate the satellite cell niche where they ...
Pax7 expressing muscle stem cells accompany all skeletal muscles in the body and in healthy individuals, efficiently repair muscle after injury. Currently, the in vitro manipulation and culture of these cells is still in its infancy, yet muscle stem cells may be the most promising route towards the therapy of muscle diseases such as muscular dystrophies.It is often overlooked that muscular dystrophies affect head and body skeletal muscle differently. Moreover, these muscles develop differently. Specifically, head muscle and its stem cells develop from the non-somitic head mesoderm which also has cardiac competence. To which extent head muscle stem cells retain properties of the early head mesoderm and might even be able to switch between a skeletal muscle and cardiac fate is not known. This is due to the fact that the timing and mechanisms underlying head muscle stem cell development are still obscure. Consequently, it is not clear at which time point one should compare the properties of head
EuroStemCell researchers from the Institut Pasteur have isolated muscle stem cells displaying a high potential for muscle repair. These...
Scientists have found that genes important for forming muscle cells in embryos and newborns are not needed in adult muscle stem cells to regenerate muscles after injury.
Lamin A is a component of the inner nuclear membrane that, together with epigenetic factors, organizes the genome in higher order structures required for transcriptional control. Mutations in the Lamin A/C gene cause several diseases, belonging to the class of laminopathies, including muscular dystrophies. Nevertheless, molecular mechanisms involved in the pathogenesis of Lamin A-dependent dystrophies are still largely unknown. Polycomb group of proteins (PcG) are epigenetic repressors and Lamin A interactors, primarily involved in the maintenance of cell identity. Using a murine model of Emery-Dreifuss Muscular Dystrophy (EDMD), we showed here that Lamin A loss deregulated PcG positioning in muscle satellite stem cells leading to de-repression of non-muscle specific genes and p16INK4a, a senescence driver encoded in the Cdkn2a locus. This aberrant transcriptional programme caused impairment in self-renewal, loss of cell identity and premature exhaustion of quiescent satellite cell pool. Genetic ...
Adult muscle satellite (stem) cells are quiescent during homeostasis. We showed that Notch signaling is highest in quiescent muscle satellite cells, and this
Translational control of gene expression is an important regulator of adult stem cell quiescence, activation and self-renewal. In skeletal muscle, quiescent satellite cells maintain low levels of protein synthesis, mediated in part through the phosphorylation of eIF2α (P-eIF2α). Pharmacological inhibition of the eIF2α phosphatase with the small molecule sal003 maintains P-eIF2α and permits the expansion of satellite cells ex vivo. Paradoxically, P-eIF2α also increases the translation of specific mRNAs, which is mediated by P-eIF2α-dependent read-through of inhibitory upstream open reading frames (uORFs). Here, we ask whether P-eIF2α-dependent mRNA translation enables expansion of satellite cells. Using transcriptomic and proteomic analyses, we show a number of genes associated with the assembly of the spindle pole to be upregulated at the level of protein, without corresponding change in mRNA levels, in satellite cells expanded in the presence of sal003. We show that uORFs in the 5′ UTR ...
Satellite cells are self-renewing muscle stem cells, which mediate the growth and repair of skeletal muscle (Zammit et al., 2006). When the muscle is damaged, these cells leave their state of quiescence, proliferate at length to generate colonies of myoblasts, and then differentiate to form multinucleated myotubes (Zammit et al., 2006). The myogenic factor that is mainly involved in controlling the progression of these myoblasts into the differentiation state is MyoD (Le Grand and Rudnicki, 2007). This protein, which preferentially binds to a DNA consensus site (CANNTG) called an E-box, has been shown in both myogenic (C2C12) and nonmyogenic cell lines to be highly important in controlling the transcription of differentiation-specific genes (Berkes and Tapscott, 2005). This function correlates in part to the ability of MyoD to recruit histone acetyltransferases (e.g., PCAF and p300) and SWI/SNF chromatin-remodeling complexes to the promoters of these genes to affect specific changes in chromatin ...
Video articles in JoVE about satellite cells skeletal muscle include Isolation and Culture of Individual Myofibers and their Satellite Cells from Adult Skeletal Muscle, Preparation and Culture of Myogenic Precursor Cells/Primary Myoblasts from Skeletal Muscle of Adult and Aged Humans, Isolation, Culture, and Transplantation of Muscle Satellite Cells, Adult and Embryonic Skeletal Muscle Microexplant Culture and Isolation of Skeletal Muscle Stem Cells, Isolation and Quantitative Immunocytochemical Characterization of Primary Myogenic Cells and Fibroblasts from Human Skeletal Muscle, Preparation of Primary Myogenic Precursor Cell/Myoblast Cultures from Basal Vertebrate Lineages, Isolation of Type I and Type II Pericytes from Mouse Skeletal Muscles, Isolation and Characterization of Satellite Cells from Rat Head Branchiomeric Muscles, Minimally Invasive Muscle Embedding (MIME) - A Novel Experimental Technique to Facilitate Donor-Cell-Mediated Myogenesis, Applications of In Vivo Functional
PubMed journal article: Reduced satellite cell numbers with spinal cord injury and aging in humans. Download Prime PubMed App to iPhone, iPad, or Android
The functional relevance of stem cell niche perturbation in sarcomagenesis is defined and the mouse model presented provides a rationale for the use of combination therapy for the treatment of genetically heterogeneous sarcomas.
Introduction: COPD is a disease of accelerated ageing, as increased cellular-ageing (senescence) occurs in the lungs of these patients. We aim at developing a primary skeletal muscle cell culture (Human skeletal muscle satellite cells [HSKMC]) model of muscle ageing to study the cascade of events that occur in muscle senescence in vitro and to explore the effect of inflammation (TNF alpha) and oxidative stress (H2O2), two of the putative mechanisms related to muscle dysfunction and/wasting, on muscle differentiation and on protein loss in differentiated cells.. Methods and Results: HSKMC were cultured to senescence when the cells stopped replicating. DNA was isolated from cells in serial passages of culture. Telomere length, a marker of biological ageing, was measured by qPCR and expressed as the ratio of telomere repeat copy number to single gene copy number in the experimental sample relative to a control sample (relative T/S ratio) (n=3). Preliminary results show a progressive shortening of ...
TY - JOUR. T1 - Common and Distinctive Functions of the Hippo Effectors Taz and Yap in Skeletal Muscle Stem Cell Function. AU - Sun, Congshan. AU - De Mello, Vanessa. AU - Mohamed, Abdalla. AU - Quiroga, Huascar P. Ortuste AU - Garcia-Munoz, Amaya AU - Al Bloshi, Abdullah AU - Tremblay, Annie M.. AU - von Kriegsheim, Alexander AU - Collie-Duguid, Elaina. AU - Vargesson, Neil. AU - Matallanas, David. AU - Wackerhage, Henning. AU - Zammit, Peter S.. N1 - Funded by MRC grant G11001931 to HW and PSZ, European Unions Seventh Framework Programme for research, technological development and demonstration under grant agreement number 262948-2 (BIODESIGN), with additional support from AssociationFrançaise Contre les Myopathies, BBSRC, Sarcoma UK and Friends of Anchor.. PY - 2017/8. Y1 - 2017/8. N2 - Hippo pathway downstream effectors Yap and Taz play key roles in cell proliferation and regeneration, regulating gene expression especially via Tead transcription factors. To investigate their role in ...
Research shows that a typical chicken views a light source much differently than a human eye would. For instance, the graphs below show that humans and chickens perceive green light similarly, but chickens have enhanced sensitivity to reds, blues and ultraviolet light. Additional research has shown that different wavelengths can be used to enhance various aspects of development. For example, green light increases growth during the early stages of development by enhancing proliferation of skeletal muscle satellite cells, which repair and build muscle. Blue light is helpful in the growth and sexual development of poultry at a later age by elevation of plasma androgens, allowing the bird to put on more muscle mass. Combined green and blue light promotes myofiber growth due to more effective stimulation of testosterone secretion.. By organizing individual LEDs to activate at predetermined voltage levels, it is feasible to implement a color-shifting technology, which is the foundation of AgriShift® ...
Characterization of skeletal muscle satellite cells metabolism and redox balance: role of aldehydes as metabolic sensors. Scholarships in Brazil Doctorate. Kátia Maria Gomes Andrade. Biological Sciences
The composition of the extracellular matrix (ECM) of skeletal muscle fibers is a unique environment that supports the regenerative capacity of satellite cells; the resident stem cell population. The impact of environment has great bearing on key properties permitting satellite cells to carry out tissue repair. In this study, we have investigated the influence of the ECM and glycolytic metabolism on satellite cell emergence and migration-two early processes required for muscle repair. Our results show that both influence the rate at which satellite cells emerge from the sub-basal lamina position and their rate of migration. These studies highlight the necessity of performing analysis of satellite behavior on their native substrate and will inform on the production of artificial scaffolds intended for medical uses.
Satellite cells are stem cells with an essential role in skeletal muscle repair. Precise regulation of gene expression is critical for proper satellite cell quiescence, proliferation, differentiation and self-renewal. Nuclear proteins required for gene expression are dependent on the nucleocytoplasmic transport machinery to access to nucleus, however little is known about regulation of nuclear transport in satellite cells. The best characterized nuclear import pathway is classical nuclear import which depends on a classical nuclear localization signal (cNLS) in a cargo protein and the heterodimeric import receptors, karyopherin alpha (KPNA) and beta (KPNB). Multiple KPNA1 paralogs exist and can differ in importing specific cNLS proteins required for cell differentiation and function. We show that transcripts for six Kpna paralogs underwent distinct changes in mouse satellite cells during muscle regeneration accompanied by changes in cNLS proteins in nuclei. Depletion of KPNA1, the most ...
Background Postnatal growth and repair of skeletal muscle relies upon a population of quiescent muscle precursor cells, called satellite cells that can be activated to proliferate and differentiate into new myofibers, as well as self-renew to replenish the satellite cell population. future rounds of regeneration. After a second round of injury, muscle regeneration is impaired in C/EBP conditional CVT-313 knockout mice compared to wild-type control mice. We find that C/EBP can regulate Notch2 expression and that restoration of Notch activity in myoblasts lacking C/EBP prevents precocious differentiation. Conclusions These findings demonstrate that C/EBP is a novel regulator of satellite cell self-renewal during muscle regeneration acting at least in part through Notch2. R1 (C19?kb; chr3:97,797,949-97,798,354) F: TGAGGAAGTTGACAGGGAGC, R: GTGTCCAGGGCAACTTGGAA; R2 (+11?kb; chr3:97,828,475-97,828,573) F: GGAAGCGATCGGTGTTGTTG, R: AAAAGCAGTGGGGCGTCTTA; R3 (+14?kb; chr3:97,831,399-97,831,590) F: ...
This study demonstrated a number of novel findings regarding satellite cell proliferation in the skeletal muscles of the OZR model of metabolic syndrome. First, there was a decrease in the number of myonuclei in muscle fiber cross sections of the OZR compared with the LZR. Second, this study is the first to show that hypertrophy is not impaired in muscles of the OZR model of metabolic syndrome, if the stimulus is adequate. In addition, to the best of our knowledge, this is the first study to observe any form of loading-induced hypertrophy in any rodent model of metabolic syndrome. The third novel finding is that, although there is no change in the proportion of quiescent satellite cells in control muscles, there was a significant attenuation of satellite cell proliferation of adult muscle under normal control loading conditions in the OZR compared with the LZR. The attenuation of satellite cell proliferation in control soleus and plantaris muscles that we observed in this study may result in a ...
Acellular matrix obtained from homologous muscular tissue has been previously used to repair muscular defects. However, the implants, although not rejected, give rise to an intense inflammatory response and are rapidly replaced by fibrous tissue. In this study we examined the possibility that co-culture with autologous satellite cells can improve the efficiency of homologous acellular matrix as skeletal muscle substitute. Satellite cells, isolated from rat dorsal muscle, were cultured in vitro on homologous acellular matrix obtained by detergent-enzymatic treatment of abdominal muscle fragments. Scanning electron microscopy revealed that after 24 h of co-culture satellite cells were attached to the matrix, but still possessed a round shape. After 96 h, seeded cells began to flatten and to differentiate, originating few multinucleated myotubes. Patches of homologous matrix, seeded or not with autologous satellite cells, were implanted in the dorsal muscle of rats. At autopsy, the implants were ...
Satellite cells are located near mature muscle fibers in mice and humans and stay in a dormant state until called upon for repair work. In earlier experiments, Rudnicki found that some satellite cells function as stem cells and maintain overall numbers of satellite cells. He distinguished these from other satellite cells, which are in various stages on the road to becoming muscle tissue.. In muscular dystrophy, satellite cells are believed to become depleted quickly because tissue damage places great demands on them for repairs. Enhancing their numbers could slow the process of muscle degeneration, even in the face of disease.. In muscle degenerative diseases, one of the big problems is thought to be that the muscles run out of repair cells, says Paul Muhlrad, a research program coordinator at MDA. Rudnickis laboratory has figured out the biochemical pathways the body uses to maintain the supply.. When the OHRI researchers injected genes for the WNT7a protein into muscle fibers in mice, ...
miR-133 suppresses Prdm16 expression in skeletal muscle stem cells (satellite cells), which controls myogenic vs. brown ... "MicroRNA-133 controls brown adipose determination in skeletal muscle satellite cells by targeting Prdm16". Cell Metabolism. 17 ... "MicroRNA regulation of cell lineages in mouse and human embryonic stem cells". Cell Stem Cell. 2 (3): 219-29. doi:10.1016/j. ... BMP2 controls bone cell determination by inducing miRNAs that target muscle genes but mainly by down-regulating multiple miRNAs ...
"Androgen receptor in human skeletal muscle and cultured muscle satellite cells: up-regulation by androgen treatment". The ... Males typically have more skeletal muscle mass than females. Androgens promote the enlargement of skeletal muscle cells and ... probably act in a coordinated manner to function by acting on several cell types in skeletal muscle tissue.[8] One cell type ... The mesoderm-derived epithelial cells of the sex cords in developing testes become the Sertoli cells, which will function to ...
CS1 maint: discouraged parameter (link) Church, J. C. T. (1968). The Satellite Cell of Skeletal Muscle (Doctoral thesis) " ...
"Salamander limb regeneration involves the activation of a multipotent skeletal muscle satellite cell population". J. Cell Biol ... 2006). "AP-2alpha: a regulator of EGF receptor signaling and proliferation in skin epidermis". J. Cell Biol. 172 (3): 409-21. ... Cell Biol. 172 (3): 383-93. doi:10.1083/jcb.200507057. PMC 2063648. PMID 16449189. Wang X, Bolotin D, Chu DH, et al. ( ...
Early posthatch starvation decreases satellite cell proliferation and skeletal muscle growth in chicks. J. Nutr. 130: 858-864. ... However, long-term fasting almost completely arrests cell mitosis and decreases the number of satellite cells. In the study of ... The growth and composition of skeletal muscle in the chicken. 2. The relationship between muscle weight and the number of ... 2000) showed that the length and timing of fasting post hatch affects satellite cell activity. Short-term fasting can enhance ...
Activation and proliferation of satellite cells then facilitate an increase in skeletal muscle growth.[25] ... Trenbolone acetate also has the ability to increase red blood cell count. With a larger amount of red blood cells, blood ... This naturally produced protein-based hormone affects every cell in the body of an organism and plays a large role in muscle ... Extreme muscle growth and cell splitting compared is facilitated through trenbolone acetate administration when compared to ...
Wnt plays a crucial role in satellite cell regulation and skeletal muscle aging and also regeneration. Wnts are known to active ... Motohashi, N.; Asakura, Atsushi (January 2014). "Muscle satellite cell heterogeneity and self-renewal". Frontiers in Cell and ... MyoD mRNA levels are also reported to be elevated in aging skeletal muscle. One of the main actions of MyoD is to remove cells ... The effect of MyoD on satellite cells is dose-dependent; high MyoD expression represses cell renewal, promotes terminal ...
... mature myostatin protein expression despite increasing skeletal muscle hypertrophy and satellite cell number in rodent muscle ... muscle in orchiectomized rats". The FASEB Journal. 27: 939-15. doi:10.1096/fasebj.27.1_supplement.939.15 (inactive 2021-01-15). ...
"Androgen receptor in human skeletal muscle and cultured muscle satellite cells: up-regulation by androgen treatment". The ... januar 2006). "Testosterone inhibits adipogenic differentiation in 3T3-L1 cells: nuclear translocation of androgen receptor ... complex with beta-catenin and T-cell factor 4 may bypass canonical Wnt signaling to down-regulate adipogenic transcription ...
... myogenic precursors expressing Pax3 and/or Pax7 form satellite cells within the skeletal muscle, which contribute to postnatal ... To form other skeletal muscles, Pax3-expressing cells detach from the dermomyotome and migrate to more distant sites, such as ... To form skeletal muscle in central body segments, PAX3-expressing cells detach from the dermomyotome and then Pax3 expression ... A subset of these Pax3-expressing dermomyotome-derived cells also serves as an ongoing progenitor pool for skeletal muscle ...
... mature myostatin protein expression despite increasing skeletal muscle hypertrophy and satellite cell number in rodent muscle ... "Effect of Trenbolone enanthate on protein degradation in levator ani/bulbocavernosus (LABC) muscle in orchiectomized rats" ...
... it may be induced by a combination of a gradual failure in the satellite cells which help to regenerate skeletal muscle fibers ... Muscle atrophies[edit]. Main article: Muscle atrophy. Disuse atrophy of muscles and bones, with loss of mass and strength, can ... which is notable for the severe muscle atrophy seen. Other syndromes or conditions which can induce skeletal muscle atrophy are ... to or the availability of critical secreted growth factors which are necessary to maintain muscle mass and satellite cell ...
"A Novel Approach to Collecting Satellite Cells From Adult Skeletal Muscles on the Basis of Their Stress Tolerance". Stem Cells ... In newts, muscle tissue is regenerated from specialized muscle cells that dedifferentiate and forget the type of cell they had ... human iPS cell-derived myeloid cell lines as unlimited cell source for dendritic cell-like antigen-presenting cells". Gene ... Such cells exhibit capability for skeletal muscle regeneration with markedly lower tumorigenic risk when compared to iPSCs. The ...
Montarras, D. (2005-09-23). "Direct Isolation of Satellite Cells for Skeletal Muscle Regeneration". Science. 309 (5743): 2064- ... muscle development and showed that Pax-positive satellite cells associated with adult fibres constitute stem cells for muscle ... cells fail to form skeletal muscle and acquire other mesodermal cell fates. Characterisation of Myf5 enhancers revealed a ... Crist, Colin G.; Montarras, Didier; Buckingham, Margaret (July 2012). "Muscle Satellite Cells Are Primed for Myogenesis but ...
As one of the key cell markers of satellite cells (the stem cell pool for skeletal muscles), it plays an important role in the ... "Expression of CD34 and Myf5 defines the majority of quiescent adult skeletal muscle satellite cells". The Journal of Cell ... regulation of vertebrate skeletal myogenesis by cell-cell contact". Journal of Cell Science. 118 (Pt 11): 2355-62. doi:10.1242/ ... While the product of this gene is capable of directing cells towards the skeletal muscle lineage, it is not absolutely required ...
Wnt plays a crucial role in satellite cell regulation and skeletal muscle aging and also regeneration. Wnts are known to active ... muscle cell fate commitment. • cellular response to estradiol stimulus. • skeletal muscle fiber adaptation. • muscle organ ... skeletal muscle cell differentiation. • positive regulation of skeletal muscle tissue regeneration. • regulation of gene ... skeletal muscle fiber development. • histone H3 acetylation. • myotube differentiation involved in skeletal muscle regeneration ...
Satellite cells are precursors to skeletal muscle cells, able to give rise to satellite cells or differentiated skeletal muscle ... Myosatellite cells, also known as satellite cells or muscle stem cells, are small multipotent cells with very little cytoplasm ... Zammit, PS; Partridge, TA; Yablonka-Reuveni, Z (November 2006). "The skeletal muscle satellite cell: the stem cell that came in ... HGF testing is also used to identify active satellite cells. Activated satellite cells also begin expressing muscle-specific ...
... "satellite cells" which help to regenerate skeletal muscle fibers, and a decrease in sensitivity to or the availability of ... Muscle atrophy is defined as a decrease in the mass of the muscle; it can be a partial or complete wasting away of muscle, and ... Inactivity and starvation in mammals lead to atrophy of skeletal muscle, accompanied by a smaller number and size of the muscle ... Other syndromes or conditions which can induce skeletal muscle atrophy are liver disease, and starvation. Muscle atrophy occurs ...
Myoblasts in skeletal muscle that do not form muscle fibers dedifferentiate back into myosatellite cells. These satellite cells ... However muscle cells cannot divide to produce new cells, and as a result we have fewer muscle cells as an adult than a newborn. ... "The skeletal muscle satellite cell: the stem cell that came in from the cold". Journal of Histochemistry and Cytochemistry. 54 ... and smooth muscle cells. On the other hand, skeletal muscles are formed by morphological units referred to as muscle fibers.[3] ...
Zammit, PS; Partridge, TA; Yablonka-Reuveni, Z (November 2006). "The skeletal muscle satellite cell: the stem cell that came in ... A skeletal muscle refers to multiple bundles (fascicles) of cells joined together called muscle fibers. The fibres and muscles ... Skeletal muscle is one of three major muscle types, the others being cardiac muscle and smooth muscle. It is a form of striated ... Quoted from National Skeletal Muscle Research Center; UCSD, Muscle Physiology Home Page - Skeletal Muscle Architecture, Effect ...
Such conditions result in fusion of committed cells (satellite cells) into myotubes, to form muscle fibers. Skeletal actin ... "Alpha-skeletal actin induces a subset of muscle genes independently of muscle differentiation and withdrawal from the cell ... "Entrez Gene: ACTA1 actin, alpha 1, skeletal muscle". Bandman E (December 1992). "Contractile protein isoforms in muscle ... alpha skeletal muscle is a protein that in humans is encoded by the ACTA1 gene. Actin alpha 1 which is expressed in skeletal ...
Myoblasts in skeletal muscle that do not form muscle fibers dedifferentiate back into myosatellite cells. These satellite cells ... and smooth muscle cells, with various properties. The striated cells of cardiac and skeletal muscles are referred to as muscle ... Zammit, PS; Partridge, TA; Yablonka-Reuveni, Z (November 2006). "The skeletal muscle satellite cell: the stem cell that came in ... A myocyte (also known as a muscle cell)[1] is the type of cell found in muscle tissue. Myocytes are long, tubular cells that ...
... it may be induced by a combination of a gradual failure in the satellite cells which help to regenerate skeletal muscle fibers ... which is notable for the severe muscle atrophy seen. Other syndromes or conditions which can induce skeletal muscle atrophy are ... to or the availability of critical secreted growth factors which are necessary to maintain muscle mass and satellite cell ... During aging, there is a gradual decrease in the ability to maintain skeletal muscle function and mass. This condition is ...
Myoblasts in skeletal muscle that do not form muscle fibers dedifferentiate back into myosatellite cells. These satellite cells ... or a smooth muscle cell as these are both small muscle cells. A cardiac muscle cell is often described as a cardiac muscle ... A skeletal muscle cell is long and threadlike with many nuclei and is called a muscle fiber. Muscle cells including myocytes ... Zammit, PS; Partridge, TA; Yablonka-Reuveni, Z (November 2006). "The skeletal muscle satellite cell: the stem cell that came in ...
Zammit, PS; Partridge, TA; Yablonka-Reuveni, Z (November 2006). "The skeletal muscle satellite cell: the stem cell that came in ... A skeletal muscle is made up of multiple bundles of muscle fascicles of muscle cells known as muscle fibers. The fibers and ... Skeletal muscle (also called striated muscle - although cardiac muscle is also striated) is one of three major muscle types, ... Hill's muscle model In vitro muscle testing Muscle atrophy Musculoskeletal injury Myopathy List of skeletal muscles of the ...
Skeletal muscle is able to regenerate far better than cardiac muscle due to satellite cells, which are dormant in all healthy ... Skeletal muscle includes skeletal muscle fibers, blood vessels, nerve fibers, and connective tissue. Skeletal muscle is wrapped ... There are two types of striated muscles: Cardiac muscle (heart muscle) Skeletal muscle (muscle attached to the skeleton) ... Unlike skeletal muscle, cardiac muscle cells are unicellular. These cells are connected to each other by intercalated disks, ...
... while skeletal muscle damage can be repaired by underlying satellite cells, which fuse to become a new skeletal muscle cell. ... This includes neurons, heart cells, skeletal muscle cells and red blood cells. Although these cells are considered permanent in ... Permanent cells are cells that are incapable of regeneration. These cells are considered to be terminally differentiated and ... Some embryology studies also use permanent cells to avoid harvesting embryonic cells from pregnant animals; since the cells are ...
... "satellite cells" that help to regenerate skeletal muscle fibers, and a decrease in sensitivity to or the availability of ... There are three types of muscle, of which skeletal and cardiac muscle are striated and smooth muscle is not. Muscle action can ... where they fuse into elongate skeletal muscle cells. The three types of muscle (skeletal, cardiac and smooth) have significant ... and propagate contractions to other muscle cells they are in contact with. All skeletal muscle and many smooth muscle ...
His studies showed that muscle satellite cells could be considered to be adult stem cells in muscle fibers. From the studies of ... and give rise to skeletal fiber nuclei or glial cells of the brain "Renewing cell populations" in which adult stem cells are an ... In skeletal muscle, the muscle fibers had been shown to exhibit an age-related increase in the number of nuclei. ... of cell function, in which each cell type has a distinct, unique function; and "activity-rest alternation" of cell function, in ...
Norena, S. R.; Williams, T. M. (2000). "Body size and skeletal muscle myoglobin of cetaceans: adaptations for maximizing dive ... Odontocetes, such as the sperm whale, possess teeth with cementum cells overlying dentine cells. Unlike human teeth, which are ... 11 May 2006). "Satellite-monitored movements of humpback whales in the Southwest Atlantic Ocean". Marine Ecology Progress ... they contain both rod and cone cells, meaning they can see in both dim and bright light, but they have far more rod cells than ...
... in studies using living cells, chikungunya virus appears to replicate in fibroblasts, skeletal muscle progenitor cells, and ... "Human muscle satellite cells as targets of Chikungunya virus infection". PLOS One. 2 (6): e527. Bibcode:2007PLoSO...2..527O. ... specifically skeletal muscles, and joints. In the chronic phase, it is suggested that viral persistence (the inability of the ... bud on the surface of the infected cell, where they are released by exocytosis to infect other cells.[34] ...
... "satellite cells" that help to regenerate skeletal muscle fibers, and a decrease in sensitivity to or the availability of ... The body contains three types of muscle tissue: (a) skeletal muscle, (b) smooth muscle, and (c) cardiac muscle. (Same ... and propagate contractions to other muscle cells they are in contact with. All skeletal muscle and many smooth muscle ... The threadlike muscle fibers are the individual muscle cells (myocytes), and each cell is encased within its own endomysium of ...
... s have specialised light-sensing cells deep in their brains[permanent dead link] that respond to light without input from ... The routes of satellite-tagged bar-tailed godwits migrating north from New Zealand. This species has the longest known non-stop ... Skeletal system. The skeleton consists of very lightweight bones. They have large air-filled cavities (called pneumatic ... Kovacs, Christopher E.; Meyers, RA (2000). "Anatomy and histochemistry of flight muscles in a wing-propelled diving bird, the ...
Creatine supplementation appears to increase the number of myonuclei that satellite cells will 'donate' to damaged muscle ... and determined that creatine is a key player in the metabolism of skeletal muscle. The substance creatine is naturally formed ... Side effects include: Weight gain due to extra water retention to the muscle Potential muscle cramps / strains / pulls Upset ... "Carbohydrate ingestion augments skeletal muscle creatine accumulation during creatine supplementation in humans". Am. J. ...
Skeletal system and locomotion. Amphibians have a skeletal system that is structurally homologous to other tetrapods, though ... Iodine and T4 (over stimulate the spectacular apoptosis [programmed cell death] of the cells of the larval gills, tail and fins ... The pectoral girdle is supported by muscle, and the well-developed pelvic girdle is attached to the backbone by a pair of ... Other satellite males remain quietly nearby, waiting for their opportunity to take over a territory. The females arrive ...
... far less than the length of the elongated muscle cell (a few millimeters in the case of human skeletal muscle cells). The ... of animal satellite cells differentiating into new muscle fibers and not merely providing a support function to muscle cells. ... Types of muscle are striated muscle (such as skeletal muscle and cardiac muscle), obliquely striated muscle (found in some ... Striated muscle has transverse bands of filaments. In obliquely striated muscle, the filaments are staggered. Smooth muscle has ...
skeletal muscle satellite cell maintenance involved in skeletal muscle regeneration. • positive regulation of protein secretion ... skeletal system development. • positive regulation of glucose import. • movement of cell or subcellular component. • muscle ... positive regulation of cell growth involved in cardiac muscle cell development. • activation of MAPK activity. • positive ... positive regulation of cardiac muscle hypertrophy. • positive regulation of smooth muscle cell migration. • تنسخ الحمض النووي ...
myosin Multiple myosin II molecules generate force in skeletal muscle through a power stroke mechanism fuelled by the energy ... The ribbon synapse is a special type of synapse found in sensory neurons such as photoreceptor cells, retinal bipolar cells, ... "Current Opinion in Cell Biology. 22 (4): 496-505. doi:10.1016/j.ceb.2010.05.001. PMC 2963628. PMID 20561775.. ... A cell membrane can be thought of as a capacitor in that positive and negative ions are stored on both sides of the membrane. ...
... was shown to ameliorate the age-related dysfunction of skeletal muscle by rescuing the function of aged muscle stem cells. In ... reversed functional impairments and restored genomic integrity in aged muscle stem cells (satellite cells). Increased GDF11 ... "GDF11 Increases with Age and Inhibits Skeletal Muscle Regeneration". Cell Metabolism. 22 (1): 164-74. doi:10.1016/j.cmet. ... A 2017 study found that super-physiological levels of GDF11 induced muscle wasting in the skeletal muscle of mice.[48] ...
Myoblasts in skeletal muscle that do not form muscle fibers dedifferentiate back into myosatellite cells. These satellite cells ... skeletal, and smooth muscle cells. The striated cells of cardiac and skeletal muscles are referred to as muscle fibers.[3] ... Zammit, PS; Partridge, TA; Yablonka-Reuveni, Z (November 2006). "The skeletal muscle satellite cell: the stem cell that came in ... A myocyte (also known as a muscle cell)[1] is the type of cell found in muscle tissue. Myocytes are long, tubular cells that ...
skeletal muscle satellite cell maintenance involved in skeletal muscle regeneration. • positive regulation of protein secretion ... skeletal system development. • positive regulation of glucose import. • movement of cell or subcellular component. • muscle ... positive regulation of cell growth involved in cardiac muscle cell development. • activation of MAPK activity. • positive ... positive regulation of cardiac muscle hypertrophy. • positive regulation of smooth muscle cell migration. • همانندسازی. • ...
Zammit, PS; Partridge, TA; Yablonka-Reuveni, Z (November 2006). "The skeletal muscle satellite cell: the stem cell that came in ... A skeletal muscle refers to multiple bundles (fascicles) of cells joined together called muscle fibers. The fibers and muscles ... Skeletal muscle is one of three major muscle types, the others being cardiac muscle and smooth muscle. It is a form of striated ... Quoted from National Skeletal Muscle Research Center; UCSD, Muscle Physiology Home Page - Skeletal Muscle Architecture, Effect ...
positive regulation of growth factor dependent skeletal muscle satellite cell proliferation. • ДНК-зависимая позитивная ... radial glial cell differentiation. • stem cell population maintenance. • cellular response to hormone stimulus. • regulation of ... cell proliferation. • response to leptin. • response to ethanol. • positive regulation of Notch signaling pathway. • негативная ... regulation of cell cycle. • astrocyte differentiation. • response to drug. • передача сигнала. • положительная регуляция ...
Previously untrained muscles acquire newly formed nuclei by fusion of satellite cells preceding the hypertrophy. Subsequent ... that evoked significant increases in skeletal muscle mass of the vastus lateralis muscle, in the quadriceps muscle group. ... Collectively, the authors conclude that skeletal muscle mass and muscle memory phenomenon is, at least in part, modulated due ... whereby the amount of skeletal muscle mass gained was greater in the second period of muscle growth than the first, suggesting ...
Performance of near-infrared spectroscopy in measuring local O2 consumption and blood flow in skeletal muscle». J Appl Physiol ... Measured HeLa cell mass». BioNumbers. دریافت‌شده در ۲۰۱۱-۱۰-۰۹. .. *↑ «Estimated HeLa cell mass». BioNumbers. دریافت‌شده در ... Showman, A. P. (1999). "The Galilean Satellites". Science. 286 (5437): 77-84. doi:10.1126/science.286.5437.77. ISSN 0036-8075. ... Rout, M. P. (1993). "Isolation of the yeast nuclear pore complex". The Journal of Cell Biology. 123 (4): 771-783. doi:10.1083/ ...
skeletal muscle satellite cell maintenance involved in skeletal muscle regeneration. • positive regulation of protein secretion ... skeletal system development. • positive regulation of glucose import. • movement of cell or subcellular component. • muscle ... positive regulation of cell growth involved in cardiac muscle cell development. • activation of MAPK activity. • positive ... positive regulation of cardiac muscle hypertrophy. • positive regulation of smooth muscle cell migration. • 脫氧核糖核酸複製. • ...
"Short-term serum deprivation causes no significant mitochondrial DNA mutation in vascular smooth muscle cells revealed by a new ... suited to identification of older skeletal remains than nuclear DNA because the greater number of copies of mtDNA per cell ... Because cells have multiple mitochondria, different mitochondria in the same cell can have different variations of the mtDNA. ... Mitochondria are small structures in cells that generate energy for the cell to use, and are hence referred to as the " ...
... whole muscle atrophy begins. Postural muscles contain more slow fibers, and are more prone to atrophy than non-postural muscle ... Narici, M. V.; Boer, M. D. de (2011-03-01). "Disuse of the musculo-skeletal system in space and on earth". European Journal of ... "The adaptation of Escherichia coli cells grown in simulated microgravity for an extended period is both phenotypic and genomic" ... as in a space station or automated artificial satellite, in an attempt to reduce crystal lattice defects.[6] Such defect-free ...
... and clinical studies in all areas of stem cell biology and applications. The journal will consider basic, translational, and ... Stem Cells International is a peer-reviewed, Open Access journal that publishes original research articles, review articles, ... Skeletal muscle represents a plentiful and accessible source of adult stem cells. Skeletal-muscle-derived stem cells, termed ... P. S. Zammit, F. Relaix, Y. Nagata et al., "Pax7 and myogenic progression in skeletal muscle satellite cells," Journal of Cell ...
HEXIM1 controls satellite cell expansion after injury to regulate skeletal muscle regeneration. ... HEXIM1 controls satellite cell expansion after injury to regulate skeletal muscle regeneration. ... Transplanted Hexim1-haplodeficient satellite cells expanded and improved muscle regeneration more effectively than WT satellite ... These findings suggest a crucial role for the HEXIM1/P-TEFb pathway in the regulation of satellite cell-mediated muscle ...
Skeletal muscle tissue is characterized by a population of quiescent mononucleated myoblasts, localized between the basal ... lamina and sarcolemma of myofibers, known as satellite cells. Satellite cells... ... Satellite cells isolation Muscle primary culture Cell culture Muscle differentiation Myogenic program ... Mauro A (1961) Satellite cell of skeletal muscle fibers. J Biophys Biochem Cytol 9:493-495CrossRefPubMedPubMedCentralGoogle ...
... beta-Catenin promotes self-renewal of skeletal-muscle satellite cells. Download Prime PubMed App to iPhone, iPad, or Android ... J Cell Sci VL - 121 IS - Pt 9 N2 - Satellite cells are the resident stem cells of adult skeletal muscle. As with all stem cells ... Satellite cells are the resident stem cells of adult skeletal muscle. As with all stem cells, how the choice between self- ... Pax7 and myogenic progression in skeletal muscle satellite cells.. *microRNA-1 and microRNA-206 regulate skeletal muscle ...
It was initially proposed that satellite cell pr ... Human skeletal muscle satellite cells are activated in response ... A single bout of exercise activates skeletal muscle satellite cells during subsequent overnight recovery: satellite cell ... Assessment of satellite cell number and activity status in human skeletal muscle biopsies. Muscle Nerve. 2009;40:455-65. ... Blaauw B, Reggiani C. The role of satellite cells in muscle hypertrophy. J Muscle Res Cell Motil. 2014;35:3-10. ...
... and Transplantation of Muscle Satellite Cells, Adult and Embryonic Skeletal Muscle Microexplant Culture and Isolation of ... Isolation of Type I and Type II Pericytes from Mouse Skeletal Muscles, Isolation and Characterization of Satellite Cells from ... Isolation and Culture of Individual Myofibers and their Satellite Cells from Adult Skeletal Muscle, Preparation and Culture ... Normal and Malignant Muscle Cell Transplantation into Immune Compromised Adult Zebrafish, Engineering Skeletal Muscle Tissues ...
Antibodies for proteins involved in skeletal muscle satellite cell migration pathways, according to their Panther/Gene Ontology ... Antibodies for proteins involved in skeletal muscle satellite cell migration pathways; according to their Panther/Gene Ontology ...
Effective fiber hypertrophy in satellite cell-depleted skeletal muscle Message Subject (Your Name) has sent you a message from ... Effective fiber hypertrophy in satellite cell-depleted skeletal muscle. John J. McCarthy, Jyothi Mula, Mitsunori Miyazaki, Rod ... Effective fiber hypertrophy in satellite cell-depleted skeletal muscle. John J. McCarthy, Jyothi Mula, Mitsunori Miyazaki, Rod ... Effective fiber hypertrophy in satellite cell-depleted skeletal muscle. John J. McCarthy, Jyothi Mula, Mitsunori Miyazaki, Rod ...
Effective ablation of satellite cells in adult skeletal muscle. To test rigorously the hypothesis that satellite cells are ... 2005). Stem cell function, self-renewal, and behavioral heterogeneity of cells from the adult muscle satellite cell niche. Cell ... satellite cells in adult skeletal muscle to test rigorously the hypothesis that satellite cells are necessary for skeletal ... of satellite cells in mature skeletal muscle following tamoxifen administration. To test the hypothesis that satellite cells ...
... muscle fibre growth and muscle fibre damage and repair.. Keyword. Skeletal muscle satellite cells, Myogenic regulatory factors ... and that the satellite cells are key cells in the regeneration and growth of muscle fibres. Satellite cells are closely ... Skeletal muscle satellite cells located between the plasma membrane and the basal lamina of muscle fibres, could for many years ... satellite cell markers, NCAM, Pax7, MyoD, myogenin, DLK1/FA1, c-Met, human skeletal muscle, immunohistochemistry, muscle growth ...
Satellite cells can be copurified with isolated single skeletal muscle fibers. (A-D) Satellite cells are attached to the ... The skeletal muscle satellite cell: stem cell or son of stem cell? Differentiation. 68:193-204. ... Pax7+ cells are present in newt limb skeletal muscle. (A and B) Immunostaining of limb skeletal muscle identifies Pax7+ cells ... Stem cell function, self-renewal, and behavioral heterogeneity of cells from the adult muscle satellite cell niche. Cell. 122: ...
We examined the effect of 14 days of bed rest on skeletal muscle satellite cell content and fiber type atrophy in middle-aged ... Fourteen days of bed rest induces a decline in satellite cell content and robust atrophy of skeletal muscle fibers in middle- ... Satellite cell content was also reduced Post-BR (-39 ± 9%;P< 0.05), and the change in satellite cell content was significantly ... Bed rest, a ground-based spaceflight analog, induces robust atrophy of skeletal muscle, an effect that is exacerbated with ...
Muscle satellite cells (MuSCs) are muscle-resident stem cells that play an indispensable role in myogenesis, and their function ... Highly efficient, functional engraftment of skeletal muscle stem cells in dystrophic muscles. Cell 134, 37-47 (2008).. ... Satellite cell activation and apoptosis in skeletal muscle from severely burned children. J. Physiol. 594, 5223-5236 (2016).. ... Engineered matrices for skeletal muscle satellite cell engraftment and function. Matrix Biol. 60-61, 96-109 (2017).. ...
Electron-microscopic cytochemical studies on satellite cells of normal human skeletal muscle were carried out using the ... Ultrastructural localization of concanavalin A-binding sites in satellite cells of human skeletal muscle. Cell Tissue Res. 210 ... Laguens R (1963) Satellite cells of skeletal muscle fibers in human progressive muscular dystrophy. Virchows Arch Pathol Anat ... Ultrastructural localization of concanavalin A-binding sites in satellite cells of human skeletal muscle. *Yoshihiro Wakayama1 ...
... Mackey, A. L. ... We observed very few (up to 1.3%) active satellite cells in healthy adult skeletal muscle at rest, but they increased ... Active satellite cell, Muscle fiber, Myonucleus, NCAM, Pax7 National Category Sport and Fitness Sciences Research subject. ... aim of our study was to validate the assessment of myonuclear and satellite cell number in biopsies from human skeletal muscle ...
... this study aimed to investigate the dose-related effects of Sustanon on the oxidative fibers of avian skeletal … ... Sustanon is a well-known anabolic drug that is used to treat hypogonadism and restore muscle mass and bone density. As research ... induces dose-independent hypertrophy and satellite cell proliferation in slow oxidative fibers of avian skeletal muscle Histol ... fiber hypertrophy that was associated with satellite cell proliferation and myonuclear accretion in avian skeletal muscle. ...
Regeneration of skeletal muscle is mainly executed by satellite cells (SCs) (8). SCs are a population of muscle stem cells that ... Fusion of satellite cells to form multinucleated muscle fibers is an essential step in skeletal muscle growth, differentiation ... Gαi2 regulates the expression of muscle-specific miRNAs in satellite cells and in C2C12 myoblasts via PKC. (A) Satellite cells ... Satellite cells, the engines of muscle repair. Nat. Rev. Mol. Cell Biol. 13:127-133. doi:10.1038/nrm3265. ...
1997). Single-cell analysis of regulatory gene expression in quiescent and activated mouse skeletal muscle satellite cells. Dev ... 1998). Skeletal muscle satellite cell cultures. Meth. Cell Biol 52, 155-176. ... 1999). M-cadherin is a reliable molecular marker of satellite cells in mouse skeletal muscle. Eur. J. Physiol 437, 145-.. ... In vivo satellite cell activation via Myf5 and MyoD in regenerating mouse skeletal muscle ...
Citation: R. T. Hepple, Dividing to Keep Muscle Together: The Role of Satellite Cells in Aging Skeletal Muscle. Sci. Aging ... Dividing to Keep Muscle Together: The Role of Satellite Cells in Aging Skeletal Muscle Russell T. Hepple ... satellite cells nuclear domain MyoD. Abstract: The factors responsible for the atrophy of skeletal muscle with aging remain to ... Recent evidence points toward an important role for a population of cells located on the surface of skeletal muscle fibers, ...
"Ghrelin knockout mice display defective skeletal muscle regeneration and impaired satellite cell self-renewal, Endocrine" on ... Ghrelin knockout mice display defective skeletal muscle regeneration and impaired satellite cell self-renewal. Angelino, Elia; ... Ghrelin knockout mice display defective skeletal muscle regeneration and impaired satellite cell self-renewal. Ghrelin knockout ... Action of obestatin in skeletal muscle repair: stem cell expansion, muscle growth, and microenvironment remodeling ...
Dissociation of solid skeletal muscle tissue generates single-cell suspensions with high viability. The Skeletal Muscle ... non-target cells from a single-cell suspension of skeletal muscle tissue generates a high-purity subfraction of satellite cells ... Isolate functional satellite cells by depleting non-target cells with the Satellite Cell Isolation Kit. The kit contains a ... All protocols T cells Dendritic cells, monocytes, macrophages NK cells Cancer Pluripotent stem cells Hematopoietic stem cells ...
Dissociation of solid skeletal muscle tissue generates single-cell suspensions with high viability. The Skeletal Muscle ... non-target cells from a single-cell suspension of skeletal muscle tissue generates a high-purity subfraction of satellite cells ... Isolate functional satellite cells by depleting non-target cells with the Satellite Cell Isolation Kit. The kit contains a ... Isolation of satellite cells from skeletal muscles using the gentleMACS™ Octo Dissociator with heaters and magnetic cell ...
A role for calcium-calmodulin in regulating nitric oxide production during skeletal muscle satellite cell activation. Ryuichi ... A role for calcium-calmodulin in regulating nitric oxide production during skeletal muscle satellite cell activation ... A role for calcium-calmodulin in regulating nitric oxide production during skeletal muscle satellite cell activation ... A role for calcium-calmodulin in regulating nitric oxide production during skeletal muscle satellite cell activation ...
... Macaluso F ; Brooks N ; Niesler CU ; Myburgh KH ( ...
Muscle satellite cell gene marker (pax7b) and myogenic cell protein marker (Desmin) were all expressed in cells of two cell ... the performance of these cells proliferation and differentiation were analyzed.Results. Two new skeletal muscle cell lines ( ... The skeletal muscle cells from the diploid and triploid olive flounder Paralichthys olivaceus were isolated and cultured in ... There were more cells of POMSCS(3n) to differentiate into the muscle fibre cells than that of POMSCS(2n). However, POMSCS(2n) ...
Satellite cells isolated by FACS from uninjured skeletal muscle and 12 h post-muscle injury from wild type and Syndecan-4 null ... In resting muscle, satellite cells are maintained in a quiescent state. Satellite cell activation induces the myogenic ... Three of the six miRNAs were found to regulate satellite cell fate. The quiescent satellite cell is actively maintained in a ... six computationally identified miRNAs demonstrated novel expression through muscle regeneration and in satellite cells. ...
Satellite cells can be copurified with isolated single skeletal muscle fibers. (A-D) Satellite cells are attached to the ... Satellite cells can be copurified with isolated single skeletal muscle fibers. (A-D) Satellite cells are attached to the ... Pax7+ cells are present in newt limb skeletal muscle. (A and B) Immunostaining of limb skeletal muscle identifies Pax7+ cells ... Pax7+ cells are present in newt limb skeletal muscle. (A and B) Immunostaining of limb skeletal muscle identifies Pax7+ cells ...
Here, we describe a key role of nitric oxide, an important signaling molecule in adult skeletal muscle, on satellite cells ... self-renewal ability of satellite cells induced by nitric oxide is sufficient to delay the reduction of the satellite cell pool ... and differentiate on muscle injury to sustain the regenerative capacity of adult skeletal muscle; in this process, they self- ... Nitric oxide stimulated satellite cells proliferation in a pathway dependent on cGMP generation. Furthermore, it increased the ...
Purinoceptor expression in regenerating skeletal muscle in the mdx mouse model of muscular dystrophy and in satellite cell ... Purinoceptor expression in regenerating skeletal muscle in the mdx mouse model of muscular dystrophy and in satellite cell ... Purinoceptor expression in regenerating skeletal muscle in the mdx mouse model of muscular dystrophy and in satellite cell ...
Primarily for practical reasons, autologous skeletal myoblasts have been the first to undergo clinical trials but other cell ... the optimization of cell survival, and (4) the potential benefits of cell transplantation in nonischemic dilated ... Cell transplantation is currently gaining a growing interest as a potential new means of improving the prognosis of patients ... However, several key issues still need to be addressed including (1) the optimal type of donor cells, (2) the mechanism by ...
  • These cells are located between the basal lamina and plasma membrane of skeletal muscle fibers in which they represent 2.5%-6% of all nuclei and remain in a quiescent state under normal physiological conditions [ 2 ]. (hindawi.com)
  • In response to muscle injury or exercise, satellite cells are activated and proliferate and differentiate into mature fibers [ 3 ]. (hindawi.com)
  • Mauro A (1961) Satellite cell of skeletal muscle fibers. (springer.com)
  • I ) Average numbers of muscle fibers per section, ( J ) average individual myofiber sizes, and ( K ) average numbers of myonuclei per 100 muscle fibers 50 days after injury ( n = 6). (jci.org)
  • The typical increase in myonuclei with hypertrophy was absent in satellite cell-depleted fibers, resulting in expansion of the myonuclear domain. (biologists.org)
  • Consistent with lack of nuclear addition to enlarged fibers, long-term BrdU labeling showed a significant reduction in the number of BrdU-positive myonuclei in satellite cell-depleted muscle compared with vehicle-treated muscle. (biologists.org)
  • These results provide convincing evidence that skeletal muscle fibers are capable of mounting a robust hypertrophic response to mechanical overload that is not dependent on satellite cells. (biologists.org)
  • Fourteen days of bed rest induces a decline in satellite cell content and robust atrophy of skeletal muscle fibers in middle-aged adults. (sigmaaldrich.com)
  • Laguens R (1963) Satellite cells of skeletal muscle fibers in human progressive muscular dystrophy. (springer.com)
  • In contrast, the assessment of satellite cells improved when more fibers were included. (diva-portal.org)
  • As research to date has been limited to its effects in glycolytic fibers, this study aimed to investigate the dose-related effects of Sustanon on the oxidative fibers of avian skeletal muscle. (nih.gov)
  • Robust histochemical and immunofluorescent techniques along with morphometric analyses were applied to determine the oxidative activity and morphological variations of the oxidative muscle fibers in all groups. (nih.gov)
  • In the adult muscle, SCs-quiescent under normal physiological conditions-are activated in response to trauma and are able to self-renew, proliferate, and differentiate to fuse to damaged fibers or form new myofibers ( 8 ). (asm.org)
  • Recent evidence points toward an important role for a population of cells located on the surface of skeletal muscle fibers, known as satellite cells, in maintaining the integrity of skeletal myocytes throughout the life span. (sciencemag.org)
  • Though most 1α-hydroxylase activity occurs in the kidneys, the enzyme is expressed in other cell types including macrophages, monocytes, and muscle fibers ( Pojednic and Ceglia, 2014 ). (frontiersin.org)
  • Once activated the cells will reenter the cell cycle and undergo a few rounds of division, then differentiate and fuse with existing muscle fibers to rebuild the damaged area. (biomedcentral.com)
  • Although the initial phases of injury-induced regeneration proceed normally in Sharp-1 −/− mice, during late stages, the mutant muscle exhibits necrotic fibers, calcium deposits and fibrosis. (biologists.org)
  • Nonetheless, the maturation of these new fibers is incomplete and do not prevent muscle degeneration. (nature.com)
  • Muscle histopathology analysis shows a great number of regenerating fibers, variation in fiber size and the presence of central nuclei. (nature.com)
  • Atypical fibers were widely separated by connective tissue cells and revealed partial loss of striations in subgroup IIa. (bvsalud.org)
  • A significant decrease in the mean area of atypical fibers, a significant increase in the mean area% of alpha- smooth muscle actin -positive cells , and a significant increase in the mean area% of CD34-positive cells were found in subgroup IIb compared with subgroup IIa. (bvsalud.org)
  • Pharmacological activation of PPARbeta/delta stimulates utrophin A expression in skeletal muscle fibers and restores sarcolemmal integrity in mature mdx mice. (qxmd.com)
  • Once activated, SCs divide and fuse to the muscle fibers where their nuclei become new myonuclei. (usask.ca)
  • Earlier studies suggested that SCs were either randomly or evenly distributed along muscle fibers. (usask.ca)
  • However, myonuclei were found to be more concentrated at tapered ends of muscle fibers. (usask.ca)
  • Meat producing chickens represent a unique model for natural hypertrophy within muscle fibers. (usask.ca)
  • Chicken pectoralis muscle was the main experimental model used in this thesis because of its overlapping fibers arranged in series, the presence of neonatal myosin at the fiber ends and relative homogeneity of fiber type. (usask.ca)
  • Immunocytochemical techniques that include an antibody against Pax7 to identify SC nuclei were applied, and computer image analyses were then used to quantify the numbers of SC nuclei and myonuclei within muscle fibers. (usask.ca)
  • This thesis demonstrates that throughout development there is a greater frequency and concentration of SCs at the ends of developing skeletal muscle fibers, which indicates a major contribution of these cells in the longitudinal growth of muscle fibers. (usask.ca)
  • Lastly, it is the first study to show a greater frequency and a higher concentration of SCs within both naturally and Nandrolone induced hypertrophied muscle fibers. (usask.ca)
  • Under normal conditions, skeletal muscle can repair itself by removing damaged myofibers and synthesizing new muscle fibers to restore functional contractile properties ( 1 ). (pnas.org)
  • After necrosis of damaged muscle fibers, an inflammatory response is initiated ( 2 ) leading to the phagocytosis of the injured myofibers and the activation of the normally quiescent population of satellite cells ( 3 , 4 ). (pnas.org)
  • Recently, two independent models, one from rodents and the other from insects, have demonstrated that nuclei are not lost from skeletal muscle fibers when they undergo either atrophy or programmed cell death. (frontiersin.org)
  • Myosin and actin content of human skeletal muscle fibers following 35 days bed rest. (biomedsearch.com)
  • [1] Most skeletal muscles are attached to bones by bundles of collagen fibers known as tendons . (wikipedia.org)
  • A skeletal muscle refers to multiple bundles ( fascicles ) of cells joined together called muscle fibers. (wikipedia.org)
  • Muscle fibers are in turn composed of myofibrils . (wikipedia.org)
  • Another group of cells, the myosatellite cells are found between the basement membrane and the sarcolemma of muscle fibers. (wikipedia.org)
  • Individual muscle fibers are formed during development from the fusion of several undifferentiated immature cells known as myoblasts into long, cylindrical, multi-nucleated cells. (wikipedia.org)
  • Skeletal muscle exhibits a distinctive banding pattern when viewed under the microscope due to the arrangement of cytoskeletal elements in the cytoplasm of the muscle fibers. (wikipedia.org)
  • Muscle architecture refers to the arrangement of muscle fibers relative to the axis of force generation of the muscle. (wikipedia.org)
  • While the muscle fibers of a fascicle lie parallel to one another, the fascicles themselves can vary in their relationship to one another and to their tendons. (wikipedia.org)
  • High-load strength-type exercise leads to growth of muscle fibers dominated by an increase in contractile proteins. (biologists.org)
  • How do these cells differ from the nuclei located within skeletal muscle fibers? (coursehero.com)
  • They are positive for sarcomeric myosin and negative for smooth muscle specific α-actin.New skeletal muscle cells originate from quiescent satellite cells, which are located in the muscle fibers between the basal lamina and the sarcolemma. (sigmaaldrich.com)
  • After activation, the cells, now called myoblasts, start to proliferate and fuse with damaged muscle fibers or with one another forming new myotubes.SkMC are optimal for in vitro muscle studies. (sigmaaldrich.com)
  • Equine skeletal muscle aging was accompanied by a shift in fiber type composition towards a higher percentage of type I and IIA muscle fibers, decrease in mitochondrial density and cytochrome c oxidase activity, but preserved mitochodnrial respiratory function. (ufl.edu)
  • In response injury, intrinsic repair mechanisms are activated in skeletal muscle to replace the damaged muscle fibers with new muscle fibers. (physiology.org)
  • A skeletal muscle is made up of multiple bundles of muscle fascicles of muscle cells known as muscle fibers. (wikipedia.org)
  • The fibers and muscles are surrounded by connective tissue layers called fasciae. (wikipedia.org)
  • Muscle fibers are the individual contractile cells within a muscle. (wikipedia.org)
  • Abstract : Adult skeletal muscle is able to adapt its size to functional demand. (duhnnae.com)
  • Popular Abstract in Swedish Syftet med den här studien var att undersöka det strukturella underlaget för förslagen att makrofager och gaserna kvävemonooxid (NO) och kolmonoxid (CO), som bildas av kvävemonooxidsyntaser (NOS) respektive hemeoxygenaser (HO), är viktiga för att en perifer nerv ska regenerera. (dissertations.se)
  • Here, we found that functional overload, which is widely used to model resistance exercise, causes skeletal muscle hypertrophy and converts satellite cells from quiescent state to activated state. (hindawi.com)
  • It was initially proposed that satellite cell proliferation and differentiation were only required to support resistance exercise-induced hypertrophy. (springer.com)
  • Blaauw B, Reggiani C. The role of satellite cells in muscle hypertrophy. (springer.com)
  • Effective fiber hypertrophy in satellite cell-depleted skeletal muscle. (springer.com)
  • Egner IM, Bruusgaard JC, Gundersen K. Satellite cell depletion prevents fiber hypertrophy in skeletal muscle. (springer.com)
  • Regulation of the muscle fiber microenvironment by activated satellite cells during hypertrophy. (springer.com)
  • Petrella JK, Kim J, Mayhew DL, Cross JM, Bamman MM. Potent myofiber hypertrophy during resistance training in humans is associated with satellite cell-mediated myonuclear addition: a cluster analysis. (springer.com)
  • Skeletal muscle hypertrophy following resistance training is accompanied by a fiber type-specific increase in satellite cell content in elderly men. (springer.com)
  • An important unresolved question in skeletal muscle plasticity is whether satellite cells are necessary for muscle fiber hypertrophy. (biologists.org)
  • To test the hypothesis that satellite cells are necessary for skeletal muscle hypertrophy, the plantaris muscle of adult Pax7-DTA mice was subjected to mechanical overload by surgical removal of the synergist muscle. (biologists.org)
  • Following two weeks of overload, satellite cell-depleted muscle showed the same increases in muscle mass (approximately twofold) and fiber cross-sectional area with hypertrophy as observed in the vehicle-treated group. (biologists.org)
  • The satellite cells are also essential for muscle fibre hypertrophy and maintenance of muscle mass in the adult. (diva-portal.org)
  • In conclusion, Sustanon induced oxidative fiber hypertrophy that was associated with satellite cell proliferation and myonuclear accretion in avian skeletal muscle. (nih.gov)
  • We have previously shown that activation of Gαi2, an α subunit of the heterotrimeric G protein complex, induces skeletal muscle hypertrophy and myoblast differentiation. (asm.org)
  • Fish body weight mainly depends on both muscle fibre number increase (hyperplasia) and muscle fibre size increase (hypertrophy) as skeletal muscle contributes to 40-60% in fish body mass ( Qin, Gu & Zhang, 2000 ). (peerj.com)
  • Satellite cells contribute to hypertrophy by facilitating nuclear addition, which maintains contractile protein synthetic capacity. (coventry.ac.uk)
  • The 'activity status' of satellite cells, an important determinant of muscle regenerative capacity is not routinely addressed in studies characterising mechanisms of muscle hypertrophy and atrophy. (coventry.ac.uk)
  • Therefore, the investigations described within this thesis examined the satellite cell specific signalling events that contribute to muscle loss or gain, in rodent models experiencing non-mechanically-induced muscle hypertrophy or atrophy. (coventry.ac.uk)
  • Besides, using a satellite cell-specific conditional and inducible Srf knockout, we show that overload hypertrophy requires Srf expression by satellite cells. (duhnnae.com)
  • Altogether, our results demonstrate that Srf is an important player in skeletal muscle plasticity: it is a mediator of mechanotransduction via the actin-Mrtfs-Srf pathway and its expression by satellite cells is required for myoblasts to fuse with myofibers during overload hypertrophy. (duhnnae.com)
  • This indicates SCs may be critically involved during postnatal skeletal muscle growth and hypertrophy. (usask.ca)
  • Skeletal muscle satellite cells (SCs) are involved in remodeling and hypertrophy processes of skeletal muscle. (forskningsdatabasen.dk)
  • There is a longstanding belief that a given nucleus controls a defined volume of cytoplasm, so when a muscle grows (hypertrophy) or shrinks (atrophy), the number of myonuclei change accordingly. (frontiersin.org)
  • There is a general agreement that hypertrophy is accompanied by the addition of new nuclei from stem cells to help the muscles meet the enhanced synthetic demands of a larger cell. (frontiersin.org)
  • In skeletal muscle there is good evidence to suggest that locally produced insulin-like growth factor-1 (IGF-I), rather than circulating IGF-I, is important in regard to muscle mass maintenance, repair and hypertrophy. (biomedsearch.com)
  • This review describes a cellular memory in skeletal muscle in which hypertrophy is 'remembered' such that a fibre that has previously been large, but subsequently lost its mass, can regain mass faster than naive fibres. (biologists.org)
  • Skeletal muscle tissue is characterized by a population of quiescent mononucleated myoblasts, localized between the basal lamina and sarcolemma of myofibers, known as satellite cells. (springer.com)
  • A new immunofluorescence method was developed where in the same tissue section, two satellite cell markers, the basal lamina and nuclei were monitored. (diva-portal.org)
  • A central question is whether the generation of progenitor cells during limb regeneration and mammalian tissue repair occur via separate or overlapping mechanisms. (rupress.org)
  • Activation of salamander satellite cells occurs in an analogous manner to how the mammalian myofiber mobilizes stem cells during skeletal muscle tissue repair. (rupress.org)
  • Although adult mammals do not form a blastema after limb amputation, their skeletal muscle tissue regenerates after injury ( Charge and Rudnicki, 2004 ). (rupress.org)
  • In this application protocol, we describe an easy and fast method for the dissociation of skeletal muscle tissue from mouse and a subsequent isolation method that generates a highly pure population of satellite cells and minimizes bias in downstream applications caused by contamination with non-target cells. (miltenyibiotec.com)
  • Use the Skeletal Muscle Dissociation Kit to generate a single-cell suspension by combining mechanical dissociation with the gentleMACS™ Dissociator and enzymatic degradation of the extracellular matrix that maintains the structural integrity of the tissue. (miltenyibiotec.com)
  • Dissociation of solid skeletal muscle tissue generates single-cell suspensions with high viability. (miltenyibiotec.com)
  • Filigheddu, Nicoletta 2018-05-30 00:00:00 Purpose Muscle regeneration depends on satellite cells (SCs), quiescent precursors that, in consequence of injury or pathological states such as muscular dystrophies, activate, proliferate, and differentiate to repair the damaged tissue. (deepdyve.com)
  • Fish muscle originated from skeletal muscle satellite cells (MSCs) is a very important tissue for fish swimming and live, and one of the food resources for human. (peerj.com)
  • Satellite cell activation induces the myogenic commitment factor, MyoD, and cell cycle entry to facilitate transition to a population of proliferating myoblasts that eventually exit the cycle and regenerate muscle tissue. (biomedcentral.com)
  • Both are seven-transmembrane domain proteins with an intracellular N-terminus and highly expressed in skeletal muscle (AdipoR1) and adipose tissue (AdipoR2) [ 6 ]. (ajas.info)
  • Skeletal muscle is the most abundant tissue in mammals, making up 45% to 55% of total body mass in humans, and plays important roles in body movement and metabolic regulation. (biomedcentral.com)
  • TGF-β expression, as well as levels of phosphorylated Smad2 and Smad3, are sustained in the mutant tissue and treatment with decorin, which blocks TGF-β signaling, improves the histopathology of Sharp-1 −/− injured muscles. (biologists.org)
  • Regeneration of muscle is dependent on satellite cells, and can be divided into distinct phases, which include inflammation, tissue formation and tissue remodeling. (biologists.org)
  • During the inflammatory phase, the damaged muscle tissue is infiltrated by immune cells, and activated macrophages play a key role in the removal of necrotic tissue. (biologists.org)
  • This is followed by tissue formation that is dependent on the proliferation and differentiation of satellite cells. (biologists.org)
  • Once the tissue is repaired, the contractile activity of myofibroblasts is terminated and cells are removed by apoptosis. (biologists.org)
  • This review will describe the regenerative properties of satellite cells, the processes of satellite cell activation and highlight the potential role of satellite cells in skeletal muscle growth, tissue engineering and meat production. (koreascience.or.kr)
  • 2004. Skeletal muscle tissue engineering. (koreascience.or.kr)
  • Skeletal muscle tissue represent about 40% of total body weight and is responsible for almost all voluntary movements. (nature.com)
  • The regenerative capacity of skeletal muscle tissue resides in satellite cells , the quiescent adult stem cells . (bvsalud.org)
  • This possibility was addressed in the context of ischemic muscle injury, which typically leads to necrosis and loss of tissue and function. (pnas.org)
  • Sustained VEGF delivery alone led to neoangiogenesis in ischemic limbs, with complete return of tissue perfusion to normal levels by 3 weeks, as well as protection from hypoxia and tissue necrosis, leading to an improvement in muscle contractility. (pnas.org)
  • as satellite cell activation and proliferation was stimulated, cells were protected from apoptosis, the inflammatory response was muted, and highly functional muscle tissue was formed. (pnas.org)
  • However, muscle degeneration in the context of tissue ischemia, advanced age ( 7 ), severe injuries, or in the context of genetic defects [e.g., muscular dystrophy ( 8 )], may lead to impaired healing, permanent loss of muscle mass, disease progression, and functional deficiency. (pnas.org)
  • Cell therapies, either by direct injection of cells into the damaged tissues ( 11 ) or the transplantation of progenitor cells on polymeric scaffolds ( 12 , 13 ), are typically limited by the death of the majority of the transplanted cells and/or poor integration of the templated tissues with the host tissue. (pnas.org)
  • However, it may be necessary to deliver multiple morphogens acting in distinct aspects of the tissue regeneration process to drive muscle regeneration to completion, as previously reported for other tissues ( 15 ). (pnas.org)
  • The hypothesis underlying this study is that localized and sustained presentation of factors that modulate both angiogenesis and myogenesis can stop or reverse muscle injury resulting from tissue ischemia. (pnas.org)
  • Factors which effect proliferation and fusion of muscle precursor cells have been studied extensively in tissue culture, although little is known about these events in vivo. (nih.gov)
  • This review assesses the tissue culture derived data with a view to understanding factors which may control the regeneration of mature skeletal muscle in vivo. (nih.gov)
  • Mammalian skeletal muscle is a dynamic and plastic tissue, capable of responding to physiological demands and pathophysiological stresses. (pnas.org)
  • Under normal circumstances, mammalian adult skeletal muscle is a stable tissue with very little turnover of nuclei. (semanticscholar.org)
  • However, since there are many different non-muscle cell populations that reside within the tissue, these experiments cannot easily distinguish true myonuclei from those of neighboring mononuclear cells. (frontiersin.org)
  • Skeletal muscle is the largest tissue in the body. (frontiersin.org)
  • miR-133 is expressed in muscle tissue and appears to repress the expression of non-muscle genes. (wikipedia.org)
  • BMP2 controls bone cell determination by inducing miRNAs that target muscle genes but mainly by down-regulating multiple miRNAs that constitute an osteogenic program, thereby releasing from inhibition pathway components required for cell lineage commitment establish a mechanism for BMP morphogens to selectively induce a tissue-specific phenotype and suppress alternative lineages. (wikipedia.org)
  • Even if subsequently subjected to grave atrophy, the higher number of myonuclei is retained, and the myonuclei seem to be protected against the elevated apoptotic activity observed in atrophying muscle tissue. (biologists.org)
  • It is a form of striated muscle tissue , which is under the voluntary control of the somatic nervous system . (wikipedia.org)
  • The fibres and muscles are surrounded by connective tissue layers called fasciae . (wikipedia.org)
  • Connective tissue is present in all muscles as fascia . (wikipedia.org)
  • enclosing each fascicle is a layer called the perimysium , and enclosing each muscle fiber is a layer of connective tissue called the endomysium . (wikipedia.org)
  • In humans, low-load endurance-type exercise leads to qualitative changes of muscle tissue characterized by an increase in structures supporting oxygen delivery and consumption, such as capillaries and mitochondria. (biologists.org)
  • While before Holloszy's seminal paper, most physiologists saw muscle tissue as inert and somewhat boring, research into muscle plasticity burgeoned afterwards. (biologists.org)
  • Numerous scientists since have shown that skeletal muscle in all species studied is an extremely malleable tissue. (biologists.org)
  • Many of the underlying molecular mechanisms that are responsible for the structural changes of muscle tissue have been unraveled over the last two decades. (biologists.org)
  • Treatment with muscle stem cells from a donor might restore damaged tissue, but doctors are unable to deliver them effectively. (news-medical.net)
  • Researchers at the Georgia Institute of Technology engineered a molecular matrix, a hydrogel, to deliver muscle stem cells called muscle satellite cells (MuSCs) directly to injured muscle tissue in patients whose muscles don't regenerate well. (news-medical.net)
  • In lab experiments on mice, the hydrogel successfully delivered MuSCs to injured, aged muscle tissue and boosted the healing process while protecting the stem cells from harsh immune reactions. (news-medical.net)
  • The method was also successful in mice with a muscle tissue deficiency that emulated Duchene muscular dystrophy, and if research progresses, the new hydrogel therapy could one day save the lives of people suffering from the disease. (news-medical.net)
  • Simply injecting additional muscle satellite cells into damaged, inflamed tissue has proven inefficient, in part because the stem cells encounter an immune system on the warpath. (news-medical.net)
  • Then the hydrogel degrades and leaves behind the cells engrafted onto muscle tissue the way natural stem cells usually would be. (news-medical.net)
  • They live on muscle strands like specks, and they're key players in making new muscle tissue,' Han said. (news-medical.net)
  • Stem Cells and Tissue Repair: Methods and Protocols presents in-depth methods for the three major approaches of rejuvenating an aging or sick body: latent regenerative capacity stimulated in a targeted way, replacement organs grown de novo and surgically implanted, and tissue surgically implanted and coaxed to integrate and restore problem areas. (springer.com)
  • Authoritative and easily accessible, Stem Cells and Tissue Repair: Methods and Protocols provides state-of the-art methods descriptions and the references therein that will provide a suitable starting point for exploring the vast literature that has already developed for regenerative medicine. (springer.com)
  • After the study they assessed various changes in body composition (fat tissue / muscle tissue) and strength. (muscleandstrength.com)
  • We propose to develop new strategies to mobilize skeletal muscle tissue-associated stem cells as a tool for efficient tissue repair. (europa.eu)
  • This will be combined with exploring novel approaches that limit tissue damage, and will focus on agents that modify muscle and muscle vasculature progenitor cells. (europa.eu)
  • Our project brings together leading investigators to examine how vascular and muscle progenitors participate in postnatal growth and muscle tissue repair. (europa.eu)
  • A key issue that this project addresses is the tissue environment in which endogenous stem cells are activated. (europa.eu)
  • One such tissue is skeletal muscle, which has been shown to express PrP C at significant levels ( 43 , 46 ) and has been found to upregulate PrP C levels under stress conditions ( 71 ). (asm.org)
  • Collins CA, Zammit PS (2009) Isolation and grafting of single muscle fibres. (springer.com)
  • Skeletal muscle satellite cells located between the plasma membrane and the basal lamina of muscle fibres, could for many years, only be studied in situ by electron microscopy. (diva-portal.org)
  • The satellite cells are involved in muscle growth during fetal and postnatal development and play a key role in repair and regeneration of damaged muscle fibres. (diva-portal.org)
  • Furthermore, new evidence is presented for so called fibre splitting observed in hypertrophic muscle fibres to be due to defect regeneration of partially damaged fibres. (diva-portal.org)
  • Regeneration of adult skeletal muscle is an asynchronous process requiring the activation, proliferation and fusion of satellite cells, to form new muscle fibres. (biologists.org)
  • Furthermore, we demonstrate that activated satellite cells, which express either Myf5 or MyoD, do not accumulate selectively on fast or slow muscle fibres. (biologists.org)
  • 1995 ). MyoD protein accumulates in satellite cells and is neurally regulated in regenerating myotubes and skeletal muscle fibres. (biologists.org)
  • 1998 ). The number of myogenic cells on muscle fibres. (biologists.org)
  • They are activated by various stimuli (myotrauma, growth factors etc), undergo rounds of proliferation as skeletal muscle myoblasts, to differentiate and fuse with each other to generate new myotubes or onto existing myofibres to augment growth or repair damaged fibres. (coventry.ac.uk)
  • Skeletal muscle fibres form by fusion of mesoderm progenitors called myoblasts. (optistem.org)
  • After birth, muscle fibres do not increase in number but continue to grow in size because of fusion of satellite cells, the postnatal myogenic cells, responsible for muscle growth and regeneration. (optistem.org)
  • L'absence de Srf n'altère ni la prolifération ni l'entrée en différenciation des myoblastes, néanmoins elle provoque un défaut de fusion des myoblastes aux fibres au cours de l'hypertrophie induite par surcharge. (duhnnae.com)
  • Ainsi, nos travaux démontrent que Srf est un acteur majeur de la plasticité musculaire, à la fois en tant que médiateur de la mécano-transduction par la voie actine-Mrtfs-Srf et par son implication dans la fusion des cellules satellites aux fibres musculaires, nécessaire à l'hypertrophie compensatoire. (duhnnae.com)
  • Pericytes resident in postnatal skeletal muscle differentiate into muscle fibres and generate satellite cells. (ox.ac.uk)
  • According to this model, previously untrained fibres recruit myonuclei from activated satellite cells before hypertrophic growth. (biologists.org)
  • It is located on the muscle fibre, under the basal lamina as a quiescent cell, which becomes activated after injury, when it leaves the fibre, proliferates, and either undergoes myogenesis to form new fibres or reconstitutes the satellite cell pool. (mendeley.com)
  • Muscle fibres, or muscle cells , are formed from the fusion of developmental myoblasts in a process known as myogenesis . (wikipedia.org)
  • Muscle fibres are cylindrical, and have more than one nucleus . (wikipedia.org)
  • Muscle fibres are the individual contractile units within muscle. (wikipedia.org)
  • A single muscle such as the biceps brachii contains many muscle fibres. (wikipedia.org)
  • MSCs are a heterogeneous population of stem and progenitor cells originated from embryonic mesoderm, and their activation, proliferation and differentiation are the crucial basis for the muscle hyperplasic and hypertrophic growth. (peerj.com)
  • Since constitutive mutation of Ppardelta leads to embryonic lethality, we sought to address this question by conditional knockout (cKO) of Ppardelta using Myf5-Cre/Ppardeltaflox/flox alleles to ablate PPARdelta in myogenic progenitor cells. (umassmed.edu)
  • Gene expression analysis showed reduced expression of the Forkhead box class O transcription factor 1 (FoxO1) gene in Ppardelta-cKO muscles under both quiescent and regenerating conditions, suggesting that PPARdelta acts through FoxO1 in regulating muscle progenitor cells. (umassmed.edu)
  • These results support a function of PPARdelta in regulating skeletal muscle metabolism and insulin sensitivity, and they establish a novel role of PPARdelta in muscle progenitor cells and postnatal muscle regeneration. (umassmed.edu)
  • Satellite cells are muscle-specific progenitor cells involved in the routine maintenance of skeletal muscle homeostasis, growth and regeneration. (coventry.ac.uk)
  • This response relies on the muscle's ability to activate myogenic progenitor cells (MPCs) resulting in myogenesis. (pnas.org)
  • Mammalian skeletal muscle can remodel, repair, and regenerate itself by mobilizing satellite cells, a resident population of myogenic progenitor cells. (pnas.org)
  • Muscle injury and subsequent activation of myogenic progenitor cells is associated with oxidative stress. (pnas.org)
  • In this study, we demonstrate that cytoglobin is up-regulated in activated myogenic progenitor cells, where it localizes to the nucleus and contributes to cell viability. (pnas.org)
  • Myogenic progenitor cells isolated from these mice were severely deficient in their ability to form myotubes as compared with myogenic progenitor cells from wild-type littermates. (pnas.org)
  • Exhaustion of muscle progenitor cells (MPCs) is thought to be an important factor contributing to the progressive weakness and atrophy of peripheral skeletal muscle that occurs with various skeletal myopathies and during normal aging ( 1 ⇓ ⇓ ⇓ ⇓ ⇓ ⇓ ⇓ - 9 ). (pnas.org)
  • Several cell types with different characteristics and tissues of origin, including myogenic stem and progenitor cells, stromal cells, and pluripotent stem cells, have been investigated over the years and have recently entered in the clinical arena with mixed results. (jci.org)
  • Whereas PPARdelta has been shown to regulate mitochondrial biosynthesis and slow-muscle fiber types, its function in skeletal muscle progenitors (satellite cells) is unknown. (umassmed.edu)
  • In the embryo and in the adult, skeletal muscle growth is dependent on the proliferation and the differentiation of muscle progenitors present within muscle masses. (nature.com)
  • Furthermore, long-term lineage analyses indicate that satellite cells, which are known progenitors of adult skeletal muscles 4 , derive from the same dermomyotome cell population. (nature.com)
  • We conclude that embryonic muscle progenitors and satellite cells share a common origin that can be traced back to the dermomyotome. (nature.com)
  • Skeletal myogenic progenitors originating from embryonic dorsal aorta coexpress endothelial and myogenic markers and contribute to postnatal muscle growth and regeneration. (nature.com)
  • Muscle regeneration by bone marrow-derived myogenic progenitors. (nature.com)
  • Robust generation and expansion of skeletal muscle progenitors and myocytes from human pluripotent stem cells. (semanticscholar.org)
  • The classical procedure, which will be discussed extensively in this chapter, involves the enzymatic dissociation of skeletal muscles, while the alternative method involves isolation of satellite cells from isolated myofibers in which the satellite cells remain in their in situ position underneath the myofiber basal lamina. (springer.com)
  • A molecular marker for the myofibre basal lamina or plasma membrane to enhance the reliability of myonuclei and satellite cell identification were to be included. (diva-portal.org)
  • SCs are a population of muscle stem cells that reside between the sarcolemma and the basal lamina. (asm.org)
  • Tosney, K. W., Dehnbostel, D. B. & Erickson, C. A. Neural crest cells prefer the myotome's basal lamina over the sclerotome as a substratum. (nature.com)
  • These cells, located beneath the basal lamina of the muscle fiber, are normally maintained in a quiescent state. (biomedcentral.com)
  • The process of muscle recovery following injury and myonuclear accretion during growth is attributed to a small population of satellite cells located beneath the basal lamina of the myofiber. (koreascience.or.kr)
  • SCs reside between the basal lamina and the muscle membrane 4 and although quiescent in normal adult muscles, SCs can be activated by specific signals upon muscle injury. (nature.com)
  • Satellite cells (SCs) are mononuclear myogenic stem cells located between the basal lamina and plasmalemma of the skeletal muscle fiber. (usask.ca)
  • Satellite cells are myogenic stem cells that can be activated from a quiescent state to proliferate for self-renewal or differentiate into myogenic cells. (diva-portal.org)
  • Both of the cells could differentiate into the large polynucleated muscle fibre cells, and immunofluorescence reactions of myosin heavy chain (MyHC) were positive. (peerj.com)
  • There were more cells of POMSC S(3n) to differentiate into the muscle fibre cells than that of POMSC S(2n) . (peerj.com)
  • By altering the concentrations of TGF‐beta, FGF, and IGF‐I, satellite cells can be induced to proliferate, differentiate, or to remain quiescent. (elsevier.com)
  • These proliferating cells eventually withdraw from the cell cycle and either return to quiescence (self-renewal) through downregulation of MyoD or differentiate through downregulation of Pax7 and upregulation of myogenin. (biomedcentral.com)
  • The activated satellite cells proliferate, migrate to the site of injury, fuse and, differentiate to form new myofibers ( 5 , 6 ). (pnas.org)
  • Stem cells are defined by three important characteristics: the ability to self-renew, to form clonal populations and to differentiate into different cell types. (medsci.org)
  • The regeneration process starts with the proliferation of satellite cells to give rise to myoblasts, which subsequently differentiate terminally into myofibers. (physiology.org)
  • Our analysis showed that functional overload induces the expression of MyoD in satellite cells and enhances the proliferative capacity and differentiation potential of these cells. (hindawi.com)
  • In addition, activated satellite cells express myogenic factor 5 (Myf5) and myogenic differentiation (MyoD) [ 7 ]. (hindawi.com)
  • Constitutive retroviral-driven expression of wild-type or stabilised beta-catenin results in more satellite cells expressing Pax7 without any MyoD -- therefore, adopting the self-renewal pathway, with fewer cells undergoing myogenic differentiation. (unboundmedicine.com)
  • Similarly, preventing the degradation of endogenous beta-catenin by inhibiting GSK3beta activity also results in more Pax7-positive-MyoD-negative (Pax7(+)MyoD(-)) satellite-cell progeny. (unboundmedicine.com)
  • The members of the myogenic regulatory family were evaluated and by using the new method MyoD and myogenin were found to be useful markers to identify activated and differentiated satellite cells. (diva-portal.org)
  • Low numbers of MyoD or myogenin stained satellite cells were observed in both untrained and strength trained subjects. (diva-portal.org)
  • Cardiotoxin was used to induce regeneration in the gastrocnemius and soleus muscles of heterozygous Myf5-nlacZ mice, and the muscles were assayed for the presence of (beta)-galactosidase (Myf5) and MyoD. (biologists.org)
  • Adult satellite cells identified by M-cadherin labelling, when activated, initially express either MyoD or Myf5 or both myogenic factors. (biologists.org)
  • 1992 ). MyoD and Myogenin are coexpressed in regenerating skeletal muscle of the mouse. (biologists.org)
  • 1993 ). Selective accumulation of MyoD and myogenin mRNAs in fast and slow adult skeletal muscle is controlled by innervation and hormones. (biologists.org)
  • 1996 ). MyoD is required for myogenic stem cell function in adult skeletal muscle. (biologists.org)
  • Heightened immunofluorescence for MyoD was found within SC in the needled muscle, which correlated with a 6- and 10-fold increase in two MyoD isoforms (~38 and 42 kDa, respectively), when analyzed by Western blotting. (scirp.org)
  • An additional 56 kDa MyoD immunoreactive species was observed in both needled and control muscle of the aging rats. (scirp.org)
  • After activation the cells will express Pax7 and myogenic differentiation antigen 1 (MyoD) concurrently while the cells undergo a few rounds of division (proliferation). (biomedcentral.com)
  • Our previous studies have demonstrated that Sharp-1 is a negative regulator of skeletal myogenesis and it blocks differentiation of muscle precursor cells by modulating the activity of MyoD. (biologists.org)
  • Chronic administration of an anabolic agent (BRL-47672, the pro-drug of clenbuterol) increased the expression of early components of satellite cell myogenesis (pax7, ki-67, myoD) but caused no alteration in myogenin expression, relative to control in rat soleus muscle. (coventry.ac.uk)
  • This was demonstrated by the pattern of pax7 and myoD expression in hypertrophying muscle, where both markers were up-regulated and in atrophying muscle, where they were down-regulated. (coventry.ac.uk)
  • Down-regulation of these markers in atrophy could have implications for muscle regenerative capacity, especially myoD, whose expression was continuously inhibited across all time-points sampled in septic muscles. (coventry.ac.uk)
  • MyoD is a transcriptional factor that is required for the differentiation of muscle stem cells (satellite cells). (rupress.org)
  • MyoD and Cdc6 are both expressed after quiescent C2C12 myoblasts or satellite cells in association with myofibers are stimulated for growth, but MyoD appears at least 2-3 h earlier than Cdc6. (rupress.org)
  • Finally, knockdown of MyoD impairs the ability of C2C12 cells to express Cdc6 after leaving quiescence, and as a result, they cannot fully progress into S phase. (rupress.org)
  • Our results define a mechanism by which MyoD helps myogenic satellite cells to enter into the first round of DNA replication after transitioning out of quiescence. (rupress.org)
  • There is evidence to suggest that MyoD may also be playing a role in helping satellite cells to expand in population upon leaving quiescence. (rupress.org)
  • Although this scenario has yet to be demonstrated in satellite cells, it is most likely that analogous mechanisms would occur, and if so, it is possible that MyoD could be involved in inducing transcription from either Cdc6 or MCM2 in these cells after leaving quiescence. (rupress.org)
  • Although there is a large body of literature documenting satellite cell activity during these different types of muscle plasticity, there remains no study that has directly tested the requirement of satellite cells for any of these processes. (biologists.org)
  • To date, the molecules that mediate muscle plasticity remain unclear.Using different models inducing muscle atrophy, we show that the transcription factor Srf is a mediator of mechanotransduction through the actin-Mrtfs-Srf pathway. (duhnnae.com)
  • The purpose of the present review is to give a short overview of the currently known factors and their role in skeletal muscle plasticity. (biologists.org)
  • All satellite cells express the stem-cell-specific transcription factor, paired-box 7 (Pax7). (hindawi.com)
  • Thus, beta-catenin signalling in proliferating satellite cells directs these cells towards the self-renewal pathway and, so, contributes to the maintenance of this stem-cell pool in adult skeletal muscle. (unboundmedicine.com)
  • ii) to evaluate which molecular markers which had been described for satellite cell and stem cell identification in different cell states (quiescence, activated or differentiated) are the most useful for studies on human skeletal muscle. (diva-portal.org)
  • Dedifferentiation of stump tissues, such as skeletal muscle, precedes blastema formation, but it was not known whether dedifferentiation involves stem cell activation. (rupress.org)
  • Furthermore, miRNAs modulate stem cell fate decisions [ 28 - 31 ] and may have similar functions in satellite cells. (biomedcentral.com)
  • Dystrophin expression in the mdx mouse restored by stem cell transplantation. (nature.com)
  • 2001. The evolving concept of a stem cell: entity or function? (koreascience.or.kr)
  • 2005. Stem cell function, self-renewal, and behavioral heterogeneity of cells from the adult muscle satellite cell niche. (koreascience.or.kr)
  • Effects and mechanism of RhoC downregulation in suppressing ovarian cancer stem cell proliferation, drug resistance, invasion and metastasis. (nih.gov)
  • Regenerative efforts typically focus on the delivery of single factors, but it is likely that multiple factors regulating distinct aspects of the regenerative process (e.g., vascularization and stem cell activation) can be used in parallel to affect regeneration of functional tissues. (pnas.org)
  • Cell Stem Cell. (wikipedia.org)
  • Different subpopulations of quiescent satellite cells can be distinguished on the basis of cell surface markers and stem cell-like properties. (mendeley.com)
  • The RNA binding protein Sam68 links a key metabolic route to the neural stem cell fate in the developing mouse brain. (elifesciences.org)
  • We propose that muscle degeneration and fibrosis provokes altered vascularization and immune responses, which eventually affect negatively stem cell functions. (europa.eu)
  • 1987 ). Acetylcholine receptor channels are absent in undifferentiated satellite cells but not in embryonic myoblasts in culture. (biologists.org)
  • Figure 3: Dermomyotome-derived cells contribute to embryonic muscle growth. (nature.com)
  • These results identify nitric oxide as a key messenger in satellite cells maintenance, expand the significance of the Vangl2-dependent Wnt noncanonical pathway in myogenesis, and indicate novel strategies to optimize nitric oxide-based therapies for muscular dystrophy. (ox.ac.uk)
  • Feldman, J. L. & Stockdale, F. E. Temporal appearance of satellite cells during myogenesis. (nature.com)
  • In order to understand its role in pre- and post-natal myogenesis, we assessed skeletal muscle development and freeze-injury-induced regeneration in Sharp-1-deficient mice. (biologists.org)
  • 1999. Time course of changes in markers of myogenesis in overloaded rat skeletal muscles. (koreascience.or.kr)
  • 2002. The regulation of Notch signaling controls satellite cell activation and cell fate determination in postnatal myogenesis. (koreascience.or.kr)
  • Skeletal myogenesis is a complex process that depends on the modulation of a series of genes. (biomedcentral.com)
  • Muscle cells were cultured to assess cell number, morphology and the expression of major proteins involved in myogenesis (Pax7, cadherins, β1 integrin, IL-4Rα and myogenin) by western blotting. (chemweb.com)
  • Thus, an enhanced understanding of cytoglobin's role in myogenesis may enable the development of therapeutic approaches for treating patients with muscle injuries and other neuromuscular disorders. (pnas.org)
  • A better understanding of the processes and proteins involved in myogenesis and muscle regeneration may enable the design of innovative therapies to improve the care of victims of severe muscle trauma, patients with skeletal myopathies, and the elderly. (pnas.org)
  • Over the course of a mammal's lifetime, the maintenance, adaptation, and repair of skeletal muscle depend on the continual ability to initiate myogenesis ( 4 , 5 , 10 ⇓ - 12 ). (pnas.org)
  • However, many quiescent satellite cells transcribe Myf5, but do not enter myogenesis because of post-transcriptional regulation, which prevents Myf5 protein accumulation. (mendeley.com)
  • Using multiple genetic reporter system in human pluripotent stem cells, a transcriptional database for human early myogenesis has been established. (elifesciences.org)
  • These results indicate the effects of resistance exercise on the regulation of satellite cells and provide insight into the molecular mechanism of satellite cell activation following physical exercise. (hindawi.com)
  • Exercise positively affects muscle fiber composition via regulation of satellite cells to improve muscle performance. (hindawi.com)
  • These findings suggest a crucial role for the HEXIM1/P-TEFb pathway in the regulation of satellite cell-mediated muscle regeneration and identify HEXIM1 as a potential therapeutic target for degenerative muscular diseases. (jci.org)
  • However, satellite cells may also play a role in muscle fibre remodelling after endurance-based exercise and extracellular matrix regulation. (springer.com)
  • Satellite cell activation appears to be regulated by post-transcriptional gene regulation. (biomedcentral.com)
  • Interestingly, a growing pool of data demonstrates that cell fate determination is reliant on post-transcriptional gene regulation [ 16 - 20 ] and may provide mechanisms to maintain quiescent satellite cells in a ready state. (biomedcentral.com)
  • Allen, RE & Boxhorn, LK 1989, ' Regulation of skeletal muscle satellite cell proliferation and differentiation by transforming growth factor‐beta, insulin‐like growth factor I, and fibroblast growth factor ', Journal of Cellular Physiology , vol. 138, no. 2, pp. 311-315. (elsevier.com)
  • Vitamin D regulation of mitochondrial health may also have implications for SC activity and self-renewal capacity, which could further affect muscle regeneration. (frontiersin.org)
  • 2004. Cellular and molecular regulation of muscle regeneration. (koreascience.or.kr)
  • Negative regulation of satellite cells by glucocorticoids could impede their efficacy in the treatment of inflammatory muscle disorders. (coventry.ac.uk)
  • The isolation, culture, and regulation of differentiation of muscle satellite cells are important methods for muscle biological research. (biomedcentral.com)
  • Altered activation of PI3K and SREBP-1c may explain the defective regulation of miR-1 and miR-133a expression in response to insulin in muscle of type 2 diabetic patients. (wikipedia.org)
  • Post-transcriptional regulation, through microRNA repression of a potential cell cycle activator, further illustrates how these cells are ready for action. (mendeley.com)
  • Sections in this new release include the karyosphere (karyosome) and its peculiar structure of the oocyte nucleus, organoids as models of disease, lipid droplets as organelles, the dark side of apoptosis, interconnections between autophagy and secretion, and the regulation and function of intracellular pressure in cell biology. (elsevier.com)
  • The radiosensitivity of satellite cells: cell cycle regulation, apoptosis and oxidative stress. (biomedsearch.com)
  • The main objective of this study was to examine the effects of clinically relevant doses of γ radiation on satellite cell survival and proliferation, cell cycle regulation, apoptosis, DNA double-strand break repair, oxidative stress and NO production. (biomedsearch.com)
  • The single-cell eQTLGen consortium aims to pinpoint the cellular contexts in which disease-causing genetic variants affect gene expression and its regulation. (elifesciences.org)
  • Vitamin D is an essential nutrient for the maintenance of skeletal muscle and bone health. (frontiersin.org)
  • Skeletal-muscle-specific stem cells, termed satellite cells, contribute to the postnatal maintenance, growth, repair, and regeneration of skeletal muscle [ 1 ]. (hindawi.com)
  • Carlson BM (1973) The regeneration of skeletal muscle. (springer.com)
  • Regeneration of skeletal muscle is mainly executed by satellite cells (SCs) ( 8 ). (asm.org)
  • In summary, we report for the first time that PSP is capable of promoting the regeneration of skeletal muscle. (physiology.org)
  • 1997 ). Single-cell analysis of regulatory gene expression in quiescent and activated mouse skeletal muscle satellite cells. (biologists.org)
  • 1991 ). Early expression of the myogenic regulatory gene, myf5, in precursor cells of skeletal muscle in the mouse embryo. (biologists.org)
  • The peptides produced by the ghrelin gene, i.e., acylated ghrelin (AG), unacylated ghrelin (UnAG), and obestatin (Ob), affect skeletal muscle biology in several ways, not always with overlapping effects. (deepdyve.com)
  • Muscle satellite cell gene marker ( pax7b ) and myogenic cell protein marker (Desmin) were all expressed in cells of two cell lines. (peerj.com)
  • Satellite cells isolated by FACS from uninjured skeletal muscle and 12 h post-muscle injury from wild type and Syndecan-4 null mice were probed using Affymetrix 430v2 gene chips and analyzed by Spotfire tm and Ingenuity Pathway analysis to identify gene expression changes and networks associated with satellite cell activation, respectively. (biomedcentral.com)
  • An unbiased gene expression screen identified over 4,000 genes differentially expressed in satellite cells in vivo within 12 h following muscle damage and more than 50% of these decrease dramatically. (biomedcentral.com)
  • To elucidate niche dependence versus cell-autonomous mutant SOD1 (mSOD1) toxicity in this model, we measured in vitro proliferation potential and MRF and cyclin gene expression in SMSC cultures derived from fast-twitch extensor digitorum longus and slow-twitch soleus muscles of SOD1-G93A mice. (pasteur.fr)
  • Overexpression of this gene is associated with tumor cell proliferation and metastasis. (nih.gov)
  • A good genetic and biochemical model for Duchenne muscular dystrophy is the Dmd mdx mouse that bears a nonsense point mutation in exon 23 of the Dmd gene, which causes lack of this protein in skeletal muscle. (nature.com)
  • [email protected]#To investigate the expression of EGR1 gene and the localization of EGR1 protein in bovine skeletal muscle-derived satellite cells (MDSCs), as well as to investigate the mechanism that EGR1 protein enters the nucleus. (bvsalud.org)
  • [email protected]#The results from the qRT-PCR and Western blot showed that the expressions of EGR1 gene on transcription level and translation level were significantly higher in differentiated cells than those in undifferentiated cells. (bvsalud.org)
  • [email protected]#During the differentiation of bovine skeletal muscle satellite cells, the transcriptional level of EGR1 gene is increased, and some EGR1 proteins are transferred into the nucleus. (bvsalud.org)
  • Furthermore, we analyzed the expression levels of the paired box homeotic gene 7 (pax7), m-cadherin (the makers of muscle satellite cells), and utrophin mRNA. (qxmd.com)
  • In this issue of the Journal of Clinical Investigation , researchers at the State University of New York Downstate Medical Center in Brooklyn report that HEXIM1, a protein that regulates gene transcription, is important for skeletal muscle regeneration in mice. (eurekalert.org)
  • M.A.Q. Saddiqui and colleagues found that HEXIM1 blocks gene expression that is required for muscle regeneration after injury. (eurekalert.org)
  • Mice with a 50% reduction in HEXIM1 exhibited greater muscle mass and function after injury compared to mice with a normal amount of the gene. (eurekalert.org)
  • We discuss the latter in the context of the small proportion of satellite cells that express high levels of Pax7, or that are derived from cells that have never activated the Myf5 myogenic determination gene. (mendeley.com)
  • Modifications of gene expression of skeletal muscle in metabolic diseases and in particular in the subject. (uniurb.it)
  • On the other hand, ablation of the PrP gene has been shown to directly affect skeletal muscles, for example, by enhancing oxidative damage ( 30 ) or by diminishing tolerance for physical exercise ( 51 ). (asm.org)
  • Here we review the molecular mechanisms controlling the activation of satellite cells in response to mechanical stress and protein intake in both in vitro and in vivo models. (springer.com)
  • According to myosatellite cell lines (MSCs) established in vitro from diploid and triploid flounder, we compared the characters of growth and differentiation of their MSCs. (peerj.com)
  • Ppardelta-cKO mice had 40% fewer satellite cells than their wild-type littermates, and these satellite cells exhibited reduced growth kinetics and proliferation in vitro. (umassmed.edu)
  • In vitro growth of these cells was evaluated in serum-containing medium and in serum-free medium in response to multiplication stimulating activity/rat insulin-like growth factor II (MSA). (elsevier.com)
  • In vitro and in vivo rodent studies show that vitamin D mitigates reactive oxygen species (ROS) production, augments antioxidant capacity, and prevents oxidative stress, a common antagonist in muscle damage. (frontiersin.org)
  • 1995. Hepatocyte growth factor activates quiescent skeletal muscle satellite cells in vitro. (koreascience.or.kr)
  • Satellite cells were also cultured in vitro for 7 days to determine if PO 4 nutrition alters their ability to proceed through their myogenic lineage. (mdpi.com)
  • In vivo satellite cell proliferation was reduced ( P 4 deficient pigs, and these cells had altered in vitro expression of markers of myogenic progression. (mdpi.com)
  • Primary human skeletal muscle cells and culture medium optimized for the in vitro cultivation and differentiation of primary human skeletal muscle cells. (sigmaaldrich.com)
  • In vitro studies with primary satellite cell cultures under standard conditions suggest that satellite cells isolated from aged horses displayed compromised proliferative, differentiation and fusion capacity in vitro. (ufl.edu)
  • residues Ser93-Leu112) induce satellite cell proliferation in vitro and promote muscle regeneration in vivo. (physiology.org)
  • Moreover, BrdU pulse-labeling demonstrated that PEDF/PSP stimulated primary rat satellite cell proliferation in myofibers in vitro. (physiology.org)
  • One week after final injection, the rabbits were euthanized, and both superior rectus muscles were removed for in-vitro physiological force assessment and muscle morphometry. (arvojournals.org)
  • meanwhile, the performance of these cells' proliferation and differentiation were analyzed. (peerj.com)
  • The use of animal and cell models has suggested a number of putative functions for the protein, including cell signaling, adhesion, proliferation, and differentiation. (asm.org)
  • Shefer G, Yablonka-Reuveni Z (2005) Isolation and culture of skeletal muscle myofibers as a means to analyze satellite cells. (springer.com)
  • In neonatal muscle, growth is mainly achieved by addition of myoblasts derived from SCs to existing myofibers ( 9 , 10 ). (asm.org)
  • Here, we describe a key role of nitric oxide, an important signaling molecule in adult skeletal muscle, on satellite cells maintenance, studied ex vivo on isolated myofibers and in vivo using the α-sarcoglycan null mouse model of dystrophy and a cardiotoxin-induced model of repetitive damage. (ox.ac.uk)
  • Proliferation of muscle satellite cells on intact myofibers in culture. (koreascience.or.kr)
  • However, the ability to regenerate muscle and replace damaged myofibers declines with age. (ufl.edu)
  • PSP delivery was found to stimulate satellite cell proliferation in damaged muscle and enhance the growth of regenerating myofibers, with complete regeneration of normal muscle mass by 2 weeks. (physiology.org)
  • To determine whether Gαi2 is required for skeletal muscle growth or regeneration, Gαi2-null mice were analyzed. (asm.org)
  • Gαi2 knockout mice display decreased lean body mass, reduced muscle size, and impaired skeletal muscle regeneration after cardiotoxin-induced injury. (asm.org)
  • 1998 ). Satellite cells in normal and regenerated soleus muscles of mdx and control mice. (biologists.org)
  • Methods To delineate the endogenous contribution of preproghrelin in muscle regeneration, we evaluated the repair process −/− in Ghrl mice upon CTX-induced injury. (deepdyve.com)
  • Results Although muscles from Ghrl mice do not visibly differ from WT muscles in term of weight, structure, and SCs −/− content, muscle regeneration after CTX-induced injury is impaired in Ghrl mice, indicating that ghrelin-derived peptides actively participate in muscle repair. (deepdyve.com)
  • Although Ppardelta-cKO mice were born normally and initially displayed no difference in body weight, muscle size or muscle composition, they later developed metabolic syndrome, which manifested as increased body weight and reduced response to glucose challenge at age nine months. (umassmed.edu)
  • To determine whether muscle satellite cells and utrophin are correlated with the degree of damage in mdx skeletal muscles, we measured the area of the degenerative region as an indicator of myofiber degeneration in the masseter, gastrocnemius, soleus, and diaphragm muscles of mdx mice. (qxmd.com)
  • We also investigated the immunolocalization of m-cadherin and utrophin proteins in the muscles of normal C57BL/10J (B10) and mdx mice. (qxmd.com)
  • The expression level of pax7 mRNA and the percentage of m-cadherin-positive cells among the total number of cell nuclei in the muscle tissues in all four muscles studied were greater in the mdx mice than in the B10 mice. (qxmd.com)
  • However, there was no significant correlation between muscle damage and expression level for pax7 mRNA (R = -0.140), nor was there a correlation between muscle damage and the percentage of satellite cells among the total number of cell nuclei (R = -0.411) in the mdx mice. (qxmd.com)
  • The expression level of utrophin mRNA and the intensity of immunostaining for utrophin in all four muscles studied were greater in the mdx mice than in the B10 mice. (qxmd.com)
  • However, there also was not a significant correlation between muscle damage and expression level of utrophin mRNA (R = 0.231) in the mdx mice, although upregulated utrophin was incorporated into the sarcolemma. (qxmd.com)
  • The sparing of extraocular muscle in dystrophinopathy is lost in mice lacking utrophin and dystrophin. (qxmd.com)
  • Finally, we demonstrate that miR-133 levels are downregulated in mice exposed to cold, resulting in de novo generation of satellite cell-derived brown adipocytes. (forskningsdatabasen.dk)
  • Mice in which cytoglobin was knocked out specifically in skeletal muscle were generated to examine the role of cytoglobin in vivo. (pnas.org)
  • Consistent with this finding, the capacity for muscle regeneration was severely impaired in mice deficient for skeletal-muscle cytoglobin. (pnas.org)
  • The native capacity of adult skeletal muscles to regenerate is vital to the recovery from physical injuries and dystrophic diseases. (jci.org)
  • 1984 ). Myosatellite cells, growth, and regeneration in murine Dystrophic muscle: A quantitative study. (biologists.org)
  • This contribution increases significantly during acute injury or in chronically regenerating dystrophic muscle. (optistem.org)
  • We concluded that dystrophic muscles, independently of their degeneration degree, retain their SCs pool with proliferating and regenerative capacities. (nature.com)
  • Implication of the satellite cell in dystrophic muscle fibrosis: a self-perpetuating mechanism of collagen overproduction. (qxmd.com)
  • In this Review, we do a roundup of the past attempts and describe the updated status of cell-based therapies aimed at counteracting the skeletal and cardiac myopathy present in dystrophic patients. (jci.org)
  • But in aged or dystrophic muscles, immune cells lead to the release a lot of toxic chemicals like cytokines and free radicals that kill the new stem cells,' said Young Jang, an assistant professor in Georgia Tech's School of Biological Sciences and one of the study's principal investigators. (news-medical.net)
  • Immunohistochemical analyses were used to quantify myosin heavy chain (MyHC) isoform expression, cross-sectional area (CSA), satellite cell and myonuclear content, and capillary density. (sigmaaldrich.com)
  • The primary aim of our study was to validate the assessment of myonuclear and satellite cell number in biopsies from human skeletal muscle. (diva-portal.org)
  • This Perspective examines the role that these cells are thought to play in aging muscle atrophy, and highlights a recent study by Brack and colleagues that attempts to understand the role of satellite cells in maintaining the ratio of myonuclear number to cytoplasmic volume within myocytes as we age. (sciencemag.org)
  • These and other data argue against the current interpretation of the myonuclear domain hypothesis and suggest that once a nucleus has been acquired by a muscle fiber it persists. (frontiersin.org)
  • Satellite cells are resident skeletal muscle stem cells responsible for muscle maintenance and repair. (biomedcentral.com)
  • Muscle regeneration is a complex process that involves restoration of mitochondrial function and activation of satellite cells (SC), the resident skeletal muscle stem cells. (frontiersin.org)
  • Although it is well known that the number of satellite cells increases following physical exercise, functional alterations in satellite cells such as proliferative capacity and differentiation efficiency following exercise and their molecular mechanisms remain unclear. (hindawi.com)
  • Furthermore, the molecular mechanisms by which exercise-stimulating extracellular factors control the satellite cell activation and differentiation remain unclear. (hindawi.com)
  • Perez-Ruiz A King's College London, Randall Division of Cell and Molecular Biophysics, New Hunt's House, Guy's Campus, London, UK. (unboundmedicine.com)
  • The introduction of immunohistochemistry and the discovery of molecular markers of satellite cells then made them accessible for light microscopic studies and a wealth of information is today available. (diva-portal.org)
  • The molecular mechanism involved in the transition of a quiescent satellite cell to a transit-amplifying myoblast is poorly understood. (biomedcentral.com)
  • The present study in pre-senile female rats, in conjunction with our previous study in young male rats, suggests that muscle remodeling and restructuring after injury may constitute the initial cellular and molecular mechanisms that underlie the benefits associated with acupuncture throughout the life-span. (scirp.org)
  • Molecular cell. (nih.gov)
  • We present a low-cost kit based on freeze-dried, cell-free reactions to illustrate synthetic and molecular biology concepts. (sciencemag.org)
  • for example, memory T cells exposed to a specific antigen have a different molecular makeup compared with naive T cells ( Mackay, 1999 ). (biologists.org)
  • We currently have a good descriptive understanding of the molecular mechanisms controlling the muscle phenotype. (biologists.org)
  • International Review of Cell and Molecular Biology, Volume 346, reviews and details current advances in cell and molecular biology. (elsevier.com)
  • The IRCMB series has a worldwide readership, maintaining a high standard by publishing invited articles on important and timely topics that are authored by prominent cell and molecular biologists. (elsevier.com)
  • Consistent with these observations, downregulation of beta-catenin using small interfering RNA (siRNA) reduced the proportion of satellite cells that express Pax7 and augmented myogenic differentiation after mitogen withdrawal. (unboundmedicine.com)
  • From the evaluation of different markers it was found that both NCAM and Pax7 identified the majority of satellite cells but that both markers were needed for reliable identification. (diva-portal.org)
  • In addition three subtypes of satellite cells (94.4% NCAM + /Pax7 + , 4.2% NCAM + /Pax7 - and 1.4% NCAM - /Pax7 + ) were observed. (diva-portal.org)
  • We describe a multipotent Pax7 + satellite cell population located within the skeletal muscle of the salamander limb. (rupress.org)
  • Second, we report that small differences in counting satellite cells using CD56 and Pax7 antibodies can be attributed to the different staining profiles. (diva-portal.org)
  • Furthermore, it increased the number of Pax7(+)/Myf5(-) cells in a cGMP-independent pathway requiring enhanced expression of Vangl2, a member of the planar cell polarity pathway involved in the Wnt noncanonical pathway. (ox.ac.uk)
  • Identification of Skeletal Muscle Satellite Cells by Immunofluorescence with Pax7 and Laminin Antibodies. (nih.gov)
  • Mammalian skeletal muscle has the ability to regenerate and repair in response to exercise or injury. (asm.org)
  • They are responsible for postnatal skeletal muscle growth, repair and regeneration. (usask.ca)
  • Satellite cell activity is necessary for postnatal skeletal muscle growth. (mdpi.com)
  • However, adult skeletal muscle stem cells (satellite cells) have long been considered uniformly determined toward the myogenic lineage. (forskningsdatabasen.dk)
  • American Journal of Physiology - Cell Physiology Published 21 January 2009 Vol. no. (physiology.org)
  • Thank you for your interest in spreading the word about Cell Physiology. (physiology.org)
  • Message Body (Your Name) thought you would like to see this page from the Cell Physiology web site. (physiology.org)
  • She is very knowledgeable and has taught me many great skills regarding to muscle physiology. (ufl.edu)
  • American Journal of Physiology - Cell Physiology Published 3 June 2015 Vol. no. (physiology.org)
  • A wealth of evidence has suggested that the function of PrP C is beneficial to the cell, but currently, our detailed comprehension of its physiology remains poor. (asm.org)
  • 1.1 Skeletal Muscle Physiology ( Valmor Tricoli ). (wiley.com)
  • Physical exercise induces changes in extracellular signaling in skeletal muscle that affect satellite cells. (hindawi.com)
  • Bed rest, a ground-based spaceflight analog, induces robust atrophy of skeletal muscle, an effect that is exacerbated with increasing age. (sigmaaldrich.com)
  • The second approach induces and grows pluripotent stem cells, drives their differentiation along certain pathways such as germ layers, neural crest, liver, teeth or retina, and cultures organs such as pancreas and heart. (springer.com)
  • mTORC1 inhibition by perinatal ER stress induces beta-cell growth arrest with subsequent development of diabetes. (elifesciences.org)
  • Short hairpin RNA (shRNA)-mediated knockdown of Gαi2 in satellite cells (SCs) leads to defective satellite cell proliferation, fusion, and differentiation ex vivo . (asm.org)
  • 1992 ). Identification of skeletal muscle precursor cells in vivo by use of MyoD1 and Myogenin probes. (biologists.org)
  • More research is needed to determine mechanistic action of 1,25(OH)D on mitochondria and SCs, as well as how this action manifests following muscle injury in vivo . (frontiersin.org)
  • Early muscle abnormalities that precede motor neuron loss in ALS may destabilize neuromuscular junctions, and we have previously demonstrated alterations in myogenic regulatory factor (MRF) expression in vivo and in the activation of myofiber-associated skeletal muscle satellite cells (SMSCs) in the mouse model of ALS (SOD1-G93A). (pasteur.fr)
  • Based on the results of these studies, satellite cell proliferation is currently thought to be a necessary step for mounting a robust growth response. (biologists.org)
  • As a consequence, it is difficult to arrive at a definitive conclusion regarding the necessity of satellite cells during muscle growth. (biologists.org)
  • Other markers such as DLK1/FA1, a member of the EGF-like family and c-Met, the receptor for hepatocyte growth factor showed that satellite cell heterogeneity in human muscle is far greater than previously shown. (diva-portal.org)
  • However, the requirement for Gαi isoforms in skeletal muscle growth and regeneration has not been determined. (asm.org)
  • Cells from 3-month-old rats exhibited a shorter lag phase of growth than cells from 12- or 24-month-old animals. (elsevier.com)
  • Dodson, MV & Allen, RE 1987, ' Interaction of multiplication stimulating activity/rat insulin-like growth factor II with skeletal muscle satellite cells during aging ', Mechanisms of Ageing and Development , vol. 39, no. 2, pp. 121-128. (elsevier.com)
  • Avian and mammalian skeletal muscles exhibit a remarkable ability to adjust to physiological stressors induced by growth, exercise, injury and disease. (koreascience.or.kr)
  • this is likely a compensatory mechanism to check excessive muscle growth. (coventry.ac.uk)
  • These data show that pericytes, resident in small vessels of skeletal muscle, contribute to its growth and regeneration during postnatal life. (optistem.org)
  • In a comparative human study, we investigated the muscle fiber type-specific association between emergence of satellite cells (SCs), muscle growth, and remodeling in response to 12 wk unilateral resistance training performed as eccentric (Ecc) or concentric (Conc) resistance training ± whey protein (Whey, 19.5 g protein + 19.5 g glucose) or placebo (Placebo, 39 g glucose) supplementation. (forskningsdatabasen.dk)
  • The role of sustained delivery, via injectable gel, of a combination of VEGF to promote angiogenesis and insulin-like growth factor-1 (IGF1) to directly promote muscle regeneration and the return of muscle function in ischemic rodent hindlimbs was investigated. (pnas.org)
  • Cell surface molecules: Growth factors and prostaglandins 6) Myotubes and innervation. (nih.gov)
  • Selective estrogen receptor-β activation stimulates skeletal muscle growth and regeneration. (semanticscholar.org)
  • Insulin-like growth factor-I E peptides: implications for aging skeletal muscle. (biomedsearch.com)
  • Further work to better understand early nutritional programming of satellite cells and the potential benefits of emphasizing early PO 4 nutrition for future lean growth potential is warranted. (mdpi.com)
  • [2] These cells are normally quiescent but can be activated by exercise or pathology to provide additional myonuclei for muscle growth or repair. (wikipedia.org)
  • Muscle growth is further supported by DNA recruitment through activation and incorporation of satellite cells. (biologists.org)
  • Skeletal muscles are the organ of movement, and their growth, regeneration and maintenance are dependent in large part on a population of myogenic stem cells known as satellite cells. (biomedsearch.com)
  • They proliferate very well in the mitogen-rich PromoCell Skeletal Muscle Cell Growth Medium. (sigmaaldrich.com)
  • Skeletal muscle stem cells (Satellite cells) are indispensable for muscle growth and remodeling following myofibril damage. (bioportfolio.com)
  • Practically everybody knows the key importance of protein for boosting muscle growth and recovery. (muscleandstrength.com)
  • It's also important to consider, while they found no difference in muscle growth between groups, for the advanced trainers reading this article who may trainer harder, with more volume, intensity and more days per week, your protein needs are increased. (muscleandstrength.com)
  • Myogenic stem cells, commonly referred to as satellite cells, are responsible for muscle growth and repair in adults. (ufl.edu)
  • Previously, we have shown that insulin growth factor-1 (IGF1) increases myofiber cross-sectional area and force generation in extraocular muscle (EOM). (arvojournals.org)
  • These results suggest that exogenously-induced satellite cell activation in EOM raises the potential for myofiber growth induced by IGF1, the result of which is greater motive force. (arvojournals.org)
  • Previous work in our laboratory has shown that naturally-occurring growth factors and muscle signaling factors can increase or decrease the strength of EOM, and may be useful in the treatment of patients with strabismus. (arvojournals.org)
  • These results demonstrate that Sharp-1 regulates muscle regenerative capacity, at least in part, by modulation of TGF-β signaling. (biologists.org)
  • Satellite cells (SCs) are the main muscle stem cells responsible for its regenerative capacity. (nature.com)
  • It has a high regenerative capacity after injury, which is directly linked to the presence of satellite cells (SCs). (nature.com)
  • The regenerative capacity of adult skeletal muscle is not unlimited. (pnas.org)
  • The first approach taps into the latent regenerative capacity of particular tissues, such as muscle, skin, fat, or bone marrow. (springer.com)
  • Skeletal muscle aerobic capacity, mitochondrial function and regenerative capacity have been found to decline with age in humans and rodents. (ufl.edu)
  • and 3) examine differences in the intrinsic regenerative capacity of muscle stem cells isolated from skeletal muscle of young and aged horses. (ufl.edu)
  • We then asked whether the intrinsic changes within an aged satellite cell would cause alteration in regenerative capacity in equine. (ufl.edu)
  • Heterotrimeric G proteins are intracellular proteins and transduce external signals from a variety of cell surface receptors to intracellular effectors ( 1 ). (asm.org)
  • Rho proteins promote reorganization of the actin cytoskeleton and regulate cell shape, attachment, and motility. (nih.gov)
  • Confocal observation revealed that some EGR1 proteins were transferred into the nucleus in the differentiation of cells, however, the EGR1 proteins would not be detected in the differentiated MDSCs nuclei if a site directed mutagenesis (serine) on EGR1 protein occurred. (bvsalud.org)
  • Many Srf target genes encode sarcomeric proteins such as α-skeletal actin, thus a downregulation of Srf-dependent transcription could participate to muscle atrophy. (duhnnae.com)
  • Expression of a NOS transgene in dystrophin-deficient muscle reduces muscle membrane damage without increasing the expression of membrane-associated cytoskeletal proteins. (qxmd.com)
  • Cell number and myotube expansion were reduced in cultured muscle cells from UN, but the expression of myogenic marker proteins was unaltered.Dietary restriction during lactation had no impact on the synthesis of myogenic marker proteins, and myocyte differentiation occurred normally in the muscles of offspring aged 42, 60 or 90 days. (chemweb.com)
  • This hydrogel's added latches, which bond with proteins protruding from stem cells' membranes, not only increase the cells' adhesion to the net but also hinder them from committing suicide. (news-medical.net)
  • Bennett G, Leblond CP, Haddad A (1974) Migration of glycoprotein from the Golgi apparatus to the surface of various cell types as shown by radioautography after labeled fucose injection into rats. (springer.com)
  • Satellite cells were isolated from the skeletal muscle of 3-, 12- and 24-month-old Fischer 344 rats. (elsevier.com)
  • cells from the 24-month-old rats were intermediate and cells from the 12-month-old rats had the highest affinity and lowest number of binding sites. (elsevier.com)
  • The lower affinity and increased number of binding sites in the young rat cells may be due to greater numbers of IGF type I receptors in muscle from young growing rats. (elsevier.com)
  • Previously, we reported that manual acupuncture needling of the tibialis anterior (TA) (ST36 = Zusanli) muscle of young male rats produced focal injury and morphological changes that accompanied the presence of activated satellite cells (SC) 72 hours post-needling. (scirp.org)
  • To investigate whether aging TA muscle responds in a similar fashion to acupuncture needling, 17-month-old female rats were subjected to a single insertion and manual manipulation of an acupuncture needle. (scirp.org)
  • 1989. Muscle transplantation between young and old rats: age of host determines recovery. (koreascience.or.kr)
  • The present work aimed at investigating the possible relation between microcurrent therapy and satellite cells in regeneration of induced skeletal muscle injury in albino rats . (bvsalud.org)
  • Twenty-four male albino rats were divided into 2 groups Control group and experimental group [II] rats were subjected to gastrocnemius- soleus muscle injury [subgroup IIa], they were subdivided into subgroups IIa1 and IIa2 sacrificed 1 and 3 weeks after injury respectively. (bvsalud.org)
  • Subgroup IIb Rats were subjected to muscle injury and micro-current electric stimulator, was applied for 20 minutes for three sessions per week. (bvsalud.org)
  • Muscles were removed from the legs of 42-, 60- and 90-day-old rats. (chemweb.com)
  • miR-133 enhances myoblast proliferation by repressing serum response factor (SRF) mIR-133 suppresses SP1 expression In rats, miR-133b is expressed in retinal dopaminergicamacrine cell, and this expression is significantly increased during early stage during retinal degeneration. (wikipedia.org)
  • Extensively soleus muscle necrosis was induced in rats by bupivacaine and an injectable alginate gel was used to release the PSP in the injured muscle. (physiology.org)
  • Loss of skeletal muscle mass, known as sarcopenia, is a serious health issue that affects millions of aging adults. (hindawi.com)
  • Since exercise can improve muscle strength and endurance capacity, it can serve as a means of preventing muscle atrophy and reducing the risk of sarcopenia. (hindawi.com)
  • Such dysregulation, as frequently reported in cases or progressive muscle degeneration and sarcopenia, limits the efficacy of muscle compensatory processes (i.e. satellite cell activation/proliferative or differentiation potential), thereby contributing to the progression of muscle atrophy and myopathy. (coventry.ac.uk)
  • As well, many older individuals suffer from sarcopenia, a protracted muscle wasting disorder that typically begins after the age of 50 and involves a loss of about 1% of muscle mass per year ( Woo, 2017 ). (frontiersin.org)
  • The factors responsible for the atrophy of skeletal muscle with aging remain to be elucidated. (sciencemag.org)
  • Nitric oxide sustains long-term skeletal muscle regeneration by regulating fate of satellite cells via signaling pathways requiring Vangl2 and cyclic GMP. (ox.ac.uk)
  • Nitric oxide stimulated satellite cells proliferation in a pathway dependent on cGMP generation. (ox.ac.uk)
  • Title: RhoA and RhoC are involved in stromal cell-derived factor-1-induced cell migration by regulating F-actin redistribution and assembly. (nih.gov)
  • Muscle sections were stained with hematoxylin and eosin , alpha smooth muscle actin [alpha-SMA] and CD34 immunostaining. (bvsalud.org)
  • The myofibrils are composed of actin and myosin filaments, repeated in units called sarcomeres , which are the basic functional units of the muscle fiber. (wikipedia.org)
  • The interaction of myosin and actin is responsible for muscle contraction. (wikipedia.org)
  • H19 was highly expressed in skeletal muscle at all the studied ages. (biomedcentral.com)
  • Here, we report that H19 was highly expressed in skeletal muscle in tissues from cattle of all postnatal ages. (biomedcentral.com)
  • We demonstrate that skeletal muscle dedifferentiation involves satellite cell activation and that these cells can contribute to new limb tissues. (rupress.org)
  • Data show that mature tissues in the stump (e.g., bone, cartilage, and skeletal muscle) respond to amputation by disorganization, histolysis, and increased cellular proliferation. (rupress.org)
  • It is unclear to what extent differentiated cells reverse mature phenotypes and to what extent undifferentiated cells, such as stem cells, residing within differentiated tissues become activated, followed by their incorporation into the blastema. (rupress.org)
  • The three genes were predominantly expressed in adipose and skeletal muscle tissues. (ajas.info)
  • Moreover, this was accompanied by a four-fold increase in the expression of proliferating cell nuclear antigen within cells of needled tissues. (scirp.org)
  • Cytoglobin is a hemoprotein expressed in response to oxidative stress in a variety of tissues, including striated muscle. (pnas.org)
  • The gel is applied to injured muscle, and the cells engraft onto the tissues and help them heal,' said Woojin Han, a postdoctoral researcher in Georgia Tech's School of Mechanical Engineering and the paper's first author. (news-medical.net)
  • The use of stem cells in the field of regenerative medicine has emerged in the last years due to their capacity to restore and maintain normal function via direct effects on injured or dysfunctional tissues [ 18 ]. (medsci.org)
  • Stem cells may also show therapeutic effects by the secretion of a variety of bioactive factors (e.g. anti-apoptotic, neovascularization, etc.) that may have effects on innate tissues [ 18 - 19 ]. (medsci.org)
  • Given the importance of dietary protein, particularly branched chain amino acids, in supporting myofibrillar and mitochondrial adaptations to both resistance and endurance-based training, a greater understanding of how protein intake impacts satellite cell activity would provide further insight into the mechanisms governing skeletal muscle remodelling with exercise. (springer.com)
  • While many studies have investigated the capacity for protein ingestion to increase post-exercise rates of muscle protein synthesis, few investigations have examined the role for protein ingestion to modulate satellite cell activity. (springer.com)
  • We provide a mechanistic framework that describes how protein ingestion may enhance satellite activity and promote exercise adaptations in human skeletal muscle. (springer.com)
  • Farup J, Rahbek SK, Knudsen IS, de Paoli F, Mackey AL, Vissing K. Whey protein supplementation accelerates satellite cell proliferation during recovery from eccentric exercise. (springer.com)
  • As for the mechanism, this study demonstrates that Gαi2(Q205L) regulates satellite cell differentiation into myotubes in a protein kinase C (PKC)- and histone deacetylase (HDAC)-dependent manner. (asm.org)
  • Adiponectin, an adipokine belonging to the complement factor C1Q protein family [ 1 ], is expressed in liver sinusoid endothelial cells, skeletal muscle and bone-forming cells as well as in adipocytes [ 2 - 4 ]. (ajas.info)
  • Emerging evidence suggests that adiponectin enhances glucose uptake by increasing GLUT4 translocation to the cell membrane [ 8 ] and promotes fatty acid oxidation by activating adenosine 5′-monophosphate (AMP)-activated protein kinase (AMPK), p38-mitogen-activated protein kinase, and peroxisome proliferator-activated receptor alpha pathways [ 9 , 10 ]. (ajas.info)
  • Muscle damage is characterized by compromised muscle fiber architecture, disruption of contractile protein integrity, and mitochondrial dysfunction. (frontiersin.org)
  • Conversely, during atrophy the dysregulation of satellite cells (e.g., via myogenic suppression), causes an opposing deficit in nuclear supplementation/contractile protein synthesis. (coventry.ac.uk)
  • Regardless of total protein deficiency, this mouse shows a mild phenotype, with comparatively moderate muscle pathology. (nature.com)
  • The protein and mRNA levels of MyoG, MyHC, Sirt1 and FoxO1 in the satellite and C 2 C 12 cells with an H19 silencing or overexpression vector were respectively detected using western blot and real-time qPCR. (biomedcentral.com)
  • A wide array of sample preparation methods enable the use of diverse applications, including: Whole-genome sequencing, RNA-Seq, small RNA discovery, methylation profiling, genome-wide protein-DNA interaction analysis (ChIP-Seq) and ATAC-Seq, exome sequencing, amplicon sequencing, Single Cells RNA-seq, Single Cells ATAC-Seq and Single Cell western. (nih.gov)
  • The DNA-bridging efficiency of H-NS, a genome organising and transcription regulatory protein, is modulated by changes in environmental conditions of the cell, which drive a structural rearrangement of the protein. (elifesciences.org)
  • Even if you are on a "high" protein diet, this new research suggests you can basically eat unlimited amounts of protein and just keep adding new lean muscle , without the fat. (muscleandstrength.com)
  • If you want an excuse to eat more protein and grow more lean muscle without the fat then this article is for you! (muscleandstrength.com)
  • Eat Unlimited Amounts of Protein & Gain Pure Muscle? (muscleandstrength.com)
  • This protein, which preferentially binds to a DNA consensus site (CANNTG) called an E-box, has been shown in both myogenic (C2C12) and nonmyogenic cell lines to be highly important in controlling the transcription of differentiation-specific genes ( Berkes and Tapscott, 2005 ). (rupress.org)
  • Given that skeletal muscles express significant amounts of PrP C and have been related to PrP C pathophysiology, in the present study, we used skeletal muscles to analyze whether the protein plays a role in adult morphogenesis. (asm.org)
  • The cellular prion protein (PrP C ) is a glycoprotein, prominently expressed in the mammalian central nervous system (CNS) and lymphoreticular system, that is anchored to the cell external surface through a glycolipidic moiety. (asm.org)
  • Upon re-examination of biopsies from power-lifters, power-lifters using anabolic substances and untrained subjects it was observed that the new results on satellite cell frequency were significantly different from those obtained when using staining for NCAM and nuclei alone. (diva-portal.org)
  • VDR expression is strongly upregulated following injury, particularly in central nuclei and SCs in animal models of muscle injury. (frontiersin.org)
  • Skeletal muscle is fairly unique in that the mature cells are syncytial and can contain hundreds of nuclei. (frontiersin.org)
  • Cell adhesion molecules and some signalling pathways reinforce its quiescent state, whereas other signals lead to activation. (mendeley.com)
  • We discuss how the satellite cell is ready to respond with the appropriate receptors, but protects its quiescence by mechanisms that include immobilization of ligands by extracellular matrix components and synthesis of inhibitors for intracellular signalling pathways and for metalloproteinases that break down the matrix and promote ligand processing and receptor activation. (mendeley.com)
  • T tubules are the pathways for action potentials to signal the sarcoplasmic reticulum to release calcium, causing a muscle contraction. (wikipedia.org)
  • To further understand the underlying cause for the age-associated decrement of mitochondrial density and function in equine skeletal muscle, expression of factors involved in mitochondria biogenesis and mitochondria-selective autophagy pathways, two of the most prominent quality control mechanisms that have been described, were analyzed. (ufl.edu)
  • In line with compromised myogenic potential of aged muscle-derived satellite cells, there were age-related alterations in mitochondrial biogenesis and autophagy pathways, with satellite cells derived from TRI being more susceptible to impairments with age. (ufl.edu)
  • among these, roles in cell adhesion, migration, and differentiation have been proposed whereby PrP C could act by modulating different cell-signaling pathways ( 63 ). (asm.org)
  • Myogenic factor 5 (Myf5) is also important for skeletal muscle development and satellite cell function. (biomedcentral.com)
  • 90% of satellite cells in mature skeletal muscle following tamoxifen administration. (biologists.org)
  • Fusion to myotubes with typical multinucleated syncytia can be induced by using the PromoCell Skeletal Muscle Cell Differentiation Medium. (sigmaaldrich.com)
  • For instance, Notch signaling is involved in fate determination and regulates satellite cell proliferation, and previous studies have shown that physical exercise increases the expression of Notch signaling pathway components-including ligands, Notch receptor, and downstream effectors-in myogenic cells [ 8 - 10 ]. (hindawi.com)
  • PPARdelta Regulates Satellite Cell Proliferation and Skeletal Muscle R" by Alison R. Angione, Chunhui Jiang et al. (umassmed.edu)
  • and Kuang, Shihuan, "PPARdelta Regulates Satellite Cell Proliferation and Skeletal Muscle Regeneration" (2011). (umassmed.edu)
  • Mechanistically, dissociation of HEXIM1 from P-TEFb and subsequent activation of P-TEFb are required for satellite cell proliferation and the prevention of early myogenic differentiation. (jci.org)
  • RhoC GTPase Is a Potent Regulator of Glutamine Metabolism and N-Acetylaspartate Production in Inflammatory Breast Cancer Cells. (nih.gov)
  • Conferences listed below (in alphabetical order within each sub-catagory) focus on Biochemistry, Cell Biology, and Epigenetics. (faseb.org)
  • Severe phosphate (PO 4 ) deficiency can alter satellite cell activity, however the role of neonatal PO 4 nutrition on satellite cell biology remains obscure. (mdpi.com)
  • In resting muscle, satellite cells are maintained in a quiescent state. (biomedcentral.com)
  • However, mammalian skeletal muscle regeneration does not involve cellularization of the syncytium. (rupress.org)
  • Mammalian skeletal muscle is composed of a heterogeneous set of multinucleate muscle fiber types, each with a distinct set of contractile and metabolic properties. (pnas.org)
  • As with all stem cells, how the choice between self-renewal or differentiation is controlled is central to understanding their function. (unboundmedicine.com)
  • In particular, UnAG and Ob promote SC self-renewal and myoblast differentiation, thus fostering muscle regeneration. (deepdyve.com)