AnatomyOrganismsDiseasesChemicals and DrugsAnalytical, Diagnostic and Therapeutic Techniques and EquipmentPhenomena and ProcessesInformation ScienceHealth Care
RNARNA, Small InterferingRNA, ViralRNA EditingRNA SplicingRNA, RibosomalRNA, BacterialDNA-Directed RNA PolymerasesRNA VirusesRNA InterferenceRNA, MessengerRNA, Double-StrandedRNA, CatalyticRNA FoldingRNA Polymerase IIRNA, FungalRNA StabilityRNA HelicasesRNA, AntisenseRNA Processing, Post-TranscriptionalRNA, TransferRNA, Small NuclearRNA PrecursorsRNA, UntranslatedNucleic Acid ConformationRNA CapsSequence Analysis, RNARNA, PlantRNA, ProtozoanBase SequenceRNA, NeoplasmRNA Ligase (ATP)DEAD-box RNA HelicasesRNA Polymerase IIIMolecular Sequence DataRNA Polymerase IRNA, NuclearRNA, GuideRNA, Ribosomal, 28SRNA, Ribosomal, 18SRNA-Binding ProteinsRNA, Ribosomal, 23SRNA TransportRNA, Spliced LeaderRNA, SatelliteRNA, Ribosomal, 16SAmino Acid SequenceRNA, ArchaealNucleic Acid HybridizationProtein BiosynthesisCell LineVirus ReplicationEscherichia coliRNA CleavageMutationOligoribonucleotidesRNA, Heterogeneous NuclearTranscription, GeneticRNA, Small CytoplasmicRNA 3' End ProcessingTemplates, GeneticRNA, Small UntranslatedHeLa CellsRibonucleoproteinsRibonucleasesPoly AGenome, ViralRNA, Ribosomal, 5.8SDNARNA, Long NoncodingRNA, Small NucleolarBinding SitesRNA Virus InfectionsProtein BindingRNA, ComplementaryUridinePromoter Regions, GeneticEndoribonucleasesCell NucleusRNA, ChloroplastModels, MolecularPlasmidsReverse Transcriptase Polymerase Chain ReactionKineticsSingle-Strand Specific DNA and RNA EndonucleasesBase PairingRNA, HelminthPlant VirusesDNA PrimersGene Expression RegulationSaccharomyces cerevisiaeTranscription FactorsRNA, Transfer, PheRNA, Transfer, LysRibosomesBlotting, NorthernDNA, ViralPolymerase Chain ReactionOligonucleotidesGene Silencing5' Untranslated RegionsRNA, Transfer, TyrSequence Homology, Nucleic Acid3' Untranslated RegionsAmanitinsGenes, ViralNucleic Acid DenaturationTransfectionRibonuclease T1Molecular WeightSequence Homology, Amino AcidCell NucleolusHIV-1Cell-Free SystemProtein Structure, TertiaryDNA, ComplementaryGene Expression Regulation, ViralGenesConserved SequenceViral Nonstructural ProteinsRNA, Transfer, Amino AcylGene ExpressionIntronsRNA Splice SitesRNA, Transfer, AlaPoliovirusCells, CulturedTobaccoRibonuclease PCentrifugation, Density GradientCytoplasmNucleotidesMosaic VirusesRNA-Directed DNA PolymeraseDactinomycinOpen Reading FramesGene Expression ProfilingHepacivirusElectrophoresis, Polyacrylamide GelRNA, Transfer, AspTritiumRNA, Transfer, MetPhylogenyBromovirusRecombinant ProteinsSubstrate SpecificityRibonuclease HNuclear ProteinsModels, GeneticRegulatory Sequences, Ribonucleic AcidPolyribosomesCell Line, TumorCapsidExoribonucleasesTemperatureBacterial ProteinsRestriction MappingRNA, Transfer, GlyRNA, Transfer, HisSaccharomyces cerevisiae ProteinsRNA, Transfer, ValPoly UNodaviridaeNucleic Acid PrecursorsVirus AssemblyDefective VirusesSequence DeletionRNA, Transfer, ArgRNA, AlgalSequence Analysis, DNAHeterogeneous-Nuclear RibonucleoproteinsEscherichia coli ProteinsSpecies SpecificityAlternative SplicingVirionRibonucleoproteins, Small NuclearHepatitis Delta VirusRibosomal ProteinsRNA, Transfer, TrpOligonucleotide Array Sequence AnalysisTerminator Regions, GeneticRecombinant Fusion ProteinsMacromolecular SubstancesPlantsTime FactorsMutagenesis, Site-DirectedMutagenesisLevivirusBlotting, WesternPolynucleotidesTrypanosoma brucei bruceiDNA Restriction EnzymesModels, BiologicalExonsGene Expression Regulation, BacterialTombusvirusGuanosinePolyadenylationRNA, Transfer, LeuPhenotypeStructure-Activity Relationship
RNA: A polynucleotide consisting essentially of chains with a repeating backbone of phosphate and ribose units to which nitrogenous bases are attached. RNA is unique among biological macromolecules in that it can encode genetic information, serve as an abundant structural component of cells, and also possesses catalytic activity. (Rieger et al., Glossary of Genetics: Classical and Molecular, 5th ed)RNA, Small Interfering: Small double-stranded, non-protein coding RNAs (21-31 nucleotides) involved in GENE SILENCING functions, especially RNA INTERFERENCE (RNAi). Endogenously, siRNAs are generated from dsRNAs (RNA, DOUBLE-STRANDED) by the same ribonuclease, Dicer, that generates miRNAs (MICRORNAS). The perfect match of the siRNAs' antisense strand to their target RNAs mediates RNAi by siRNA-guided RNA cleavage. siRNAs fall into different classes including trans-acting siRNA (tasiRNA), repeat-associated RNA (rasiRNA), small-scan RNA (scnRNA), and Piwi protein-interacting RNA (piRNA) and have different specific gene silencing functions.RNA, Viral: Ribonucleic acid that makes up the genetic material of viruses.RNA Editing: A process that changes the nucleotide sequence of mRNA from that of the DNA template encoding it. Some major classes of RNA editing are as follows: 1, the conversion of cytosine to uracil in mRNA; 2, the addition of variable number of guanines at pre-determined sites; and 3, the addition and deletion of uracils, templated by guide-RNAs (RNA, GUIDE).RNA Splicing: The ultimate exclusion of nonsense sequences or intervening sequences (introns) before the final RNA transcript is sent to the cytoplasm.RNA, Ribosomal: The most abundant form of RNA. Together with proteins, it forms the ribosomes, playing a structural role and also a role in ribosomal binding of mRNA and tRNAs. Individual chains are conventionally designated by their sedimentation coefficients. In eukaryotes, four large chains exist, synthesized in the nucleolus and constituting about 50% of the ribosome. (Dorland, 28th ed)RNA, Bacterial: Ribonucleic acid in bacteria having regulatory and catalytic roles as well as involvement in protein synthesis.DNA-Directed RNA Polymerases: Enzymes that catalyze DNA template-directed extension of the 3'-end of an RNA strand one nucleotide at a time. They can initiate a chain de novo. In eukaryotes, three forms of the enzyme have been distinguished on the basis of sensitivity to alpha-amanitin, and the type of RNA synthesized. (From Enzyme Nomenclature, 1992).RNA Viruses: Viruses whose genetic material is RNA.RNA Interference: A gene silencing phenomenon whereby specific dsRNAs (RNA, DOUBLE-STRANDED) trigger the degradation of homologous mRNA (RNA, MESSENGER). The specific dsRNAs are processed into SMALL INTERFERING RNA (siRNA) which serves as a guide for cleavage of the homologous mRNA in the RNA-INDUCED SILENCING COMPLEX. DNA METHYLATION may also be triggered during this process.RNA, Messenger: RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.RNA, Double-Stranded: RNA consisting of two strands as opposed to the more prevalent single-stranded RNA. Most of the double-stranded segments are formed from transcription of DNA by intramolecular base-pairing of inverted complementary sequences separated by a single-stranded loop. Some double-stranded segments of RNA are normal in all organisms.RNA, Catalytic: RNA that has catalytic activity. The catalytic RNA sequence folds to form a complex surface that can function as an enzyme in reactions with itself and other molecules. It may function even in the absence of protein. There are numerous examples of RNA species that are acted upon by catalytic RNA, however the scope of this enzyme class is not limited to a particular type of substrate.RNA Folding: The processes of RNA tertiary structure formation.RNA Polymerase II: A DNA-dependent RNA polymerase present in bacterial, plant, and animal cells. It functions in the nucleoplasmic structure and transcribes DNA into RNA. It has different requirements for cations and salt than RNA polymerase I and is strongly inhibited by alpha-amanitin. EC 2.7.7.6.RNA, Fungal: Ribonucleic acid in fungi having regulatory and catalytic roles as well as involvement in protein synthesis.RNA Stability: The extent to which an RNA molecule retains its structural integrity and resists degradation by RNASE, and base-catalyzed HYDROLYSIS, under changing in vivo or in vitro conditions.RNA Helicases: A family of proteins that promote unwinding of RNA during splicing and translation.RNA, Antisense: RNA molecules which hybridize to complementary sequences in either RNA or DNA altering the function of the latter. Endogenous antisense RNAs function as regulators of gene expression by a variety of mechanisms. Synthetic antisense RNAs are used to effect the functioning of specific genes for investigative or therapeutic purposes.RNA Processing, Post-Transcriptional: Post-transcriptional biological modification of messenger, transfer, or ribosomal RNAs or their precursors. It includes cleavage, methylation, thiolation, isopentenylation, pseudouridine formation, conformational changes, and association with ribosomal protein.RNA, Transfer: The small RNA molecules, 73-80 nucleotides long, that function during translation (TRANSLATION, GENETIC) to align AMINO ACIDS at the RIBOSOMES in a sequence determined by the mRNA (RNA, MESSENGER). There are about 30 different transfer RNAs. Each recognizes a specific CODON set on the mRNA through its own ANTICODON and as aminoacyl tRNAs (RNA, TRANSFER, AMINO ACYL), each carries a specific amino acid to the ribosome to add to the elongating peptide chains.RNA, Small Nuclear: Short chains of RNA (100-300 nucleotides long) that are abundant in the nucleus and usually complexed with proteins in snRNPs (RIBONUCLEOPROTEINS, SMALL NUCLEAR). Many function in the processing of messenger RNA precursors. Others, the snoRNAs (RNA, SMALL NUCLEOLAR), are involved with the processing of ribosomal RNA precursors.RNA Precursors: RNA transcripts of the DNA that are in some unfinished stage of post-transcriptional processing (RNA PROCESSING, POST-TRANSCRIPTIONAL) required for function. RNA precursors may undergo several steps of RNA SPLICING during which the phosphodiester bonds at exon-intron boundaries are cleaved and the introns are excised. Consequently a new bond is formed between the ends of the exons. Resulting mature RNAs can then be used; for example, mature mRNA (RNA, MESSENGER) is used as a template for protein production.RNA, Untranslated: RNA which does not code for protein but has some enzymatic, structural or regulatory function. Although ribosomal RNA (RNA, RIBOSOMAL) and transfer RNA (RNA, TRANSFER) are also untranslated RNAs they are not included in this scope.Nucleic Acid Conformation: The spatial arrangement of the atoms of a nucleic acid or polynucleotide that results in its characteristic 3-dimensional shape.RNA Caps: Nucleic acid structures found on the 5' end of eukaryotic cellular and viral messenger RNA and some heterogeneous nuclear RNAs. These structures, which are positively charged, protect the above specified RNAs at their termini against attack by phosphatases and other nucleases and promote mRNA function at the level of initiation of translation. Analogs of the RNA caps (RNA CAP ANALOGS), which lack the positive charge, inhibit the initiation of protein synthesis.Sequence Analysis, RNA: A multistage process that includes cloning, physical mapping, subcloning, sequencing, and information analysis of an RNA SEQUENCE.RNA, Plant: Ribonucleic acid in plants having regulatory and catalytic roles as well as involvement in protein synthesis.RNA, Protozoan: Ribonucleic acid in protozoa having regulatory and catalytic roles as well as involvement in protein synthesis.Base Sequence: The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.RNA, Neoplasm: RNA present in neoplastic tissue.RNA Ligase (ATP): An enzyme that catalyzes the conversion of linear RNA to a circular form by the transfer of the 5'-phosphate to the 3'-hydroxyl terminus. It also catalyzes the covalent joining of two polyribonucleotides in phosphodiester linkage. EC 6.5.1.3.DEAD-box RNA Helicases: A large family of RNA helicases that share a common protein motif with the single letter amino acid sequence D-E-A-D (Asp-Glu-Ala-Asp). In addition to RNA helicase activity, members of the DEAD-box family participate in other aspects of RNA metabolism and regulation of RNA function.RNA Polymerase III: A DNA-dependent RNA polymerase present in bacterial, plant, and animal cells. It functions in the nucleoplasmic structure where it transcribes DNA into RNA. It has specific requirements for cations and salt and has shown an intermediate sensitivity to alpha-amanitin in comparison to RNA polymerase I and II. EC 2.7.7.6.Molecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.RNA Polymerase I: A DNA-dependent RNA polymerase present in bacterial, plant, and animal cells. The enzyme functions in the nucleolar structure and transcribes DNA into RNA. It has different requirements for cations and salts than RNA polymerase II and III and is not inhibited by alpha-amanitin. EC 2.7.7.6.RNA, Nuclear: RNA molecules found in the nucleus either associated with chromosomes or in the nucleoplasm.RNA, Guide: Small kinetoplastid mitochondrial RNA that plays a major role in RNA EDITING. These molecules form perfect hybrids with edited mRNA sequences and possess nucleotide sequences at their 5'-ends that are complementary to the sequences of the mRNA's immediately downstream of the pre-edited regions.RNA, Ribosomal, 28S: Constituent of the 60S subunit of eukaryotic ribosomes. 28S rRNA is involved in the initiation of polypeptide synthesis in eukaryotes.RNA, Ribosomal, 18S: Constituent of the 40S subunit of eukaryotic ribosomes. 18S rRNA is involved in the initiation of polypeptide synthesis in eukaryotes.RNA-Binding Proteins: Proteins that bind to RNA molecules. Included here are RIBONUCLEOPROTEINS and other proteins whose function is to bind specifically to RNA.RNA, Ribosomal, 23S: Constituent of 50S subunit of prokaryotic ribosomes containing about 3200 nucleotides. 23S rRNA is involved in the initiation of polypeptide synthesis.RNA Transport: The process of moving specific RNA molecules from one cellular compartment or region to another by various sorting and transport mechanisms.RNA, Spliced Leader: The small RNAs which provide spliced leader sequences, SL1, SL2, SL3, SL4 and SL5 (short sequences which are joined to the 5' ends of pre-mRNAs by TRANS-SPLICING). They are found primarily in primitive eukaryotes (protozoans and nematodes).RNA, Satellite: Small, linear single-stranded RNA molecules functionally acting as molecular parasites of certain RNA plant viruses. Satellite RNAs exhibit four characteristic traits: (1) they require helper viruses to replicate; (2) they are unnecessary for the replication of helper viruses; (3) they are encapsidated in the coat protein of the helper virus; (4) they have no extensive sequence homology to the helper virus. Thus they differ from SATELLITE VIRUSES which encode their own coat protein, and from the genomic RNA; (=RNA, VIRAL); of satellite viruses. (From Maramorosch, Viroids and Satellites, 1991, p143)RNA, Ribosomal, 16S: Constituent of 30S subunit prokaryotic ribosomes containing 1600 nucleotides and 21 proteins. 16S rRNA is involved in initiation of polypeptide synthesis.Amino Acid Sequence: The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.RNA, Archaeal: Ribonucleic acid in archaea having regulatory and catalytic roles as well as involvement in protein synthesis.Nucleic Acid Hybridization: Widely used technique which exploits the ability of complementary sequences in single-stranded DNAs or RNAs to pair with each other to form a double helix. Hybridization can take place between two complimentary DNA sequences, between a single-stranded DNA and a complementary RNA, or between two RNA sequences. The technique is used to detect and isolate specific sequences, measure homology, or define other characteristics of one or both strands. (Kendrew, Encyclopedia of Molecular Biology, 1994, p503)Protein Biosynthesis: The biosynthesis of PEPTIDES and PROTEINS on RIBOSOMES, directed by MESSENGER RNA, via TRANSFER RNA that is charged with standard proteinogenic AMINO ACIDS.Cell Line: Established cell cultures that have the potential to propagate indefinitely.Virus Replication: The process of intracellular viral multiplication, consisting of the synthesis of PROTEINS; NUCLEIC ACIDS; and sometimes LIPIDS, and their assembly into a new infectious particle.Escherichia coli: A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.RNA Cleavage: A reaction that severs one of the sugar-phosphate linkages of the phosphodiester backbone of RNA. It is catalyzed enzymatically, chemically, or by radiation. Cleavage may be exonucleolytic, or endonucleolytic.Mutation: Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.Oligoribonucleotides: A group of ribonucleotides (up to 12) in which the phosphate residues of each ribonucleotide act as bridges in forming diester linkages between the ribose moieties.RNA, Heterogeneous Nuclear: Nuclear nonribosomal RNA larger than about 1000 nucleotides, the mass of which is rapidly synthesized and degraded within the cell nucleus. Some heterogeneous nuclear RNA may be a precursor to mRNA. However, the great bulk of total hnRNA hybridizes with nuclear DNA rather than with mRNA.Transcription, Genetic: The biosynthesis of RNA carried out on a template of DNA. The biosynthesis of DNA from an RNA template is called REVERSE TRANSCRIPTION.RNA, Small Cytoplasmic: Small RNAs found in the cytoplasm usually complexed with proteins in scRNPs (RIBONUCLEOPROTEINS, SMALL CYTOPLASMIC).RNA 3' End Processing: The steps that generate the 3' ends of mature RNA molecules. For most mRNAs (RNA, MESSENGER), 3' end processing referred to as POLYADENYLATION includes the addition of POLY A.Templates, Genetic: Macromolecular molds for the synthesis of complementary macromolecules, as in DNA REPLICATION; GENETIC TRANSCRIPTION of DNA to RNA, and GENETIC TRANSLATION of RNA into POLYPEPTIDES.RNA, Small Untranslated: Short RNA, about 200 base pairs in length or shorter, that does not code for protein.HeLa Cells: The first continuously cultured human malignant CELL LINE, derived from the cervical carcinoma of Henrietta Lacks. These cells are used for VIRUS CULTIVATION and antitumor drug screening assays.Ribonucleoproteins: Complexes of RNA-binding proteins with ribonucleic acids (RNA).Ribonucleases: Enzymes that catalyze the hydrolysis of ester bonds within RNA. EC 3.1.-.Poly A: A group of adenine ribonucleotides in which the phosphate residues of each adenine ribonucleotide act as bridges in forming diester linkages between the ribose moieties.Genome, Viral: The complete genetic complement contained in a DNA or RNA molecule in a virus.RNA, Ribosomal, 5.8S: Constituent of the 60S subunit of eukaryotic ribosomes. 5.8S rRNA is involved in the initiation of polypeptide synthesis in eukaryotes.DNA: A deoxyribonucleotide polymer that is the primary genetic material of all cells. Eukaryotic and prokaryotic organisms normally contain DNA in a double-stranded state, yet several important biological processes transiently involve single-stranded regions. DNA, which consists of a polysugar-phosphate backbone possessing projections of purines (adenine and guanine) and pyrimidines (thymine and cytosine), forms a double helix that is held together by hydrogen bonds between these purines and pyrimidines (adenine to thymine and guanine to cytosine).RNA, Long Noncoding: A class of untranslated RNA molecules that are typically greater than 200 nucleotides in length and do not code for proteins. Members of this class have been found to play roles in transcriptional regulation, post-transcriptional processing, CHROMATIN REMODELING, and in the epigenetic control of chromatin.RNA, Small Nucleolar: Small nuclear RNAs that are involved in the processing of pre-ribosomal RNA in the nucleolus. Box C/D containing snoRNAs (U14, U15, U16, U20, U21 and U24-U63) direct site-specific methylation of various ribose moieties. Box H/ACA containing snoRNAs (E2, E3, U19, U23, and U64-U72) direct the conversion of specific uridines to pseudouridine. Site-specific cleavages resulting in the mature ribosomal RNAs are directed by snoRNAs U3, U8, U14, U22 and the snoRNA components of RNase MRP and RNase P.Binding Sites: The parts of a macromolecule that directly participate in its specific combination with another molecule.RNA Virus InfectionsProtein Binding: The process in which substances, either endogenous or exogenous, bind to proteins, peptides, enzymes, protein precursors, or allied compounds. Specific protein-binding measures are often used as assays in diagnostic assessments.RNA, Complementary: Synthetic transcripts of a specific DNA molecule or fragment, made by an in vitro transcription system. This cRNA can be labeled with radioactive uracil and then used as a probe. (King & Stansfield, A Dictionary of Genetics, 4th ed)UridinePromoter Regions, Genetic: DNA sequences which are recognized (directly or indirectly) and bound by a DNA-dependent RNA polymerase during the initiation of transcription. Highly conserved sequences within the promoter include the Pribnow box in bacteria and the TATA BOX in eukaryotes.Endoribonucleases: A family of enzymes that catalyze the endonucleolytic cleavage of RNA. It includes EC 3.1.26.-, EC 3.1.27.-, EC 3.1.30.-, and EC 3.1.31.-.Cell Nucleus: Within a eukaryotic cell, a membrane-limited body which contains chromosomes and one or more nucleoli (CELL NUCLEOLUS). The nuclear membrane consists of a double unit-type membrane which is perforated by a number of pores; the outermost membrane is continuous with the ENDOPLASMIC RETICULUM. A cell may contain more than one nucleus. (From Singleton & Sainsbury, Dictionary of Microbiology and Molecular Biology, 2d ed)RNA, Chloroplast: Ribonucleic acid in chloroplasts having regulatory and catalytic roles as well as involvement in protein synthesis.Models, Molecular: Models used experimentally or theoretically to study molecular shape, electronic properties, or interactions; includes analogous molecules, computer-generated graphics, and mechanical structures.Plasmids: Extrachromosomal, usually CIRCULAR DNA molecules that are self-replicating and transferable from one organism to another. They are found in a variety of bacterial, archaeal, fungal, algal, and plant species. They are used in GENETIC ENGINEERING as CLONING VECTORS.Reverse Transcriptase Polymerase Chain Reaction: A variation of the PCR technique in which cDNA is made from RNA via reverse transcription. The resultant cDNA is then amplified using standard PCR protocols.Kinetics: The rate dynamics in chemical or physical systems.Single-Strand Specific DNA and RNA Endonucleases: Enzymes that catalyze the endonucleolytic cleavage of single-stranded regions of DNA or RNA molecules while leaving the double-stranded regions intact. They are particularly useful in the laboratory for producing "blunt-ended" DNA molecules from DNA with single-stranded ends and for sensitive GENETIC TECHNIQUES such as NUCLEASE PROTECTION ASSAYS that involve the detection of single-stranded DNA and RNA.Base Pairing: Pairing of purine and pyrimidine bases by HYDROGEN BONDING in double-stranded DNA or RNA.RNA, Helminth: Ribonucleic acid in helminths having regulatory and catalytic roles as well as involvement in protein synthesis.Plant Viruses: Viruses parasitic on plants higher than bacteria.DNA Primers: Short sequences (generally about 10 base pairs) of DNA that are complementary to sequences of messenger RNA and allow reverse transcriptases to start copying the adjacent sequences of mRNA. Primers are used extensively in genetic and molecular biology techniques.Gene Expression Regulation: Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control (induction or repression) of gene action at the level of transcription or translation.Saccharomyces cerevisiae: A species of the genus SACCHAROMYCES, family Saccharomycetaceae, order Saccharomycetales, known as "baker's" or "brewer's" yeast. The dried form is used as a dietary supplement.Transcription Factors: Endogenous substances, usually proteins, which are effective in the initiation, stimulation, or termination of the genetic transcription process.RNA, Transfer, Phe: A transfer RNA which is specific for carrying phenylalanine to sites on the ribosomes in preparation for protein synthesis.RNA, Transfer, Lys: A transfer RNA which is specific for carrying lysine to sites on the ribosomes in preparation for protein synthesis.Ribosomes: Multicomponent ribonucleoprotein structures found in the CYTOPLASM of all cells, and in MITOCHONDRIA, and PLASTIDS. They function in PROTEIN BIOSYNTHESIS via GENETIC TRANSLATION.Blotting, Northern: Detection of RNA that has been electrophoretically separated and immobilized by blotting on nitrocellulose or other type of paper or nylon membrane followed by hybridization with labeled NUCLEIC ACID PROBES.DNA, Viral: Deoxyribonucleic acid that makes up the genetic material of viruses.Polymerase Chain Reaction: In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships.Oligonucleotides: Polymers made up of a few (2-20) nucleotides. In molecular genetics, they refer to a short sequence synthesized to match a region where a mutation is known to occur, and then used as a probe (OLIGONUCLEOTIDE PROBES). (Dorland, 28th ed)Gene Silencing: Interruption or suppression of the expression of a gene at transcriptional or translational levels.5' Untranslated Regions: The sequence at the 5' end of the messenger RNA that does not code for product. This sequence contains the ribosome binding site and other transcription and translation regulating sequences.RNA, Transfer, Tyr: A transfer RNA which is specific for carrying tyrosine to sites on the ribosomes in preparation for protein synthesis.Sequence Homology, Nucleic Acid: The sequential correspondence of nucleotides in one nucleic acid molecule with those of another nucleic acid molecule. Sequence homology is an indication of the genetic relatedness of different organisms and gene function.3' Untranslated Regions: The sequence at the 3' end of messenger RNA that does not code for product. This region contains transcription and translation regulating sequences.Amanitins: Cyclic peptides extracted from carpophores of various mushroom species. They are potent inhibitors of RNA polymerases in most eukaryotic species, blocking the production of mRNA and protein synthesis. These peptides are important in the study of transcription. Alpha-amanitin is the main toxin from the species Amanitia phalloides, poisonous if ingested by humans or animals.Genes, Viral: The functional hereditary units of VIRUSES.Nucleic Acid Denaturation: Disruption of the secondary structure of nucleic acids by heat, extreme pH or chemical treatment. Double strand DNA is "melted" by dissociation of the non-covalent hydrogen bonds and hydrophobic interactions. Denatured DNA appears to be a single-stranded flexible structure. The effects of denaturation on RNA are similar though less pronounced and largely reversible.Transfection: The uptake of naked or purified DNA by CELLS, usually meaning the process as it occurs in eukaryotic cells. It is analogous to bacterial transformation (TRANSFORMATION, BACTERIAL) and both are routinely employed in GENE TRANSFER TECHNIQUES.Ribonuclease T1: An enzyme catalyzing the endonucleolytic cleavage of RNA at the 3'-position of a guanylate residue. EC 3.1.27.3.Molecular Weight: The sum of the weight of all the atoms in a molecule.Sequence Homology, Amino Acid: The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.Cell Nucleolus: Within most types of eukaryotic CELL NUCLEUS, a distinct region, not delimited by a membrane, in which some species of rRNA (RNA, RIBOSOMAL) are synthesized and assembled into ribonucleoprotein subunits of ribosomes. In the nucleolus rRNA is transcribed from a nucleolar organizer, i.e., a group of tandemly repeated chromosomal genes which encode rRNA and which are transcribed by RNA polymerase I. (Singleton & Sainsbury, Dictionary of Microbiology & Molecular Biology, 2d ed)HIV-1: The type species of LENTIVIRUS and the etiologic agent of AIDS. It is characterized by its cytopathic effect and affinity for the T4-lymphocyte.Cell-Free System: A fractionated cell extract that maintains a biological function. A subcellular fraction isolated by ultracentrifugation or other separation techniques must first be isolated so that a process can be studied free from all of the complex side reactions that occur in a cell. The cell-free system is therefore widely used in cell biology. (From Alberts et al., Molecular Biology of the Cell, 2d ed, p166)Protein Structure, Tertiary: The level of protein structure in which combinations of secondary protein structures (alpha helices, beta sheets, loop regions, and motifs) pack together to form folded shapes called domains. Disulfide bridges between cysteines in two different parts of the polypeptide chain along with other interactions between the chains play a role in the formation and stabilization of tertiary structure. Small proteins usually consist of only one domain but larger proteins may contain a number of domains connected by segments of polypeptide chain which lack regular secondary structure.DNA, Complementary: Single-stranded complementary DNA synthesized from an RNA template by the action of RNA-dependent DNA polymerase. cDNA (i.e., complementary DNA, not circular DNA, not C-DNA) is used in a variety of molecular cloning experiments as well as serving as a specific hybridization probe.Gene Expression Regulation, Viral: Any of the processes by which cytoplasmic factors influence the differential control of gene action in viruses.Genes: A category of nucleic acid sequences that function as units of heredity and which code for the basic instructions for the development, reproduction, and maintenance of organisms.Conserved Sequence: A sequence of amino acids in a polypeptide or of nucleotides in DNA or RNA that is similar across multiple species. A known set of conserved sequences is represented by a CONSENSUS SEQUENCE. AMINO ACID MOTIFS are often composed of conserved sequences.Viral Nonstructural Proteins: Proteins encoded by a VIRAL GENOME that are produced in the organisms they infect, but not packaged into the VIRUS PARTICLES. Some of these proteins may play roles within the infected cell during VIRUS REPLICATION or act in regulation of virus replication or VIRUS ASSEMBLY.RNA, Transfer, Amino Acyl: Intermediates in protein biosynthesis. The compounds are formed from amino acids, ATP and transfer RNA, a reaction catalyzed by aminoacyl tRNA synthetase. They are key compounds in the genetic translation process.Gene Expression: The phenotypic manifestation of a gene or genes by the processes of GENETIC TRANSCRIPTION and GENETIC TRANSLATION.Introns: Sequences of DNA in the genes that are located between the EXONS. They are transcribed along with the exons but are removed from the primary gene transcript by RNA SPLICING to leave mature RNA. Some introns code for separate genes.RNA Splice Sites: Nucleotide sequences located at the ends of EXONS and recognized in pre-messenger RNA by SPLICEOSOMES. They are joined during the RNA SPLICING reaction, forming the junctions between exons.RNA, Transfer, Ala: A transfer RNA which is specific for carrying alanine to sites on the ribosomes in preparation for protein synthesis.Poliovirus: A species of ENTEROVIRUS which is the causal agent of POLIOMYELITIS in humans. Three serotypes (strains) exist. Transmission is by the fecal-oral route, pharyngeal secretions, or mechanical vector (flies). Vaccines with both inactivated and live attenuated virus have proven effective in immunizing against the infection.Cells, Cultured: Cells propagated in vitro in special media conducive to their growth. Cultured cells are used to study developmental, morphologic, metabolic, physiologic, and genetic processes, among others.Tobacco: A plant genus of the family SOLANACEAE. Members contain NICOTINE and other biologically active chemicals; its dried leaves are used for SMOKING.Ribonuclease P: An RNA-containing enzyme that plays an essential role in tRNA processing by catalyzing the endonucleolytic cleavage of TRANSFER RNA precursors. It removes the extra 5'-nucleotides from tRNA precursors to generate mature tRNA molecules.Centrifugation, Density Gradient: Separation of particles according to density by employing a gradient of varying densities. At equilibrium each particle settles in the gradient at a point equal to its density. (McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)Cytoplasm: The part of a cell that contains the CYTOSOL and small structures excluding the CELL NUCLEUS; MITOCHONDRIA; and large VACUOLES. (Glick, Glossary of Biochemistry and Molecular Biology, 1990)Nucleotides: The monomeric units from which DNA or RNA polymers are constructed. They consist of a purine or pyrimidine base, a pentose sugar, and a phosphate group. (From King & Stansfield, A Dictionary of Genetics, 4th ed)Mosaic Viruses: Viruses which produce a mottled appearance of the leaves of plants.RNA-Directed DNA Polymerase: An enzyme that synthesizes DNA on an RNA template. It is encoded by the pol gene of retroviruses and by certain retrovirus-like elements. EC 2.7.7.49.Dactinomycin: A compound composed of a two CYCLIC PEPTIDES attached to a phenoxazine that is derived from STREPTOMYCES parvullus. It binds to DNA and inhibits RNA synthesis (transcription), with chain elongation more sensitive than initiation, termination, or release. As a result of impaired mRNA production, protein synthesis also declines after dactinomycin therapy. (From AMA Drug Evaluations Annual, 1993, p2015)Open Reading Frames: A sequence of successive nucleotide triplets that are read as CODONS specifying AMINO ACIDS and begin with an INITIATOR CODON and end with a stop codon (CODON, TERMINATOR).Gene Expression Profiling: The determination of the pattern of genes expressed at the level of GENETIC TRANSCRIPTION, under specific circumstances or in a specific cell.Hepacivirus: A genus of FLAVIVIRIDAE causing parenterally-transmitted HEPATITIS C which is associated with transfusions and drug abuse. Hepatitis C virus is the type species.Electrophoresis, Polyacrylamide Gel: Electrophoresis in which a polyacrylamide gel is used as the diffusion medium.RNA, Transfer, Asp: A transfer RNA which is specific for carrying aspartic acid to sites on the ribosomes in preparation for protein synthesis.TritiumRNA, Transfer, Met: A transfer RNA which is specific for carrying methionine to sites on the ribosomes. During initiation of protein synthesis, tRNA(f)Met in prokaryotic cells and tRNA(i)Met in eukaryotic cells binds to the start codon (CODON, INITIATOR).Phylogeny: The relationships of groups of organisms as reflected by their genetic makeup.Bromovirus: A genus of tripartite plant viruses in the family BROMOVIRIDAE. Transmission is by beetles. Brome mosaic virus is the type species.Recombinant Proteins: Proteins prepared by recombinant DNA technology.Substrate Specificity: A characteristic feature of enzyme activity in relation to the kind of substrate on which the enzyme or catalytic molecule reacts.Ribonuclease H: A ribonuclease that specifically cleaves the RNA moiety of RNA:DNA hybrids. It has been isolated from a wide variety of prokaryotic and eukaryotic organisms as well as RETROVIRUSES.Nuclear Proteins: Proteins found in the nucleus of a cell. Do not confuse with NUCLEOPROTEINS which are proteins conjugated with nucleic acids, that are not necessarily present in the nucleus.Models, Genetic: Theoretical representations that simulate the behavior or activity of genetic processes or phenomena. They include the use of mathematical equations, computers, and other electronic equipment.Regulatory Sequences, Ribonucleic Acid: Sequences within RNA that regulate the processing, stability (RNA STABILITY) or translation (TRANSLATION, GENETIC) of RNA.Polyribosomes: A multiribosomal structure representing a linear array of RIBOSOMES held together by messenger RNA; (RNA, MESSENGER); They represent the active complexes in cellular protein synthesis and are able to incorporate amino acids into polypeptides both in vivo and in vitro. (From Rieger et al., Glossary of Genetics: Classical and Molecular, 5th ed)Cell Line, Tumor: A cell line derived from cultured tumor cells.Capsid: The outer protein protective shell of a virus, which protects the viral nucleic acid.Exoribonucleases: A family of enzymes that catalyze the exonucleolytic cleavage of RNA. It includes EC 3.1.13.-, EC 3.1.14.-, EC 3.1.15.-, and EC 3.1.16.-. EC 3.1.-Temperature: The property of objects that determines the direction of heat flow when they are placed in direct thermal contact. The temperature is the energy of microscopic motions (vibrational and translational) of the particles of atoms.Bacterial Proteins: Proteins found in any species of bacterium.Restriction Mapping: Use of restriction endonucleases to analyze and generate a physical map of genomes, genes, or other segments of DNA.RNA, Transfer, Gly: A transfer RNA which is specific for carrying glycine to sites on the ribosomes in preparation for protein synthesis.RNA, Transfer, His: A transfer RNA which is specific for carrying histidine to sites on the ribosomes in preparation for protein synthesis.Saccharomyces cerevisiae Proteins: Proteins obtained from the species SACCHAROMYCES CEREVISIAE. The function of specific proteins from this organism are the subject of intense scientific interest and have been used to derive basic understanding of the functioning similar proteins in higher eukaryotes.RNA, Transfer, Val: A transfer RNA which is specific for carrying valine to sites on the ribosomes in preparation for protein synthesis.Poly U: A group of uridine ribonucleotides in which the phosphate residues of each uridine ribonucleotide act as bridges in forming diester linkages between the ribose moieties.Nodaviridae: A family of RNA viruses infecting insects and fish. There are two genera: Alphanodavirus and Betanodavirus.Nucleic Acid Precursors: Use for nucleic acid precursors in general or for which there is no specific heading.Virus Assembly: The assembly of VIRAL STRUCTURAL PROTEINS and nucleic acid (VIRAL DNA or VIRAL RNA) to form a VIRUS PARTICLE.Defective Viruses: Viruses which lack a complete genome so that they cannot completely replicate or cannot form a protein coat. Some are host-dependent defectives, meaning they can replicate only in cell systems which provide the particular genetic function which they lack. Others, called SATELLITE VIRUSES, are able to replicate only when their genetic defect is complemented by a helper virus.Sequence Deletion: Deletion of sequences of nucleic acids from the genetic material of an individual.RNA, Transfer, Arg: A transfer RNA which is specific for carrying arginine to sites on the ribosomes in preparation for protein synthesis.RNA, Algal: Ribonucleic acid in algae having regulatory and catalytic roles as well as involvement in protein synthesis.Sequence Analysis, DNA: A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.Heterogeneous-Nuclear Ribonucleoproteins: A family of ribonucleoproteins that were originally found as proteins bound to nascent RNA transcripts in the form of ribonucleoprotein particles. Although considered ribonucleoproteins they are primarily classified by their protein component. They are involved in a variety of processes such as packaging of RNA and RNA TRANSPORT within the nucleus. A subset of heterogeneous-nuclear ribonucleoproteins are involved in additional functions such as nucleocytoplasmic transport (ACTIVE TRANSPORT, CELL NUCLEUS) of RNA and mRNA stability in the CYTOPLASM.Escherichia coli Proteins: Proteins obtained from ESCHERICHIA COLI.Species Specificity: The restriction of a characteristic behavior, anatomical structure or physical system, such as immune response; metabolic response, or gene or gene variant to the members of one species. It refers to that property which differentiates one species from another but it is also used for phylogenetic levels higher or lower than the species.Alternative Splicing: A process whereby multiple RNA transcripts are generated from a single gene. Alternative splicing involves the splicing together of other possible sets of EXONS during the processing of some, but not all, transcripts of the gene. Thus a particular exon may be connected to any one of several alternative exons to form a mature RNA. The alternative forms of mature MESSENGER RNA produce PROTEIN ISOFORMS in which one part of the isoforms is common while the other parts are different.Virion: The infective system of a virus, composed of the viral genome, a protein core, and a protein coat called a capsid, which may be naked or enclosed in a lipoprotein envelope called the peplos.Ribonucleoproteins, Small Nuclear: Highly conserved nuclear RNA-protein complexes that function in RNA processing in the nucleus, including pre-mRNA splicing and pre-mRNA 3'-end processing in the nucleoplasm, and pre-rRNA processing in the nucleolus (see RIBONUCLEOPROTEINS, SMALL NUCLEOLAR).Hepatitis Delta Virus: A defective virus, containing particles of RNA nucleoprotein in virion-like form, present in patients with acute hepatitis B and chronic hepatitis. It requires the presence of a hepadnavirus for full replication. This is the lone species in the genus Deltavirus.Ribosomal Proteins: Proteins found in ribosomes. They are believed to have a catalytic function in reconstituting biologically active ribosomal subunits.RNA, Transfer, Trp: A transfer RNA which is specific for carrying tryptophan to sites on the ribosomes in preparation for protein synthesis.Oligonucleotide Array Sequence Analysis: Hybridization of a nucleic acid sample to a very large set of OLIGONUCLEOTIDE PROBES, which have been attached individually in columns and rows to a solid support, to determine a BASE SEQUENCE, or to detect variations in a gene sequence, GENE EXPRESSION, or for GENE MAPPING.Terminator Regions, Genetic: DNA sequences recognized as signals to end GENETIC TRANSCRIPTION.Recombinant Fusion Proteins: Recombinant proteins produced by the GENETIC TRANSLATION of fused genes formed by the combination of NUCLEIC ACID REGULATORY SEQUENCES of one or more genes with the protein coding sequences of one or more genes.Macromolecular Substances: Compounds and molecular complexes that consist of very large numbers of atoms and are generally over 500 kDa in size. In biological systems macromolecular substances usually can be visualized using ELECTRON MICROSCOPY and are distinguished from ORGANELLES by the lack of a membrane structure.Plants: Multicellular, eukaryotic life forms of kingdom Plantae (sensu lato), comprising the VIRIDIPLANTAE; RHODOPHYTA; and GLAUCOPHYTA; all of which acquired chloroplasts by direct endosymbiosis of CYANOBACTERIA. They are characterized by a mainly photosynthetic mode of nutrition; essentially unlimited growth at localized regions of cell divisions (MERISTEMS); cellulose within cells providing rigidity; the absence of organs of locomotion; absence of nervous and sensory systems; and an alternation of haploid and diploid generations.Time Factors: Elements of limited time intervals, contributing to particular results or situations.Mutagenesis, Site-Directed: Genetically engineered MUTAGENESIS at a specific site in the DNA molecule that introduces a base substitution, or an insertion or deletion.Mutagenesis: Process of generating a genetic MUTATION. It may occur spontaneously or be induced by MUTAGENS.Levivirus: A bacteriophage genus of the family LEVIVIRIDAE, whose viruses contain the short version of the genome and have a separate gene for cell lysis.Blotting, Western: Identification of proteins or peptides that have been electrophoretically separated by blot transferring from the electrophoresis gel to strips of nitrocellulose paper, followed by labeling with antibody probes.PolynucleotidesTrypanosoma brucei brucei: A hemoflagellate subspecies of parasitic protozoa that causes nagana in domestic and game animals in Africa. It apparently does not infect humans. It is transmitted by bites of tsetse flies (Glossina).DNA Restriction Enzymes: Enzymes that are part of the restriction-modification systems. They catalyze the endonucleolytic cleavage of DNA sequences which lack the species-specific methylation pattern in the host cell's DNA. Cleavage yields random or specific double-stranded fragments with terminal 5'-phosphates. The function of restriction enzymes is to destroy any foreign DNA that invades the host cell. Most have been studied in bacterial systems, but a few have been found in eukaryotic organisms. They are also used as tools for the systematic dissection and mapping of chromosomes, in the determination of base sequences of DNAs, and have made it possible to splice and recombine genes from one organism into the genome of another. EC 3.21.1.Models, Biological: Theoretical representations that simulate the behavior or activity of biological processes or diseases. For disease models in living animals, DISEASE MODELS, ANIMAL is available. Biological models include the use of mathematical equations, computers, and other electronic equipment.Exons: The parts of a transcript of a split GENE remaining after the INTRONS are removed. They are spliced together to become a MESSENGER RNA or other functional RNA.Gene Expression Regulation, Bacterial: Any of the processes by which cytoplasmic or intercellular factors influence the differential control of gene action in bacteria.Tombusvirus: A genus of plant viruses that infects ANGIOSPERMS. Transmission occurs mechanically and through soil, with one species transmitted via a fungal vector. The type species is Tomato bushy stunt virus.Guanosine: A purine nucleoside that has guanine linked by its N9 nitrogen to the C1 carbon of ribose. It is a component of ribonucleic acid and its nucleotides play important roles in metabolism. (From Dorland, 28th ed)Polyadenylation: The addition of a tail of polyadenylic acid (POLY A) to the 3' end of mRNA (RNA, MESSENGER). Polyadenylation involves recognizing the processing site signal, (AAUAAA), and cleaving of the mRNA to create a 3' OH terminal end to which poly A polymerase (POLYNUCLEOTIDE ADENYLYLTRANSFERASE) adds 60-200 adenylate residues. The 3' end processing of some messenger RNAs, such as histone mRNA, is carried out by a different process that does not include the addition of poly A as described here.RNA, Transfer, Leu: A transfer RNA which is specific for carrying leucine to sites on the ribosomes in preparation for protein synthesis.Phenotype: The outward appearance of the individual. It is the product of interactions between genes, and between the GENOTYPE and the environment.Structure-Activity Relationship: The relationship between the chemical structure of a compound and its biological or pharmacological activity. Compounds are often classed together because they have structural characteristics in common including shape, size, stereochemical arrangement, and distribution of functional groups.

Absence of RNASE III alters the pathway by which RNAI, the antisense inhibitor of ColE1 replication, decays. (1/22353)

RNAI is a short RNA, 108 nt in length, which regulates the replication of the plasmid ColE1. RNAI turns over rapidly, enabling plasmid replication rate to respond quickly to changes in plasmid copy number. Because RNAI is produced in abundance, is easily extracted and turns over quickly, it has been used as a model for mRNA in studying RNA decay pathways. The enzymes polynucleotide phosphorylase, poly(A) polymerase and RNase E have been demonstrated to have roles in both messenger and RNAI decay; it is reported here that these enzymes can work independently of one another to facilitate RNAI decay. The roles in RNAI decay of two further enzymes which facilitate mRNA decay, the exonuclease RNase II and the endonuclease RNase III, are also examined. RNase II does not appear to accelerate RNAI decay but it is found that, in the absence of RNase III, polyadenylated RNAI, unprocessed by RNase E, accumulates. It is also shown that RNase III can cut RNAI near nt 82 or 98 in vitro. An RNAI fragment corresponding to the longer of these can be found in extracts of an mc+ pcnB strain (which produces RNase III) but not of an rnc pcnB strain, suggesting that RNAI may be a substrate for RNase III in vivo. A possible pathway for the early steps in RNAI decay which incorporates this information is suggested.  (+info)

The CafA protein required for the 5'-maturation of 16 S rRNA is a 5'-end-dependent ribonuclease that has context-dependent broad sequence specificity. (2/22353)

The CafA protein, which was initially described as having a role in either Escherichia coli cell division or chromosomal segregation, has recently been shown to be required for the maturation of the 5'-end of 16 S rRNA. The sequence of CafA is similar to that of the N-terminal ribonucleolytic half of RNase E, an essential E. coli enzyme that has a central role in the processing of rRNA and the decay of mRNA and RNAI, the antisense regulator of ColE1-type plasmids. We show here that a highly purified preparation of CafA is sufficient in vitro for RNA cutting. We detected CafA cleavage of RNAI and a structured region from the 5'-untranslated region of ompA mRNA within segments cleavable by RNaseE, but not CafA cleavage of 9 S RNA at its "a" RNase E site. The latter is consistent with the finding that the generation of 5 S rRNA from its 9 S precursor can be blocked by inactivation of RNase E in cells that are wild type for CafA. Interestingly, however, a decanucleotide corresponding in sequence to the a site of 9 S RNA was cut efficiently indicating that cleavage by CafA is regulated by the context of sites within structured RNAs. Consistent with this notion is our finding that although 23 S rRNA is stable in vivo, a segment from this RNA is cut efficient by CafA at multiple sites in vitro. We also show that, like RNase E cleavage, the efficiency of cleavage by CafA is dependent on the presence of a monophosphate group on the 5'-end of the RNA. This finding raises the possibility that the context dependence of cleavage by CafA may be due at least in part to the separation of a cleavable sequence from the 5'-end of an RNA. Comparison of the sites surrounding points of CafA cleavage suggests that this enzyme has broad sequence specificity. Together with the knowledge that CafA can cut RNAI and ompA mRNA in vitro within segments whose cleavage in vivo initiates the decay of these RNAs, this finding suggests that CafA may contribute at some point during the decay of many RNAs in E. coli.  (+info)

RNAi: double-stranded RNA directs the ATP-dependent cleavage of mRNA at 21 to 23 nucleotide intervals. (3/22353)

Double-stranded RNA (dsRNA) directs the sequence-specific degradation of mRNA through a process known as RNA interference (RNAi). Using a recently developed Drosophila in vitro system, we examined the molecular mechanism underlying RNAi. We find that RNAi is ATP dependent yet uncoupled from mRNA translation. During the RNAi reaction, both strands of the dsRNA are processed to RNA segments 21-23 nucleotides in length. Processing of the dsRNA to the small RNA fragments does not require the targeted mRNA. The mRNA is cleaved only within the region of identity with the dsRNA. Cleavage occurs at sites 21-23 nucleotides apart, the same interval observed for the dsRNA itself, suggesting that the 21-23 nucleotide fragments from the dsRNA are guiding mRNA cleavage.  (+info)

Caenorhabditis elegans beta-G spectrin is dispensable for establishment of epithelial polarity, but essential for muscular and neuronal function. (4/22353)

The Caenorhabditis elegans genome encodes one alpha spectrin subunit, a beta spectrin subunit (beta-G), and a beta-H spectrin subunit. Our experiments show that the phenotype resulting from the loss of the C. elegans alpha spectrin is reproduced by tandem depletion of both beta-G and beta-H spectrins. We propose that alpha spectrin combines with the beta-G and beta-H subunits to form alpha/beta-G and alpha/beta-H heteromers that perform the entire repertoire of spectrin function in the nematode. The expression patterns of nematode beta-G spectrin and vertebrate beta spectrins exhibit three striking parallels including: (1) beta spectrins are associated with the sites of cell-cell contact in epithelial tissues; (2) the highest levels of beta-G spectrin occur in the nervous system; and (3) beta spectrin-G in striated muscle is associated with points of attachment of the myofilament apparatus to adjacent cells. Nematode beta-G spectrin associates with plasma membranes at sites of cell-cell contact, beginning at the two-cell stage, and with a dramatic increase in intensity after gastrulation when most cell proliferation has been completed. Strikingly, depletion of nematode beta-G spectrin by RNA-mediated interference to undetectable levels does not affect the establishment of structural and functional polarity in epidermis and intestine. Contrary to recent speculation, beta-G spectrin is not associated with internal membranes and depletion of beta-G spectrin was not associated with any detectable defects in secretion. Instead beta-G spectrin-deficient nematodes arrest as early larvae with progressive defects in the musculature and nervous system. Therefore, C. elegans beta-G spectrin is required for normal muscle and neuron function, but is dispensable for embryonic elongation and establishment of early epithelial polarity. We hypothesize that heteromeric spectrin evolved in metazoans in response to the needs of cells in the context of mechanically integrated tissues that can withstand the rigors imposed by an active organism.  (+info)

Flagellum ontogeny in trypanosomes studied via an inherited and regulated RNA interference system. (5/22353)

The African trypanosome, Trypanosoma brucei possesses a large and unique intraflagellar structure called the paraflagellar rod (PFR). The PFR is composed of 2 major proteins, PFRA and PFRC. We have generated an inducible mutant trypanosome cell line (snl-2) that expresses linked inverted copies of a PFRA gene, capable of forming a PFRA double-stranded (ds) RNA. When expression of this dsRNA was induced, new PFRA RNA and PFRA protein quickly disappeared and PFR construction was affected, resulting in cell paralysis. This inducible RNA interference (RNAi) effect was fast-acting, heritable and reversible. It allowed us to demonstrate that PFR proteins are able to enter both mature and growing flagella but appear to concentrate differentially in new flagella because of the construction process. The PFR is constructed by a polar assembly process at the distal end of the flagellum resulting in a stable cytoskeletal structure with low turn-over. The inducible RNAi approach will have widespread applicability in studies of gene function and cellular processes in parasites.  (+info)

Mitotic phosphorylation of histone H3 is governed by Ipl1/aurora kinase and Glc7/PP1 phosphatase in budding yeast and nematodes. (6/22353)

Phosphorylation of histone H3 at serine 10 occurs during mitosis and meiosis in a wide range of eukaryotes and has been shown to be required for proper chromosome transmission in Tetrahymena. Here we report that Ipl1/aurora kinase and its genetically interacting phosphatase, Glc7/PP1, are responsible for the balance of H3 phosphorylation during mitosis in Saccharomyces cerevisiae and Caenorhabditis elegans. In these models, both enzymes are required for H3 phosphorylation and chromosome segregation, although a causal link between the two processes has not been demonstrated. Deregulation of human aurora kinases has been implicated in oncogenesis as a consequence of chromosome missegregation. Our findings reveal an enzyme system that regulates chromosome dynamics and controls histone phosphorylation that is conserved among diverse eukaryotes.  (+info)

Double-stranded RNA injection produces nonspecific defects in zebrafish. (7/22353)

We have investigated the ability of dsRNA to inhibit gene functions in zebrafish using sequences targeted to the maternal gene pouII-1, the transgene GFP, and an intron of the zebrafish gene terra. We found that embryos injected with all of these dsRNAs at approximately 7.5 pg/embryo or higher had general growth arrest during gastrulation and displayed various nonspecific defects at 24 h postfertilization, although embryonic development was unaffected before the midblastula stage. Reducing dsRNA concentration could alleviate the global defects. Injection of GFP dsRNA (7.5-30 pg/embryo) did not inhibit GFP expression in transgenic fish, although abnormal embryos were induced. Co-injection of GFP mRNA with either GFP or non-GFP dsRNA caused reduction of GFP expression. Whole-mount in situ hybridization clearly showed that embryos injected with dsRNA degraded co-injected and endogenous mRNA without sequence specificity, indicating that dsRNA has a nonspecific effect at the posttranscriptional level. It appears that RNAi is not a viable technique for studying gene function in zebrafish embryos.  (+info)

Drosophila mitochondrial transcription factor A (d-TFAM) is dispensable for the transcription of mitochondrial DNA in Kc167 cells. (8/22353)

We have cloned cDNA encoding Drosophila mitochondrial (mt) transcription factor A (d-TFAM). RNA interference (RNAi) of d-TFAM by lipofection of haemocyte-derived Kc167 cells with double-stranded RNA reduced d-TFAM to less than 5% of the normal level. Reflecting the ability of TFAM to stabilize mtDNA, RNAi of d-TFAM reduced mtDNA to 40%. Nonetheless, transcription of the ND2 and ND5 genes and their mRNAs remained unchanged for 8 days of the duration of RNAi. We thus show that d-TFAM is not essential for the transcription of Drosophila mtDNA.  (+info)

AnatomyOrganismsDiseasesChemicals and DrugsAnalytical, Diagnostic and Therapeutic Techniques and EquipmentPhenomena and ProcessesInformation ScienceHealth Care
RNARNA, Small InterferingRNA, ViralRNA EditingRNA SplicingRNA, RibosomalRNA, BacterialDNA-Directed RNA PolymerasesRNA VirusesRNA InterferenceRNA, MessengerRNA, Double-StrandedRNA, CatalyticRNA FoldingRNA Polymerase IIRNA, FungalRNA StabilityRNA HelicasesRNA, AntisenseRNA Processing, Post-TranscriptionalRNA, TransferRNA, Small NuclearRNA PrecursorsRNA, UntranslatedNucleic Acid ConformationRNA CapsSequence Analysis, RNARNA, PlantRNA, ProtozoanBase SequenceRNA, NeoplasmRNA Ligase (ATP)DEAD-box RNA HelicasesRNA Polymerase IIIMolecular Sequence DataRNA Polymerase IRNA, NuclearRNA, GuideRNA, Ribosomal, 28SRNA, Ribosomal, 18SRNA-Binding ProteinsRNA, Ribosomal, 23SRNA TransportRNA, Spliced LeaderRNA, SatelliteRNA, Ribosomal, 16SAmino Acid SequenceRNA, ArchaealNucleic Acid HybridizationProtein BiosynthesisCell LineVirus ReplicationEscherichia coliRNA CleavageMutationOligoribonucleotidesRNA, Heterogeneous NuclearTranscription, GeneticRNA, Small CytoplasmicRNA 3' End ProcessingTemplates, GeneticRNA, Small UntranslatedHeLa CellsRibonucleoproteinsRibonucleasesPoly AGenome, ViralRNA, Ribosomal, 5.8SDNARNA, Long NoncodingRNA, Small NucleolarBinding SitesRNA Virus InfectionsProtein BindingRNA, ComplementaryUridinePromoter Regions, GeneticEndoribonucleasesCell NucleusRNA, ChloroplastModels, MolecularPlasmidsReverse Transcriptase Polymerase Chain ReactionKineticsSingle-Strand Specific DNA and RNA EndonucleasesBase PairingRNA, HelminthPlant VirusesDNA PrimersGene Expression RegulationSaccharomyces cerevisiaeTranscription FactorsRNA, Transfer, PheRNA, Transfer, LysRibosomesBlotting, NorthernDNA, ViralPolymerase Chain ReactionOligonucleotidesGene Silencing5' Untranslated RegionsRNA, Transfer, TyrSequence Homology, Nucleic Acid3' Untranslated RegionsAmanitinsGenes, ViralNucleic Acid DenaturationTransfectionRibonuclease T1Molecular WeightSequence Homology, Amino AcidCell NucleolusHIV-1Cell-Free SystemProtein Structure, TertiaryDNA, ComplementaryGene Expression Regulation, ViralGenesConserved SequenceViral Nonstructural ProteinsRNA, Transfer, Amino AcylGene ExpressionIntronsRNA Splice SitesRNA, Transfer, AlaPoliovirusCells, CulturedTobaccoRibonuclease PCentrifugation, Density GradientCytoplasmNucleotidesMosaic VirusesRNA-Directed DNA PolymeraseDactinomycinOpen Reading FramesGene Expression ProfilingHepacivirusElectrophoresis, Polyacrylamide GelRNA, Transfer, AspTritiumRNA, Transfer, MetPhylogenyBromovirusRecombinant ProteinsSubstrate SpecificityRibonuclease HNuclear ProteinsModels, GeneticRegulatory Sequences, Ribonucleic AcidPolyribosomesCell Line, TumorCapsidExoribonucleasesTemperatureBacterial ProteinsRestriction MappingRNA, Transfer, GlyRNA, Transfer, HisSaccharomyces cerevisiae ProteinsRNA, Transfer, ValPoly UNodaviridaeNucleic Acid PrecursorsVirus AssemblyDefective VirusesSequence DeletionRNA, Transfer, ArgRNA, AlgalSequence Analysis, DNAHeterogeneous-Nuclear RibonucleoproteinsEscherichia coli ProteinsSpecies SpecificityAlternative SplicingVirionRibonucleoproteins, Small NuclearHepatitis Delta VirusRibosomal ProteinsRNA, Transfer, TrpOligonucleotide Array Sequence AnalysisTerminator Regions, GeneticRecombinant Fusion ProteinsMacromolecular SubstancesPlantsTime FactorsMutagenesis, Site-DirectedMutagenesisLevivirusBlotting, WesternPolynucleotidesTrypanosoma brucei bruceiDNA Restriction EnzymesModels, BiologicalExonsGene Expression Regulation, BacterialTombusvirusGuanosinePolyadenylationRNA, Transfer, LeuPhenotypeStructure-Activity Relationship

*Negative-sense single-stranded RNA virus

"Molecular cloning of natural paramyxovirus copy-back defective interfering RNAs and their expression from DNA". Virology. 191 ( ... Similarly, viruses can also synthesize proteins that prevent the phosphorylation of STAT1 a little further along the signaling ... The virus uses its own RNA replicase, also known as RNA-dependent RNA polymerase (RdRp), to form positive RNA template strands ... The negative viral RNA is complementary to the mRNA and must be converted to a positive RNA by RNA polymerase before ...

*Long non-coding RNA

... short interfering RNAs (siRNAs), Piwi-interacting RNAs (piRNAs), small nucleolar RNAs (snoRNAs), and other short RNAs. However ... June 2008). "An endogenous small interfering RNA pathway in Drosophila". Nature. 453 (7196): 798-802. Bibcode:2008Natur.453.. ... September 2004). "Role of a neuronal small non-messenger RNA: behavioural alterations in BC1 RNA-deleted mice". Behavioural ... Similar to small regulatory RNAs such as microRNAs and snoRNAs, these functions often involve complementary base pairing with ...

*DNA-directed RNA interference

Unlike small interfering RNA (siRNA) therapeutics that turn over within a cell and consequently only silence genes transiently ... Any RNA, including endogenous mRNAs or viral RNAs, can be silenced by designing constructs to express double-stranded RNA ... DNA constructs are designed to express self-complementary double-stranded RNAs, typically short-hairpin RNAs (shRNA), that once ... DNA-directed RNA interference (ddRNAi) is a gene-silencing technique that utilizes DNA constructs to activate an animal cell's ...

*Small interfering RNA

... (siRNA), sometimes known as short interfering RNA or silencing RNA, is a class of double-stranded RNA ... Jensen, Kirsty; Anderson, Jennifer A.; Glass, Elizabeth J. (2014-04-15). "Comparison of small interfering RNA (siRNA) delivery ... Li LC (2008). "Small RNA-Mediated Gene Activation". RNA and the Regulation of Gene Expression: A Hidden Layer of Complexity. ... Dicer cuts the long dsRNA to form short interfering RNA or siRNA; this is what enables the molecules to form the RNA-Induced ...

*Short hairpin RNA

Small interfering RNA Paddison, PJ; Caudy, AA; Bernstein, E; Hannon, GJ; Conklin, DS (15 April 2002). "Short hairpin RNAs ( ... A short hairpin RNA or small hairpin RNA (shRNA/Hairpin Vector) is an artificial RNA molecule with a tight hairpin turn that ... Brummelkamp, TR; Bernards, R; Agami, R (19 April 2002). "A system for stable expression of short interfering RNAs in mammalian ... Xiang, Shuanglin; Fruehauf, Johannes; Li, Chiang J (2006). "Short hairpin RNA-expressing bacteria elicit RNA interference in ...

*DUT (gene)

Studebaker AW, Lafuse WP, Kloesel R, Williams MV (Feb 2005). "Modulation of human dUTPase using small interfering RNA". ...

*Survivin

Small interfering RNA (siRNA) are synthetic antisense oligonucleotides to the mRNA of the gene of interest that works to ... Huynh T, Wälchli S, Sioud M (December 2006). "Transcriptional targeting of small interfering RNAs into cancer cells". Biochem. ... Survivin is 16.5 kDa large and is the smallest member of the IAP family. X-ray crystallography has shown two molecules of human ... and CTLs to eliminate and suppress the pulmonary metastases of non-small cell lung carcinoma. The activation of the immune ...

*Exosome (vesicle)

Wahlgren J.; Statello L.; Skogberg G.; Telemo E.; Valadi H. (2016). "Delivery of Small Interfering RNAs to Cells via Exosomes ... Exosomes can be considered a promising carrier for effective delivery of small interfering RNA due to their existence in body's ... For example, RNA that is shuttled from one cell to another, known as "exosomal shuttle RNA," could potentially affect protein ... Exosomes contain RNA, proteins, lipids and metabolites that is reflective of the cell type of origin. As exosomes contain ...

*Transcriptome in vivo analysis tag

July 2007). "Transvascular delivery of small interfering RNA to the central nervous system". Nature. 448 (7149): 39-43. doi: ... The transcriptome is a set of all RNA, including rRNA, mRNA, tRNA, and non-coding RNA. Specifically mRNA transcripts can be ... RNA-seq uses reverse transcriptase to convert the mRNA template to cDNA. During library preparation, the cDNA is fragmented ... into small pieces, which then serve as the template for sequencing. After sequencing RNA-seq analysis can then be performed. ...

*Complementarity (molecular biology)

Small interfering RNAs (siRNAs) are similar in function to miRNAs; they come from other sources of RNA, but serve a similar ... MiRNAs are formed from longer sequences of RNA that are cut free by a Dicer enzyme from an RNA sequence that is from a ... RNA is more likely to form these kinds of structures due to base pair binding not seen in DNA, such as guanine binding with ... And three is by providing a new double-stranded RNA (dsRNA) sequence that Dicer can act upon to create more miRNA to find and ...

*RNA interference

Two types of small ribonucleic acid (RNA) molecules - microRNA (miRNA) and small interfering RNA (siRNA) - are central to RNA ... RNAs are the direct products of genes, and these small RNAs can bind to other specific messenger RNA (mRNA) molecules and ... These short double-stranded fragments are called small interfering RNAs (siRNAs). These siRNAs are then separated into single ... discovered, by using synthetically made small interfering RNA (siRNA), it was possible to target the silencing of specific ...

*Overlapping gene

"Recognition of small interfering RNA by a viral suppressor of RNA silencing". Nature. 426 (6968): 874-878. doi:10.1038/ ... In some cases overprinted proteins do have well-defined, but novel, three-dimensional structures; one example is the RNA ... Some studies attribute this observation to selective pressure toward small genome sizes mediated by the physical constraints of ... likely to greatly increase the number of potential expressible genes from a small set of viral genetic information. Genes may ...

*Piwi-interacting RNA

Further, it is thought that piRNA and endogenous small interfering RNA (endo-siRNA) may have comparable and even redundant ... Piwi-interacting RNA (piRNA) is the largest class of small non-coding RNA molecules expressed in animal cells. piRNAs form RNA- ... Due to their small size, expression and amplification of small RNAs can be challenging, so specialised PCR-based methods have ... Kim, V.N. (2006). "Small RNAs Just Got Bigger: Piwi-Interacting RNAs (piRNAs) in Mammalian Testes". Genes Dev. 20: 1993-1997. ...

*Inclisiran

It is a small interfering RNA that inhibits translation of the protein PCSK9. Fitzgerald, Kevin; White, Suellen; Borodovsky, ...

*EIF2C1

Ma JB, Ye K, Patel DJ (May 2004). "Structural basis for overhang-specific small interfering RNA recognition by the PAZ domain ... Doi N, Zenno S, Ueda R, Ohki-Hamazaki H, Ui-Tei K, Saigo K (Jan 2003). "Short-interfering-RNA-mediated gene silencing in ... It may interact with dicer1 and play a role in short-interfering-RNA-mediated gene silencing. This gene is located on ... This gene encodes a member of the Argonaute family of proteins which play a role in RNA interference. The encoded protein is ...

*Dicer

Small interfering RNA (siRNA) are produced and function in a similar manner to miRNA by cleaving double-stranded RNA with Dicer ... gene expression RISC RNA interference microRNA Small interfering RNA Drosha Ribonuclease III mRNA GRCh38: Ensembl release 89: ... into short double-stranded RNA fragments called small interfering RNA and microRNA, respectively. These fragments are ... ISBN 978-0-8053-9592-1. Zeng Y, Yi R, Cullen BR (Aug 2003). "MicroRNAs and small interfering RNAs can inhibit mRNA expression ...

*Piwi

piRNAs have thus been classified as repeat-associated small interfering RNAs (rasiRNAs). Although their biogenesis is not yet ... phosphate of RNA; and the C-terminal PIWI domain acts as an RNase H endonuclease that can cleave RNA. The small RNA partners of ... Kim VN (2006). "Small RNAs just got bigger: Piwi-interacting RNAs (piRNAs) in mammalian testes". Genes Dev. 20 (15): 1993-7. ... the argonaute protein in the RISC complex can bind both small interfering RNA (siRNA) generated from exogenous double-stranded ...

*RRM2B

"Improvement in radiosensitivity using small interfering RNA targeting p53R2 in esophageal squamous cell carcinoma". Oncology ... "ATM-mediated serine 72 phosphorylation stabilizes ribonucleotide reductase small subunit p53R2 protein against MDM2 to DNA ...

*RNA polymerase IV

... is an enzyme which synthesizes small interfering RNA (siRNA) in plants. Polymerase IV is specific to plants ... "Role of RNA polymerase IV in plant small RNA metabolism". Proc Natl Acad Sci USA. 104. doi:10.1073/pnas.0611456104. CS1 maint: ... RNA polymerase silences the transposons and repetitive DNA in the siRNA pathway. The siRNA plays a major role in defending the ... Herr, A. J. , M. B. Jensen, T. Dalmay, and D. C. Baulcombe (2005). "RNA Polymerase IV Directs Silencing of Endogenous DNA". ...

*LYK5

Removal of endogenous LYK5 by small interfering RNA abrogates LKB1-induced G1 phase arrest. STRADα stabilizes LKB1 protein both ...

*Gene silencing

The discovery of small interfering RNAs (the specificity determinant in RNA-mediated gene silencing) also utilized virus- ... These small fragments, which include small interfering RNAs (siRNA) and microRNA (miRNA), are approximately 21-23 nucleotides ... "Clearance of replicating hepatitis C virus replicon RNAs in cell culture by small interfering RNAs". Proceedings of the ... Lapteva N, Yang AG, Sanders DE, Strube RW, Chen SY (January 2005). "CXCR4 knockdown by small interfering RNA abrogates breast ...

*Anil Suri

Small interfering RNA-mediated down regulation of Sperm-Associated Antigen 9 inhibits cervix tumor growth. Garg M, Kanojia D, ...

*Robin Allshire

"Hairpin RNA induces secondary small interfering RNA synthesis and silencing in trans in fission yeast". EMBO Rep. 11: 112. 2010 ... "Long non-coding RNA-mediated transcriptional interference of a permease gene confers drug tolerance in fission yeast". Nat. ... He has provided insight into how transcription and resulting non-coding RNA might influence the assembly of specialised CENP-A ... He has investigated how RNA interference (RNAi) mediates heterochromatin formation and shown that splicing fators contribute to ...

*RNA

... small interfering RNA (siRNA), small nucleolar RNA (snoRNAs), Piwi-interacting RNA (piRNA), tRNA-derived small RNA (tsRNA) and ... According to the length of RNA chain, RNA includes small RNA and long RNA. Usually, small RNAs are shorter than 200 nt in ... Long RNAs, also called large RNAs, mainly include long non-coding RNA (lncRNA) and mRNA. Small RNAs mainly include 5.8S ... Also, RNA-dependent RNA polymerase is part of the RNA interference pathway in many organisms. Messenger RNA (mRNA) is the RNA ...

*Hazara virus

"Inhibition of Hazara nairovirus replication by small interfering RNAs and their combination with ribavirin". Virology Journal. ... The L RNA segment encodes an RNA-dependent RNA polymerase (L protein), the M RNA segment encodes two surface glycoproteins (Gc ... which are an order of enveloped negative-stranded RNA viruses with a genome split into three parts-Small (S), Middle (M) and ... Bilk, S.; Schulze, C.; Fischer, M.; Beer, M.; Hlinak, A.; Hoffmann, B. (2012). "Organ distribution of Schmallenberg virus RNA ...

*Interferon

... clinical trials and the preparation of small amounts of interferon messenger RNA to clone the human alpha and beta interferon ... Interferons are named for their ability to "interfere" with viral replication by protecting cells from virus infections. IFNs ... Some viruses can encode proteins that bind to double-stranded RNA (dsRNA) to prevent the activity of RNA-dependent protein ... RNA interference technology tools such as siRNA or vector-based reagents can either silence or stimulate interferon pathways. ...

*Epigenetics

Small interfering RNAs can modulate transcriptional gene expression via epigenetic modulation of targeted promoters. Sometimes ... A smaller quantity of sperm RNA is transmitted from the father, but there is recent evidence that this epigenetic information ... Genomics maps for small non-coding RNA's and their targets in microbial genomes Yool A, Edmunds WJ (1998). "Epigenetic ... sRNAs are small (50-250 nucleotides), highly structured, non-coding RNA fragments found in bacteria. They control gene ...
Bio-inspired pulmonary surfactant-modified nanogels: a promising siRNA delivery system  Bio-inspired pulmonary surfactant-modified nanogels: a promising siRNA delivery system
article{5993109, author = {De Backer, Lynn and Braeckmans, Kevin and Stuart, Marc CA and Demeester, Jo and De Smedt, Stefaan and Raemdonck, Koen}, issn = {0168-3659}, journal = {JOURNAL OF CONTROLLED RELEASE}, keyword = {DRUG-DELIVERY,EXOGENOUS SURFACTANT,LUNG,THERAPEUTICS,THERAPIES,SMALL-INTERFERING RNA,LOADED DEXTRAN NANOGELS,POLYMER HYBRID NANOPARTICLES,Targeted delivery,Pulmonary surfactant,siRNA delivery,Lung,Hybrid nanoparticles,Dextran nanogels,PLATFORM,CARRIERS}, language = {eng}, pages = {177--186}, title = {Bio-inspired pulmonary surfactant-modified nanogels: a promising siRNA delivery system}, url = {http://dx.doi.org/10.1016/j.jconrel.2015.03.015}, volume = {206}, year = {2015 ...
https://biblio.ugent.be/publication/5993109
Potent RNAi by short RNA triggers by Chia-ying Chu and Tariq M. Rana  "Potent RNAi by short RNA triggers" by Chia-ying Chu and Tariq M. Rana
RNA interference (RNAi) is a gene-silencing mechanism by which a ribonucleoprotein complex, the RNA-induced silencing complex (RISC) and a double-stranded (ds) short-interfering RNA (siRNA), targets a complementary mRNA for site-specific cleavage and subsequent degradation. While longer dsRNA are endogenously processed into 21- to 24-nucleotide (nt) siRNAs or miRNAs to induce gene silencing, RNAi studies in human cells typically use synthetic 19- to 20-nt siRNA duplexes with 2-nt overhangs at the 3-end of both strands. Here, we report that systematic synthesis and analysis of siRNAs with deletions at the passenger and/or guide strand revealed a short RNAi trigger, 16-nt siRNA, which induces potent RNAi in human cells. Our results indicate that the minimal requirement for dsRNA to trigger RNAi is an approximately 42 A A-form helix with approximately 1.5 helical turns. The 16-nt siRNA more effectively knocked down mRNA and protein levels than 19-nt siRNA when targeting the endogenous CDK9 gene,
https://escholarship.umassmed.edu/oapubs/1921/
Genomic siRNA Libraries as Tools for Pseudo-Genetics | SBIR.gov  Genomic siRNA Libraries as Tools for Pseudo-Genetics | SBIR.gov
DESCRIPTION (provided by applicant): The proposed research will enable mammalian cells to be used in mutation/selection experiments to identify genes involved in cellular processes. The objective of the proposal is to develop procedures for preparing siRNA libraries using genomic DNA and cDNA samples as the source material for siRNA templates. Libraries of siRNA vectors could comprise 1,000,000,000 to 1,000,000,000,000 unique siRNA expression vectors, making it possible to cover entire mammalian genomes with overlapping siRNAs. Mammalian cell populations transfected or transduced with siRNA vector libraries will be placed under selection to create cell populations expressing a desirable phenotype. The siRNA vector(s) integrated in the genomes of the selected cells will be amplified, cloned, and sequenced to reveal the siRNA template sequence. The siRNA sequences will be used to identify the genes whose down-regulation create the phenotype that was selected. The siRNA vector libraries should ...
https://www.sbir.gov/sbirsearch/detail/86813
Multivalent dendritic polyglycerolamine with arginine and histidine end groups for efficient siRNA transfection •...  Multivalent dendritic polyglycerolamine with arginine and histidine end groups for efficient siRNA transfection •...
The success of siRNA-based therapeutics highly depends on a safe and efficient delivery of siRNA into the cytosol. In this study, we post-modified the primary amines on dendritic polyglycerolamine (dPG-NH2) with different ratios of two relevant amino acids, namely, arginine (Arg) and histidine (His). To investigate the effects from introducing Arg and His to dPG, the resulting polyplexes of amino acid functionalized dPG-NH2s (AAdPGs)/siRNA were evaluated regarding cytotoxicity, transfection efficiency, and cellular uptake. Among AAdPGs, an optimal vector with (1:3) Arg to His ratio, showed efficient siRNA transfection with minimal cytotoxicity (cell viability ≥ 90%) in NIH 3T3 cells line. We also demonstrated that the cytotoxicity of dPG-NH2 decreased as a result of amino acid functionalization. While the incorporation of both cationic (Arg) and pH-responsive residues (His) are important for safe and efficient siRNA transfection, this study indicates that AAdPGs containing higher degrees of ...
http://www.sfb765.de/publikationen/a06030/index.html
Short hairpin RNA-mediated gene silencing<...  Short hairpin RNA-mediated gene silencing<...
TY - CHAP. T1 - Short hairpin RNA-mediated gene silencing. AU - Lambeth, Luke S. AU - Smith, Craig A.. PY - 2013. Y1 - 2013. N2 - Since thefirst application of RNA interference (RNAi) in mammalian cells, the expression of short hairpin RNAs (shRNAs) for targeted gene silencing has become a benchmark technology. Using plasmid and viral vectoring systems, the transcription of shRNA precursors that are effectively processed by the RNAi pathway can lead to potent gene knockdown. The past decade has seen continual advancement and improvement to the various strategies that can be used for shRNA delivery, and the use of shRNAs for clinical applications is well underway. Driving these developments has been the many benefits afforded by shRNA technologies, including the stable integration of expression constructs for long-term expression, infection of difficultto-target cell lines and tissues using viral vectors, and the temporal control of shRNA transcription by inducible promoters. The use of different ...
https://research.monash.edu/en/publications/short-hairpin-rna-mediated-gene-silencing-2
Plus it  Plus it
Introduction: RNA interference technology is underway in clinical trials for limited diseases. RNAi technology for solid tumors, especially in systemic administration, still faces hurdles and has not emerged on the clinical stage. Here we introduce an in vivo pH sensitive delivery system of siRNA and microRNA using super carbonate apatite (sCA) nanoparticles (mean size: 10 nm), which simply consist of inorganic ions. In order to show the therapeutic superiority of the sCA system over currently available in vivo siRNA delivery systems, we perform further experiments comparing the sCA system with Invivofectamine 2.0 (IF) and Atelocollagen (Atelo). Finally we examine the toxicity of sCA nanoparticle system in mice and monkeys.. Methods: To assess the bio-distribution of fluorescently labeled siRNA in normal organs and tumor tissues, we used the IVIS Spectrum CT system (PerkinElmer) and fluorescence microscopy. In addition, the multiphoton live imaging system (SP5; Leica) and light sheet ...
http://cancerres.aacrjournals.org/content/74/19_Supplement/4460
The time course of lipophilic siRNA accumulation in KB- | Open-i  The time course of lipophilic siRNA accumulation in KB- | Open-i
The time course of lipophilic siRNA accumulation in KB-8-5 cells. The incubation time after carrier-free transfection of cholesterol-conjugated siMDR with hexyl
https://openi.nlm.nih.gov/detailedresult.php?img=PMC3299988_gkr1002f3&req=4
MISSION™ shRNA Library: Next Generation RNA Interference | China-Mainland | Sigma-Aldrich  MISSION™ shRNA Library: Next Generation RNA Interference | China-Mainland | Sigma-Aldrich
As the portfolio of RNAi methods continues to expand, options become available for even the most complex systems being studied. Until recently, synthetic siRNA was the RNAi vehicle most broadly applicable to a wide variety of systems and applications. With commercial suppliers designing and producing synthetic siRNAs, little manipulation is required for the consumer. This format is amenable to any scale of research being performed provided the system is easily transfected (e.g., standard transformed cell lines). However, obstacles for using synthetic siRNAs include being a non-renewable resource, the transient nature of silencing, and the difficulty faced in transfecting primary cells and non-dividing cell lines such as neurons, lymphocytes, and macrophages. In addition, in vivo knockdown studies are particularly cumbersome.. For those facing the above hurdles, DNA vector-based shRNA methods provide the necessary solutions. shRNA expression vectors may be propagated in Escherichia coli and, ...
https://www.sigmaaldrich.com/china-mainland/zh/technical-documents/articles/life-science-innovations/mission-shrna-library0.html
ASSA13-10-16 The Role of Endoplasmic Reticulum Stress in The Injury Induced by Bim of Hypoxic Cardiomyocytes | Heart  ASSA13-10-16 The Role of Endoplasmic Reticulum Stress in The Injury Induced by Bim of Hypoxic Cardiomyocytes | Heart
Results Green fluorescence was observed in the cells transfected of negative control siRNA group though the fluorescence microscope. Compared with the blank control group, The MTT assay determined that the survival rate of H9C2 was decreased (p , 0.05) after the injured by hypoxia. And the results of flow cytometry showed that hypoxia increased cell apoptosis rate (P , 0.01) and the concentration of calcium (p , 0.01), while the transfection of Bim-siRNA reduced the effects caused by hypoxia (P , 0.05 or P , 0.01). Compared with the hypoxia group, the transfection of Bim-siRNA increased the cell survival rate, decreased cell apoptosis rate and the concentration of calcium (p , 0.01 or p , 0.05). While there was no significant difference among Hypoxia Group, Hypoxia + Negative Control siRNA Group and Hypoxia + Mock control Group (p , 0.05). The results of Western blotting showed that the transfection of Bim-siRNA reduced the expression of Bim obviously (p , 0.01); meanwhile, reduced the ...
http://heart.bmj.com/content/99/Suppl_1/A47.1
RNAi Therapeutics: 2 Short Stories: An siRNA Delivery Paper by Merck, Pharmaceutical Interest in Silences Gene Target  RNAi Therapeutics: 2 Short Stories: An siRNA Delivery Paper by Merck, Pharmaceutical Interest in Silence's Gene Target
The most enjoyable part in following RNAi Therapeutics is to look at the rich stream of scientific data and determine the absolute maturity and competitive position of the technologies and companies involved, as well as getting a glimpse at relationship dynamics. I therefore thought to share today two examples of this that I picked up recently. One is a paper by Sirna Therapeutics/Merck shedding some light on their approach towards RNAi pharmacology and RNAi trigger design. The other is some intriguing evidence that Silence Therapeutics most important gene target, PKN3, is gaining traction in the pharmaceutical space. Studying the pharmacology of siRNA delivery. Pei and colleagues from Merck published in RNA a nice paper on better understanding the pharmacology of siRNA delivery [Pei et al. (2010). Quantitative evaluation of siRNA delivery in vivo]. Unlike small molecules or even antibodies, the pharmacology of RNAi Therapeutics is more complex as simply measuring the raw tissue abundance of an ...
http://rnaitherapeutics.blogspot.com/2010/10/2-short-stories-sirna-delivery-paper-by.html
Selecting siRNA Sequences to Incorporate into the pSilencer Vectors ( The first step in prep...)  Selecting siRNA Sequences to Incorporate into the pSilencer Vectors ( The first step in prep...)
The first step in preparing a plasmid for siRNA experiments is to identify target sequences in the gene of interest that are susceptible to siRNA-induced degradation. We have found that a little more than half of the siRNAs provide at least a 50% reduction in target mRNA levels and approximately 1 out of 4 siRNAs ,Selecting,siRNA,Sequences,to,Incorporate,into,the,pSilencer,Vectors,biological,advanced biology technology,biology laboratory technology,biology device technology,latest biology technology
http://www.bio-medicine.org/biology-technology/Selecting-siRNA-Sequences-to-Incorporate-into-the-pSilencer-Vectors-1036-1/
Discovery of Next-Generation siRNA Delivery Systems Through Rational Design of Novel Cationic Lipids | UBC Chemistry  Discovery of Next-Generation siRNA Delivery Systems Through Rational Design of Novel Cationic Lipids | UBC Chemistry
Semple, SC, Akinc, A, Sandhu, A, Mui, B, Chow, C, Sah, D, Stebbing, D, Crosley, E, Hafez, I, Dorkin, JR, Qin, J, Lam, K, Wong, K, Nechev, L, Eisenhardt, ML, Jayaraman, M, Kazem, M, Maier, M, Srinivasulu, M, Weinstein, M, Chen, Q, Alvarez, R, Barros, S, Klimuk, SK, Borland, T, Kosovrasti, V, Tam, Y, MacLachlan, I, Manoharan, M, Ciufolini, MA, Tracy, M, de Fougerolles, A, Cullis, PR, Madden, TD, Hope, ...
http://www.chem.ubc.ca/discovery-next-generation-sirna-delivery-systems-through-rational-design-novel-cationic-lipids
mTOR and Rictor mediate cell migration.A: siRNA-induced | Open-i  mTOR and Rictor mediate cell migration.A: siRNA-induced | Open-i
mTOR and Rictor mediate cell migration.A: siRNA-induced mTOR depletion inhibits Tsc2−/− MEF migration. Tsc2−/− MEFs were transfected with siRNA mTOR or
https://openi.nlm.nih.gov/detailedresult.php?img=PMC4216017_pone.0111476.g008&req=4
VIRsiRNApred: a web server for predicting inhibition efficacy of siRNAs targeting human viruses | Journal of Translational...  VIRsiRNApred: a web server for predicting inhibition efficacy of siRNAs targeting human viruses | Journal of Translational...
Researchers working in the field of siRNA based therapeutics for viruses have generated a vast amount of data over the years. However, bioinformatics resources in the field were lacking and there was no viral siRNA efficacy prediction method available. In this direction, we have recently developed a comprehensive viral siRNA database "VIRsiRNAdb" [48] and another "HIVsirDB" [49] exclusively for HIV. Now we have developed VIRsiRNApred -a viral siRNA efficacy prediction algorithm.. Although many mammalian siRNA prediction algorithms have been developed in the past [33], these methods either classify a siRNA as effective/non-effective [29] or predict the inhibition efficacy of a siRNA [31, 32]. However, there is limited success in predicting siRNA efficacy due to limited size and diversity of available siRNA datasets [50].. Mammalian siRNA efficacy prediction methods were initially developed using siRNA tested under heterogeneous experimental conditions like Saetrom (581 siRNA), Shabalina (653 ...
https://translational-medicine.biomedcentral.com/articles/10.1186/1479-5876-11-305
Role of Arabidopsis AGO6 in siRNA accumulation, DNA methylation and transcriptional gene silencing | The EMBO Journal  Role of Arabidopsis AGO6 in siRNA accumulation, DNA methylation and transcriptional gene silencing | The EMBO Journal
Gene silencing occurs at the transcriptional and post‐transcriptional levels (Baulcombe, 2004; Bender, 2004; Mello and Conte, 2004; Chan et al, 2005; Matzke and Birchler, 2005; Morris, 2005; Wassenegger, 2005). Post‐transcriptional gene silencing (PTGS) involves microRNAs (miRNAs) and certain classes of short interfering RNAs (siRNAs) (Carrington and Ambros, 2003; Bartel, 2004; Baulcombe, 2004; He and Hannon, 2004; Tang, 2005). miRNAs are about ∼21-22 nt in size and are processed by Dicer family of endonuclease III enzymes from longer precursor RNAs that can form stem‐loop structures (Carrington and Ambros, 2003; Bartel, 2004). siRNAs are generated from long double‐stranded RNAs (dsRNAs) by enzymes of the Dicer family (Baulcombe, 2004; Matzke and Birchler, 2005; Bouche et al, 2006; Moissiard and Voinnet, 2006). There are two major size classes of siRNAs, that is, ∼21‐ and ∼24‐nt siRNAs (Brodersen and Voinnet, 2006). miRNAs and siRNAs are incorporated into RNA‐induced ...
http://emboj.embopress.org/content/26/6/1691
Sirnaomics Receives Two SBIR Grants from NIH for Developing siRNA Therapeutics to Treat  Sirnaomics Receives Two SBIR Grants from NIH for Developing siRNA Therapeutics to Treat
GAITHERSBURG, Md., June 29 /PRNewswire/ -- Sirnaomics Receives Two SBIR Grants from NIH for Developing siRNA Therapeutics to Treat Glioblastoma and...
https://www.prnewswire.com/news-releases/sirnaomics-receives-two-sbir-grants-from-nih-for-developing-sirna-therapeutics-to-treat-glioblastoma-and-influenza-infection-97388394.html
Research programme: siRNA therapeutics - Suzhou Ribo Life Sciences - AdisInsight  Research programme: siRNA therapeutics - Suzhou Ribo Life Sciences - AdisInsight
Suzhou Ribo Life Sciences is developing siRNA therapeutics for a range of diseases of high unmet need in China, including liver fibrosis, HIV, liver and
http://adisinsight.springer.com/drugs/800046699?error=cookies_not_supported&code=c8f6b67d-0859-4897-8434-3ef45c487fda
One siRNA sequence, many cell lines: post #1  One siRNA sequence, many cell lines: post #1
One siRNA sequence, many cell lines - posted in siRNA, microRNA and RNAi: Hi all, Im new to process of siRNA transfection and I was wondering: Will one siRNA sequence (previously validated in the lab) be good enough to transfect multiple other cell lines from the same organism? I understand that the actual process of transfection will be different for each cell line, but I am curious as to whether I need to also worry about the sequence itself. Thanks!
http://www.protocol-online.org/forums/topic/25829-one-sirna-sequence-many-cell-lines/
siRNA - siRNA libraries, custom siRNA synthesis and transfection reagents | Sigma-Aldrich  siRNA - siRNA libraries, custom siRNA synthesis and transfection reagents | Sigma-Aldrich
Advanced design and quality synthesis for predesigned siRNA and siRNA libraries using the Rosetta siRNA Design Algorithm to reduce off-target effects and increase RNAi performance.
http://www.sigmaaldrich.com/life-science/functional-genomics-and-rnai/sirna.html?cm_mmc=affiliate-_-GeneCards-_-siRNA-_-WBSCR2
A stepwise pathway for biogenesis of 24‐nt secondary siRNAs and spreading of DNA methylation | The EMBO Journal  A stepwise pathway for biogenesis of 24‐nt secondary siRNAs and spreading of DNA methylation | The EMBO Journal
Our study supports a previous conjecture that primary RdDM is required to initiate 24‐nt secondary siRNA formation. This requirement was initially suggested by the absence of secondary siRNAs in nrpe1 and drd1 mutants, which still produce primary siRNAs and the overlapping nascent RNA but lack primary RdDM (Kanno et al, 2008). The nascent RNA stably accumulates in the absence of primary RdDM in non‐silenced plants but, in that instance, is presumably a Pol II transcript (Figure 6) because it is still made in an nrpd1 mutant. The key function of primary RdDM appears to be in attracting the secondary siRNA‐generating machinery, which includes Pol IV and RDR2. The contribution may be direct if primary RdDM provides a template that is preferentially recognized by Pol IV, which has been proposed to transcribe methylated DNA (Herr et al, 2005; Onodera et al, 2005). In this model, Pol IV would transcribe the nascent RNA from the methylated template (Figure 6). An indirect contribution of primary ...
http://emboj.embopress.org/content/28/1/48
Plus it  Plus it
Cell Culture. The human cancer cell lines SW620, MCF-7, and HT29 were obtained from the American Type Culture Collection (Manassas, VA) and maintained in 5% CO2 at 37°C in a humidified environment. These cells were propagated in Liebovitzs L-15 medium, modified Eagles medium, and McCoys 5A media, respectively, and supplemented with 10% fetal bovine serum, 100 units/ml penicillin, 100 μg/ml streptomycin, and 10 mM pyruvate. MEM was further supplemented with 10 μg/ml bovine insulin.. RNA Oligonucleotides. siRNA oligonucleotides purchased from QIAGEN (Valencia, CA) were designed according to the manufacturers guidelines to target a portion of the human dUTPase open reading frame common to both nuclear and mitochondrial isoforms [siDUT/230 (sense, 5′-CGGACAUUCAGAUAGCGCUd(TT); and antisense, 5′-AGCGCUUAUCUGAAUGUCCGd(TT)]. siRNA oligonucleotides targeting the green fluorescent protein (siGFP-22) were also purchased from QIAGEN for use as a negative control. Double-stranded siRNAs were ...
http://molpharm.aspetjournals.org/content/66/3/620
Plus it  Plus it
The field of RNA-based gene regulation has been attracting increasing interest over the past couple of years, and the regulation of gene expression by small dsRNAs is being studied intensively. Such interference can be mediated by siRNAs, which cleave a sequence-specific target mRNA, or by micro-RNAs, which inhibit translation of a target mRNA. Noncoding RNAs have also been found to play important roles in the regulation of gene expression, for example, in gene silencing by methylation of DNA or histones. Small interfering RNAs are expected to have medical application in human therapy as drugs with high specificity for their molecular targets.. A number of studies on synthetic siRNAs or DNA vector-derived small hairpin RNAs (shRNAs) in cell culture systems have been published, and there are also several animal studies (15, 16, 17, 18, 19) . McCaffrey et al. (15) cotransfected the firefly luciferase gene along with synthetic siRNAs or a shRNA expression vector into mice by hydrodynamic injection ...
http://clincancerres.aacrjournals.org/content/10/22/7721
Silence Therapeutics | RNA Interference  Silence Therapeutics | RNA Interference
Once inside the cells, our siRNA molecules are recognised by the cellular machinery, which removes one of the strands (passenger strand) of the siRNA construct and allows the other strand (guide strand) to find its target mRNA and bind to it. This specific binding triggers the biological process of RNA interference (RNAi), by which said cellular machinery will degrade the target mRNA and prevent it from being translated into functional proteins.. We harness this natural pathway to develop new generation therapeutics by designing tailored siRNA sequences that are able to bind to mRNAs that code for disease-causing genes.. ...
http://silence-therapeutics.com/our-technology/rna-interference/
An accurate and interpretable model for siRNA efficacy prediction | BMC Bioinformatics | Full Text  An accurate and interpretable model for siRNA efficacy prediction | BMC Bioinformatics | Full Text
RNA interference (RNAi) is the process through which a double-stranded RNA (dsRNA) induces gene expression silencing, either by degradation of sequence-specific complementary messenger RNA (mRNA) or by repression of translation [1]. The RNAi pathway was firstly identified in lower organisms (plants, fungi and invertebrates) and led to many successful applications such as genome-wide RNAi screens [2-5]. In mammalian systems, chemically synthesized dsRNA reagents shorter than 30 nt were found to trigger sequence-specific RNAi response without inducing the cells immune mechanism [6, 7]. The use of exogenous small interfering RNAs (siRNAs) for abolishing gene expression has quickly become a widespread molecular tool providing a powerful means for gene functional study and new drug target identification [8, 9]. Moreover, RNAi represents a promising technology for therapeutic applications against HIV [10], neurodegenerative disorders [11] and cancer [12]. Its popularity stems in particular from its ...
https://bmcbioinformatics.biomedcentral.com/articles/10.1186/1471-2105-7-520
Targeted Degradation of Proteins by PROTACs - Current Protocols  Targeted Degradation of Proteins by PROTACs - Current Protocols
In recent years, small interference RNAs (siRNAs) have greatly enhanced our understanding of protein functions by allowing knockdown of targeted proteins at the mRNA level
http://www.currentprotocols.com/WileyCDA/CPUnit/refId-ch090242.html
Targeted Degradation of Proteins by PROTACs - Current Protocols  Targeted Degradation of Proteins by PROTACs - Current Protocols
In recent years, small interference RNAs (siRNAs) have greatly enhanced our understanding of protein functions by allowing knockdown of targeted proteins at the mRNA level
http://www.currentprotocols.com/WileyCDA/CPUnit/refId-ch090242.html?quicktabs_cp=abstract
IJMS | Free Full-Text | RNA Interference in Mammalia Cells by RNA-3-PNA Chimeras | Notes  IJMS | Free Full-Text | RNA Interference in Mammalia Cells by RNA-3'-PNA Chimeras | Notes
The discovery of siRNAs as the mediators of RNA interference has led to an increasing interest in their therapeutic applications. Chemical modifications are introduced into siRNAs to optimize the potency, the stability and the pharmacokinetic properties in vivo. Here, we synthesize and test the effects of RNA-3-PNA chimeras on siRNA functioning and stability. We demonstrate that the chemical modifications are compatible with the siRNA machinery, because all the PNA-modified siRNAs can efficiently mediate specific gene silencing in mammalian cells. Furthermore, we find that the modification on the sense strand of siRNA results in an increased persistence of the activity, whereas modification on both strands results in enhanced nuclease resistance in serum.
http://www.mdpi.com/1422-0067/9/3/299/notes
RNAi Therapeutics: RNAi Therapeutics Companies  RNAi Therapeutics: RNAi Therapeutics Companies
Due to reasons discussed in the previous post, almost all of these programs are Direct RNAi programs, i.e. the siRNA is administered close to the diseased site. All except for Acuitys program are also with siRNAs that have been chemically modified (to enhance stability etc), and it remains to be seen whether Acuitys strategy to plunge into the clinic first was a wise one. Sirna Therapeutics soon followed suit, but I think took the right decision to invest time to carefully think about how to position their potential product in the more and more crowded AMD market. Sirna Therapeutics was also the first public company based on RNAi. Formerly known as Ribozyme Pharmaceuticals, they leveraged their experience with RNAs to build an operation that had all the tools to to build a decent IP portfolio and quickly enter the clinic. This IP portfolio is mostly based on chemistry and targeting many genes one by one such that it could claim exclusivity for targeting those genes with RNAi. It remains to be ...
http://rnaitherapeutics.blogspot.com/2007/04/rnai-therapeutics-companies.html
nanoUDLA: DNA Computer Works in Human Cells  nanoUDLA: DNA Computer Works in Human Cells
Benenson and colleagues engineered a target gene to be sensitive to several different siRNAs of their own design. In the simplest case, they introduced a single siRNA molecule to switch off a target gene that encoded a fluorescent protein. In more complex cases, a pair of siRNAs or either of two siRNAs switched off another target gene, which in turn switched off a gene for a fluorescent protein. To make sure the system worked as intended, the researchers based their siRNAs on those of other species, they report in a paper published online today by Nature Biotechnology ...
http://nanoudla.blogspot.com/2007/09/dna-computer-works-in-human-cells.html
Choosing The Right Carrier For SiRNA-based Applications-A New Reporter System Which Acts By Induction Of Endogenous...  Choosing The Right Carrier For SiRNA-based Applications-A New Reporter System Which Acts By Induction Of Endogenous...
Anew detection mechanism for the control of successful siRNA delivery to cells or tissue is introduced using a siRNA-based probe that is capable of inducing a ...
https://www.omicsonline.org/proceedings/choosing-the-right-carrier-for-sirnabased-applicationsa-new-reporter-system-which-acts-by-induction-of-endogenous-intracellular-fluorescence-16015.html
Sirna Design: Methods And Protocols 2012  Sirna Design: Methods And Protocols 2012
PlanningOperationsProduct ManagementProductionPublic RelationsResearchSalesOther Yes, I need to discuss cells from Adweek about programs, formats and entries that they are may regulate of siRNA Design: Methods and Protocols to me. You emit together randomized to this siRNA Design: Methods. puncture us to find up to siRNA realize as completed to this selection.
http://michael-noeres.de/freebook.php?q=siRNA-Design%3A-Methods-and-Protocols-2012/
Sirna Therapeutics - Venrock  Sirna Therapeutics - Venrock
Acquired by Silicon Image Anchor Bay Technologies is developing a new class of components and systems, based on high-performance Digital Video and Audio format-conversion technologies, for the Digital A/V market.. ...
http://www.venrock.com/investment/sirna-therapeutics/
Peptide-mediated Protein Knockdown Technology  Peptide-mediated Protein Knockdown Technology
Techniques that regulate the level of protein expression by targeting genes at the DNA or RNA level have proven to be powerful strategies in the drive to understand protein expression and function. However, because of their very nature, these techniques are restricted in terms of speed, specificity and reversibility. For instance, these genetic methods of disrupting protein expression can take days to weeks; consequently, cellular and molecular compensation may occur, thereby obscuring expected phenotypes. In addition, as these genetic manipulations result in the eradication of all mRNA splice isoforms, as well as post-translationally modified versions of targeted proteins, these methods lack specificity and are largely limited to studying context-dependent protein function. Finally, the reversibility of these genetic manipulations, including many recently developed on-and-off inducible methods, is relatively slow (being achieved on a timescale of days to weeks) and is incomplete. These ...
http://www.primarypeptides.com/technology/protein-knockdown-technology/
Non-viral siRNA delivery to the lung. - Semantic Scholar  Non-viral siRNA delivery to the lung. - Semantic Scholar
SiRNAs exert their biological effect by guiding the degradation of their cognate mRNA sequence, thereby shutting down the corresponding protein production (gene silencing by RNA interference or RNAi). Due to this property, siRNAs are emerging as promising therapeutic agents for the treatment of inherited and acquired diseases, as well as research tools for the elucidation of gene function in both health and disease. Because of their lethality and prevalence, lung diseases have attracted particular attention as targets of siRNA-mediated cures. In addition, lung is accessible to therapeutic agents via multiple routes, e.g., through the nose and the mouth, thus obviating the need for targeting and making it an appealing target for RNAi-based therapeutic strategies. The clinical success of siRNA-mediated interventions critically depends upon the safety and efficacy of the delivery methods and agents. Delivery of siRNAs relevant to lung diseases has been attempted through multiple routes and using various
https://www.semanticscholar.org/paper/Non-viral-siRNA-delivery-to-the-lung-Thomas-Lu/03d74e82b067a0d08e4460e3695dbfccce36d1d6
Plus it  Plus it
2345 Small interfering RNA (siRNA) oligonucleotides have been shown to be potent mediators of RNA interference (RNAi) that induce gene silencing with a high degree of sequence specificity. This has resulted in a rapid shift from antisense and ribozymes to siRNA for gene knockdown studies, and thus sparked strong interest in their use as therapeutics. Therapeutic use of siRNA, however, requires both improved biological stability and intracellular targeting. Thus far, gene inhibition by synthetic siRNA following intravenous administration has been limited to high pressure administration yielding primary effects in liver or using lipoplexes yielding primary effects in lung, in both cases via poorly understood mechanisms not readily adaptable to any other tissue and lacking clinical applicability. Recent work with aqueous siRNA administered parenterally by many routes found it could elicit effects on implanted tumors but without correlation to tumor exposure or tumor gene inhibition, leading the ...
http://cancerres.aacrjournals.org/content/64/7_Supplement/542.2
OPUS 4 | Search  OPUS 4 | Search
Small interfering RNAs (siRNAs) are now established as the preferred tool to inhibit gene function in mammalian cells yet trigger unintended gene silencing due to their inherent miRNA-like behavior. Such off-target effects are primarily mediated by the sequence-specific interaction between the siRNA seed regions (position 2-8 of either siRNA strand counting from the 5-end) and complementary sequences in the 3UTR of (off-) targets. It was previously shown that chemical modification of siRNAs can reduce off-targeting but only very few modifications have been tested leaving more to be identified. Here we developed a luciferase reporter-based assay suitable to monitor siRNA off-targeting in a high throughput manner using stable cell lines. We investigated the impact of chemically modifying single nucleotide positions within the siRNA seed on siRNA function and off-targeting using 10 different types of chemical modifications, three different target sequences and three siRNA concentrations. We found ...
http://publikationen.ub.uni-frankfurt.de/solrsearch/index/search/searchtype/authorsearch/author/Jyoti+Chattopadhyaya
Mouse siGENOME siRNA Library - Transcription Factors | Dharmacon  Mouse siGENOME siRNA Library - Transcription Factors | Dharmacon
An arrayed siRNA collection targeting mouse transcription factors. siGENOME siRNA is a cost-effective choice for RNAi screening. Available as SMARTpool or 4 individual siRNA reagents.
http://dharmacon.gelifesciences.com/sirna/mouse-sigenome-sirna-library-transcription-factors/
Mouse siGENOME siRNA Library - Apoptosis | Dharmacon  Mouse siGENOME siRNA Library - Apoptosis | Dharmacon
An arrayed siRNA collection targeting mouse genes in apoptosis pathways. siGENOME siRNA is a cost-effective choice for RNAi screening. Available as SMARTpool or 4 individual siRNA reagents.
http://dharmacon.gelifesciences.com/sirna/mouse-sigenome-sirna-library-apoptosis/
Heparin sodium IC50 - Synthetic Small Molecule Inhibitors of Hh Signaling  Heparin sodium IC50 - Synthetic Small Molecule Inhibitors of Hh Signaling
Biology is generating more data than ever before. had been extracted from database magazines in BMC BMC and Bioinformatics Biology. To date, there were 19 significant contributors towards the task, each of whom continues to be shown Heparin sodium IC50 as an writer upon this publication. This task was taken up to highlight the grouped community facet of the MB project. The homepage continues to be visited 100 approximately?000 times. The task has 80 new users in total, and there were 15 approximately?000 edits. We wish that with ongoing improvements and through elevated publicity, use shall continue steadily to grow. Continue Reading. ...
http://biosweepny.com/tag/heparin-sodium-ic50/
Acolbifene - Synthetic Small Molecule Inhibitors of Hh Signaling  Acolbifene - Synthetic Small Molecule Inhibitors of Hh Signaling
Interleukin 17A (IL-17A) continues to be connected with protective instead of pathogenic response in Chagas disease (ChD). 42.1% of these were man. The Credit card group included 145 sufferers, which 58.6% were man, with ages which range from 23 to 67 years (mean of 49). The IND group shown higher degrees of IL-17A significantly, median of 26.16 (3.66C48.33) when compared with both the Credit card group, median of 13.89 (3.87C34.54) (. Continue Reading. ...
http://biosweepny.com/tag/acolbifene/
Human ON-TARGETplus siRNA Library - Genome | Dharmacon  Human ON-TARGETplus siRNA Library - Genome | Dharmacon
An arrayed collection of siRNA reagents for RNAi screening, targeting the whole human genome. ON-TARGETplus siRNA is guaranteed to silence, and is modified to reduce off-targets for fewer false positives.
http://dharmacon.gelifesciences.com/sirna/human-on-targetplus-sirna-library-genome/
HSP signaling | Inhibitors, Antibodies and siRNAs on HSP Signaling Pathway are available at Selleck.  HSP signaling | Inhibitors, Antibodies and siRNAs on HSP Signaling Pathway are available at Selleck.
The participants had Finnish as their native language and were from families with two parents and one to three children. For 18 of the families, at least one parent had either a bachelors (or equivalent), masters, or doctoral degree and for the majority of the families their monthly income was at or above the Finnish average level. The parents were asked about their childs possible hearing difficulties and other illnesses. The parents also provided the childs health summary, which contained information from the childs regular visits to a nurse and/or medical doctor that had occurred at least three times per year. Except for allergies, atopic skin or asthma, the subjects had no illnesses and no reported hearing or other. medical problems. The children were born at full term, had. normal birth weights, and their weight and height had developed normally. All of the children also had some Etoposide nmr musical experience outside the home as they had all attended the same playschool involving ...
http://hspsignaling.com
Fuse-It-siRNA - ibidi  Fuse-It-siRNA - ibidi
A fusion reagent for rapid and efficient gene silencing in living cells-the improvement of siRNA transfection Exceptionally efficient siRNA transfection, esp...
https://ibidi.com/fuse-it-membrane-fusion/198-fuse-it-sirna.html
QIAGEN launches human siRNA library sets  QIAGEN launches human siRNA library sets
Prime Standard QIA a leading supplier of products and technologies for nucleic acid separation, purification and handling today announced that it has launched a series of off-the-shelf human library siRNA sets, covering a broad gene family selection including kinases, GPCRs, apoptosis related genes, and oncogenes, to name a few.
https://www.news-medical.net/news/2004/05/03/1160.aspx
shRNA - Good even if I dont need extra benefits? - siRNA, microRNA and RNAi  shRNA - Good even if I don't need extra benefits? - siRNA, microRNA and RNAi
IMO I think that people go with siRNA first to see if their siRNA sequence works and you get good knockdown. If you get good knowndown, then you can make the shRNA plasmid. But if you dont see good knockdown you end up making a new siRNA. If you went to shRNA first and then found that there is no knowndown, then it is a waste of time and money.. ...
http://www.protocol-online.org/biology-forums/posts/35435.html
OriGene - ITGA5 (NM 002205) shRNA  OriGene - ITGA5 (NM 002205) shRNA
ITGA5 - ITGA5 - Human, 4 unique 29mer shRNA constructs in retroviral GFP vector shRNA available for purchase from OriGene - Your Gene Company.
http://www.origene.com/shRNA/TG312094.aspx
OriGene - PDCD7 (NM 016688) shRNA  OriGene - PDCD7 (NM 016688) shRNA
PDCD7 - Pdcd7 - Mouse, 4 unique 29mer shRNA constructs in retroviral GFP vector shRNA available for purchase from OriGene - Your Gene Company.
http://www.origene.com/mouse_RNA/TG502855.aspx
Want to scale agile? Dont. Descale the work first. Achieve big through small.  Want to scale agile? Don't. Descale the work first. Achieve big through small.
This is the second post in a series, sharing a number of observed anti-patterns and corresponding patterns on the topic of organisational agility (aka digital transformation). We are in the midst of…
https://medium.com/sooner-safer-happier/want-to-scale-agile-dont-descale-the-work-first-achieve-big-through-small-7bdd09962540
Omega Research  Omega Research
We screened receptors and identified one, denoted earlier as ChemR23, that mediates RvE1 signal to attenuate nuclear factor-B. Specific binding of RvE1 to this receptor was confirmed using synthetic [3H]-labeled RvE1. Treatment of DCs with small interference RNA specific for ChemR23 sharply reduced RvE1 regulation of IL-12 ...
http://omega-research.com/researchview.php?ID=400&catid=5
How much Accell siRNA do I need to order?  How much Accell siRNA do I need to order?
Accell siRNA has a higher working concentration than siGENOME or ON-TARGETplus siRNA products. Use this tool as a guideline for ordering the appropriate amount of Accell siRNA for your cell culture format. http: //dharmacon. horizondiscovery. com/resources/tools-and-calculators/sirna-calculators ...
https://horizondiscovery.com/FAQ/Horizon-Discovery/RNAi-Custom-RNA-Synthesis/siRNA/How-much-Accell-siRNA-do-I-need-to-order
siRNA Synthesis.  siRNA Synthesis.
BSI custom siRNA synthesis services are delivered in desalted, purified, annealed duplex format with modified nucleotides of DNA , 2OMe.
http://www.biosyn.com/sirna-synthesis.aspx
PlumX - In vivo siRNA delivery system for targeting to the liver by poly-l-glutamic acid-coated lipoplex.  PlumX - In vivo siRNA delivery system for targeting to the liver by poly-l-glutamic acid-coated lipoplex.
In this study, we developed anionic polymer-coated liposome/siRNA complexes (lipoplexes) with chondroitin sulfate C (CS), poly-l-glutamic acid (PGA) and poly-aspartic acid (PAA) for siRNA delivery by intravenous injection, and evaluated the biodistribution and gene silencing effect in mice. The sizes of CS-, PGA- and PAA-coated lipoplexes were about 200?nm and their ?-potentials were negative. CS-, PGA- and PAA-coated lipoplexes did not induce agglutination after mixing with erythrocytes. In terms of biodistribution, siRNAs after intravenous administration of cationic lipoplexes were largely observed in the lungs, but those of CS-, PGA- and PAA-coated lipoplexes were in both the liver and the kidneys, indicating that siRNA might be partially released from the anionic polymer-coated lipoplexes in the blood circulation and accumulate in the kidney, although the lipoplexes can prevent the agglutination with blood components. To increase the association between siRNA and cationic liposome, we used ...
https://plu.mx/a/?doi=10.1016/j.rinphs.2014.01.001
PLOS Computational Biology: Modeling Recursive RNA Interference  PLOS Computational Biology: Modeling Recursive RNA Interference
Author Summary RNA interference is a gene regulatory system in which small RNA molecules turn off genes that have similar sequences to the small RNAs. This has become a powerful tool because a researcher can use RNA interference to turn off any gene of interest in order to test its function. There is great interest in identifying the genes required for the RNA interference pathway, and one approach to identifying such genes has been to use RNA interference to turn off potential RNA interference genes and to ask whether RNA interference still functions when these genes are turned off. The goal of our report is to ask how it is possible for RNA interference to turn itself off, using a mathematical model of the system. The results show that RNA interference cannot turn itself off if the RNA interference pathway is too effective to start with, so that experiments in which RNA interference acts on itself will only work in systems having a low efficiency. The results of our model suggest possible ways to
http://journals.plos.org/ploscompbiol/article/figure?id=10.1371/journal.pcbi.1000183.g007
Modeling Recursive RNA Interference  Modeling Recursive RNA Interference
Author Summary RNA interference is a gene regulatory system in which small RNA molecules turn off genes that have similar sequences to the small RNAs. This has become a powerful tool because a researcher can use RNA interference to turn off any gene of interest in order to test its function. There is great interest in identifying the genes required for the RNA interference pathway, and one approach to identifying such genes has been to use RNA interference to turn off potential RNA interference genes and to ask whether RNA interference still functions when these genes are turned off. The goal of our report is to ask how it is possible for RNA interference to turn itself off, using a mathematical model of the system. The results show that RNA interference cannot turn itself off if the RNA interference pathway is too effective to start with, so that experiments in which RNA interference acts on itself will only work in systems having a low efficiency. The results of our model suggest possible ways to
http://journals.plos.org/ploscompbiol/article?id=10.1371/journal.pcbi.1000183
Dicerna Announces Expansion of Ongoing DCR-MYC Phase 1 Study to Evaluate Safety and Efficacy in Patients with Advanced...  Dicerna Announces Expansion of Ongoing DCR-MYC Phase 1 Study to Evaluate Safety and Efficacy in Patients with Advanced...
Dicerna Pharmaceuticals, Inc. (NASDAQ:DRNA) , a leader in the development of RNAi therapeutics, today announced it is expanding its ongoing Phase 1 study of DCR-MYC in solid tumors, multiple myeloma, or lymphoma to include a cohort of patients with pancreatic neuroendocrine tumors (PNETs) following early signs of clinical and metabolic response and tumor shrinkage in PNET patients. DCR-MYC is an investigational Dicer substrate short-interfering RNA (DsiRNA) therapeutic targeting the MYC oncogene and the first MYC-targeting short-interfering RNA (siRNA) to enter clinical trials. "Based on the clinical activity seen in two out of three patients with PNET, evidence of a complete metabolic response (based on FDG-PET) and a partial response (based on RECIST criteria), as well as published evidence on the role of MYC in growth and maintenance of PNET tumors, we are adding a PNET expansion cohort in the ongoing Phase 1 study," said Pankaj Bhargava, M.D., chief medical officer of Dicerna. "Most patients ...
http://www.finances.com/company-news/96143-dicerna-announces-expansion-of-ongoing-dcr-myc-phase-1-study-to-evaluate-safety-and-efficacy-in-patients-with-advanced-pancreatic-neuroendocrine-tumors-pnets.htm
piRNA clusters and open chromatin structure | Mobile DNA | Full Text  piRNA clusters and open chromatin structure | Mobile DNA | Full Text
Transposable elements (TEs) are major structural components of eukaryotic genomes; however, mobilization of TEs generally has negative effects on the host genome. To counteract this threat, host cells have evolved genetic and epigenetic mechanisms that keep TEs silenced. One such mechanism involves the Piwi-piRNA complex, which represses TEs in animal gonads either by cleaving TE transcripts in the cytoplasm or by directing specific chromatin modifications at TE loci in the nucleus. Most Piwi-interacting RNAs (piRNAs) are derived from genomic piRNA clusters. There has been remarkable progress in our understanding of the mechanisms underlying piRNA biogenesis. However, little is known about how a specific locus in the genome is converted into a piRNA-producing site. In this review, we will discuss a possible link between chromatin boundaries and piRNA cluster formation.
https://mobilednajournal.biomedcentral.com/articles/10.1186/1759-8753-5-22
Abstract 839: Transfer of siRNA Molecules via Gap Junctions in Heart Cells | Circulation  Abstract 839: Transfer of siRNA Molecules via Gap Junctions in Heart Cells | Circulation
Specific gene knock-down in post-natal cells by siRNA molecules has immense potential as a research and therapeutic tool. While direct effects have been clearly demonstrated in siRNA-transduced cells, we investigated a possible "bystander effect" whereby siRNAs transfer between transduced and non-transduced (NT) primary neonatal rat ventricular myocytes (NRVMs) via gap junctions. To enable siRNA expression in NRVMs, lentiviral vectors (LV) encoding short-hairpin (sh)RNAs, which are processed to siRNAs, were generated. Two populations of LV-transduced NRVMs were produced; one expressing GFP and the other co-expressing a second reporter plus a siRNA designed to knock-down GFP. Following 7 days co-culture of these populations, flow cytometry revealed a 35% reduction in the mean GFP fluorescence intensity and real-time PCR confirmed GFP mRNA knock-down. To explore dependence of this effect on gap junctions, we co-transduced cells with a LV encoding a dominant-negative connexin43 mutant (Cx43Δ) as a ...
http://circ.ahajournals.org/content/116/Suppl_16/II_163.2
Patenting RNA Interference Technology - Law360  Patenting RNA Interference Technology - Law360
Goodwin Procter associate Daniel Wilson looks into patenting strategies for a powerful new tool for treating disease as well as for creating models of disease.
https://www.law360.com/articles/3425/patenting-rna-interference-technology
Signal Mediated Amplification of RNA Technology - Resistant Staphylococcus  Signal Mediated Amplification of RNA Technology - Resistant Staphylococcus
Signal-mediated amplification of RNA technology (SMART) is a novel isothermal amplification technology that uses a three-way junction (3WJ) structure to
https://www.americorpshealth.biz/resistant-staphylococcus-2/signalmediated-amplification-of-rna-technology.html
Custom shRNA Constructs - Cellecta  Custom shRNA Constructs - Cellecta
To make an lentiviral shRNA construct, we only need to know the RefSeq number. We typically design and clone 3-5 constructs that target your transcript. Our proprietary shRNA design delivers approximately 70% shRNAs that generate ,70% transcript knockdown in standard cell lines as measured by qRT-PCR so it is likely that at least 2 of 3 or 3 of 5 constructs will be effective.. We make the inserst, clone them, and sequence the constructs to verify correct construction. You receive several of our best-designed constructs to test and characterize to see which best matches your experimental needs. We can provide the plasmid constructs, or you have the option to also package the constructs as ready-to-transduce lentiviral particles.. We do not guarantee this level for any specific target, and the percentage of highly effective shRNAs will vary from target to target.. ...
https://cellecta.com/collections/shrna-vectors-and-constructs/products/custom-shrna-constructs
Plus it  Plus it
Attempts to target mutant KRAS have been unsuccessful. Most of the current therapeutic approaches are indirect, mainly via inhibiting KRAS down-stream signaling, which have been marginally successful. Here we report the identification of Smad ubiquitination regulatory factor 2 (SMURF2), a HECT-type ubiquitin ligase (E3) as a critical regulator of mutant KRAS protein stability. We show that the loss of SMURF2 either by si-/sh-RNA mediated gene silencing or by overexpression of a catalytically inactive SMURF2 Cys716Ala (CA) mutant, can cause lysosome-mediated KRAS degradation; whereas, overexpression of wild type SMURF2 enhances KRAS protein stability. Most importantly, we found that mutant KRAS protein is more susceptible to SMURF2 alterations in that mutant protein half-life decreased from ,12h in control siRNA-treated cells to ,3h with Smurf2 siRNA treatment, whereas only marginal differences were noted for wild-type KRAS protein upon similar treatments. Importantly, this loss of mutant KRAS ...
http://mcr.aacrjournals.org/content/12/12_Supplement/B48
RFP-Trap  RFP-Trap
RNAi refers to dsRNA-induced gene silencing, a cellular process that degrades RNA homologous to one strand of the dsRNA [1, 2]. The intermediates of long dsRNA-initiated RNAi are double-stranded small interfering RNAs (siRNA), typically 21-23 nucleotide (nt) long. The siRNAs, when introduced into cells, can be used to silence genes in mammalian systems where long dsRNAs prompt protein kinase R (PKR), RNase L, and interferon activities that result in non-specific RNA degradation and general shutdown of protein synthesis [3]. siRNAs can either be chemically synthesized then directly transfected into cells or can be generated inside the cell by introducing vectors that express short-hairpin RNA (shRNA) precursors of siRNAs. The process of shRNA into functional siRNA involves cellular RNAi machinery that naturally process genome encoded microRNAs (miRNA) that are responsible for cellular regulation of gene expression by modulating mRNA stability, translation, and chromatin structures ...
http://blog.allelebiotech.com/tag/rfp-trap/
RNA interference- a novel approach for plant disease management  RNA interference- a novel approach for plant disease management
RNA interference (RNAi) is an incredible revolution in the field of functional genomics, a breakthrough in plant molecular genetics. This technology will generate enormous potential for engineering control of gene expres-sion. The success of managing biotic stress using RNAi technology will prove to be biologically and environmentally safe. It is therapeutic in approach as the resistance induced by RNAi is triggered by ds RNA that results in silencing of specific genes before being translated in a homology dependent manner. Over the time, RNAi is significantly proving it as one of the most promiscent management strategy which eliminates certain risks associated with the development of transgenic plants. This review gives an insight into the probability of management of plant diseases caused by various biotic agents viz. fungi, bacteria and viruses using RNA interference technique and host-pathogen related targeted sites ...
http://agris.fao.org/agris-search/search.do?recordID=IN2018800053
Selleck Chemicals Blog-Inactivation of PBX3 and HOXA9 by down-regulating H3K79 methylation represses NPM1-mutated leukemic cell...  Selleck Chemicals Blog-Inactivation of PBX3 and HOXA9 by down-regulating H3K79 methylation represses NPM1-mutated leukemic cell...
Acute myeloid leukemia (AML) with an NPM1 mutation (NPMc+) has a distinct gene expression signature and displays molecular abnormalities similar to mixed lineage leukemia (MLL), including aberrant expression of the PBX3 and HOXA gene cluster. However, it is unclear if the aberrant expression of PBX3 and HOXA is essential for the survival of NPM1-mutated leukemic cells. Methods: Using the gene expression profiling of TCGA and E-MTAB-3444 datasets, we screened for high co-expression of PBX3 and HOXA9 in NPMc+ leukemia patients. We performed NPMc+ depletion and overexpression experiments to examine aberrant H3K79 methylation through epigenetic regulation. Through RNA interference technology and small-molecule inhibitor treatment, we evaluated the effect of methyl-modified H3K79 on cell survival and explored the possible underlying mechanism. Results: We showed that NPMc+ increased the expression of PBX3 and HOXA9, which are both poor prognosis indicators in AML. High PBX3 and HOXA9 expression was ...
https://www.selleckchem.com/blog/Inactivation-of-PBX3-and-HOXA9-by-down-regulating-H3K79-methylation-represses-NPM1-mutated-leukemic-cell-survival.html
riboxx RNA Technologies - riboxxFECT transfection reagent for potent delivery of RNA, siRNA or miRNA mimics  riboxx RNA Technologies - riboxxFECT transfection reagent for potent delivery of RNA, siRNA or miRNA mimics
riboxxFECT is a reagent dedicated for transfection of all formats of siRNA, microRNA mimics and RNA in primary cells, adherent cells or cells in suspension.
https://www.riboxx.com/product-riboxxfect.html
AID 506767 - Binding affinity to SAP145 in SAP145-targeting siRNA-treated human HeLa cells at 1 uM by fluorescent microscopy -...  AID 506767 - Binding affinity to SAP145 in SAP145-targeting siRNA-treated human HeLa cells at 1 uM by fluorescent microscopy -...
BioAssay record AID 506767 submitted by ChEMBL: Binding affinity to SAP145 in SAP145-targeting siRNA-treated human HeLa cells at 1 uM by fluorescent microscopy.
https://pubchem.ncbi.nlm.nih.gov/bioassay/506767
Off-target effects dominate a large-scale RNAi screen for modulators of the TGF-β pathway and reveal microRNA regulation of...  Off-target effects dominate a large-scale RNAi screen for modulators of the TGF-β pathway and reveal microRNA regulation of...
We performed a 6,000-gene siRNA screen for modulators of the TGF-β signal-transduction pathway. Although the GFP-SMAD2 translocation screen was indeed effective at isolating modulators of nuclear localization upon stimulus, it did not succeed in identifying novel components or modulators of the TGF-β pathway. All screen hits were found to be off-target effects against TGFBR1 and TGFBR2 (note that siRNAs intended to target TGFBR1 and TGFBR2 were not included in the screen, but used as controls), suggesting that there may be no other non-redundant components of the SMAD signaling pathway. However, a screen using a library that covers the entire genome would have to be performed to confirm this theory. Although the siRNA library was designed to target most known cancer and cancer-related genes (see Methods), other lesser-known genes that were not included in this screen may still be involved in TGF-β signaling.. The off-target hits were the most rate-limiting components of the TGF-β pathway, ...
https://silencejournal.biomedcentral.com/articles/10.1186/1758-907X-2-3
polymer/DSPC/cholesterol/PEG lipid/siRNA nanoparticles  polymer/DSPC/cholesterol/PEG lipid/siRNA nanoparticles
Page contains details about polymer/DSPC/cholesterol/PEG lipid/siRNA nanoparticles . It has composition images, properties, Characterization methods, synthesis, applications and reference articles : nano.nature.com
http://nano.nature.com/nano/GR-M5961660
PEG-ECO/siRNA nanoparticles  PEG-ECO/siRNA nanoparticles
Page contains details about PEG-ECO/siRNA nanoparticles . It has composition images, properties, Characterization methods, synthesis, applications and reference articles : nano.nature.com
http://nano.nature.com/nano/GR-M8693471
Stimuli-responsive siRNA carriers for efficient gene silencing in tumors via systemic delivery - Biomaterials Science (RSC...  Stimuli-responsive siRNA carriers for efficient gene silencing in tumors via systemic delivery - Biomaterials Science (RSC...
Development of efficient carriers for small interfering RNA (siRNA) delivery and validation tools for assessing in vivo RNA interference (RNAi) efficiency is crucial to advance RNAi-based therapeutics to the clinic. Here, acid-degradable ketalized linear polyethylenimine (KL-PEI) designed for efficient, stim
http://pubs.rsc.org/en/content/articlelanding/2014/bm/c3bm60187k
Pharmaceuticals | Free Full-Text | RNAi Therapeutic Platforms for Lung Diseases  Pharmaceuticals | Free Full-Text | RNAi Therapeutic Platforms for Lung Diseases
RNA interference (RNAi) is rapidly becoming an important method for analyzing gene functions in many eukaryotes and holds promise for the development of therapeutic gene silencing. The induction of RNAi relies on small silencing RNAs, which affect specific messenger RNA (mRNA) degradation. Two types of small RNA molecules, i.e. small interfering RNAs (siRNAs) and microRNAs (miRNAs), are central to RNAi. Drug discovery studies and novel treatments of siRNAs are currently targeting a wide range of diseases, including various viral infections and cancers. Lung diseases in general are attractive targets for siRNA therapeutics because of their lethality and prevalence. In addition, the lung is anatomically accessible to therapeutic agents via the intrapulmonary route. Recently, increasing evidence indicates that miRNAs play an important role in lung abnormalities, such as inflammation and oncogenesis. Therefore, miRNAs are being targeted for therapeutic purposes. In this review, we present strategies for
http://www.mdpi.com/1424-8247/6/2/223
Gates Funding RNA Treatment for HIV Infection | Science and Enterprise  Gates Funding RNA Treatment for HIV Infection | Science and Enterprise
The Gates Foundation is backing a biotechnology companys early development of antibodies to treat human immunodeficiency virus or HIV based on RNA.
https://sciencebusiness.technewslit.com/?p=28339
jetPRIME - DNA / siRNA transfection reagent - Polyplus-transfection  jetPRIME - DNA / siRNA transfection reagent - Polyplus-transfection
Looking for a powerful and versatile DNA and siRNA transfection reagent? Try jetPRIME to obtain efficient and reliable scientific results! Request your jetPRIME sample immediately!
https://www.polyplus-transfection.com/products/jetprime/
siGENOME GAPD Control siRNA  siGENOME GAPD Control siRNA
... is a validated positive control, guaranteed to silence GAPD in human cells. siGENOME siRNA positive control designs are highly functional, chemically synthesized and mostly unmodified siRNA duplexes that allow positive silencing for validation of experimental design and detection methodologies.. Also known as glyceraldehyde-3-phosphate dehydrogenase or GAPDH, GAPD is an important enzyme in carbohydrate metabolism that is well conserved across the animal kingdom. This gene is abundantly expressed in most cells and because it is non-essential, knockdown of the corresponding mRNA does not affect cell viability. ...
https://horizondiscovery.com/en/products/gene-modulation/knockdown-reagents/controls/PIFs/siGENOME-GAPD-Control-siRNA
Paramutation of tobacco transgenes by small RNA-mediated transcriptio…  Paramutation of tobacco transgenes by small RNA-mediated transcriptio…
Detail záznamu - Paramutation of tobacco transgenes by small RNA-mediated transcriptional gene silencing - Detail záznamu - Knihovna Akademie věd České republiky
https://asep.lib.cas.cz/arl-cav/m-sk/detail-cav_un_epca-0360303-Paramutation-of-tobacco-transgenes-by-small-RNAmediated-transcriptional-gene-silencing/
Measuring siRNA-mediated knockdown of IL-8 mRNA ( By Genospectra Inc. 6519 Dumbart...)  Measuring siRNA-mediated knockdown of IL-8 mRNA ( By Genospectra Inc. 6519 Dumbart...)
...By Genospectra Inc. 6519 Dumbarton Circle Fremont CA 94555. ... ... A critical step in siRNA-mediated gene expression knockdown st... INTRODUCTION There are many sources of exp...,Measuring,siRNA-mediated,knockdown,of,IL-8,mRNA,biological,advanced biology technology,biology laboratory technology,biology device technology,latest biology technology
http://www.bio-medicine.org/biology-technology/Measuring-siRNA-mediated-knockdown-of-IL-8-mRNA-1434-1/
Mechanism and functions of small RNA pathways in Neurospora - Yi Liu  Mechanism and functions of small RNA pathways in Neurospora - Yi Liu
RNA interference (RNAi) is a post-transcriptional/transcriptional gene silencing mechanism conserved from fungi to humans. In RNAi pathways, small non-coding RN...
http://grantome.com/grant/NIH/R01-GM084283-05
Plus it  Plus it
Though ZNF 746 known as Parkin-interacting substrate (PARIS) was reported to repress PGC-1α and its target gene NRF-1 leading to the neurodegeneration in Parkinsons disease, its function in tumorigenesis has not been investigated until now. Thus, in the present study, the role of ZNF746 was investigated in the invasion and epithelial to mesenchymal transition (EMT) in ZNF746 overexpressed H460 non-small cell lung cancer (NSCLC) cells. Invasion assay showed that inhibition of ZNF 746 using siRNA transfection method inhibited the invasion of H460 cells using Boyden chamber. Real-time quantitative RT-PCR (RT-qPCR) revealed that the silencing of ZNF 746 attenuated the expression of matrix metalloproteinase (MMP) 1, MMP2 and MMP 9, but not MMP7 in H460 cells. Immunoblotting assay revealed that the expressions of E-cadherin of epithelial phenotype were up-regulated, while Slug was down-regulated in ZNF746 siRNA transfected H460 cells. Consistently, mRNA expression of E-cadherin was up-regulated ...
http://clincancerres.aacrjournals.org/content/20/2_Supplement/A30
Australian RNAi technology: silencing gene expression for plant, animal and human health science - CSIRO  Australian RNAi technology: silencing gene expression for plant, animal and human health science - CSIRO
We have led the way in the development of what has been hailed as a major breakthrough in molecular biology: silencing gene expression by RNA interference (RNAi). CSIROs RNAi gene silencing technology is enabling researchers around the world to protect plants and animals from diseases, and to develop new plant varieties with beneficial attributes.
https://www.csiro.au/en/Research/Farming-food/Innovation-and-technology-for-the-future/Gene-technology/RNAi
RNAi - Technologies, Markets and Companies - 2013 Report  RNAi - Technologies, Markets and Companies - 2013 Report
Dublin, Ireland (PRWEB) March 21, 2013 -- RNA interference (RNAi) or gene silencing involves the use of double stranded RNA (dsRNA). Once inside the cell, this
http://www.prweb.com/releases/prweb2013/3/prweb10552436.htm
siRNA, DsiRNA and Plasmid Transfection Efficiency: siRNA-mediated gene silencing  siRNA, DsiRNA and Plasmid Transfection Efficiency: siRNA-mediated gene silencing
Dr. Josephine Lai (Professor of Pharmacology, University of Arizona) is a pioneer in developing experimental designs and methods for delivering siRNA to the CNS for gene expression analysis.She and her team have documented these in the publication ...
http://sirnatransfection.blogspot.com/2008/10/sirna-mediated-gene-silencing.html
Figures and data in A team of heterochromatin factors collaborates with small RNA pathways to combat repetitive elements and...  Figures and data in A team of heterochromatin factors collaborates with small RNA pathways to combat repetitive elements and...
Genome-wide profiling and functional analyses reveal a network of heterochromatin and small RNA factors that silences repetitive elements and prevents genotoxic stress to ensure fertility.
https://elifesciences.org/articles/21666/figures
Addgene: DECIPHER Mouse shRNA Libraries - Pathway and Disease Targets  Addgene: DECIPHER Mouse shRNA Libraries - Pathway and Disease Targets
DECIPHER libraries are barcoded lentiviral shRNA libraries optimized for RNAi Genetic Screens in pooled format deposited by Chenchik and Frangou.
http://www.addgene.org/pooled-library/decipher-mouse-pathway-disease-targets/
Alnylam Continues Leadership in RNAi Technologies and Delivery with New Pre-Clinical Data Presented on Enhanced Stabilization...  Alnylam Continues Leadership in RNAi Technologies and Delivery with New Pre-Clinical Data Presented on "Enhanced Stabilization...
Alnylam Pharmaceuticals, Inc. (Nasdaq:ALNY), the leading RNAi therapeutics company, today announced that the Company presented new pre-clinical data highlighting its next generation
https://www.pharmiweb.com/PressReleases/pressrel.asp?ROW_ID=244845
Loading of PEGylated siRNA lipoplexes on microbubbles restores their siRNA delivery capacity in the presence of ultrasound  Loading of PEGylated siRNA lipoplexes on microbubbles restores their siRNA delivery capacity in the presence of ultrasound
inproceedings{430184, author = {Vandenbroucke, Roosmarijn and Lentacker, Ine and Demeester, Jo and De Smedt, Stefaan and Sanders, Niek}, booktitle = {HUMAN GENE THERAPY}, number = {10}, pages = {1046--1046}, title = {Loading of PEGylated siRNA lipoplexes on microbubbles restores their siRNA delivery capacity in the presence of ultrasound}, volume = {18}, year = {2008 ...
https://biblio.ugent.be/publication/430184
A powerful strategy for developing microbial cell factories by employing synthetic small RNAs  A powerful strategy for developing microbial cell factories by employing synthetic small RNAs
The current systems for the production of chemicals, fuels and materials heavily rely on the use of fossil resources. Due to the increasing concerns on climate change and other environmental problems, however, there has been ...
https://phys.org/print295156224.html
ARGONAUTE 1 homeostasis invokes the coordinate action of the microRNA and siRNA pathways | EMBO Reports  ARGONAUTE 1 homeostasis invokes the coordinate action of the microRNA and siRNA pathways | EMBO Reports
AGO1 mRNA contains a miR168 complementarity site that is cleaved through the slicer activity of the AGO1 protein (Vaucheret et al, 2004; Baumberger & Baulcombe, 2005; Qi et al, 2005). As transgene‐derived uncapped and unpolyadenylated RNAs have been shown to activate cosuppression (Gazzani et al, 2004; Luo & Chen, 2007), it is possible that miR168‐guided cleavage of AGO1 mRNA, which produces uncapped and unpolyadenylated cleavage fragments, contributes to the hyper‐susceptibility of AGO1 to cosuppression. To test this possibility, we engineered two constructs: pAGO1:4m‐AGO1‐GUS and pAGO1:Δ168‐AGO1‐GUS. The pAGO1:4m‐AGO1‐GUS construct contains the same sequence as pAGO1:168‐AGO1‐GUS but has silent mutations that create four additional mismatches between AGO1 mRNA and miR168, and render AGO1 resistant to miR168 regulation (Vaucheret et al, 2004). The pAGO1:Δ168‐AGO1‐GUS construct is expressed from the 1.5 kb AGO1 promoter and consists of the 5′ 387 nt of AGO1 mRNA ...
http://embor.embopress.org/content/10/5/521
Pyruvate kinase M2-specific siRNA induces apoptosis and tumor regression | JEM  Pyruvate kinase M2-specific siRNA induces apoptosis and tumor regression | JEM
Although multiple available siRNA design algorithms did not predict any sequences within alternative exon 10 that would mediate robust silencing, we have identified multiple siRNAs that afford potent and specific silencing of the M2 isoform of pyruvate kinase. An inspection of the 10 top performing sequences reveals that the number of mismatches between the M1 and M2 isoforms ranges from 4 to 13. 5 of these 10 sequences contain mismatches at one of the critical central positions 10 or 11, which have been shown to be important in conferring specificity (Wang et al., 2008b). We observed one "hot spot": two of the top three siRNAs target consecutive 19-mers (si155 and si156). We also observed one "warm spot": three siRNAs work moderately well over a sequence that spans 23 nucleotides (si83, si85, and si87).. Recent analysis of transcriptomes indicates that ,90% of all human genes are expressed as alternatively spliced isoforms (Wang et al., 2008a). The ability to target one isoform of a gene ...
http://jem.rupress.org/content/early/2012/01/18/jem.20111487
BIO-SYNTHESIS - Custom Antibody Custom Peptide Synthesis Custom SiRNA Synthesis: Small Interfering RNA  BIO-SYNTHESIS - Custom Antibody Custom Peptide Synthesis Custom SiRNA Synthesis: Small Interfering RNA
siRNAs were first discovered by David Baulcombes group in Norwich, England, as part of post-transcriptional gene silencing (PTGS) in plants, and published their findings in Science in a paper titled "A species of small antisense RNA in posttranscriptional gene silencing in plants". Shortly thereafter, in 2001, synthetic siRNAs were then shown to be able to induce RNAi in mammalian cells by Thomas Tuschl and colleagues in a paper published in Nature. This discovery led to a surge in interest in harnessing RNAi for biomedical research and drug development. ...
http://bio-synthesis.blogspot.com/2011/03/small-interfering-rna_14.html
Transcription Factor siRNA library set, plate 13 - (SRP0123) - Products - Abnova  Transcription Factor siRNA library set, plate 13 - (SRP0123) - Products - Abnova
This plate consists of 35 siRNAs targeting human Transcription Factor genes (Mouse homolog 24 genes). (SRP0123) - Products - Abnova
http://www.abnova.com/products/products_detail.asp?catalog_id=SRP0123
Automated Protein Distribution Detection in High-Throughput Image-Based siRNA Library Screens | SpringerLink  Automated Protein Distribution Detection in High-Throughput Image-Based siRNA Library Screens | SpringerLink
The availability of RNA interference (RNAi) libraries, automated microscopy and computational methods enables millions of biochemical assays to be carried out simultaneously. This allows systematic, d
https://link.springer.com/article/10.1007%2Fs11265-008-0205-7
Inhibition of host TRAFs by virus | Herpes Advice  Inhibition of host TRAFs by virus | Herpes Advice
The nonparametric Mann-Whitney U test was used to assess the difference in the geometric mean titers (GMTs) of anti-HHV8 IgG between the HHV8 mono-infection and co-infection groups. Triglyceride (TG) was measured with a Triglyceride kit (Wako, Tokyo, Japan) according to the manufacturers instructions. Differences were considered significant when p ≤ 0.05. Results from phylogenetic analyses suggest networks of HCV transmission among these men. Next we assessed dose-dependency of ODN 320, with concentrations ranging from 10 to 320 nM. Ind. Studies were rated as low, moderate or high risk of bias.. SDC2-specific monoclonal antibody (2965) was from R&D Systems. siRNA target sequences were: AAGGGTTCCTGCTTTCACAGA for CypA; AAGGTGGAGAGAGCACCAAGACA for CypB; GTGACATCACCACTGGAGATG for CypC; AACCTGCTAAATTGTGCGTTA for CypD; and AATTCTCCGAACGTGTCACGT for control. These seven helicase motifs essentially form the motor which converts the chemical energy derived from ATP hydrolysis into a mechanical force ...
http://www.wdmac.com/inhibition-of-host-trafs-by-virus/
A strategy for constructing and verifying short hairpin RNA expression vectors  A strategy for constructing and verifying short hairpin RNA expression vectors
RNA Interference in Practice / AvaxHome  RNA Interference in Practice / AvaxHome
Ute SchepersRNA Interference in Practice:Principles, Basics, and Methods for Gene Silencing in C.elegans, Drosophila, and MammalsJohn Wiley & Sons | ISBN 3527310207 | 2005 | PDF | 270 pages | 3.4 MBThis hands-on guide to RNA interference brings the power of targeted gene silencing to any laboratory with the basic equipment for handling nucleic acids.In easy-to-follow, step-by-step protocols you will learn* how RNAi works in worms, flies and mammals,* how to design the most efficient RNAi constructs,* how to achieve transient, stable and conditional RNAi in cell cultures,* how to determine the efficiency of an RNAi experiment,* and how to use RNAi for gene therapy.All the protocols have been thoroughly tested in the authors own laboratory, and she provides examples of successful experiments and troubleshooting hints to help in establishing your own successful RNAi experiments. Also includes a list of suppliers for RNAi reagents and equipment as well as a glossary of terms.
https://avxhm.se/ebooks/rna_interference_in_practice.html
Surface Engineered Dendrimers in Sirna Delivery and Gene Silencing. | Physicians Weekly for Medical News, Journals & Articles  Surface Engineered Dendrimers in Sirna Delivery and Gene Silencing. | Physician's Weekly for Medical News, Journals & Articles
Therapeutic efficacy of dreadful diseases like cancer, HIV (Human Immunodeficiency Virus) can be enhanced by delivering molecules which regulate function at gene level rather than at receptor level. Silencing RNA is one such approach recently used to silence target gene expressed diseases; and thereby reduce target protein levels. Many of the non-viral vectors are proved to act as carriers for silencing RNA. Dendrimers being one of them have less size, low poly dispersibility index, water solubility, multivalence, and easy surface modification. Many such surface modifications have been carried out to improve the delivery potential of small interfering RNA (siRNA) modified dendrimers compared to simple plain dendrimers.. METHODS ...
https://www.physiciansweekly.com/surface-engineered-dendrimers-in-sirna-delivery-and-gene-silencing/
Rna, transfer synonyms, Rna, transfer antonyms - FreeThesaurus.com  Rna, transfer synonyms, Rna, transfer antonyms - FreeThesaurus.com
Synonyms for Rna, transfer in Free Thesaurus. Antonyms for Rna, transfer. 3 synonyms for transfer RNA: acceptor RNA, soluble RNA, tRNA. What are synonyms for Rna, transfer?
http://www.freethesaurus.com/Rna%2C+transfer
PIRC102 Gene - GeneCards | PIRC102 RNA Gene  PIRC102 Gene - GeneCards | PIRC102 RNA Gene
Complete information for PIRC102 gene (RNA Gene), Piwi-Interacting RNA Cluster 102, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene Compendium
http://www.genecards.org/cgi-bin/carddisp.pl?gene=PIRC102
siRNA Transfection GeneSilencer Reagent | amsbio  siRNA Transfection GeneSilencer Reagent | amsbio
AMSBIO offers transfection reagents including GeneSilencer® with a unique cationic lipid formulation for efficient transfection of siRNA into mammalian cells.
http://www.amsbio.com/sirna-transfection-reagent.aspx
Custom siRNAs according to your specs, or let us design them using our software at no extra cost - AccuTarget Custom siRNA and...  Custom siRNA's according to your specs, or let us design them using our software at no extra cost - AccuTarget Custom siRNA and...
Custom siRNAs can be synthesized according to your sequence information, or use our complimentary siRNA design service. Up to 30-mer siRNA including a choice of 32 different 3 overhangs can be ordered with a variety of modification options for expanded specificity
http://www.bioneer.co.kr/products/rnai/CustomDesignedSiRNASynthesis-overview.aspx
BLOCK-iT™ siRNAs | Thermo Fisher Scientific  BLOCK-iT™ siRNAs | Thermo Fisher Scientific
In mammalian cells the introduction of small 21-23 nucleotide sequence-specific RNA duplexes (small/short interfering RNAs, siRNAs) can act to initiate post-transcriptional gene knockdown and avoid triggering non-specific effects in mammalian cells
https://www.thermofisher.com/mx/en/home/life-science/rnai/synthetic-rnai-analysis/standard-sirna.html
Short Hairpin RNA-mediated Selective Knockdown of NaV1.8 Tetrodotoxin-resistant Voltage-gated Sodium Channel in Dorsal Root...  Short Hairpin RNA-mediated Selective Knockdown of NaV1.8 Tetrodotoxin-resistant Voltage-gated Sodium Channel in Dorsal Root...
First, we sought to demonstrate a selective knockdown of the NaV1.8 protein. To this end, we created a stable cell line expressing the NaV1.8 protein by transfection followed by G418 selection. Figure 2is an immunocytochemical (A1) and a Western blot (A2) confirmation of the proper expression of NaV1.8 immunoreactive protein of the expected molecular mass (, 260 kd) in the NaV1.8-HEK293 cell line. Infection of this cell line with the shRNA/EGFP-expressing lentivirus resulted in a decrease in the anti-NaV1.8 antibody immunoreactive band detected by a Western blot. As expected, lentivirus only expressing the EGFP reporter or the pan-tetrodotoxin-sensitive shRNA designed to knock down the tetrodotoxin-sensitive α subunits did not inhibit the NaV1.8 protein expression. Of the five shRNA/EGFP constructs targeting the NaV1.8, all demonstrated significant reduction in the immunoreactive protein band except for the NaV1.8 (1103) construct (fig. 2B). The GFP immunoreactivity (fig. 2B, bottom) served as ...
http://anesthesiology.pubs.asahq.org/article.aspx?articleid=1923738
Image-based genome-wide siRNA screen identifies selective autophagy factors. - PubMed - NCBI  Image-based genome-wide siRNA screen identifies selective autophagy factors. - PubMed - NCBI
Nature. 2011 Dec 1;480(7375):113-7. doi: 10.1038/nature10546. Research Support, N.I.H., Extramural; Research Support, N.I.H., Intramural; Research Support, Non-U.S. Govt; Research Support, U.S. Govt, Non-P.H.S.
https://www.ncbi.nlm.nih.gov/pubmed/22020285?access_num=22020285&link_type=MED&dopt=Abstract
Cadherin-11 promotes the metastasis of prostate cancer cells to bone<...  Cadherin-11 promotes the metastasis of prostate cancer cells to bone<...
TY - JOUR. T1 - Cadherin-11 promotes the metastasis of prostate cancer cells to bone. AU - Chu, Khoi. AU - Cheng, Chien Jui. AU - Ye, Xiangcang. AU - Lee, Yu Chen. AU - Zurita, Amado J.. AU - Chen, Dung Tsa. AU - Yu-Lee, Li Yuan. AU - Zhang, Sui. AU - Yeh, Edward T.. AU - Hu, Mickey C T. AU - Logothetis, Christopher J.. AU - Lin, Sue Hwa. PY - 2008/8/1. Y1 - 2008/8/1. N2 - Bone is the most common site of metastases from prostate cancer. The mechanism by which prostate cancer cells metastasize to bone is not fully understood, but interactions between prostate cancer cells and bone cells are thought to initiate the colonization of metastatic cells at that site. Here, we show that cadherin-11 (also known as osteoblast-cadherin) was highly expressed in prostate cancer cell line derived from bone metastases and had strong homophilic binding to recombinant cadherin-11 in vitro. Down-regulation of cadherin-11 in bone metastasis-derived PC3 cells with cadherin-11 -specific short hairpin RNA ...
https://tmu.pure.elsevier.com/en/publications/cadherin-11-promotes-the-metastasis-of-prostate-cancer-cells-to-b
US Patent for RNA-mediated gene assembly from DNA oligonucleotides Patent (Patent # 9,873,900 issued January 23, 2018) -...  US Patent for RNA-mediated gene assembly from DNA oligonucleotides Patent (Patent # 9,873,900 issued January 23, 2018) -...
The present invention is directed to methods and materials for RNA-mediated gene assembly from oligonucleotide sequences. In some embodiments, the oligonucleotides used for gene assembly are provided in an array format. An RNA polymerase promoter is appended to surface-bound oligonucleotides and a plurality of RNA copies of each oligonucleotide are then produced with an RNA polymerase. These RNA molecules self-assemble into a desired full-length RNA transcript by hybridization and ligation. The resulting RNA transcript may then be converted into double strand DNA useful in a variety of applications including protein expression.
https://patents.justia.com/patent/9873900
RNA interference-based therapy for transthyretin amyloidosis  RNA interference-based therapy for transthyretin amyloidosis
Transthyretin amyloidosis is caused by deposition of hepatocyte-derived transthyretin amyloid in peripheral nerves and heart. A paper recently published in the New England Journal of Medicine reports the safety and efficacy of a potent antitransthyretin small interfering RNA (RNAi) encapsulated in lipid nanoparticles and injected in patients with transthyretin amyloidosis. The RNAi resulted in sustained reduction of transthyretin levels. This study establishes a proof of concept for RNAi therapy targeting messenger RNA transcribed from a disease-causing gene.. ...
https://ommbidblog.com/2013/08/30/rna-interference-based-therapy-for-transthyretin-amyloidosis/
Plus it  Plus it
Tumors developed in BRCA1 mutation carriers show distinctive cytologic and molecular profiles compared with the sporadic tumor counterparts (1, 24). Nevertheless, at the moment, tailored treatments for this group of patients have only been partially investigated (12, 13). The rarity of human BRCA1-mutated cancer cell lines has further limited the exploitation of such approaches.. In the current study, we used the RNA interference technology to generate several isogenic BRCA1-silenced/nonsilenced breast cancer cell lines to assess whether a biological rational exists to implement therapeutic protocols specific for BRCA1 cancer patients. Our cell models were then challenged with several chemotherapeutics commonly used in breast cancer treatment.. We found no association between BRCA1 down-regulation and sensitivity to the topoisomerase II inhibitors etoposide and doxorubicin. Although differential response was observed in a few clones, this was not correlated to BRCA1 expression levels. ...
http://mct.aacrjournals.org/content/8/4/844
Fucosyltransferase 1 mediates angiogenesis, cell adhesion and rheumatoid arthritis synovial tissue fibroblast proliferation |...  Fucosyltransferase 1 mediates angiogenesis, cell adhesion and rheumatoid arthritis synovial tissue fibroblast proliferation |...
We previously reported that sialyl Lewisy, synthesized by fucosyltransferases, is involved in angiogenesis. Fucosyltransferase 1 (fut1) is an α(1,2)-fucosyltransferase responsible for synthesis of the H blood group and Lewisy antigens. However, the angiogenic involvement of fut 1 in the pathogenesis of rheumatoid arthritis synovial tissue (RA ST) has not been clearly defined. Assay of α(1,2)-linked fucosylated proteins in RA was performed by enzyme-linked lectin assay. Fut1 expression was determined in RA ST samples by immunohistological staining. We performed angiogenic Matrigel assays using a co-culture system of human dermal microvascular endothelial cells (HMVECs) and fut1 small interfering RNA (siRNA) transfected RA synovial fibroblasts. To determine if fut1 played a role in leukocyte retention and cell proliferation in the RA synovium, myeloid THP-1 cell adhesion assays and fut1 siRNA transfected RA synovial fibroblast proliferation assays were performed. Total α(1,2)-linked fucosylated
https://arthritis-research.biomedcentral.com/articles/10.1186/ar4456/figures/1
Y-box binding protein 1 is up-regulated in proliferative breast cancer and its inhibition deregulates the cell cycle. - NextBio...  Y-box binding protein 1 is up-regulated in proliferative breast cancer and its inhibition deregulates the cell cycle. - NextBio...
The Y-box-binding protein 1 (YB-1), a member of the cold-shock domain RNA-and DNA-binding protein family, has pleiotropic functions such as regulation of the cell cycle. The aim of this study was to evaluate if YB-1 is a proliferative marker in breast cancer and elucidate potential downstream targets involved in YB-1-mediated cell cycle regulation using RNA interference technology. YB-1 protein expression was evaluated in tissue microarrays of 131 breast invasive ductal carcinomas by immunohistochemistry, while the YB-1 gene expression profile was evaluated in the T-47D, MDA-MB-231, ZR-75-1 and MCF7 breast cancer cell lines. Silencing of the YB-1 gene in T-47D breast cancer cells was performed using siRNA and the effects of down-regulation of YB-1 on cell growth and regulation of the cell cycle were ascertained. A focused panel of 84 genes involved in cell cycle progression was also examined. In tissue microarrays, YB-1 expression was shown to be associated with proliferating cell nuclear ...
http://www.nextbio.com/b/search/article.nb?id=20596676
AnatomyOrganismsDiseasesChemicals and DrugsAnalytical, Diagnostic and Therapeutic Techniques and EquipmentPhenomena and ProcessesInformation ScienceHealth Care
RNARNA, Small InterferingRNA, ViralRNA EditingRNA SplicingRNA, RibosomalRNA, BacterialDNA-Directed RNA PolymerasesRNA VirusesRNA InterferenceRNA, MessengerRNA, Double-StrandedRNA, CatalyticRNA FoldingRNA Polymerase IIRNA, FungalRNA StabilityRNA HelicasesRNA, AntisenseRNA Processing, Post-TranscriptionalRNA, TransferRNA, Small NuclearRNA PrecursorsRNA, UntranslatedNucleic Acid ConformationRNA CapsSequence Analysis, RNARNA, PlantRNA, ProtozoanBase SequenceRNA, NeoplasmRNA Ligase (ATP)DEAD-box RNA HelicasesRNA Polymerase IIIMolecular Sequence DataRNA Polymerase IRNA, NuclearRNA, GuideRNA, Ribosomal, 28SRNA, Ribosomal, 18SRNA-Binding ProteinsRNA, Ribosomal, 23SRNA TransportRNA, Spliced LeaderRNA, SatelliteRNA, Ribosomal, 16SAmino Acid SequenceRNA, ArchaealNucleic Acid HybridizationProtein BiosynthesisCell LineVirus ReplicationEscherichia coliRNA CleavageMutationOligoribonucleotidesRNA, Heterogeneous NuclearTranscription, GeneticRNA, Small CytoplasmicRNA 3' End ProcessingTemplates, GeneticRNA, Small UntranslatedHeLa CellsRibonucleoproteinsRibonucleasesPoly AGenome, ViralRNA, Ribosomal, 5.8SDNARNA, Long NoncodingRNA, Small NucleolarBinding SitesRNA Virus InfectionsProtein BindingRNA, ComplementaryUridinePromoter Regions, GeneticEndoribonucleasesCell NucleusRNA, ChloroplastModels, MolecularPlasmidsReverse Transcriptase Polymerase Chain ReactionKineticsSingle-Strand Specific DNA and RNA EndonucleasesBase PairingRNA, HelminthPlant VirusesDNA PrimersGene Expression RegulationSaccharomyces cerevisiaeTranscription FactorsRNA, Transfer, PheRNA, Transfer, LysRibosomesBlotting, NorthernDNA, ViralPolymerase Chain ReactionOligonucleotidesGene Silencing5' Untranslated RegionsRNA, Transfer, TyrSequence Homology, Nucleic Acid3' Untranslated RegionsAmanitinsGenes, ViralNucleic Acid DenaturationTransfectionRibonuclease T1Molecular WeightSequence Homology, Amino AcidCell NucleolusHIV-1Cell-Free SystemProtein Structure, TertiaryDNA, ComplementaryGene Expression Regulation, ViralGenesConserved SequenceViral Nonstructural ProteinsRNA, Transfer, Amino AcylGene ExpressionIntronsRNA Splice SitesRNA, Transfer, AlaPoliovirusCells, CulturedTobaccoRibonuclease PCentrifugation, Density GradientCytoplasmNucleotidesMosaic VirusesRNA-Directed DNA PolymeraseDactinomycinOpen Reading FramesGene Expression ProfilingHepacivirusElectrophoresis, Polyacrylamide GelRNA, Transfer, AspTritiumRNA, Transfer, MetPhylogenyBromovirusRecombinant ProteinsSubstrate SpecificityRibonuclease HNuclear ProteinsModels, GeneticRegulatory Sequences, Ribonucleic AcidPolyribosomesCell Line, TumorCapsidExoribonucleasesTemperatureBacterial ProteinsRestriction MappingRNA, Transfer, GlyRNA, Transfer, HisSaccharomyces cerevisiae ProteinsRNA, Transfer, ValPoly UNodaviridaeNucleic Acid PrecursorsVirus AssemblyDefective VirusesSequence DeletionRNA, Transfer, ArgRNA, AlgalSequence Analysis, DNAHeterogeneous-Nuclear RibonucleoproteinsEscherichia coli ProteinsSpecies SpecificityAlternative SplicingVirionRibonucleoproteins, Small NuclearHepatitis Delta VirusRibosomal ProteinsRNA, Transfer, TrpOligonucleotide Array Sequence AnalysisTerminator Regions, GeneticRecombinant Fusion ProteinsMacromolecular SubstancesPlantsTime FactorsMutagenesis, Site-DirectedMutagenesisLevivirusBlotting, WesternPolynucleotidesTrypanosoma brucei bruceiDNA Restriction EnzymesModels, BiologicalExonsGene Expression Regulation, BacterialTombusvirusGuanosinePolyadenylationRNA, Transfer, LeuPhenotypeStructure-Activity Relationship

Phys.org - small interfering rnaPhys.org - small interfering rna

Small interfering RNA. Small interfering RNA (siRNA), sometimes known as short interfering RNA or silencing RNA, is a class of ... Approval of first RNA interference drug - why the excitement?. Small interfering RNA sounds like something from a science ... attaching antibody-like RNA nanoparticles to microvesicles can deliver effective RNA therapeutics such as small interfering RNA ... The group published their findings in Science in a paper titled "A species of small antisense RNA in posttranscriptional gene ...
more infohttps://phys.org/tags/small+interfering+rna/

Small interfering RNA - WikipediaSmall interfering RNA - Wikipedia

Small interfering RNA (siRNA), sometimes known as short interfering RNA or silencing RNA, is a class of double-stranded RNA ... Jensen, Kirsty; Anderson, Jennifer A.; Glass, Elizabeth J. (2014-04-15). "Comparison of small interfering RNA (siRNA) delivery ... Li LC (2008). "Small RNA-Mediated Gene Activation". RNA and the Regulation of Gene Expression: A Hidden Layer of Complexity. ... Dicer cuts the long dsRNA to form short interfering RNA or siRNA; this is what enables the molecules to form the RNA-Induced ...
more infohttps://en.wikipedia.org/wiki/Small_interfering_RNA

Small interfering RNA (siRNA)Small interfering RNA (siRNA)

... Predesigned siRNA product lines. Guaranteed to silence target gene ... Predesigned for Human and Mouse long noncoding RNA (lncRNA). +. Recommended for transfectable mammalian cells in culture. +. + ... Lincode siRNA Highly specific knockdown of long noncoding RNA (lncRNA). Accell siRNA Target silencing in difficult-to-transfect ... siRNAs for efficient knockdown of long, noncoding RNA (lncRNA) genes with modifications to ensure specificity. ...
more infohttps://horizondiscovery.com/en/products/gene-modulation/knockdown-reagents/controls/PIFs/~/link.aspx?_id=4799651F-176A-43F6-BB5E-0816A8B4EBAB&_z=z

Genomewide view of gene silencing by small interfering RNAs | PNASGenomewide view of gene silencing by small interfering RNAs | PNAS

Abbreviations: RNAi, RNA interference; dsRNA, double-stranded RNA; siRNA, small interfering RNA; miRNA, microRNA; YFP, yellow ... cells that directs the degradation of messenger RNAs homologous to short double-stranded RNAs termed small interfering RNA ( ... Genomewide view of gene silencing by small interfering RNAs. Jen-Tsan Chi, Howard Y. Chang, Nancy N. Wang, Dustin S. Chang, ... Genomewide view of gene silencing by small interfering RNAs. Jen-Tsan Chi, Howard Y. Chang, Nancy N. Wang, Dustin S. Chang, ...
more infohttps://www.pnas.org/content/100/11/6343?ijkey=af24d1e5235d4100a3fcd67ed065c4f2583ec651&keytype2=tf_ipsecsha

Poly(Ester Amine)-Mediated, Aerosol-Delivered Akt1 Small Interfering RNA Suppresses Lung Tumorigenesis - RedorbitPoly(Ester Amine)-Mediated, Aerosol-Delivered Akt1 Small Interfering RNA Suppresses Lung Tumorigenesis - Redorbit

Poly(ester amine) carrier may serve as an effective carrier, and aerosol delivery of Akt1 small interfering RNA may be a ... Poly(Ester Amine)-Mediated, Aerosol-Delivered Akt1 Small Interfering RNA Suppresses Lung Tumorigenesis. by Sam Savage ... were used for in vivo effects of aerosol-delivered Akt1 small interfering RNA (siRNA) in lung tumorigenesis. In K-ras^sup LA1^ ... To demonstrate the feasibility and emphasize the importance of noninvasive aerosol delivery of Akt1 small interfering RNA ( ...
more infohttp://www.redorbit.com/news/health/1459846/polyester_aminemediated_aerosoldelivered_akt1_small_interfering_rna_suppresses_lung_tumorigenesis/

Genome-Scale MicroRNA and Small Interfering RNA Screens Identify Small RNA Modulators of TRAIL-Induced Apoptosis Pathway |...Genome-Scale MicroRNA and Small Interfering RNA Screens Identify Small RNA Modulators of TRAIL-Induced Apoptosis Pathway |...

Genome-Scale MicroRNA and Small Interfering RNA Screens Identify Small RNA Modulators of TRAIL-Induced Apoptosis Pathway. ... Genome-Scale MicroRNA and Small Interfering RNA Screens Identify Small RNA Modulators of TRAIL-Induced Apoptosis Pathway ... Genome-Scale MicroRNA and Small Interfering RNA Screens Identify Small RNA Modulators of TRAIL-Induced Apoptosis Pathway ... Genome-Scale MicroRNA and Small Interfering RNA Screens Identify Small RNA Modulators of TRAIL-Induced Apoptosis Pathway ...
more infohttp://cancerres.aacrjournals.org/content/67/22/10782?ijkey=e0bf2cc376d210b31ea4aa9c4ea4aad5a6cfc272&keytype2=tf_ipsecsha

Small interfering RNA-mediated translation repression alters ribosome by Xinrong Ma"Small interfering RNA-mediated translation repression alters ribosome " by Xinrong Ma

We demonstrated that small RNAs (sRNAs) generated from exogenously introduced inverted repeat transgenes, with perfect ... RNA interference (RNAi) is an evolutionarily conserved gene silencing mechanism in eukaryotes, with regulatory roles in a ... Ma, Xinrong, "Small interfering RNA-mediated translation repression alters ribosome sensitivity to inhibition by cycloheximide ... Small interfering RNA-mediated translation repression alters ribosome sensitivity to inhibition by cycloheximide in ...
more infohttps://digitalcommons.unl.edu/dissertations/AAI3558863/

Testing Novel Compounds for Noninvasive Delivery of Small Interfering RNA into CNS | Parkinsons DiseaseTesting Novel Compounds for Noninvasive Delivery of Small Interfering RNA into CNS | Parkinson's Disease

Small interfering RNA (siRNA) molecules have been successfully used to target specific genes in cell culture. However, the lack ... Testing Novel Compounds for Noninvasive Delivery of Small Interfering RNA into CNS. Rapid Response Innovation Awards, 2011. ... Gene expression can be specifically modulated by molecules named small interfering RNAs (siRNAs). Although siRNAs have emerged ... Recently, we have designed non-viral vectors that can deliver functional small interfering siRNAs specifically into cultured ...
more infohttps://www.michaeljfox.org/foundation/grant-detail.php?grant_id=929

IJMS | Free Full-Text | Prevention of Tendon Adhesions by ERK2 Small Interfering RNAs | HTMLIJMS | Free Full-Text | Prevention of Tendon Adhesions by ERK2 Small Interfering RNAs | HTML

Using a chicken model, we have examined the effects of a small interfering RNA (siRNA) targeting ERK2 delivered by a lentiviral ... RNA interference (RNAi) is an evolutionarily conserved process in which cells employ small interfering RNA (siRNA) duplexes to ... Prevention of Tendon Adhesions by ERK2 Small Interfering RNAs. Hongjiang Ruan †, Shen Liu †, Fengfeng Li, Xujun Li and Cunyi ... Using a chicken model, we have examined the effects of a small interfering RNA (siRNA) targeting ERK2 delivered by a lentiviral ...
more infohttp://www.mdpi.com/1422-0067/14/2/4361/htm

IJMS | Free Full-Text | Prevention of Tendon Adhesions by ERK2 Small Interfering RNAs | NotesIJMS | Free Full-Text | Prevention of Tendon Adhesions by ERK2 Small Interfering RNAs | Notes

Using a chicken model, we have examined the effects of a small interfering RNA (siRNA) targeting ERK2 delivered by a lentiviral ... Small Regulatory RNAs in the Control of Motility and Biofilm Formation in E. coli and Salmonella ...
more infohttp://www.mdpi.com/1422-0067/14/2/4361/notes

Viral small interfering RNAs target host genes to mediate disease symptoms in plants. - PubMed - NCBIViral small interfering RNAs target host genes to mediate disease symptoms in plants. - PubMed - NCBI

We show that the yellowing symptoms are a result of small interfering RNA (siRNA)-directed RNA silencing of the chlorophyll ... Viral small interfering RNAs target host genes to mediate disease symptoms in plants.. Smith NA1, Eamens AL, Wang MB. ... Viral Small Interfering RNAs Target Host Genes to Mediate Disease Symptoms in Plants ... Viral Small Interfering RNAs Target Host Genes to Mediate Disease Symptoms in Plants ...
more infohttps://www.ncbi.nlm.nih.gov/pubmed/21573142?dopt=Abstract

Combined Small Interfering RNA Therapy and In Vivo Magnetic Resonance Imaging in Islet Transplantation | DiabetesCombined Small Interfering RNA Therapy and In Vivo Magnetic Resonance Imaging in Islet Transplantation | Diabetes

Combined Small Interfering RNA Therapy and In Vivo Magnetic Resonance Imaging in Islet Transplantation. ... Combined Small Interfering RNA Therapy and In Vivo Magnetic Resonance Imaging in Islet Transplantation ... Combined Small Interfering RNA Therapy and In Vivo Magnetic Resonance Imaging in Islet Transplantation ... Combined Small Interfering RNA Therapy and In Vivo Magnetic Resonance Imaging in Islet Transplantation ...
more infohttp://diabetes.diabetesjournals.org/content/60/2/565

Identification of essential genes in cultured mammalian cells using small interfering RNAs. - PubMed - NCBIIdentification of essential genes in cultured mammalian cells using small interfering RNAs. - PubMed - NCBI

Identification of essential genes in cultured mammalian cells using small interfering RNAs.. Harborth J1, Elbashir SM, Bechert ... We report the first RNAi-induced phenotypes in mammalian cultured cells using RNA interference mediated by duplexes of 21-nt ... Genes were classified as essential or nonessential depending on impaired cell growth after RNA silencing. Phenotypes also ... RNAs. The 21 gene products studied have different functions and subcellular localizations. Knockdown experiments monitored by ...
more infohttps://www.ncbi.nlm.nih.gov/pubmed/11792820?dopt=Abstract

Systematic coarse-grained modeling of complexation between small interfering RNA and polycations (Journal Article) | SciTech...Systematic coarse-grained modeling of complexation between small interfering RNA and polycations (Journal Article) | SciTech...

Here, we systematically develop such a model for the complexation of small interfering RNA (siRNA) and grafted ... Journal Article: Systematic coarse-grained modeling of complexation between small interfering RNA and polycations ... Title: Systematic coarse-grained modeling of complexation between small interfering RNA and polycations ...
more infohttps://www.osti.gov/scitech/biblio/22493384-systematic-coarse-grained-modeling-complexation-between-small-interfering-rna-polycations

Transgene suppression in plants by foliar application of in vitro-synthesized small interfering RNAs | SpringerLinkTransgene suppression in plants by foliar application of in vitro-synthesized small interfering RNAs | SpringerLink

Transgene suppression in plants by foliar application of in vitro-synthesized small interfering RNAs. *Alexandra S. Dubrovina. ... Transgene suppression in plants by foliar application of in vitro-synthesized small interfering RNAs. Appl Microbiol Biotechnol ... Singh A, Gautam V, Singh S, Sarkar Das S, Verma S, Mishra V, Mukherjee S, Sarkar AK (2018) Plant small RNAs: advancement in the ... Borges F, Martienssen RA (2015) The expanding world of small RNAs in plants. Nat Rev Mol Cell Biol 16:727-741 ...
more infohttps://link.springer.com/article/10.1007%2Fs00253-020-10355-y

Inhibition of HIV-1 Infection by Small Interfering RNA-Mediated RNA Interference | The Journal of ImmunologyInhibition of HIV-1 Infection by Small Interfering RNA-Mediated RNA Interference | The Journal of Immunology

Inhibition of HIV-1 Infection by Small Interfering RNA-Mediated RNA Interference. John Capodici, Katalin Karikó and Drew ... Inhibition of HIV-1 Infection by Small Interfering RNA-Mediated RNA Interference ... Inhibition of HIV-1 Infection by Small Interfering RNA-Mediated RNA Interference ... Inhibition of HIV-1 Infection by Small Interfering RNA-Mediated RNA Interference ...
more infohttp://www.jimmunol.org/content/169/9/5196

Characterization and evaluation of amphipathic, cationic peptides for small interfering RNA deliveryCharacterization and evaluation of amphipathic, cationic peptides for small interfering RNA delivery

... ... Baoling Chen (2015). Characterization and evaluation of amphipathic, cationic peptides for small interfering RNA delivery. ... which can be triggered by small interfering RNA. The efficiency and specificity of this process makes siRNA a powerful tool for ... In the human non-small cell lung tumor xenograft model, the STR-HK-siRNA complexes induced the highest tumor inhibition rate ( ...
more infohttps://uwspace.uwaterloo.ca/handle/10012/9447

A Theranostic Small Interfering RNA Nanoprobe Protects Pancreatic Islet Grafts From Adoptively Transferred Immune Rejection |...A Theranostic Small Interfering RNA Nanoprobe Protects Pancreatic Islet Grafts From Adoptively Transferred Immune Rejection |...

Combined small interfering RNA therapy and in vivo magnetic resonance imaging in islet transplantation. Diabetes 2011;60:565- ... A Theranostic Small Interfering RNA Nanoprobe Protects Pancreatic Islet Grafts From Adoptively Transferred Immune Rejection. ... A Theranostic Small Interfering RNA Nanoprobe Protects Pancreatic Islet Grafts From Adoptively Transferred Immune Rejection ... Here, we used a dual-purpose therapy/imaging small interfering (si)RNA magnetic nanoparticle (MN) probe that targets β2 ...
more infohttp://diabetes.diabetesjournals.org/content/61/12/3247

Phased, Secondary, Small Interfering RNAs in Posttranscriptional Regulatory Networks | Plant CellPhased, Secondary, Small Interfering RNAs in Posttranscriptional Regulatory Networks | Plant Cell

... small interfering RNAs (phasiRNAs), originally designated as trans-acting small interfering RNAs or tasiRNAs. PhasiRNA ... small interfering RNAs (phasiRNAs); and natural antisense transcript small interfering RNAs (NAT-siRNAs). These categories are ... Small interfering RNAs (siRNAs) are defined by the dependency of their biogenesis on an RNA-dependent RNA polymerase (RDR). The ... 2012). RNA polymerase V-dependent small RNAs in Arabidopsis originate from small, intergenic loci including most SINE repeats. ...
more infohttp://www.plantcell.org/content/25/7/2400.full

Oral History | CSHL | Research | Ron Plasterk on Small Interfering RNAsOral History | CSHL | Research | Ron Plasterk on Small Interfering RNAs

Actually I think that at the core of it more important that double-stranded RNA are the small interfering RNAs - the SiRNAs - ... Small Interfering RNAs (Ron Plasterk) Then use your browsers back button to return ... these small RNAs that were made by the dicer-protein so you have long double stranded RNA which is diced by these dicer-RNAs ... RNA Induced Silencing Complex - and that can find the messenger RNA and base pair to it. And if it base pairs to it ...
more infohttp://library.cshl.edu/oralhistory/interview/cshl/research/small-interfering-rnas/

Atu027, a Liposomal Small Interfering RNA Formulation Targeting Protein Kinase N3, Inhibits Cancer Progression | Cancer ResearchAtu027, a Liposomal Small Interfering RNA Formulation Targeting Protein Kinase N3, Inhibits Cancer Progression | Cancer Research

We have previously described a small interfering RNA (siRNA) delivery system (AtuPLEX) for RNA interference (RNAi) in the ... Atu027, a Liposomal Small Interfering RNA Formulation Targeting Protein Kinase N3, Inhibits Cancer Progression. Manuela Aleku, ... Therapeutic EphA2 gene targeting in vivo using neutral liposomal small interfering RNA delivery. Cancer Res 2005; 65: 6910-8. ... Novel cationic cardiolipin analogue-based liposome for efficient DNA and small interfering RNA delivery in vitro and in vivo. ...
more infohttp://cancerres.aacrjournals.org/content/68/23/9788?ijkey=e1f1d94f19d9e6d8e880c828e46770cf9c308c82&keytype2=tf_ipsecsha

Chemical Modification Patterns Compatible with High Potency Dicer-Substrate Small Interfering RNAsChemical Modification Patterns Compatible with High Potency Dicer-Substrate Small Interfering RNAs

Dicer-substrate small interfering RNAs (DsiRNAs) are synthetic RNA duplexes that are processed by Dicer into 21-mer species and ... O-methyl RNA, phosphorothioates and small interfering RNA. Nucleic Acids Res. 2003;31:3185-3193. [PMC free article] [PubMed] ... called small interfering RNAs (siRNAs), are the actual molecular triggers of RNAi and direct target specificity of the RNA- ... and structural variation of small interfering RNAs and short hairpin RNAs and the effect on mammalian gene silencing. Antisense ...
more infohttp://pubmedcentralcanada.ca/pmcc/articles/PMC2582043/

Evaluation of locked nucleic acid-modified small interfering RNA in vitro and in vivo | Molecular Cancer TherapeuticsEvaluation of locked nucleic acid-modified small interfering RNA in vitro and in vivo | Molecular Cancer Therapeutics

RNA interference has become widely used as an experimental tool to study gene function. In addition, small interfering RNA ( ... ATP requirements and small interfering RNA structure in the RNA interference pathway. Cell 2001;107:309-21. ... Sequence, chemical, and structural variation of small interfering RNAs and short hairpin RNAs and the effect on mammalian gene ... Evaluation of locked nucleic acid-modified small interfering RNA in vitro and in vivo. Olaf R. Mook, Frank Baas, Marit B. de ...
more infohttp://mct.aacrjournals.org/content/6/3/833.long

Delivery of RIPK4 small interfering RNA for bladder cancer therapy using natural halloysite nanotubes | Science AdvancesDelivery of RIPK4 small interfering RNA for bladder cancer therapy using natural halloysite nanotubes | Science Advances

Small interfering RNA (siRNA) has shown potential as a molecular approach to down-regulate specific gene expression in cancer ... Delivery of RIPK4 small interfering RNA for bladder cancer therapy using natural halloysite nanotubes ... In the present study, we showed that natural halloysite nanotube (HNT)-assisted delivery of an active small interfering RNA ( ... Delivery of RIPK4 small interfering RNA for bladder cancer therapy using natural halloysite nanotubes ...
more infohttps://advances.sciencemag.org/content/5/9/eaaw6499

Kallikrein gene knock-down by small interfering RNA transfection induces a profibrotic phenotype in rat mesangial cells.Kallikrein gene 'knock-down' by small interfering RNA transfection induces a profibrotic phenotype in rat mesangial cells.

RNA, Messenger / antagonists & inhibitors, genetics. RNA, Small Interfering / pharmacology*. Rats. Rats, Wistar. Receptor, ... 0/Culture Media, Conditioned; 0/Fibronectins; 0/LDL-Receptor Related Protein 1; 0/RNA, Messenger; 0/RNA, Small Interfering; 0/ ... its expression using specific small interfering RNAs (siRNA). METHODS: Rat mesangial cells were treated with 12, 60, 120 nmol/l ...
more infohttp://www.biomedsearch.com/nih/Kallikrein-gene-knock-down-by/18090545.html
AnatomyOrganismsDiseasesChemicals and DrugsAnalytical, Diagnostic and Therapeutic Techniques and EquipmentPhenomena and ProcessesInformation ScienceHealth Care
RNARNA, Small InterferingRNA, ViralRNA EditingRNA SplicingRNA, RibosomalRNA, BacterialDNA-Directed RNA PolymerasesRNA VirusesRNA InterferenceRNA, MessengerRNA, Double-StrandedRNA, CatalyticRNA FoldingRNA Polymerase IIRNA, FungalRNA StabilityRNA HelicasesRNA, AntisenseRNA Processing, Post-TranscriptionalRNA, TransferRNA, Small NuclearRNA PrecursorsRNA, UntranslatedNucleic Acid ConformationRNA CapsSequence Analysis, RNARNA, PlantRNA, ProtozoanBase SequenceRNA, NeoplasmRNA Ligase (ATP)DEAD-box RNA HelicasesRNA Polymerase IIIMolecular Sequence DataRNA Polymerase IRNA, NuclearRNA, GuideRNA, Ribosomal, 28SRNA, Ribosomal, 18SRNA-Binding ProteinsRNA, Ribosomal, 23SRNA TransportRNA, Spliced LeaderRNA, SatelliteRNA, Ribosomal, 16SAmino Acid SequenceRNA, ArchaealNucleic Acid HybridizationProtein BiosynthesisCell LineVirus ReplicationEscherichia coliRNA CleavageMutationOligoribonucleotidesRNA, Heterogeneous NuclearTranscription, GeneticRNA, Small CytoplasmicRNA 3' End ProcessingTemplates, GeneticRNA, Small UntranslatedHeLa CellsRibonucleoproteinsRibonucleasesPoly AGenome, ViralRNA, Ribosomal, 5.8SDNARNA, Long NoncodingRNA, Small NucleolarBinding SitesRNA Virus InfectionsProtein BindingRNA, ComplementaryUridinePromoter Regions, GeneticEndoribonucleasesCell NucleusRNA, ChloroplastModels, MolecularPlasmidsReverse Transcriptase Polymerase Chain ReactionKineticsSingle-Strand Specific DNA and RNA EndonucleasesBase PairingRNA, HelminthPlant VirusesDNA PrimersGene Expression RegulationSaccharomyces cerevisiaeTranscription FactorsRNA, Transfer, PheRNA, Transfer, LysRibosomesBlotting, NorthernDNA, ViralPolymerase Chain ReactionOligonucleotidesGene Silencing5' Untranslated RegionsRNA, Transfer, TyrSequence Homology, Nucleic Acid3' Untranslated RegionsAmanitinsGenes, ViralNucleic Acid DenaturationTransfectionRibonuclease T1Molecular WeightSequence Homology, Amino AcidCell NucleolusHIV-1Cell-Free SystemProtein Structure, TertiaryDNA, ComplementaryGene Expression Regulation, ViralGenesConserved SequenceViral Nonstructural ProteinsRNA, Transfer, Amino AcylGene ExpressionIntronsRNA Splice SitesRNA, Transfer, AlaPoliovirusCells, CulturedTobaccoRibonuclease PCentrifugation, Density GradientCytoplasmNucleotidesMosaic VirusesRNA-Directed DNA PolymeraseDactinomycinOpen Reading FramesGene Expression ProfilingHepacivirusElectrophoresis, Polyacrylamide GelRNA, Transfer, AspTritiumRNA, Transfer, MetPhylogenyBromovirusRecombinant ProteinsSubstrate SpecificityRibonuclease HNuclear ProteinsModels, GeneticRegulatory Sequences, Ribonucleic AcidPolyribosomesCell Line, TumorCapsidExoribonucleasesTemperatureBacterial ProteinsRestriction MappingRNA, Transfer, GlyRNA, Transfer, HisSaccharomyces cerevisiae ProteinsRNA, Transfer, ValPoly UNodaviridaeNucleic Acid PrecursorsVirus AssemblyDefective VirusesSequence DeletionRNA, Transfer, ArgRNA, AlgalSequence Analysis, DNAHeterogeneous-Nuclear RibonucleoproteinsEscherichia coli ProteinsSpecies SpecificityAlternative SplicingVirionRibonucleoproteins, Small NuclearHepatitis Delta VirusRibosomal ProteinsRNA, Transfer, TrpOligonucleotide Array Sequence AnalysisTerminator Regions, GeneticRecombinant Fusion ProteinsMacromolecular SubstancesPlantsTime FactorsMutagenesis, Site-DirectedMutagenesisLevivirusBlotting, WesternPolynucleotidesTrypanosoma brucei bruceiDNA Restriction EnzymesModels, BiologicalExonsGene Expression Regulation, BacterialTombusvirusGuanosinePolyadenylationRNA, Transfer, LeuPhenotypeStructure-Activity Relationship
SyntheticTransfectionComplementaryTranscriptShRNAVectorVivoVitroTargetViralResistance

Synthetic3

search

Transfection1

search

Complementary1

search

Transcript1

search
  • A primary transcript of the HIV provirus serves as the genomic RNA for future generations of HIV and is processed to ensure efficient translation of viral proteins. (jimmunol.org)

ShRNA1

search
  • If the shRNA is expressed at levels that are too high the cell might not be able to correctly process the endogenous RNA which could cause significant problems. (wikipedia.org)

Vector1

search

Vivo1

search
  • In vivo studies included serial MRI of NOD-SCID mice transplanted with MN-small interfering (si)Caspase-3-labeled human islets under the left kidney capsule and MN-treated islets under the right kidney capsule. (diabetesjournals.org)

Vitro1

search
  • Dalakouras A, Wassenegger M, McMillan JN, Cardoza V, Maegele I, Dadami E, Runne M, Krczal G, Wassenegger M (2016) Induction of silencing in plants by high-pressure spraying of in vitro-synthesized small RNAs. (springer.com)

Target1

search
  • During the viral life cycle, viral RNA is present in the cytoplasm of cells after fusion and before reverse transcription, which presents a target that when acted on can inhibit infection before proviral integration. (jimmunol.org)

Viral1

search
  • The inhibition occurred at two points in the viral life cycle, after fusion and before reverse transcription and during transcription of viral RNA from integrated provirus. (jimmunol.org)

Resistance2

search
  • The external RNAs were capable of local and systemic movement inducing plant resistance against the pathogens. (springer.com)
  • Dubrovina AS, Kiselev KV (2019) Exogenous RNAs for gene regulation and plant resistance. (springer.com)