AnatomyOrganismsDiseasesChemicals and DrugsAnalytical, Diagnostic and Therapeutic Techniques and EquipmentPhenomena and ProcessesDisciplines and OccupationsTechnology, Industry, AgricultureInformation ScienceHealth Care
RNARNA, Small InterferingRNA, ViralRNA EditingRNA SplicingRNA, RibosomalRNA, BacterialDNA-Directed RNA PolymerasesRNA VirusesRNA InterferenceRNA, MessengerRNA, Double-StrandedRNA, CatalyticRNA FoldingRNA Polymerase IIRNA, FungalRNA StabilityRNA HelicasesRNA, AntisenseRNA Processing, Post-TranscriptionalRNA, TransferRNA, Small NuclearRNA PrecursorsRNA, UntranslatedNucleic Acid ConformationRNA CapsSequence Analysis, RNARNA, PlantRNA, ProtozoanBase SequenceRNA, NeoplasmRNA Ligase (ATP)DEAD-box RNA HelicasesRNA Polymerase IIIMolecular Sequence DataRNA Polymerase IRNA, NuclearRNA, GuideRNA, Ribosomal, 28SRNA, Ribosomal, 18SRNA-Binding ProteinsRNA, Ribosomal, 23SRNA TransportRNA, Spliced LeaderRNA, SatelliteRNA, Ribosomal, 16SAmino Acid SequenceRNA, ArchaealNucleic Acid HybridizationProtein BiosynthesisCell LineVirus ReplicationEscherichia coliRNA CleavageMutationOligoribonucleotidesRNA, Heterogeneous NuclearTranscription, GeneticRNA, Small CytoplasmicRNA 3' End ProcessingTemplates, GeneticRNA, Small UntranslatedHeLa CellsRibonucleoproteinsRibonucleasesPoly AGenome, ViralRNA, Ribosomal, 5.8SDNARNA, Long NoncodingRNA, Small NucleolarBinding SitesRNA Virus InfectionsProtein BindingRNA, ComplementaryUridinePromoter Regions, GeneticEndoribonucleasesCell NucleusRNA, ChloroplastModels, MolecularPlasmidsReverse Transcriptase Polymerase Chain ReactionKineticsSingle-Strand Specific DNA and RNA EndonucleasesBase PairingRNA, HelminthPlant VirusesDNA PrimersGene Expression RegulationSaccharomyces cerevisiaeTranscription FactorsRNA, Transfer, PheRNA, Transfer, LysRibosomesBlotting, NorthernDNA, ViralPolymerase Chain ReactionOligonucleotidesGene Silencing5' Untranslated RegionsRNA, Transfer, TyrSequence Homology, Nucleic Acid3' Untranslated RegionsAmanitinsGenes, ViralNucleic Acid DenaturationTransfectionRibonuclease T1Molecular WeightSequence Homology, Amino AcidCell NucleolusHIV-1Cell-Free SystemProtein Structure, TertiaryDNA, ComplementaryGene Expression Regulation, ViralGenesConserved SequenceViral Nonstructural ProteinsRNA, Transfer, Amino AcylGene ExpressionIntronsRNA Splice SitesRNA, Transfer, AlaPoliovirusCells, CulturedTobaccoRibonuclease PCentrifugation, Density GradientCytoplasmNucleotidesMosaic VirusesRNA-Directed DNA PolymeraseDactinomycinOpen Reading FramesGene Expression ProfilingHepacivirusElectrophoresis, Polyacrylamide GelRNA, Transfer, AspTritiumRNA, Transfer, MetPhylogenyBromovirusRecombinant ProteinsSubstrate SpecificityRibonuclease HNuclear ProteinsModels, GeneticRegulatory Sequences, Ribonucleic AcidPolyribosomesCell Line, TumorCapsidExoribonucleasesTemperatureBacterial ProteinsRestriction MappingRNA, Transfer, GlyRNA, Transfer, HisSaccharomyces cerevisiae ProteinsRNA, Transfer, ValPoly UNodaviridaeNucleic Acid PrecursorsVirus AssemblyDefective VirusesSequence DeletionRNA, Transfer, ArgRNA, AlgalSequence Analysis, DNAHeterogeneous-Nuclear RibonucleoproteinsEscherichia coli ProteinsSpecies SpecificityAlternative SplicingVirionRibonucleoproteins, Small NuclearHepatitis Delta VirusRibosomal ProteinsRNA, Transfer, TrpOligonucleotide Array Sequence AnalysisTerminator Regions, GeneticRecombinant Fusion ProteinsMacromolecular SubstancesPlantsTime FactorsMutagenesis, Site-DirectedMutagenesisLevivirusBlotting, WesternPolynucleotidesTrypanosoma brucei bruceiDNA Restriction EnzymesModels, BiologicalExonsGene Expression Regulation, BacterialTombusvirusGuanosinePolyadenylationRNA, Transfer, LeuPhenotypeStructure-Activity RelationshipMethylationPlants, ToxicTranscriptional Elongation FactorsOligonucleotide ProbesGenetic VectorsSigma FactorEvolution, MolecularOperonArgonaute ProteinsCricetinaeLiverNucleoproteinsGene Knockdown TechniquesMagnesiumGene LibraryDNA, RibosomalUridine MonophosphateBase CompositionRNA-Induced Silencing ComplexIn Situ HybridizationTetrahymenaDrosophila melanogasterGenetic CodeDNA, BacterialCercopithecus aethiopsRNA Cap AnalogsViroidsChromatinSindbis VirusSignal TransductionViral LoadProtoplastsRNA, Transfer, ProDown-RegulationAmino Acid MotifsCrystallography, X-RaySpliceosomesTobacco Mosaic VirusNucleic Acid HeteroduplexesPlant DiseasesCytidineGenetic Complementation TestThermodynamicsGenes, ReporterCapsid ProteinsPolynucleotide AdenylyltransferaseDNA, RecombinantRNA, Transfer, SerAdenosine DeaminasePhosphorylationBacillus subtilisProteinsRNA, Transfer, Amino Acid-SpecificChromosome MappingProtein ConformationRecombination, GeneticPhosphorus IsotopesFungal ProteinsGenes, FungalCarrier ProteinsPolyribonucleotide NucleotidyltransferaseConsensus SequenceEndonucleasesRNA, Messenger, StoredSignal Recognition ParticleRegulatory Sequences, Nucleic AcidPhosphorus RadioisotopesOocytesPoint MutationReverse TranscriptionUracilT-PhagesDimerizationTumor Cells, CulturedDrosophilaRNA Polymerase Sigma 54Peptide Chain Initiation, TranslationalPseudouridineHistonesCatalysisCucumovirusElectrophoresis, Agar GelProtein SubunitsHost Factor 1 ProteinTranscriptional ActivationRNA 3' Polyadenylation SignalsRepressor ProteinstRNA MethyltransferasesGenes, BacterialTelomeraseHelper VirusesGene DeletionReticulocytesDNA ReplicationDrosophila ProteinsCycloheximideDNA ProbesComputational BiologyTransfer RNA AminoacylationXenopusMethyltransferasesFibroblastsGreen Fluorescent ProteinsPicornaviridaeArabidopsisUltraviolet RaysMicroscopy, ElectronNucleocapsidRiboswitchGlobinsPolyribonucleotidesPlant ProteinsHEK293 CellsRNA, Transfer, IleHydrogen BondingPlants, Genetically ModifiedCarmovirusEncephalomyocarditis virusAntiviral AgentsMurine hepatitis virusUridine TriphosphateCarbon IsotopesCross-Linking ReagentsNucleoside-TriphosphataseXenopus laevisTombusviridaeExosome Multienzyme Ribonuclease ComplexGene Expression Regulation, DevelopmentalGene Expression Regulation, Planttat Gene Products, Human Immunodeficiency VirusAdenineImmunoprecipitationCattleNucleotidyltransferasesRNA Cap-Binding ProteinsReal-Time Polymerase Chain ReactionTranscriptomeCatalytic DomainRetroviridaeInsect VirusesMitochondriaTrans-ActivatorsAvian Sarcoma VirusesmRNA Cleavage and Polyadenylation FactorsHot TemperatureRNA, Transfer, GluPrecipitin TestsInfluenza A virusSuppression, GeneticNucleocytoplasmic Transport ProteinsHydrolysisReoviridaePotexvirusTranscription Factors, TFIIPolynucleotide LigasesAvian leukosis virusGene Products, tatGene Expression Regulation, NeoplasticOligonucleotides, AntisenseSELEX Aptamer TechniqueTrans-SplicingHost-Pathogen InteractionsInosineAdenosine TriphosphateRibonucleoprotein, U1 Small NuclearUntranslated RegionsDNA, Single-StrandedAvian myeloblastosis virusUp-RegulationSoftwareHoloenzymesApoptosisTriticumBlotting, SouthernDNA, FungalRibonuclease, PancreaticVero CellsRifampinAllolevivirusBunyaviridaePol1 Transcription Initiation Complex ProteinsTATA-Box Binding ProteinRNA, Transfer, ThrGene Expression Regulation, EnzymologicChickensDatabases, Nucleic AcidPuromycinRNA, Transfer, GlnCell ProliferationMengovirusGene Expression Regulation, FungalDNA Mutational AnalysisRabbitsViral Structural ProteinsNuclear Magnetic Resonance, BiomolecularCytosine NucleotidesTranscription Factors, GeneralTwo-Hybrid System TechniquesAdenosine TriphosphatasesAlgorithmsGene Products, revHepatitis delta AntigensGenetic TechniquesYeastsChick EmbryoPeptidesRiboseCaenorhabditis elegansPoly CGene Products, gagActive Transport, Cell NucleusInterferonsRetroelementsSensitivity and SpecificityChromatin ImmunoprecipitationPeptide BiosynthesisKidneyPoly I-Crev Gene Products, Human Immunodeficiency VirusGuanosine MonophosphateQ beta ReplicasePoly GVirologyChloroplastsImmunoblottingGuanosine TriphosphateTranscription Initiation SiteProtein TransportManganeseAdenosineMoloney murine leukemia virusGenes, PlantAcid Anhydride HydrolasesNucleotide MappingGenotypeNeoplasm ProteinsMembrane ProteinsMultigene FamilyGenes, RegulatorTetrahymena thermophilaCell DivisionBacteriophagesMicroscopy, FluorescenceCentrifugation, ZonalAutoradiographyCell DifferentiationDichlororibofuranosylbenzimidazoleChromatography, AffinityCytidine TriphosphateAdenoviruses, HumanArabidopsis ProteinsProtein Structure, SecondaryExosomesReproducibility of ResultsPoly(A)-Binding ProteinsChromatographyZinc FingersDNA, CatalyticLuciferasesPeptide Elongation FactorsOrgan SpecificityImmunohistochemistryMice, Inbred C57BLModels, StructuralBiological EvolutionDNA HelicasesGuaninePeptide Initiation FactorsRNA, Transfer, CysAdenine NucleotidesTymovirusVesiculovirusSchizosaccharomycesEukaryotic CellsBinding, CompetitiveCell FractionationVaccinia virusSequence AnalysisHepatitis AntigensSequence HomologyMutagenesis, InsertionalFluorescent Antibody TechniqueViral Plaque AssayPlant LeavesPhosphoproteinsEnterovirusViral InterferenceEnzyme ActivationHu Paraneoplastic Encephalomyelitis AntigensEukaryotic Initiation FactorsAdenoviridaeProtein IsoformsFrameshifting, RibosomalElectrophoresisMolecular StructureAutoantigensCulture TechniquesTATA BoxChloramphenicol O-AcetyltransferaseTranscription Factor TFIIBCell SurvivalBacteriophage lambdaSimian virus 40DNA VirusesTranscription Factor TFIIIBGenetic EngineeringClosterovirusProtozoan ProteinsFramycetinViremiaAnti-HIV AgentsAmino AcidsDNA FootprintingEnhancer Elements, GeneticGammaretrovirusCell ExtractsProtein Processing, Post-TranslationalProtein-Serine-Threonine KinasesGenes, gagTransgenesRibonucleoproteins, Small NucleolarHordeumRibonucleosidesNucleic Acid Synthesis InhibitorsDeoxyribonucleasesEnterovirus B, HumanLeucineRibonucleoproteins, Small CytoplasmicAnticodonBiogenesisMethionineAlphavirusAllelesNucleosidesRhinovirusHIVOrotic AcidChenopodium quinoaProtein PrecursorsSemliki forest virusTranscription Initiation, GeneticPotassium PermanganateDengue VirusMagnetic Resonance SpectroscopyGenomicsPeptide Chain Elongation, TranslationalOrthomyxoviridaeDose-Response Relationship, DrugBiological TransportMammalsChromosomal Proteins, Non-HistoneTranscription Elongation, GeneticCD4 Lymphocyte CountBrainCell Cycle ProteinsOncogenic VirusesHIV Reverse TranscriptaseTranscription Factors, TFIIILuteovirusHaplorhiniCodon, InitiatorEmbryo, Nonmammaliangag Gene Products, Human Immunodeficiency VirusPotyvirusGenomeThiouridineCell Transformation, ViralArchaeal ProteinsMice, Inbred BALB CProtein Interaction Domains and MotifsRNA, Transfer, AsnDNA, MitochondrialOligoribonucleotides, AntisensePurinesCarcinoma, Krebs 2VirusesChromatography, Ion ExchangeNIH 3T3 CellsAlpha-AmanitinCucumis sativusMolecular Probe TechniquesTranscription Termination, GeneticPolynucleotide 5'-Hydroxyl-KinaseInterferon-betaLentivirusIn Situ Hybridization, FluorescenceBacteriaAlu ElementsTissue DistributionBunyamwera virusRibonucleoprotein, U4-U6 Small NuclearModels, ChemicalGuanine NucleotidesTranscription Factor TFIIHNuclease Protection AssaysGuanosine TetraphosphateMediator ComplexFlaviviridaeLigandsCell Transformation, NeoplasticRotavirusLuminescent ProteinsCytosineChromosome DeletionSatellite VirusesNerve Tissue ProteinsDNA, IntergenicSubcellular FractionsProtein KinasesCluster AnalysisPositive Transcriptional Elongation Factor Bbeta-GalactosidaseWest Nile virusHydrogen-Ion ConcentrationCaenorhabditis elegans ProteinsCodon, TerminatorChemistryDiarrhea Viruses, Bovine ViralRauscher VirusTranscription Factor TFIIDTATA-Binding Protein Associated FactorsMicroarray AnalysisMicroinjectionsTrioxsalenVirus CultivationLysineChimeraCations, DivalentChloramphenicolEukaryotaDeoxyribonuclease ITransformation, GeneticComputer SimulationSulfuric Acid EstersGenes, InsectToll-Like Receptor 3HepatovirusArchaeaEukaryotic Initiation Factor-4AS-AdenosylmethionineInterferon-alphaGene AmplificationTobamovirusMolecular ChaperonesDeoxyadenosinesChemical PhenomenaFormaldehydeEncephalitis Viruses, JapaneseVirulenceThermus thermophilusCell Line, TransformedChromatography, DEAE-CelluloseInsect ProteinsSpecimen HandlingAntisense Elements (Genetics)Oryza sativaAntigens, ViralPlant Viral Movement ProteinsProvirusesEmbryo, MammalianCircular DichroismFlow CytometryG-QuadruplexesAnimals, Genetically ModifiedReagent Kits, DiagnosticPoly A-UChromatography, GelMice, KnockoutNuclear Matrix-Associated Proteins
RNA
A polynucleotide consisting essentially of chains with a repeating backbone of phosphate and ribose units to which nitrogenous bases are attached. RNA is unique among biological macromolecules in that it can encode genetic information, serve as an abundant structural component of cells, and also possesses catalytic activity. (Rieger et al., Glossary of Genetics: Classical and Molecular, 5th ed)
RNA, Small Interfering
Small double-stranded, non-protein coding RNAs (21-31 nucleotides) involved in GENE SILENCING functions, especially RNA INTERFERENCE (RNAi). Endogenously, siRNAs are generated from dsRNAs (RNA, DOUBLE-STRANDED) by the same ribonuclease, Dicer, that generates miRNAs (MICRORNAS). The perfect match of the siRNAs' antisense strand to their target RNAs mediates RNAi by siRNA-guided RNA cleavage. siRNAs fall into different classes including trans-acting siRNA (tasiRNA), repeat-associated RNA (rasiRNA), small-scan RNA (scnRNA), and Piwi protein-interacting RNA (piRNA) and have different specific gene silencing functions.
RNA, Viral
Ribonucleic acid that makes up the genetic material of viruses.
RNA Editing
A process that changes the nucleotide sequence of mRNA from that of the DNA template encoding it. Some major classes of RNA editing are as follows: 1, the conversion of cytosine to uracil in mRNA; 2, the addition of variable number of guanines at pre-determined sites; and 3, the addition and deletion of uracils, templated by guide-RNAs (RNA, GUIDE).
RNA Splicing
The ultimate exclusion of nonsense sequences or intervening sequences (introns) before the final RNA transcript is sent to the cytoplasm.
RNA, Ribosomal
The most abundant form of RNA. Together with proteins, it forms the ribosomes, playing a structural role and also a role in ribosomal binding of mRNA and tRNAs. Individual chains are conventionally designated by their sedimentation coefficients. In eukaryotes, four large chains exist, synthesized in the nucleolus and constituting about 50% of the ribosome. (Dorland, 28th ed)
RNA, Bacterial
Ribonucleic acid in bacteria having regulatory and catalytic roles as well as involvement in protein synthesis.
DNA-Directed RNA Polymerases
Enzymes that catalyze DNA template-directed extension of the 3'-end of an RNA strand one nucleotide at a time. They can initiate a chain de novo. In eukaryotes, three forms of the enzyme have been distinguished on the basis of sensitivity to alpha-amanitin, and the type of RNA synthesized. (From Enzyme Nomenclature, 1992).
RNA Viruses
Viruses whose genetic material is RNA.
RNA Interference
A gene silencing phenomenon whereby specific dsRNAs (RNA, DOUBLE-STRANDED) trigger the degradation of homologous mRNA (RNA, MESSENGER). The specific dsRNAs are processed into SMALL INTERFERING RNA (siRNA) which serves as a guide for cleavage of the homologous mRNA in the RNA-INDUCED SILENCING COMPLEX. DNA METHYLATION may also be triggered during this process.
RNA, Messenger
RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.
RNA, Double-Stranded
RNA consisting of two strands as opposed to the more prevalent single-stranded RNA. Most of the double-stranded segments are formed from transcription of DNA by intramolecular base-pairing of inverted complementary sequences separated by a single-stranded loop. Some double-stranded segments of RNA are normal in all organisms.
RNA, Catalytic
RNA that has catalytic activity. The catalytic RNA sequence folds to form a complex surface that can function as an enzyme in reactions with itself and other molecules. It may function even in the absence of protein. There are numerous examples of RNA species that are acted upon by catalytic RNA, however the scope of this enzyme class is not limited to a particular type of substrate.
RNA Folding
The processes of RNA tertiary structure formation.
RNA Polymerase II
A DNA-dependent RNA polymerase present in bacterial, plant, and animal cells. It functions in the nucleoplasmic structure and transcribes DNA into RNA. It has different requirements for cations and salt than RNA polymerase I and is strongly inhibited by alpha-amanitin. EC 2.7.7.6.
RNA, Fungal
Ribonucleic acid in fungi having regulatory and catalytic roles as well as involvement in protein synthesis.
RNA Stability
The extent to which an RNA molecule retains its structural integrity and resists degradation by RNASE, and base-catalyzed HYDROLYSIS, under changing in vivo or in vitro conditions.
RNA Helicases
A family of proteins that promote unwinding of RNA during splicing and translation.
RNA, Antisense
RNA molecules which hybridize to complementary sequences in either RNA or DNA altering the function of the latter. Endogenous antisense RNAs function as regulators of gene expression by a variety of mechanisms. Synthetic antisense RNAs are used to effect the functioning of specific genes for investigative or therapeutic purposes.
RNA Processing, Post-Transcriptional
Post-transcriptional biological modification of messenger, transfer, or ribosomal RNAs or their precursors. It includes cleavage, methylation, thiolation, isopentenylation, pseudouridine formation, conformational changes, and association with ribosomal protein.
RNA, Transfer
The small RNA molecules, 73-80 nucleotides long, that function during translation (TRANSLATION, GENETIC) to align AMINO ACIDS at the RIBOSOMES in a sequence determined by the mRNA (RNA, MESSENGER). There are about 30 different transfer RNAs. Each recognizes a specific CODON set on the mRNA through its own ANTICODON and as aminoacyl tRNAs (RNA, TRANSFER, AMINO ACYL), each carries a specific amino acid to the ribosome to add to the elongating peptide chains.
RNA, Small Nuclear
Short chains of RNA (100-300 nucleotides long) that are abundant in the nucleus and usually complexed with proteins in snRNPs (RIBONUCLEOPROTEINS, SMALL NUCLEAR). Many function in the processing of messenger RNA precursors. Others, the snoRNAs (RNA, SMALL NUCLEOLAR), are involved with the processing of ribosomal RNA precursors.
RNA Precursors
RNA transcripts of the DNA that are in some unfinished stage of post-transcriptional processing (RNA PROCESSING, POST-TRANSCRIPTIONAL) required for function. RNA precursors may undergo several steps of RNA SPLICING during which the phosphodiester bonds at exon-intron boundaries are cleaved and the introns are excised. Consequently a new bond is formed between the ends of the exons. Resulting mature RNAs can then be used; for example, mature mRNA (RNA, MESSENGER) is used as a template for protein production.
RNA, Untranslated
RNA which does not code for protein but has some enzymatic, structural or regulatory function. Although ribosomal RNA (RNA, RIBOSOMAL) and transfer RNA (RNA, TRANSFER) are also untranslated RNAs they are not included in this scope.
Nucleic Acid Conformation
The spatial arrangement of the atoms of a nucleic acid or polynucleotide that results in its characteristic 3-dimensional shape.
RNA Caps
Nucleic acid structures found on the 5' end of eukaryotic cellular and viral messenger RNA and some heterogeneous nuclear RNAs. These structures, which are positively charged, protect the above specified RNAs at their termini against attack by phosphatases and other nucleases and promote mRNA function at the level of initiation of translation. Analogs of the RNA caps (RNA CAP ANALOGS), which lack the positive charge, inhibit the initiation of protein synthesis.
Sequence Analysis, RNA
A multistage process that includes cloning, physical mapping, subcloning, sequencing, and information analysis of an RNA SEQUENCE.
RNA, Plant
Ribonucleic acid in plants having regulatory and catalytic roles as well as involvement in protein synthesis.
RNA, Protozoan
Ribonucleic acid in protozoa having regulatory and catalytic roles as well as involvement in protein synthesis.
Base Sequence
The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.
RNA, Neoplasm
RNA present in neoplastic tissue.
RNA Ligase (ATP)
An enzyme that catalyzes the conversion of linear RNA to a circular form by the transfer of the 5'-phosphate to the 3'-hydroxyl terminus. It also catalyzes the covalent joining of two polyribonucleotides in phosphodiester linkage. EC 6.5.1.3.
DEAD-box RNA Helicases
A large family of RNA helicases that share a common protein motif with the single letter amino acid sequence D-E-A-D (Asp-Glu-Ala-Asp). In addition to RNA helicase activity, members of the DEAD-box family participate in other aspects of RNA metabolism and regulation of RNA function.
RNA Polymerase III
A DNA-dependent RNA polymerase present in bacterial, plant, and animal cells. It functions in the nucleoplasmic structure where it transcribes DNA into RNA. It has specific requirements for cations and salt and has shown an intermediate sensitivity to alpha-amanitin in comparison to RNA polymerase I and II. EC 2.7.7.6.
Molecular Sequence Data
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
RNA Polymerase I
A DNA-dependent RNA polymerase present in bacterial, plant, and animal cells. The enzyme functions in the nucleolar structure and transcribes DNA into RNA. It has different requirements for cations and salts than RNA polymerase II and III and is not inhibited by alpha-amanitin. EC 2.7.7.6.
RNA, Nuclear
RNA molecules found in the nucleus either associated with chromosomes or in the nucleoplasm.
RNA, Guide
Small kinetoplastid mitochondrial RNA that plays a major role in RNA EDITING. These molecules form perfect hybrids with edited mRNA sequences and possess nucleotide sequences at their 5'-ends that are complementary to the sequences of the mRNA's immediately downstream of the pre-edited regions.
RNA, Ribosomal, 28S
Constituent of the 60S subunit of eukaryotic ribosomes. 28S rRNA is involved in the initiation of polypeptide synthesis in eukaryotes.
RNA, Ribosomal, 18S
Constituent of the 40S subunit of eukaryotic ribosomes. 18S rRNA is involved in the initiation of polypeptide synthesis in eukaryotes.
RNA-Binding Proteins
Proteins that bind to RNA molecules. Included here are RIBONUCLEOPROTEINS and other proteins whose function is to bind specifically to RNA.
RNA, Ribosomal, 23S
Constituent of 50S subunit of prokaryotic ribosomes containing about 3200 nucleotides. 23S rRNA is involved in the initiation of polypeptide synthesis.
RNA Transport
The process of moving specific RNA molecules from one cellular compartment or region to another by various sorting and transport mechanisms.
RNA, Spliced Leader
The small RNAs which provide spliced leader sequences, SL1, SL2, SL3, SL4 and SL5 (short sequences which are joined to the 5' ends of pre-mRNAs by TRANS-SPLICING). They are found primarily in primitive eukaryotes (protozoans and nematodes).
RNA, Satellite
Small, linear single-stranded RNA molecules functionally acting as molecular parasites of certain RNA plant viruses. Satellite RNAs exhibit four characteristic traits: (1) they require helper viruses to replicate; (2) they are unnecessary for the replication of helper viruses; (3) they are encapsidated in the coat protein of the helper virus; (4) they have no extensive sequence homology to the helper virus. Thus they differ from SATELLITE VIRUSES which encode their own coat protein, and from the genomic RNA; (=RNA, VIRAL); of satellite viruses. (From Maramorosch, Viroids and Satellites, 1991, p143)
RNA, Ribosomal, 16S
Constituent of 30S subunit prokaryotic ribosomes containing 1600 nucleotides and 21 proteins. 16S rRNA is involved in initiation of polypeptide synthesis.
Amino Acid Sequence
The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.
RNA, Archaeal
Ribonucleic acid in archaea having regulatory and catalytic roles as well as involvement in protein synthesis.
Nucleic Acid Hybridization
Widely used technique which exploits the ability of complementary sequences in single-stranded DNAs or RNAs to pair with each other to form a double helix. Hybridization can take place between two complimentary DNA sequences, between a single-stranded DNA and a complementary RNA, or between two RNA sequences. The technique is used to detect and isolate specific sequences, measure homology, or define other characteristics of one or both strands. (Kendrew, Encyclopedia of Molecular Biology, 1994, p503)
Protein Biosynthesis
The biosynthesis of PEPTIDES and PROTEINS on RIBOSOMES, directed by MESSENGER RNA, via TRANSFER RNA that is charged with standard proteinogenic AMINO ACIDS.
Cell Line
Established cell cultures that have the potential to propagate indefinitely.
Virus Replication
The process of intracellular viral multiplication, consisting of the synthesis of PROTEINS; NUCLEIC ACIDS; and sometimes LIPIDS, and their assembly into a new infectious particle.
Escherichia coli
A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.
RNA Cleavage
A reaction that severs one of the sugar-phosphate linkages of the phosphodiester backbone of RNA. It is catalyzed enzymatically, chemically, or by radiation. Cleavage may be exonucleolytic, or endonucleolytic.
Mutation
Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.
Oligoribonucleotides
A group of ribonucleotides (up to 12) in which the phosphate residues of each ribonucleotide act as bridges in forming diester linkages between the ribose moieties.
RNA, Heterogeneous Nuclear
Nuclear nonribosomal RNA larger than about 1000 nucleotides, the mass of which is rapidly synthesized and degraded within the cell nucleus. Some heterogeneous nuclear RNA may be a precursor to mRNA. However, the great bulk of total hnRNA hybridizes with nuclear DNA rather than with mRNA.
Transcription, Genetic
The biosynthesis of RNA carried out on a template of DNA. The biosynthesis of DNA from an RNA template is called REVERSE TRANSCRIPTION.
RNA, Small Cytoplasmic
Small RNAs found in the cytoplasm usually complexed with proteins in scRNPs (RIBONUCLEOPROTEINS, SMALL CYTOPLASMIC).
RNA 3' End Processing
The steps that generate the 3' ends of mature RNA molecules. For most mRNAs (RNA, MESSENGER), 3' end processing referred to as POLYADENYLATION includes the addition of POLY A.
Templates, Genetic
Macromolecular molds for the synthesis of complementary macromolecules, as in DNA REPLICATION; GENETIC TRANSCRIPTION of DNA to RNA, and GENETIC TRANSLATION of RNA into POLYPEPTIDES.
RNA, Small Untranslated
Short RNA, about 200 base pairs in length or shorter, that does not code for protein.
HeLa Cells
The first continuously cultured human malignant CELL LINE, derived from the cervical carcinoma of Henrietta Lacks. These cells are used for VIRUS CULTIVATION and antitumor drug screening assays.
Ribonucleoproteins
Complexes of RNA-binding proteins with ribonucleic acids (RNA).
Ribonucleases
Enzymes that catalyze the hydrolysis of ester bonds within RNA. EC 3.1.-.
Poly A
A group of adenine ribonucleotides in which the phosphate residues of each adenine ribonucleotide act as bridges in forming diester linkages between the ribose moieties.
Genome, Viral
The complete genetic complement contained in a DNA or RNA molecule in a virus.
RNA, Ribosomal, 5.8S
Constituent of the 60S subunit of eukaryotic ribosomes. 5.8S rRNA is involved in the initiation of polypeptide synthesis in eukaryotes.
DNA
A deoxyribonucleotide polymer that is the primary genetic material of all cells. Eukaryotic and prokaryotic organisms normally contain DNA in a double-stranded state, yet several important biological processes transiently involve single-stranded regions. DNA, which consists of a polysugar-phosphate backbone possessing projections of purines (adenine and guanine) and pyrimidines (thymine and cytosine), forms a double helix that is held together by hydrogen bonds between these purines and pyrimidines (adenine to thymine and guanine to cytosine).
RNA, Long Noncoding
A class of untranslated RNA molecules that are typically greater than 200 nucleotides in length and do not code for proteins. Members of this class have been found to play roles in transcriptional regulation, post-transcriptional processing, CHROMATIN REMODELING, and in the epigenetic control of chromatin.
RNA, Small Nucleolar
Small nuclear RNAs that are involved in the processing of pre-ribosomal RNA in the nucleolus. Box C/D containing snoRNAs (U14, U15, U16, U20, U21 and U24-U63) direct site-specific methylation of various ribose moieties. Box H/ACA containing snoRNAs (E2, E3, U19, U23, and U64-U72) direct the conversion of specific uridines to pseudouridine. Site-specific cleavages resulting in the mature ribosomal RNAs are directed by snoRNAs U3, U8, U14, U22 and the snoRNA components of RNase MRP and RNase P.
Binding Sites
The parts of a macromolecule that directly participate in its specific combination with another molecule.
RNA Virus Infections
Protein Binding
The process in which substances, either endogenous or exogenous, bind to proteins, peptides, enzymes, protein precursors, or allied compounds. Specific protein-binding measures are often used as assays in diagnostic assessments.
RNA, Complementary
Synthetic transcripts of a specific DNA molecule or fragment, made by an in vitro transcription system. This cRNA can be labeled with radioactive uracil and then used as a probe. (King & Stansfield, A Dictionary of Genetics, 4th ed)
Uridine
Promoter Regions, Genetic
DNA sequences which are recognized (directly or indirectly) and bound by a DNA-dependent RNA polymerase during the initiation of transcription. Highly conserved sequences within the promoter include the Pribnow box in bacteria and the TATA BOX in eukaryotes.
Endoribonucleases
A family of enzymes that catalyze the endonucleolytic cleavage of RNA. It includes EC 3.1.26.-, EC 3.1.27.-, EC 3.1.30.-, and EC 3.1.31.-.
Cell Nucleus
Within a eukaryotic cell, a membrane-limited body which contains chromosomes and one or more nucleoli (CELL NUCLEOLUS). The nuclear membrane consists of a double unit-type membrane which is perforated by a number of pores; the outermost membrane is continuous with the ENDOPLASMIC RETICULUM. A cell may contain more than one nucleus. (From Singleton & Sainsbury, Dictionary of Microbiology and Molecular Biology, 2d ed)
RNA, Chloroplast
Ribonucleic acid in chloroplasts having regulatory and catalytic roles as well as involvement in protein synthesis.
Models, Molecular
Models used experimentally or theoretically to study molecular shape, electronic properties, or interactions; includes analogous molecules, computer-generated graphics, and mechanical structures.
Plasmids
Extrachromosomal, usually CIRCULAR DNA molecules that are self-replicating and transferable from one organism to another. They are found in a variety of bacterial, archaeal, fungal, algal, and plant species. They are used in GENETIC ENGINEERING as CLONING VECTORS.
Reverse Transcriptase Polymerase Chain Reaction
A variation of the PCR technique in which cDNA is made from RNA via reverse transcription. The resultant cDNA is then amplified using standard PCR protocols.
Kinetics
The rate dynamics in chemical or physical systems.
Single-Strand Specific DNA and RNA Endonucleases
Enzymes that catalyze the endonucleolytic cleavage of single-stranded regions of DNA or RNA molecules while leaving the double-stranded regions intact. They are particularly useful in the laboratory for producing "blunt-ended" DNA molecules from DNA with single-stranded ends and for sensitive GENETIC TECHNIQUES such as NUCLEASE PROTECTION ASSAYS that involve the detection of single-stranded DNA and RNA.
Base Pairing
Pairing of purine and pyrimidine bases by HYDROGEN BONDING in double-stranded DNA or RNA.
RNA, Helminth
Ribonucleic acid in helminths having regulatory and catalytic roles as well as involvement in protein synthesis.
Plant Viruses
Viruses parasitic on plants higher than bacteria.
DNA Primers
Short sequences (generally about 10 base pairs) of DNA that are complementary to sequences of messenger RNA and allow reverse transcriptases to start copying the adjacent sequences of mRNA. Primers are used extensively in genetic and molecular biology techniques.
Gene Expression Regulation
Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control (induction or repression) of gene action at the level of transcription or translation.
Saccharomyces cerevisiae
A species of the genus SACCHAROMYCES, family Saccharomycetaceae, order Saccharomycetales, known as "baker's" or "brewer's" yeast. The dried form is used as a dietary supplement.
Transcription Factors
Endogenous substances, usually proteins, which are effective in the initiation, stimulation, or termination of the genetic transcription process.
RNA, Transfer, Phe
A transfer RNA which is specific for carrying phenylalanine to sites on the ribosomes in preparation for protein synthesis.
RNA, Transfer, Lys
A transfer RNA which is specific for carrying lysine to sites on the ribosomes in preparation for protein synthesis.
Ribosomes
Multicomponent ribonucleoprotein structures found in the CYTOPLASM of all cells, and in MITOCHONDRIA, and PLASTIDS. They function in PROTEIN BIOSYNTHESIS via GENETIC TRANSLATION.
Blotting, Northern
Detection of RNA that has been electrophoretically separated and immobilized by blotting on nitrocellulose or other type of paper or nylon membrane followed by hybridization with labeled NUCLEIC ACID PROBES.
DNA, Viral
Deoxyribonucleic acid that makes up the genetic material of viruses.
Polymerase Chain Reaction
In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships.
Oligonucleotides
Polymers made up of a few (2-20) nucleotides. In molecular genetics, they refer to a short sequence synthesized to match a region where a mutation is known to occur, and then used as a probe (OLIGONUCLEOTIDE PROBES). (Dorland, 28th ed)
Gene Silencing
Interruption or suppression of the expression of a gene at transcriptional or translational levels.
5' Untranslated Regions
The sequence at the 5' end of the messenger RNA that does not code for product. This sequence contains the ribosome binding site and other transcription and translation regulating sequences.
RNA, Transfer, Tyr
A transfer RNA which is specific for carrying tyrosine to sites on the ribosomes in preparation for protein synthesis.
Sequence Homology, Nucleic Acid
The sequential correspondence of nucleotides in one nucleic acid molecule with those of another nucleic acid molecule. Sequence homology is an indication of the genetic relatedness of different organisms and gene function.
3' Untranslated Regions
The sequence at the 3' end of messenger RNA that does not code for product. This region contains transcription and translation regulating sequences.
Amanitins
Cyclic peptides extracted from carpophores of various mushroom species. They are potent inhibitors of RNA polymerases in most eukaryotic species, blocking the production of mRNA and protein synthesis. These peptides are important in the study of transcription. Alpha-amanitin is the main toxin from the species Amanitia phalloides, poisonous if ingested by humans or animals.
Genes, Viral
The functional hereditary units of VIRUSES.
Nucleic Acid Denaturation
Disruption of the secondary structure of nucleic acids by heat, extreme pH or chemical treatment. Double strand DNA is "melted" by dissociation of the non-covalent hydrogen bonds and hydrophobic interactions. Denatured DNA appears to be a single-stranded flexible structure. The effects of denaturation on RNA are similar though less pronounced and largely reversible.
Transfection
The uptake of naked or purified DNA by CELLS, usually meaning the process as it occurs in eukaryotic cells. It is analogous to bacterial transformation (TRANSFORMATION, BACTERIAL) and both are routinely employed in GENE TRANSFER TECHNIQUES.
Ribonuclease T1
An enzyme catalyzing the endonucleolytic cleavage of RNA at the 3'-position of a guanylate residue. EC 3.1.27.3.
Molecular Weight
The sum of the weight of all the atoms in a molecule.
Sequence Homology, Amino Acid
The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.
Cell Nucleolus
Within most types of eukaryotic CELL NUCLEUS, a distinct region, not delimited by a membrane, in which some species of rRNA (RNA, RIBOSOMAL) are synthesized and assembled into ribonucleoprotein subunits of ribosomes. In the nucleolus rRNA is transcribed from a nucleolar organizer, i.e., a group of tandemly repeated chromosomal genes which encode rRNA and which are transcribed by RNA polymerase I. (Singleton & Sainsbury, Dictionary of Microbiology & Molecular Biology, 2d ed)
HIV-1
The type species of LENTIVIRUS and the etiologic agent of AIDS. It is characterized by its cytopathic effect and affinity for the T4-lymphocyte.
Cell-Free System
A fractionated cell extract that maintains a biological function. A subcellular fraction isolated by ultracentrifugation or other separation techniques must first be isolated so that a process can be studied free from all of the complex side reactions that occur in a cell. The cell-free system is therefore widely used in cell biology. (From Alberts et al., Molecular Biology of the Cell, 2d ed, p166)
Protein Structure, Tertiary
The level of protein structure in which combinations of secondary protein structures (alpha helices, beta sheets, loop regions, and motifs) pack together to form folded shapes called domains. Disulfide bridges between cysteines in two different parts of the polypeptide chain along with other interactions between the chains play a role in the formation and stabilization of tertiary structure. Small proteins usually consist of only one domain but larger proteins may contain a number of domains connected by segments of polypeptide chain which lack regular secondary structure.
DNA, Complementary
Single-stranded complementary DNA synthesized from an RNA template by the action of RNA-dependent DNA polymerase. cDNA (i.e., complementary DNA, not circular DNA, not C-DNA) is used in a variety of molecular cloning experiments as well as serving as a specific hybridization probe.
Gene Expression Regulation, Viral
Any of the processes by which cytoplasmic factors influence the differential control of gene action in viruses.
Genes
A category of nucleic acid sequences that function as units of heredity and which code for the basic instructions for the development, reproduction, and maintenance of organisms.
Conserved Sequence
A sequence of amino acids in a polypeptide or of nucleotides in DNA or RNA that is similar across multiple species. A known set of conserved sequences is represented by a CONSENSUS SEQUENCE. AMINO ACID MOTIFS are often composed of conserved sequences.
Viral Nonstructural Proteins
Proteins encoded by a VIRAL GENOME that are produced in the organisms they infect, but not packaged into the VIRUS PARTICLES. Some of these proteins may play roles within the infected cell during VIRUS REPLICATION or act in regulation of virus replication or VIRUS ASSEMBLY.
RNA, Transfer, Amino Acyl
Intermediates in protein biosynthesis. The compounds are formed from amino acids, ATP and transfer RNA, a reaction catalyzed by aminoacyl tRNA synthetase. They are key compounds in the genetic translation process.
Gene Expression
The phenotypic manifestation of a gene or genes by the processes of GENETIC TRANSCRIPTION and GENETIC TRANSLATION.
Introns
Sequences of DNA in the genes that are located between the EXONS. They are transcribed along with the exons but are removed from the primary gene transcript by RNA SPLICING to leave mature RNA. Some introns code for separate genes.
RNA Splice Sites
Nucleotide sequences located at the ends of EXONS and recognized in pre-messenger RNA by SPLICEOSOMES. They are joined during the RNA SPLICING reaction, forming the junctions between exons.
RNA, Transfer, Ala
A transfer RNA which is specific for carrying alanine to sites on the ribosomes in preparation for protein synthesis.
Poliovirus
A species of ENTEROVIRUS which is the causal agent of POLIOMYELITIS in humans. Three serotypes (strains) exist. Transmission is by the fecal-oral route, pharyngeal secretions, or mechanical vector (flies). Vaccines with both inactivated and live attenuated virus have proven effective in immunizing against the infection.
Cells, Cultured
Cells propagated in vitro in special media conducive to their growth. Cultured cells are used to study developmental, morphologic, metabolic, physiologic, and genetic processes, among others.
Tobacco
A plant genus of the family SOLANACEAE. Members contain NICOTINE and other biologically active chemicals; its dried leaves are used for SMOKING.
Ribonuclease P
An RNA-containing enzyme that plays an essential role in tRNA processing by catalyzing the endonucleolytic cleavage of TRANSFER RNA precursors. It removes the extra 5'-nucleotides from tRNA precursors to generate mature tRNA molecules.
Centrifugation, Density Gradient
Separation of particles according to density by employing a gradient of varying densities. At equilibrium each particle settles in the gradient at a point equal to its density. (McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)
Cytoplasm
The part of a cell that contains the CYTOSOL and small structures excluding the CELL NUCLEUS; MITOCHONDRIA; and large VACUOLES. (Glick, Glossary of Biochemistry and Molecular Biology, 1990)
Nucleotides
The monomeric units from which DNA or RNA polymers are constructed. They consist of a purine or pyrimidine base, a pentose sugar, and a phosphate group. (From King & Stansfield, A Dictionary of Genetics, 4th ed)
Mosaic Viruses
Viruses which produce a mottled appearance of the leaves of plants.
RNA-Directed DNA Polymerase
An enzyme that synthesizes DNA on an RNA template. It is encoded by the pol gene of retroviruses and by certain retrovirus-like elements. EC 2.7.7.49.
Dactinomycin
A compound composed of a two CYCLIC PEPTIDES attached to a phenoxazine that is derived from STREPTOMYCES parvullus. It binds to DNA and inhibits RNA synthesis (transcription), with chain elongation more sensitive than initiation, termination, or release. As a result of impaired mRNA production, protein synthesis also declines after dactinomycin therapy. (From AMA Drug Evaluations Annual, 1993, p2015)
Open Reading Frames
A sequence of successive nucleotide triplets that are read as CODONS specifying AMINO ACIDS and begin with an INITIATOR CODON and end with a stop codon (CODON, TERMINATOR).
Gene Expression Profiling
The determination of the pattern of genes expressed at the level of GENETIC TRANSCRIPTION, under specific circumstances or in a specific cell.
Hepacivirus
A genus of FLAVIVIRIDAE causing parenterally-transmitted HEPATITIS C which is associated with transfusions and drug abuse. Hepatitis C virus is the type species.
Electrophoresis, Polyacrylamide Gel
Electrophoresis in which a polyacrylamide gel is used as the diffusion medium.
RNA, Transfer, Asp
A transfer RNA which is specific for carrying aspartic acid to sites on the ribosomes in preparation for protein synthesis.
Tritium
RNA, Transfer, Met
A transfer RNA which is specific for carrying methionine to sites on the ribosomes. During initiation of protein synthesis, tRNA(f)Met in prokaryotic cells and tRNA(i)Met in eukaryotic cells binds to the start codon (CODON, INITIATOR).
Phylogeny
The relationships of groups of organisms as reflected by their genetic makeup.
Bromovirus
A genus of tripartite plant viruses in the family BROMOVIRIDAE. Transmission is by beetles. Brome mosaic virus is the type species.
Recombinant Proteins
Proteins prepared by recombinant DNA technology.
Substrate Specificity
A characteristic feature of enzyme activity in relation to the kind of substrate on which the enzyme or catalytic molecule reacts.
Ribonuclease H
A ribonuclease that specifically cleaves the RNA moiety of RNA:DNA hybrids. It has been isolated from a wide variety of prokaryotic and eukaryotic organisms as well as RETROVIRUSES.
Nuclear Proteins
Proteins found in the nucleus of a cell. Do not confuse with NUCLEOPROTEINS which are proteins conjugated with nucleic acids, that are not necessarily present in the nucleus.
Models, Genetic
Theoretical representations that simulate the behavior or activity of genetic processes or phenomena. They include the use of mathematical equations, computers, and other electronic equipment.
Regulatory Sequences, Ribonucleic Acid
Sequences within RNA that regulate the processing, stability (RNA STABILITY) or translation (TRANSLATION, GENETIC) of RNA.
Polyribosomes
A multiribosomal structure representing a linear array of RIBOSOMES held together by messenger RNA; (RNA, MESSENGER); They represent the active complexes in cellular protein synthesis and are able to incorporate amino acids into polypeptides both in vivo and in vitro. (From Rieger et al., Glossary of Genetics: Classical and Molecular, 5th ed)
Cell Line, Tumor
A cell line derived from cultured tumor cells.
Capsid
The outer protein protective shell of a virus, which protects the viral nucleic acid.
Exoribonucleases
A family of enzymes that catalyze the exonucleolytic cleavage of RNA. It includes EC 3.1.13.-, EC 3.1.14.-, EC 3.1.15.-, and EC 3.1.16.-. EC 3.1.-
Temperature
The property of objects that determines the direction of heat flow when they are placed in direct thermal contact. The temperature is the energy of microscopic motions (vibrational and translational) of the particles of atoms.
Bacterial Proteins
Proteins found in any species of bacterium.
Restriction Mapping
Use of restriction endonucleases to analyze and generate a physical map of genomes, genes, or other segments of DNA.
RNA, Transfer, Gly
A transfer RNA which is specific for carrying glycine to sites on the ribosomes in preparation for protein synthesis.
RNA, Transfer, His
A transfer RNA which is specific for carrying histidine to sites on the ribosomes in preparation for protein synthesis.
Saccharomyces cerevisiae Proteins
Proteins obtained from the species SACCHAROMYCES CEREVISIAE. The function of specific proteins from this organism are the subject of intense scientific interest and have been used to derive basic understanding of the functioning similar proteins in higher eukaryotes.
RNA, Transfer, Val
A transfer RNA which is specific for carrying valine to sites on the ribosomes in preparation for protein synthesis.
Poly U
A group of uridine ribonucleotides in which the phosphate residues of each uridine ribonucleotide act as bridges in forming diester linkages between the ribose moieties.
Nodaviridae
A family of RNA viruses infecting insects and fish. There are two genera: Alphanodavirus and Betanodavirus.
Nucleic Acid Precursors
Use for nucleic acid precursors in general or for which there is no specific heading.
Virus Assembly
The assembly of VIRAL STRUCTURAL PROTEINS and nucleic acid (VIRAL DNA or VIRAL RNA) to form a VIRUS PARTICLE.
Defective Viruses
Viruses which lack a complete genome so that they cannot completely replicate or cannot form a protein coat. Some are host-dependent defectives, meaning they can replicate only in cell systems which provide the particular genetic function which they lack. Others, called SATELLITE VIRUSES, are able to replicate only when their genetic defect is complemented by a helper virus.
Sequence Deletion
Deletion of sequences of nucleic acids from the genetic material of an individual.
RNA, Transfer, Arg
A transfer RNA which is specific for carrying arginine to sites on the ribosomes in preparation for protein synthesis.
RNA, Algal
Ribonucleic acid in algae having regulatory and catalytic roles as well as involvement in protein synthesis.
Sequence Analysis, DNA
A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.
Heterogeneous-Nuclear Ribonucleoproteins
A family of ribonucleoproteins that were originally found as proteins bound to nascent RNA transcripts in the form of ribonucleoprotein particles. Although considered ribonucleoproteins they are primarily classified by their protein component. They are involved in a variety of processes such as packaging of RNA and RNA TRANSPORT within the nucleus. A subset of heterogeneous-nuclear ribonucleoproteins are involved in additional functions such as nucleocytoplasmic transport (ACTIVE TRANSPORT, CELL NUCLEUS) of RNA and mRNA stability in the CYTOPLASM.
Escherichia coli Proteins
Proteins obtained from ESCHERICHIA COLI.
Species Specificity
The restriction of a characteristic behavior, anatomical structure or physical system, such as immune response; metabolic response, or gene or gene variant to the members of one species. It refers to that property which differentiates one species from another but it is also used for phylogenetic levels higher or lower than the species.
Alternative Splicing
A process whereby multiple RNA transcripts are generated from a single gene. Alternative splicing involves the splicing together of other possible sets of EXONS during the processing of some, but not all, transcripts of the gene. Thus a particular exon may be connected to any one of several alternative exons to form a mature RNA. The alternative forms of mature MESSENGER RNA produce PROTEIN ISOFORMS in which one part of the isoforms is common while the other parts are different.
Virion
The infective system of a virus, composed of the viral genome, a protein core, and a protein coat called a capsid, which may be naked or enclosed in a lipoprotein envelope called the peplos.
Ribonucleoproteins, Small Nuclear
Highly conserved nuclear RNA-protein complexes that function in RNA processing in the nucleus, including pre-mRNA splicing and pre-mRNA 3'-end processing in the nucleoplasm, and pre-rRNA processing in the nucleolus (see RIBONUCLEOPROTEINS, SMALL NUCLEOLAR).
Hepatitis Delta Virus
A defective virus, containing particles of RNA nucleoprotein in virion-like form, present in patients with acute hepatitis B and chronic hepatitis. It requires the presence of a hepadnavirus for full replication. This is the lone species in the genus Deltavirus.
Ribosomal Proteins
Proteins found in ribosomes. They are believed to have a catalytic function in reconstituting biologically active ribosomal subunits.
RNA, Transfer, Trp
A transfer RNA which is specific for carrying tryptophan to sites on the ribosomes in preparation for protein synthesis.
Oligonucleotide Array Sequence Analysis
Hybridization of a nucleic acid sample to a very large set of OLIGONUCLEOTIDE PROBES, which have been attached individually in columns and rows to a solid support, to determine a BASE SEQUENCE, or to detect variations in a gene sequence, GENE EXPRESSION, or for GENE MAPPING.
Terminator Regions, Genetic
DNA sequences recognized as signals to end GENETIC TRANSCRIPTION.
Recombinant Fusion Proteins
Recombinant proteins produced by the GENETIC TRANSLATION of fused genes formed by the combination of NUCLEIC ACID REGULATORY SEQUENCES of one or more genes with the protein coding sequences of one or more genes.
Macromolecular Substances
Compounds and molecular complexes that consist of very large numbers of atoms and are generally over 500 kDa in size. In biological systems macromolecular substances usually can be visualized using ELECTRON MICROSCOPY and are distinguished from ORGANELLES by the lack of a membrane structure.
Plants
Multicellular, eukaryotic life forms of kingdom Plantae (sensu lato), comprising the VIRIDIPLANTAE; RHODOPHYTA; and GLAUCOPHYTA; all of which acquired chloroplasts by direct endosymbiosis of CYANOBACTERIA. They are characterized by a mainly photosynthetic mode of nutrition; essentially unlimited growth at localized regions of cell divisions (MERISTEMS); cellulose within cells providing rigidity; the absence of organs of locomotion; absence of nervous and sensory systems; and an alternation of haploid and diploid generations.
Time Factors
Elements of limited time intervals, contributing to particular results or situations.
Mutagenesis, Site-Directed
Genetically engineered MUTAGENESIS at a specific site in the DNA molecule that introduces a base substitution, or an insertion or deletion.
Mutagenesis
Process of generating a genetic MUTATION. It may occur spontaneously or be induced by MUTAGENS.
Levivirus
A bacteriophage genus of the family LEVIVIRIDAE, whose viruses contain the short version of the genome and have a separate gene for cell lysis.
Blotting, Western
Identification of proteins or peptides that have been electrophoretically separated by blot transferring from the electrophoresis gel to strips of nitrocellulose paper, followed by labeling with antibody probes.
Polynucleotides
Trypanosoma brucei brucei
A hemoflagellate subspecies of parasitic protozoa that causes nagana in domestic and game animals in Africa. It apparently does not infect humans. It is transmitted by bites of tsetse flies (Glossina).
DNA Restriction Enzymes
Enzymes that are part of the restriction-modification systems. They catalyze the endonucleolytic cleavage of DNA sequences which lack the species-specific methylation pattern in the host cell's DNA. Cleavage yields random or specific double-stranded fragments with terminal 5'-phosphates. The function of restriction enzymes is to destroy any foreign DNA that invades the host cell. Most have been studied in bacterial systems, but a few have been found in eukaryotic organisms. They are also used as tools for the systematic dissection and mapping of chromosomes, in the determination of base sequences of DNAs, and have made it possible to splice and recombine genes from one organism into the genome of another. EC 3.21.1.
Models, Biological
Theoretical representations that simulate the behavior or activity of biological processes or diseases. For disease models in living animals, DISEASE MODELS, ANIMAL is available. Biological models include the use of mathematical equations, computers, and other electronic equipment.
Exons
The parts of a transcript of a split GENE remaining after the INTRONS are removed. They are spliced together to become a MESSENGER RNA or other functional RNA.
Gene Expression Regulation, Bacterial
Any of the processes by which cytoplasmic or intercellular factors influence the differential control of gene action in bacteria.
Tombusvirus
A genus of plant viruses that infects ANGIOSPERMS. Transmission occurs mechanically and through soil, with one species transmitted via a fungal vector. The type species is Tomato bushy stunt virus.
Guanosine
A purine nucleoside that has guanine linked by its N9 nitrogen to the C1 carbon of ribose. It is a component of ribonucleic acid and its nucleotides play important roles in metabolism. (From Dorland, 28th ed)
Polyadenylation
The addition of a tail of polyadenylic acid (POLY A) to the 3' end of mRNA (RNA, MESSENGER). Polyadenylation involves recognizing the processing site signal, (AAUAAA), and cleaving of the mRNA to create a 3' OH terminal end to which poly A polymerase (POLYNUCLEOTIDE ADENYLYLTRANSFERASE) adds 60-200 adenylate residues. The 3' end processing of some messenger RNAs, such as histone mRNA, is carried out by a different process that does not include the addition of poly A as described here.
RNA, Transfer, Leu
A transfer RNA which is specific for carrying leucine to sites on the ribosomes in preparation for protein synthesis.
Phenotype
The outward appearance of the individual. It is the product of interactions between genes, and between the GENOTYPE and the environment.
Structure-Activity Relationship
The relationship between the chemical structure of a compound and its biological or pharmacological activity. Compounds are often classed together because they have structural characteristics in common including shape, size, stereochemical arrangement, and distribution of functional groups.
Methylation
Addition of methyl groups. In histo-chemistry methylation is used to esterify carboxyl groups and remove sulfate groups by treating tissue sections with hot methanol in the presence of hydrochloric acid. (From Stedman, 25th ed)

Absence of RNASE III alters the pathway by which RNAI, the antisense inhibitor of ColE1 replication, decays. (1/22353)

RNAI is a short RNA, 108 nt in length, which regulates the replication of the plasmid ColE1. RNAI turns over rapidly, enabling plasmid replication rate to respond quickly to changes in plasmid copy number. Because RNAI is produced in abundance, is easily extracted and turns over quickly, it has been used as a model for mRNA in studying RNA decay pathways. The enzymes polynucleotide phosphorylase, poly(A) polymerase and RNase E have been demonstrated to have roles in both messenger and RNAI decay; it is reported here that these enzymes can work independently of one another to facilitate RNAI decay. The roles in RNAI decay of two further enzymes which facilitate mRNA decay, the exonuclease RNase II and the endonuclease RNase III, are also examined. RNase II does not appear to accelerate RNAI decay but it is found that, in the absence of RNase III, polyadenylated RNAI, unprocessed by RNase E, accumulates. It is also shown that RNase III can cut RNAI near nt 82 or 98 in vitro. An RNAI fragment corresponding to the longer of these can be found in extracts of an mc+ pcnB strain (which produces RNase III) but not of an rnc pcnB strain, suggesting that RNAI may be a substrate for RNase III in vivo. A possible pathway for the early steps in RNAI decay which incorporates this information is suggested.  (+info)

The CafA protein required for the 5'-maturation of 16 S rRNA is a 5'-end-dependent ribonuclease that has context-dependent broad sequence specificity. (2/22353)

The CafA protein, which was initially described as having a role in either Escherichia coli cell division or chromosomal segregation, has recently been shown to be required for the maturation of the 5'-end of 16 S rRNA. The sequence of CafA is similar to that of the N-terminal ribonucleolytic half of RNase E, an essential E. coli enzyme that has a central role in the processing of rRNA and the decay of mRNA and RNAI, the antisense regulator of ColE1-type plasmids. We show here that a highly purified preparation of CafA is sufficient in vitro for RNA cutting. We detected CafA cleavage of RNAI and a structured region from the 5'-untranslated region of ompA mRNA within segments cleavable by RNaseE, but not CafA cleavage of 9 S RNA at its "a" RNase E site. The latter is consistent with the finding that the generation of 5 S rRNA from its 9 S precursor can be blocked by inactivation of RNase E in cells that are wild type for CafA. Interestingly, however, a decanucleotide corresponding in sequence to the a site of 9 S RNA was cut efficiently indicating that cleavage by CafA is regulated by the context of sites within structured RNAs. Consistent with this notion is our finding that although 23 S rRNA is stable in vivo, a segment from this RNA is cut efficient by CafA at multiple sites in vitro. We also show that, like RNase E cleavage, the efficiency of cleavage by CafA is dependent on the presence of a monophosphate group on the 5'-end of the RNA. This finding raises the possibility that the context dependence of cleavage by CafA may be due at least in part to the separation of a cleavable sequence from the 5'-end of an RNA. Comparison of the sites surrounding points of CafA cleavage suggests that this enzyme has broad sequence specificity. Together with the knowledge that CafA can cut RNAI and ompA mRNA in vitro within segments whose cleavage in vivo initiates the decay of these RNAs, this finding suggests that CafA may contribute at some point during the decay of many RNAs in E. coli.  (+info)

RNAi: double-stranded RNA directs the ATP-dependent cleavage of mRNA at 21 to 23 nucleotide intervals. (3/22353)

Double-stranded RNA (dsRNA) directs the sequence-specific degradation of mRNA through a process known as RNA interference (RNAi). Using a recently developed Drosophila in vitro system, we examined the molecular mechanism underlying RNAi. We find that RNAi is ATP dependent yet uncoupled from mRNA translation. During the RNAi reaction, both strands of the dsRNA are processed to RNA segments 21-23 nucleotides in length. Processing of the dsRNA to the small RNA fragments does not require the targeted mRNA. The mRNA is cleaved only within the region of identity with the dsRNA. Cleavage occurs at sites 21-23 nucleotides apart, the same interval observed for the dsRNA itself, suggesting that the 21-23 nucleotide fragments from the dsRNA are guiding mRNA cleavage.  (+info)

Caenorhabditis elegans beta-G spectrin is dispensable for establishment of epithelial polarity, but essential for muscular and neuronal function. (4/22353)

The Caenorhabditis elegans genome encodes one alpha spectrin subunit, a beta spectrin subunit (beta-G), and a beta-H spectrin subunit. Our experiments show that the phenotype resulting from the loss of the C. elegans alpha spectrin is reproduced by tandem depletion of both beta-G and beta-H spectrins. We propose that alpha spectrin combines with the beta-G and beta-H subunits to form alpha/beta-G and alpha/beta-H heteromers that perform the entire repertoire of spectrin function in the nematode. The expression patterns of nematode beta-G spectrin and vertebrate beta spectrins exhibit three striking parallels including: (1) beta spectrins are associated with the sites of cell-cell contact in epithelial tissues; (2) the highest levels of beta-G spectrin occur in the nervous system; and (3) beta spectrin-G in striated muscle is associated with points of attachment of the myofilament apparatus to adjacent cells. Nematode beta-G spectrin associates with plasma membranes at sites of cell-cell contact, beginning at the two-cell stage, and with a dramatic increase in intensity after gastrulation when most cell proliferation has been completed. Strikingly, depletion of nematode beta-G spectrin by RNA-mediated interference to undetectable levels does not affect the establishment of structural and functional polarity in epidermis and intestine. Contrary to recent speculation, beta-G spectrin is not associated with internal membranes and depletion of beta-G spectrin was not associated with any detectable defects in secretion. Instead beta-G spectrin-deficient nematodes arrest as early larvae with progressive defects in the musculature and nervous system. Therefore, C. elegans beta-G spectrin is required for normal muscle and neuron function, but is dispensable for embryonic elongation and establishment of early epithelial polarity. We hypothesize that heteromeric spectrin evolved in metazoans in response to the needs of cells in the context of mechanically integrated tissues that can withstand the rigors imposed by an active organism.  (+info)

Flagellum ontogeny in trypanosomes studied via an inherited and regulated RNA interference system. (5/22353)

The African trypanosome, Trypanosoma brucei possesses a large and unique intraflagellar structure called the paraflagellar rod (PFR). The PFR is composed of 2 major proteins, PFRA and PFRC. We have generated an inducible mutant trypanosome cell line (snl-2) that expresses linked inverted copies of a PFRA gene, capable of forming a PFRA double-stranded (ds) RNA. When expression of this dsRNA was induced, new PFRA RNA and PFRA protein quickly disappeared and PFR construction was affected, resulting in cell paralysis. This inducible RNA interference (RNAi) effect was fast-acting, heritable and reversible. It allowed us to demonstrate that PFR proteins are able to enter both mature and growing flagella but appear to concentrate differentially in new flagella because of the construction process. The PFR is constructed by a polar assembly process at the distal end of the flagellum resulting in a stable cytoskeletal structure with low turn-over. The inducible RNAi approach will have widespread applicability in studies of gene function and cellular processes in parasites.  (+info)

Mitotic phosphorylation of histone H3 is governed by Ipl1/aurora kinase and Glc7/PP1 phosphatase in budding yeast and nematodes. (6/22353)

Phosphorylation of histone H3 at serine 10 occurs during mitosis and meiosis in a wide range of eukaryotes and has been shown to be required for proper chromosome transmission in Tetrahymena. Here we report that Ipl1/aurora kinase and its genetically interacting phosphatase, Glc7/PP1, are responsible for the balance of H3 phosphorylation during mitosis in Saccharomyces cerevisiae and Caenorhabditis elegans. In these models, both enzymes are required for H3 phosphorylation and chromosome segregation, although a causal link between the two processes has not been demonstrated. Deregulation of human aurora kinases has been implicated in oncogenesis as a consequence of chromosome missegregation. Our findings reveal an enzyme system that regulates chromosome dynamics and controls histone phosphorylation that is conserved among diverse eukaryotes.  (+info)

Double-stranded RNA injection produces nonspecific defects in zebrafish. (7/22353)

We have investigated the ability of dsRNA to inhibit gene functions in zebrafish using sequences targeted to the maternal gene pouII-1, the transgene GFP, and an intron of the zebrafish gene terra. We found that embryos injected with all of these dsRNAs at approximately 7.5 pg/embryo or higher had general growth arrest during gastrulation and displayed various nonspecific defects at 24 h postfertilization, although embryonic development was unaffected before the midblastula stage. Reducing dsRNA concentration could alleviate the global defects. Injection of GFP dsRNA (7.5-30 pg/embryo) did not inhibit GFP expression in transgenic fish, although abnormal embryos were induced. Co-injection of GFP mRNA with either GFP or non-GFP dsRNA caused reduction of GFP expression. Whole-mount in situ hybridization clearly showed that embryos injected with dsRNA degraded co-injected and endogenous mRNA without sequence specificity, indicating that dsRNA has a nonspecific effect at the posttranscriptional level. It appears that RNAi is not a viable technique for studying gene function in zebrafish embryos.  (+info)

Drosophila mitochondrial transcription factor A (d-TFAM) is dispensable for the transcription of mitochondrial DNA in Kc167 cells. (8/22353)

We have cloned cDNA encoding Drosophila mitochondrial (mt) transcription factor A (d-TFAM). RNA interference (RNAi) of d-TFAM by lipofection of haemocyte-derived Kc167 cells with double-stranded RNA reduced d-TFAM to less than 5% of the normal level. Reflecting the ability of TFAM to stabilize mtDNA, RNAi of d-TFAM reduced mtDNA to 40%. Nonetheless, transcription of the ND2 and ND5 genes and their mRNAs remained unchanged for 8 days of the duration of RNAi. We thus show that d-TFAM is not essential for the transcription of Drosophila mtDNA.  (+info)

Bio-inspired pulmonary surfactant-modified nanogels: a promising siRNA delivery systemBio-inspired pulmonary surfactant-modified nanogels: a promising siRNA delivery system
article{5993109, author = {De Backer, Lynn and Braeckmans, Kevin and Stuart, Marc CA and Demeester, Jo and De Smedt, Stefaan and Raemdonck, Koen}, issn = {0168-3659}, journal = {JOURNAL OF CONTROLLED RELEASE}, keyword = {DRUG-DELIVERY,EXOGENOUS SURFACTANT,LUNG,THERAPEUTICS,THERAPIES,SMALL-INTERFERING RNA,LOADED DEXTRAN NANOGELS,POLYMER HYBRID NANOPARTICLES,Targeted delivery,Pulmonary surfactant,siRNA delivery,Lung,Hybrid nanoparticles,Dextran nanogels,PLATFORM,CARRIERS}, language = {eng}, pages = {177--186}, title = {Bio-inspired pulmonary surfactant-modified nanogels: a promising siRNA delivery system}, url = {http://dx.doi.org/10.1016/j.jconrel.2015.03.015}, volume = {206}, year = {2015 ...
https://biblio.ugent.be/publication/5993109
Potent RNAi by short RNA triggers by Chia-ying Chu and Tariq M. RanaPotent RNAi by short RNA triggers by Chia-ying Chu and Tariq M. Rana
RNA interference (RNAi) is a gene-silencing mechanism by which a ribonucleoprotein complex, the RNA-induced silencing complex (RISC) and a double-stranded (ds) short-interfering RNA (siRNA), targets a complementary mRNA for site-specific cleavage and subsequent degradation. While longer dsRNA are endogenously processed into 21- to 24-nucleotide (nt) siRNAs or miRNAs to induce gene silencing, RNAi studies in human cells typically use synthetic 19- to 20-nt siRNA duplexes with 2-nt overhangs at the 3-end of both strands. Here, we report that systematic synthesis and analysis of siRNAs with deletions at the passenger and/or guide strand revealed a short RNAi trigger, 16-nt siRNA, which induces potent RNAi in human cells. Our results indicate that the minimal requirement for dsRNA to trigger RNAi is an approximately 42 A A-form helix with approximately 1.5 helical turns. The 16-nt siRNA more effectively knocked down mRNA and protein levels than 19-nt siRNA when targeting the endogenous CDK9 gene,
https://escholarship.umassmed.edu/oapubs/1921/
Genome-Wide siRNA Screen Identifies Complementary Signaling Pathways Involved in Listeria Infection and Reveals Different Actin...Genome-Wide siRNA Screen Identifies Complementary Signaling Pathways Involved in Listeria Infection and Reveals Different Actin...
Genomic siRNA Libraries as Tools for Pseudo-Genetics | SBIR.govGenomic siRNA Libraries as Tools for Pseudo-Genetics | SBIR.gov
DESCRIPTION (provided by applicant): The proposed research will enable mammalian cells to be used in mutation/selection experiments to identify genes involved in cellular processes. The objective of the proposal is to develop procedures for preparing siRNA libraries using genomic DNA and cDNA samples as the source material for siRNA templates. Libraries of siRNA vectors could comprise 1,000,000,000 to 1,000,000,000,000 unique siRNA expression vectors, making it possible to cover entire mammalian genomes with overlapping siRNAs. Mammalian cell populations transfected or transduced with siRNA vector libraries will be placed under selection to create cell populations expressing a desirable phenotype. The siRNA vector(s) integrated in the genomes of the selected cells will be amplified, cloned, and sequenced to reveal the siRNA template sequence. The siRNA sequences will be used to identify the genes whose down-regulation create the phenotype that was selected. The siRNA vector libraries should ...
https://www.sbir.gov/sbirsearch/detail/86813
Multivalent dendritic polyglycerolamine with arginine and histidine end groups for efficient siRNA transfection •...Multivalent dendritic polyglycerolamine with arginine and histidine end groups for efficient siRNA transfection •...
The success of siRNA-based therapeutics highly depends on a safe and efficient delivery of siRNA into the cytosol. In this study, we post-modified the primary amines on dendritic polyglycerolamine (dPG-NH2) with different ratios of two relevant amino acids, namely, arginine (Arg) and histidine (His). To investigate the effects from introducing Arg and His to dPG, the resulting polyplexes of amino acid functionalized dPG-NH2s (AAdPGs)/siRNA were evaluated regarding cytotoxicity, transfection efficiency, and cellular uptake. Among AAdPGs, an optimal vector with (1:3) Arg to His ratio, showed efficient siRNA transfection with minimal cytotoxicity (cell viability ≥ 90%) in NIH 3T3 cells line. We also demonstrated that the cytotoxicity of dPG-NH2 decreased as a result of amino acid functionalization. While the incorporation of both cationic (Arg) and pH-responsive residues (His) are important for safe and efficient siRNA transfection, this study indicates that AAdPGs containing higher degrees of ...
http://www.sfb765.de/publikationen/a06030/index.html
Short hairpin RNA-mediated gene silencing<...Short hairpin RNA-mediated gene silencing<...
TY - CHAP. T1 - Short hairpin RNA-mediated gene silencing. AU - Lambeth, Luke S. AU - Smith, Craig A.. PY - 2013. Y1 - 2013. N2 - Since thefirst application of RNA interference (RNAi) in mammalian cells, the expression of short hairpin RNAs (shRNAs) for targeted gene silencing has become a benchmark technology. Using plasmid and viral vectoring systems, the transcription of shRNA precursors that are effectively processed by the RNAi pathway can lead to potent gene knockdown. The past decade has seen continual advancement and improvement to the various strategies that can be used for shRNA delivery, and the use of shRNAs for clinical applications is well underway. Driving these developments has been the many benefits afforded by shRNA technologies, including the stable integration of expression constructs for long-term expression, infection of difficultto-target cell lines and tissues using viral vectors, and the temporal control of shRNA transcription by inducible promoters. The use of different ...
https://research.monash.edu/en/publications/short-hairpin-rna-mediated-gene-silencing-2
The time course of lipophilic siRNA accumulation in KB- | Open-iThe time course of lipophilic siRNA accumulation in KB- | Open-i
The time course of lipophilic siRNA accumulation in KB-8-5 cells. The incubation time after carrier-free transfection of cholesterol-conjugated siMDR with hexyl
https://openi.nlm.nih.gov/detailedresult.php?img=PMC3299988_gkr1002f3&req=4
MISSION™ shRNA Library: Next Generation RNA Interference | China-Mainland | Sigma-AldrichMISSION™ shRNA Library: Next Generation RNA Interference | China-Mainland | Sigma-Aldrich
As the portfolio of RNAi methods continues to expand, options become available for even the most complex systems being studied. Until recently, synthetic siRNA was the RNAi vehicle most broadly applicable to a wide variety of systems and applications. With commercial suppliers designing and producing synthetic siRNAs, little manipulation is required for the consumer. This format is amenable to any scale of research being performed provided the system is easily transfected (e.g., standard transformed cell lines). However, obstacles for using synthetic siRNAs include being a non-renewable resource, the transient nature of silencing, and the difficulty faced in transfecting primary cells and non-dividing cell lines such as neurons, lymphocytes, and macrophages. In addition, in vivo knockdown studies are particularly cumbersome.. For those facing the above hurdles, DNA vector-based shRNA methods provide the necessary solutions. shRNA expression vectors may be propagated in Escherichia coli and, ...
https://www.sigmaaldrich.com/china-mainland/zh/technical-documents/articles/life-science-innovations/mission-shrna-library0.html
ASSA13-10-16 The Role of Endoplasmic Reticulum Stress in The Injury Induced by Bim of Hypoxic Cardiomyocytes | HeartASSA13-10-16 The Role of Endoplasmic Reticulum Stress in The Injury Induced by Bim of Hypoxic Cardiomyocytes | Heart
Results Green fluorescence was observed in the cells transfected of negative control siRNA group though the fluorescence microscope. Compared with the blank control group, The MTT assay determined that the survival rate of H9C2 was decreased (p , 0.05) after the injured by hypoxia. And the results of flow cytometry showed that hypoxia increased cell apoptosis rate (P , 0.01) and the concentration of calcium (p , 0.01), while the transfection of Bim-siRNA reduced the effects caused by hypoxia (P , 0.05 or P , 0.01). Compared with the hypoxia group, the transfection of Bim-siRNA increased the cell survival rate, decreased cell apoptosis rate and the concentration of calcium (p , 0.01 or p , 0.05). While there was no significant difference among Hypoxia Group, Hypoxia + Negative Control siRNA Group and Hypoxia + Mock control Group (p , 0.05). The results of Western blotting showed that the transfection of Bim-siRNA reduced the expression of Bim obviously (p , 0.01); meanwhile, reduced the ...
http://heart.bmj.com/content/99/Suppl_1/A47.1
RNAi Therapeutics: 2 Short Stories: An siRNA Delivery Paper by Merck, Pharmaceutical Interest in Silences Gene TargetRNAi Therapeutics: 2 Short Stories: An siRNA Delivery Paper by Merck, Pharmaceutical Interest in Silences Gene Target
The most enjoyable part in following RNAi Therapeutics is to look at the rich stream of scientific data and determine the absolute maturity and competitive position of the technologies and companies involved, as well as getting a glimpse at relationship dynamics. I therefore thought to share today two examples of this that I picked up recently. One is a paper by Sirna Therapeutics/Merck shedding some light on their approach towards RNAi pharmacology and RNAi trigger design. The other is some intriguing evidence that Silence Therapeutics most important gene target, PKN3, is gaining traction in the pharmaceutical space. Studying the pharmacology of siRNA delivery. Pei and colleagues from Merck published in RNA a nice paper on better understanding the pharmacology of siRNA delivery [Pei et al. (2010). Quantitative evaluation of siRNA delivery in vivo]. Unlike small molecules or even antibodies, the pharmacology of RNAi Therapeutics is more complex as simply measuring the raw tissue abundance of an ...
http://rnaitherapeutics.blogspot.com/2010/10/2-short-stories-sirna-delivery-paper-by.html
Discovery of Next-Generation siRNA Delivery Systems Through Rational Design of Novel Cationic Lipids | UBC ChemistryDiscovery of Next-Generation siRNA Delivery Systems Through Rational Design of Novel Cationic Lipids | UBC Chemistry
Semple, SC, Akinc, A, Sandhu, A, Mui, B, Chow, C, Sah, D, Stebbing, D, Crosley, E, Hafez, I, Dorkin, JR, Qin, J, Lam, K, Wong, K, Nechev, L, Eisenhardt, ML, Jayaraman, M, Kazem, M, Maier, M, Srinivasulu, M, Weinstein, M, Chen, Q, Alvarez, R, Barros, S, Klimuk, SK, Borland, T, Kosovrasti, V, Tam, Y, MacLachlan, I, Manoharan, M, Ciufolini, MA, Tracy, M, de Fougerolles, A, Cullis, PR, Madden, TD, Hope, ...
http://www.chem.ubc.ca/discovery-next-generation-sirna-delivery-systems-through-rational-design-novel-cationic-lipids
mTOR and Rictor mediate cell migration.A: siRNA-induced | Open-imTOR and Rictor mediate cell migration.A: siRNA-induced | Open-i
mTOR and Rictor mediate cell migration.A: siRNA-induced mTOR depletion inhibits Tsc2−/− MEF migration. Tsc2−/− MEFs were transfected with siRNA mTOR or
https://openi.nlm.nih.gov/detailedresult.php?img=PMC4216017_pone.0111476.g008&req=4
VIRsiRNApred: a web server for predicting inhibition efficacy of siRNAs targeting human viruses | Journal of Translational...VIRsiRNApred: a web server for predicting inhibition efficacy of siRNAs targeting human viruses | Journal of Translational...
Researchers working in the field of siRNA based therapeutics for viruses have generated a vast amount of data over the years. However, bioinformatics resources in the field were lacking and there was no viral siRNA efficacy prediction method available. In this direction, we have recently developed a comprehensive viral siRNA database VIRsiRNAdb [48] and another HIVsirDB [49] exclusively for HIV. Now we have developed VIRsiRNApred -a viral siRNA efficacy prediction algorithm.. Although many mammalian siRNA prediction algorithms have been developed in the past [33], these methods either classify a siRNA as effective/non-effective [29] or predict the inhibition efficacy of a siRNA [31, 32]. However, there is limited success in predicting siRNA efficacy due to limited size and diversity of available siRNA datasets [50].. Mammalian siRNA efficacy prediction methods were initially developed using siRNA tested under heterogeneous experimental conditions like Saetrom (581 siRNA), Shabalina (653 ...
https://translational-medicine.biomedcentral.com/articles/10.1186/1479-5876-11-305
Sirnaomics Receives Two SBIR Grants from NIH for Developing siRNA Therapeutics to TreatSirnaomics Receives Two SBIR Grants from NIH for Developing siRNA Therapeutics to Treat
GAITHERSBURG, Md., June 29 /PRNewswire/ -- Sirnaomics Receives Two SBIR Grants from NIH for Developing siRNA Therapeutics to Treat Glioblastoma and...
https://www.prnewswire.com/news-releases/sirnaomics-receives-two-sbir-grants-from-nih-for-developing-sirna-therapeutics-to-treat-glioblastoma-and-influenza-infection-97388394.html
Research programme: siRNA therapeutics - Suzhou Ribo Life Sciences - AdisInsightResearch programme: siRNA therapeutics - Suzhou Ribo Life Sciences - AdisInsight
Suzhou Ribo Life Sciences is developing siRNA therapeutics for a range of diseases of high unmet need in China, including liver fibrosis, HIV, liver and
http://adisinsight.springer.com/drugs/800046699?error=cookies_not_supported&code=c8f6b67d-0859-4897-8434-3ef45c487fda
Which controls can I choose for FlexiPlate siRNA? - QIAGENWhich controls can I choose for FlexiPlate siRNA? - QIAGEN
You can add the following controls to your FlexiPlate siRNA plate: AllStars Negative Control siRNA, AllStars Cell Death Control siRNA, Negative Control siRNA, Human GAPDH siRNA, Human Beta-Actin siRNA, Human and mouse MAPK1 siRNA, Human or mouse Lamin A/C siRNA, Mouse AKT1 siRNA, or other siRNAs from GeneGlobe, such as HP Validated siRNAs. ...
https://www.qiagen.com/bd/resources/faq?id=2dbcdb4d-5f8d-4bc3-9352-1eee81a9b4f1&lang=en
Unique functionality of 22-nt miRNAs in triggering RDR6-dependent siRNA biogenesis from target transcripts in ArabidopsisUnique functionality of 22-nt miRNAs in triggering RDR6-dependent siRNA biogenesis from target transcripts in Arabidopsis
RNA interference pathways can involve amplification of secondary siRNAs by RNA-dependent RNA polymerases. In plants, RDR6-dependent secondary siRNAs arise from transcripts targeted by some microRNAs (miRNAs). Here, Arabidopsis thaliana secondary siRNAs from mRNA as well as trans-acting siRNAs are sh …
https://pubmed.ncbi.nlm.nih.gov/20562854/
One siRNA sequence, many cell lines: post #1One siRNA sequence, many cell lines: post #1
One siRNA sequence, many cell lines - posted in siRNA, microRNA and RNAi: Hi all, Im new to process of siRNA transfection and I was wondering: Will one siRNA sequence (previously validated in the lab) be good enough to transfect multiple other cell lines from the same organism? I understand that the actual process of transfection will be different for each cell line, but I am curious as to whether I need to also worry about the sequence itself. Thanks!
http://www.protocol-online.org/forums/topic/25829-one-sirna-sequence-many-cell-lines/
A stepwise pathway for biogenesis of 24‐nt secondary siRNAs and spreading of DNA methylation | The EMBO JournalA stepwise pathway for biogenesis of 24‐nt secondary siRNAs and spreading of DNA methylation | The EMBO Journal
Our study supports a previous conjecture that primary RdDM is required to initiate 24‐nt secondary siRNA formation. This requirement was initially suggested by the absence of secondary siRNAs in nrpe1 and drd1 mutants, which still produce primary siRNAs and the overlapping nascent RNA but lack primary RdDM (Kanno et al, 2008). The nascent RNA stably accumulates in the absence of primary RdDM in non‐silenced plants but, in that instance, is presumably a Pol II transcript (Figure 6) because it is still made in an nrpd1 mutant. The key function of primary RdDM appears to be in attracting the secondary siRNA‐generating machinery, which includes Pol IV and RDR2. The contribution may be direct if primary RdDM provides a template that is preferentially recognized by Pol IV, which has been proposed to transcribe methylated DNA (Herr et al, 2005; Onodera et al, 2005). In this model, Pol IV would transcribe the nascent RNA from the methylated template (Figure 6). An indirect contribution of primary ...
http://emboj.embopress.org/content/28/1/48
Plus itPlus it
The field of RNA-based gene regulation has been attracting increasing interest over the past couple of years, and the regulation of gene expression by small dsRNAs is being studied intensively. Such interference can be mediated by siRNAs, which cleave a sequence-specific target mRNA, or by micro-RNAs, which inhibit translation of a target mRNA. Noncoding RNAs have also been found to play important roles in the regulation of gene expression, for example, in gene silencing by methylation of DNA or histones. Small interfering RNAs are expected to have medical application in human therapy as drugs with high specificity for their molecular targets.. A number of studies on synthetic siRNAs or DNA vector-derived small hairpin RNAs (shRNAs) in cell culture systems have been published, and there are also several animal studies (15, 16, 17, 18, 19) . McCaffrey et al. (15) cotransfected the firefly luciferase gene along with synthetic siRNAs or a shRNA expression vector into mice by hydrodynamic injection ...
http://clincancerres.aacrjournals.org/content/10/22/7721
Targeted Degradation of Proteins by PROTACs - Current ProtocolsTargeted Degradation of Proteins by PROTACs - Current Protocols
In recent years, small interference RNAs (siRNAs) have greatly enhanced our understanding of protein functions by allowing knockdown of targeted proteins at the mRNA level
http://www.currentprotocols.com/WileyCDA/CPUnit/refId-ch090242.html
A new, inhaled siRNA therapeutic option for asthma - Advanced Science NewsA new, inhaled siRNA therapeutic option for asthma - Advanced Science News
After more than 20 years of research, we are now witnessing a breakthrough of small interfering RNA (siRNA)-based therapies. In 2018, the first-ever siRNA drug, Onpattro, reached the market, followed by the approval of Givlaari in 2019, and many other clinical trials are in progress. Holding the potential to treat a wide range of diseases from cancer to immunological disorders, siRNA therapeutics have received plenty of attention. With the support of a suitable delivery system, they can be directed to downregulate a specific target gene. Both approved siRNA drugs - Onpattro and Givlaari - are only able to reach the liver, however. Other organs that can be treated by loco-regional administration, such as the lung, are, in principle, good targets for siRNA therapies as well. In this view, siRNA-based drugs could not only act as an ally in the battle against the current COVID-19 pandemic but also against other severe lung diseases such as asthma. Despite the great advances in asthma treatment, this ...
https://www.advancedsciencenews.com/a-new-inhaled-sirna-therapeutic-option-for-asthma/
RNA | Technology TrendsRNA | Technology Trends
Ribonucleic acid (RNA) is a ubiquitous family of large biological molecules that performs multiple vital roles in the coding, decoding, regulation, and expression of genes. Together with DNA, RNA comprises the nucleic acids, which, along with proteins, constitute the three major macromolecules essential for all known forms of life. Like DNA, RNA is assembled as a chain of nucleotides, but is usually single-stranded. Cellular organisms use messenger RNA (mRNA) to convey genetic information (recorded using the letters G, A, U, and C for the nucleotides guanine, adenine, uracil and cytosine) that directs synthesis of specific proteins, while many viruses encode their genetic information using an RNA genome.. Some RNA molecules play an active role within cells by catalyzing biological reactions, controlling gene expression, or sensing and communicating responses to cellular signals. One of these active processes is protein synthesis, a universal function whereby mRNA molecules direct the assembly of ...
https://www.primidi.com/rna
MISSION® siRNA Universal Negative Controls - MISSION siRNA | Sigma-AldrichMISSION® siRNA Universal Negative Controls - MISSION siRNA | Sigma-Aldrich
MISSION® siRNA Universal Negative Controls are an essential component to any siRNA experiment. Using a Negative siRNA control allows the researcher to create a baseline for mRNA knockdown efficiency. MISSION siRNA Universal Negative Controls have been tested in human, rat, and mouse cells. All have carefully designed to have no homology to known gene sequences.Benefits of MISSION Universal Negative siRNA Control:Universal controls designed for use in a wide variety of species including Human, Mouse, Rat, Bovine, Pig, Chicken, Sheep, and CHO cells.Novel design method used to ensure no homology to all Mature and Predicted RefSeq mRNA sequences.Contain no known immune-response motifs.1The unconjugated controls were validated with Agilent 40K human gene arrays to ensure no significant nonspecific gene interactions.Functionally validated to show no immune response via qRT PCRTwo different Universal Negative Control
https://www.sigmaaldrich.com/life-science/molecular-biology/molecular-biology-products.html?TablePage=101258984
RNAi Therapeutics: RNAi Therapeutics CompaniesRNAi Therapeutics: RNAi Therapeutics Companies
Due to reasons discussed in the previous post, almost all of these programs are Direct RNAi programs, i.e. the siRNA is administered close to the diseased site. All except for Acuitys program are also with siRNAs that have been chemically modified (to enhance stability etc), and it remains to be seen whether Acuitys strategy to plunge into the clinic first was a wise one. Sirna Therapeutics soon followed suit, but I think took the right decision to invest time to carefully think about how to position their potential product in the more and more crowded AMD market. Sirna Therapeutics was also the first public company based on RNAi. Formerly known as Ribozyme Pharmaceuticals, they leveraged their experience with RNAs to build an operation that had all the tools to to build a decent IP portfolio and quickly enter the clinic. This IP portfolio is mostly based on chemistry and targeting many genes one by one such that it could claim exclusivity for targeting those genes with RNAi. It remains to be ...
http://rnaitherapeutics.blogspot.com/2007/04/rnai-therapeutics-companies.html
Plus itPlus it
RNA interference (RNAi) is a specific and powerful tool used to manipulate gene expression and study gene function. The cytochrome P450 3A4 (CYP3A4) can metabolize more than 50% of drugs. In the present study, we investigated whether vector-expressed small interfering RNAs (siRNAs) altered the CYP3A4 expression and function using the Chinese hamster cell line (V79) overexpressing CYP3A4 (CHL-3A4). Three different siRNA oligonucleotides (3A4I, 3A4II, and 3A4III) were designed and tested for their ability to interfere with CYP3A4 gene expression. Our study demonstrated that transient transfection of CHL-3A4 cells with the 3A4III siRNAs, but not 3A4I and II, significantly reduced CYP3A4 mRNA levels by 65% and protein expression levels by 75%. All these siRNAs did not affect the expression of CYP3A5 at both mRNA and protein levels in V79 cells overexpressing CYP3A5. Transfection of CHL-3A4 cells with 3A4III siRNAs significantly diminished the cytotoxicity of two CYP3A4 substrate drugs, ...
https://dmd.aspetjournals.org/content/34/9/1650
nanoUDLA: DNA Computer Works in Human CellsnanoUDLA: DNA Computer Works in Human Cells
Benenson and colleagues engineered a target gene to be sensitive to several different siRNAs of their own design. In the simplest case, they introduced a single siRNA molecule to switch off a target gene that encoded a fluorescent protein. In more complex cases, a pair of siRNAs or either of two siRNAs switched off another target gene, which in turn switched off a gene for a fluorescent protein. To make sure the system worked as intended, the researchers based their siRNAs on those of other species, they report in a paper published online today by Nature Biotechnology ...
http://nanoudla.blogspot.com/2007/09/dna-computer-works-in-human-cells.html
SID.ir | RORC2 GENE SILENCING IN HUMAN TH17 CELLS BY SIRNA: DESIGN AND EVALUATION OF HIGHLY EFFICIENT SIRNASID.ir | RORC2 GENE SILENCING IN HUMAN TH17 CELLS BY SIRNA: DESIGN AND EVALUATION OF HIGHLY EFFICIENT SIRNA
Download Free Full-Text of an article RORC2 GENE SILENCING IN HUMAN TH17 CELLS BY SIRNA: DESIGN AND EVALUATION OF HIGHLY EFFICIENT SIRNA
https://www.sid.ir/en/journal/ViewPaper.aspx?id=276683
Choosing The Right Carrier For SiRNA-based Applications-A New Reporter System Which Acts By Induction Of Endogenous...Choosing The Right Carrier For SiRNA-based Applications-A New Reporter System Which Acts By Induction Of Endogenous...
Anew detection mechanism for the control of successful siRNA delivery to cells or tissue is introduced using a siRNA-based probe that is capable of inducing a ...
https://www.omicsonline.org/proceedings/choosing-the-right-carrier-for-sirnabased-applicationsa-new-reporter-system-which-acts-by-induction-of-endogenous-intracellular-fluorescence-16015.html
Sirna Design: Methods And Protocols 2012Sirna Design: Methods And Protocols 2012
PlanningOperationsProduct ManagementProductionPublic RelationsResearchSalesOther Yes, I need to discuss cells from Adweek about programs, formats and entries that they are may regulate of siRNA Design: Methods and Protocols to me. You emit together randomized to this siRNA Design: Methods. puncture us to find up to siRNA realize as completed to this selection.
http://michael-noeres.de/freebook.php?q=siRNA-Design%3A-Methods-and-Protocols-2012/
10 tips on how to best optimize siRNA transfection | Proteintech Group10 tips on how to best optimize siRNA transfection | Proteintech Group
siRNA transfection is a powerful tool used to understand the mechanisms of gene regulation and molecular pathways. The following 10 tips will help you to optimize your siRNA transfection.
https://www.ptglab.com/news/blog/10-tips-on-how-to-best-optimize-sirna-transfection/
3-Poly(A) tail enhances siRNA activity against exogenous reporter genes in MCF-7 cells | Abstract3-Poly(A) tail enhances siRNA activity against exogenous reporter genes in MCF-7 cells | Abstract
RNA interference (RNAi) is a powerful tool in the study of gene function. We added poly(A) tails to the 3 ends of siRNA antisense strands by in vitro..
https://www.alliedacademies.org/abstract/3polya-tail-enhances-sirna-activity-against-exogenous-reporter-genes-in-mcf7-cells-4429.html
Sirna Therapeutics - VenrockSirna Therapeutics - Venrock
Acquired by Silicon Image Anchor Bay Technologies is developing a new class of components and systems, based on high-performance Digital Video and Audio format-conversion technologies, for the Digital A/V market.. ...
http://www.venrock.com/investment/sirna-therapeutics/
BioCapTM KLF4 mRNA - mRNA Products | Next Generation RNA TechnologiesBioCapTM KLF4 mRNA - mRNA Products | Next Generation RNA Technologies
Transcription factor; can act both as activator and as repressor. Binds the 5-CACCC-3 core sequence. Binds to the promoter region of its own gene and can activate its own transcription. Regulates the expression of key transcription factors during embryonic development. Plays an important role in maintaining embryonic stem cells, and in preventing their differentiation. Required for establishing the barrier function of the skin and for postnatal maturation and maintenance of the ocular surface. Involved in the differentiation of epithelial cells and may also function in skeletal and kidney development. Contributes to the down-regulation of p53/TP53 transcription. (Source: UniProt http://www.uniprot.org/uniprot/o43474 ...
https://www.pharna.com/product/1000201/
Peptide-mediated Protein Knockdown TechnologyPeptide-mediated Protein Knockdown Technology
Techniques that regulate the level of protein expression by targeting genes at the DNA or RNA level have proven to be powerful strategies in the drive to understand protein expression and function. However, because of their very nature, these techniques are restricted in terms of speed, specificity and reversibility. For instance, these genetic methods of disrupting protein expression can take days to weeks; consequently, cellular and molecular compensation may occur, thereby obscuring expected phenotypes. In addition, as these genetic manipulations result in the eradication of all mRNA splice isoforms, as well as post-translationally modified versions of targeted proteins, these methods lack specificity and are largely limited to studying context-dependent protein function. Finally, the reversibility of these genetic manipulations, including many recently developed on-and-off inducible methods, is relatively slow (being achieved on a timescale of days to weeks) and is incomplete. These ...
http://www.primarypeptides.com/technology/protein-knockdown-technology/
Non-viral siRNA delivery to the lung. - Semantic ScholarNon-viral siRNA delivery to the lung. - Semantic Scholar
SiRNAs exert their biological effect by guiding the degradation of their cognate mRNA sequence, thereby shutting down the corresponding protein production (gene silencing by RNA interference or RNAi). Due to this property, siRNAs are emerging as promising therapeutic agents for the treatment of inherited and acquired diseases, as well as research tools for the elucidation of gene function in both health and disease. Because of their lethality and prevalence, lung diseases have attracted particular attention as targets of siRNA-mediated cures. In addition, lung is accessible to therapeutic agents via multiple routes, e.g., through the nose and the mouth, thus obviating the need for targeting and making it an appealing target for RNAi-based therapeutic strategies. The clinical success of siRNA-mediated interventions critically depends upon the safety and efficacy of the delivery methods and agents. Delivery of siRNAs relevant to lung diseases has been attempted through multiple routes and using various
https://www.semanticscholar.org/paper/Non-viral-siRNA-delivery-to-the-lung-Thomas-Lu/03d74e82b067a0d08e4460e3695dbfccce36d1d6
Plus itPlus it
2345 Small interfering RNA (siRNA) oligonucleotides have been shown to be potent mediators of RNA interference (RNAi) that induce gene silencing with a high degree of sequence specificity. This has resulted in a rapid shift from antisense and ribozymes to siRNA for gene knockdown studies, and thus sparked strong interest in their use as therapeutics. Therapeutic use of siRNA, however, requires both improved biological stability and intracellular targeting. Thus far, gene inhibition by synthetic siRNA following intravenous administration has been limited to high pressure administration yielding primary effects in liver or using lipoplexes yielding primary effects in lung, in both cases via poorly understood mechanisms not readily adaptable to any other tissue and lacking clinical applicability. Recent work with aqueous siRNA administered parenterally by many routes found it could elicit effects on implanted tumors but without correlation to tumor exposure or tumor gene inhibition, leading the ...
http://cancerres.aacrjournals.org/content/64/7_Supplement/542.2
OPUS 4 | SearchOPUS 4 | Search
Small interfering RNAs (siRNAs) are now established as the preferred tool to inhibit gene function in mammalian cells yet trigger unintended gene silencing due to their inherent miRNA-like behavior. Such off-target effects are primarily mediated by the sequence-specific interaction between the siRNA seed regions (position 2-8 of either siRNA strand counting from the 5-end) and complementary sequences in the 3UTR of (off-) targets. It was previously shown that chemical modification of siRNAs can reduce off-targeting but only very few modifications have been tested leaving more to be identified. Here we developed a luciferase reporter-based assay suitable to monitor siRNA off-targeting in a high throughput manner using stable cell lines. We investigated the impact of chemically modifying single nucleotide positions within the siRNA seed on siRNA function and off-targeting using 10 different types of chemical modifications, three different target sequences and three siRNA concentrations. We found ...
http://publikationen.ub.uni-frankfurt.de/solrsearch/index/search/searchtype/authorsearch/author/Jyoti+Chattopadhyaya
pAV-CKAP2v1-shRNA, SH895365 | Vigene BiosciencespAV-CKAP2v1-shRNA, SH895365 | Vigene Biosciences
Four pre-designed shRNA constructs targeting cytoskeleton associated protein 2 (CKAP2), transcript variant 1 and one scrambled control. Each shRNA construct is driven by the U6 promoter and contains a GFP reporter.
https://www.vigenebio.com/pav-ckap2v1-shrna
pAV-MNS1-shRNA, SH897572 | Vigene BiosciencespAV-MNS1-shRNA, SH897572 | Vigene Biosciences
Four pre-designed shRNA constructs targeting meiosis-specific nuclear structural 1 (MNS1) and one scrambled control. Each shRNA construct is driven by the U6 promoter and contains a GFP reporter.
https://www.vigenebio.com/pav-mns1-shrna
ON TARGETplus siRNAON TARGETplus siRNA
Panels (A) and (B) are representative examples of off-target signatures with and without application of ON-TARGETplus modifications to (A) a single siRNA and (B) a SMARTpool reagent. Green bars indicate genes with 2-fold or more reduction of expression when treated with the indicated siRNA reagent.The ON-TARGETplus modifications reduced the off-targets when compared to unmodified siRNA. Pooling of siRNA and the ON-TARGETplus modification pattern independently, and in combination, provide significant reduction in off-target gene silencing. Panel (C) represents quantitation of off-targets (down-regulated by 2-fold or more) induced by the indicated siRNA reagents targeting 10 different genes (4 siRNAs per gene or a single SMARTpool reagent). Off-targets were quantified using microarray analysis (Agilent) then compiled. Each shaded box represents the middle 50% of the data set. Horizontal line in box: Median value of the data set. Vertical bars: minimum and maximum data values.. Only the ...
https://horizondiscovery.com/en/products/gene-modulation/knockdown-reagents/controls/PIFs/~/link.aspx?_id=FC62E470-F3CC-4A9D-AE63-97F850200EBF&_z=z
Mouse siGENOME siRNA Library - Transcription Factors | DharmaconMouse siGENOME siRNA Library - Transcription Factors | Dharmacon
An arrayed siRNA collection targeting mouse transcription factors. siGENOME siRNA is a cost-effective choice for RNAi screening. Available as SMARTpool or 4 individual siRNA reagents.
http://dharmacon.gelifesciences.com/sirna/mouse-sigenome-sirna-library-transcription-factors/
Mouse siGENOME siRNA Library - Apoptosis | DharmaconMouse siGENOME siRNA Library - Apoptosis | Dharmacon
An arrayed siRNA collection targeting mouse genes in apoptosis pathways. siGENOME siRNA is a cost-effective choice for RNAi screening. Available as SMARTpool or 4 individual siRNA reagents.
http://dharmacon.gelifesciences.com/sirna/mouse-sigenome-sirna-library-apoptosis/
Heparin sodium IC50 - Synthetic Small Molecule Inhibitors of Hh SignalingHeparin sodium IC50 - Synthetic Small Molecule Inhibitors of Hh Signaling
Biology is generating more data than ever before. had been extracted from database magazines in BMC BMC and Bioinformatics Biology. To date, there were 19 significant contributors towards the task, each of whom continues to be shown Heparin sodium IC50 as an writer upon this publication. This task was taken up to highlight the grouped community facet of the MB project. The homepage continues to be visited 100 approximately?000 times. The task has 80 new users in total, and there were 15 approximately?000 edits. We wish that with ongoing improvements and through elevated publicity, use shall continue steadily to grow. Continue Reading. ...
http://biosweepny.com/tag/heparin-sodium-ic50/
PlumX - In vivo siRNA delivery system for targeting to the liver by poly-l-glutamic acid-coated lipoplex.PlumX - In vivo siRNA delivery system for targeting to the liver by poly-l-glutamic acid-coated lipoplex.
In this study, we developed anionic polymer-coated liposome/siRNA complexes (lipoplexes) with chondroitin sulfate C (CS), poly-l-glutamic acid (PGA) and poly-aspartic acid (PAA) for siRNA delivery by intravenous injection, and evaluated the biodistribution and gene silencing effect in mice. The sizes of CS-, PGA- and PAA-coated lipoplexes were about 200?nm and their ?-potentials were negative. CS-, PGA- and PAA-coated lipoplexes did not induce agglutination after mixing with erythrocytes. In terms of biodistribution, siRNAs after intravenous administration of cationic lipoplexes were largely observed in the lungs, but those of CS-, PGA- and PAA-coated lipoplexes were in both the liver and the kidneys, indicating that siRNA might be partially released from the anionic polymer-coated lipoplexes in the blood circulation and accumulate in the kidney, although the lipoplexes can prevent the agglutination with blood components. To increase the association between siRNA and cationic liposome, we used ...
https://plu.mx/a/?doi=10.1016/j.rinphs.2014.01.001
Modeling Recursive RNA InterferenceModeling Recursive RNA Interference
Author Summary RNA interference is a gene regulatory system in which small RNA molecules turn off genes that have similar sequences to the small RNAs. This has become a powerful tool because a researcher can use RNA interference to turn off any gene of interest in order to test its function. There is great interest in identifying the genes required for the RNA interference pathway, and one approach to identifying such genes has been to use RNA interference to turn off potential RNA interference genes and to ask whether RNA interference still functions when these genes are turned off. The goal of our report is to ask how it is possible for RNA interference to turn itself off, using a mathematical model of the system. The results show that RNA interference cannot turn itself off if the RNA interference pathway is too effective to start with, so that experiments in which RNA interference acts on itself will only work in systems having a low efficiency. The results of our model suggest possible ways to
http://journals.plos.org/ploscompbiol/article?id=10.1371/journal.pcbi.1000183
Dicerna Announces Expansion of Ongoing DCR-MYC Phase 1 Study to Evaluate Safety and Efficacy in Patients with Advanced...Dicerna Announces Expansion of Ongoing DCR-MYC Phase 1 Study to Evaluate Safety and Efficacy in Patients with Advanced...
Dicerna Pharmaceuticals, Inc. (NASDAQ:DRNA) , a leader in the development of RNAi therapeutics, today announced it is expanding its ongoing Phase 1 study of DCR-MYC in solid tumors, multiple myeloma, or lymphoma to include a cohort of patients with pancreatic neuroendocrine tumors (PNETs) following early signs of clinical and metabolic response and tumor shrinkage in PNET patients. DCR-MYC is an investigational Dicer substrate short-interfering RNA (DsiRNA) therapeutic targeting the MYC oncogene and the first MYC-targeting short-interfering RNA (siRNA) to enter clinical trials. Based on the clinical activity seen in two out of three patients with PNET, evidence of a complete metabolic response (based on FDG-PET) and a partial response (based on RECIST criteria), as well as published evidence on the role of MYC in growth and maintenance of PNET tumors, we are adding a PNET expansion cohort in the ongoing Phase 1 study, said Pankaj Bhargava, M.D., chief medical officer of Dicerna. Most patients ...
http://www.finances.com/company-news/96143-dicerna-announces-expansion-of-ongoing-dcr-myc-phase-1-study-to-evaluate-safety-and-efficacy-in-patients-with-advanced-pancreatic-neuroendocrine-tumors-pnets.htm
piRNA clusters and open chromatin structure | Mobile DNA | Full TextpiRNA clusters and open chromatin structure | Mobile DNA | Full Text
Transposable elements (TEs) are major structural components of eukaryotic genomes; however, mobilization of TEs generally has negative effects on the host genome. To counteract this threat, host cells have evolved genetic and epigenetic mechanisms that keep TEs silenced. One such mechanism involves the Piwi-piRNA complex, which represses TEs in animal gonads either by cleaving TE transcripts in the cytoplasm or by directing specific chromatin modifications at TE loci in the nucleus. Most Piwi-interacting RNAs (piRNAs) are derived from genomic piRNA clusters. There has been remarkable progress in our understanding of the mechanisms underlying piRNA biogenesis. However, little is known about how a specific locus in the genome is converted into a piRNA-producing site. In this review, we will discuss a possible link between chromatin boundaries and piRNA cluster formation.
https://mobilednajournal.biomedcentral.com/articles/10.1186/1759-8753-5-22
Abstract 839: Transfer of siRNA Molecules via Gap Junctions in Heart Cells | CirculationAbstract 839: Transfer of siRNA Molecules via Gap Junctions in Heart Cells | Circulation
Specific gene knock-down in post-natal cells by siRNA molecules has immense potential as a research and therapeutic tool. While direct effects have been clearly demonstrated in siRNA-transduced cells, we investigated a possible bystander effect whereby siRNAs transfer between transduced and non-transduced (NT) primary neonatal rat ventricular myocytes (NRVMs) via gap junctions. To enable siRNA expression in NRVMs, lentiviral vectors (LV) encoding short-hairpin (sh)RNAs, which are processed to siRNAs, were generated. Two populations of LV-transduced NRVMs were produced; one expressing GFP and the other co-expressing a second reporter plus a siRNA designed to knock-down GFP. Following 7 days co-culture of these populations, flow cytometry revealed a 35% reduction in the mean GFP fluorescence intensity and real-time PCR confirmed GFP mRNA knock-down. To explore dependence of this effect on gap junctions, we co-transduced cells with a LV encoding a dominant-negative connexin43 mutant (Cx43Δ) as a ...
http://circ.ahajournals.org/content/116/Suppl_16/II_163.2
Characterisation and application of a bovine U6 promoter for expression of short hairpin RNAs | BMC Biotechnology | Full TextCharacterisation and application of a bovine U6 promoter for expression of short hairpin RNAs | BMC Biotechnology | Full Text
The use of small interfering RNA (siRNA) molecules in animals to achieve double-stranded RNA-mediated interference (RNAi) has recently emerged as a powerful method of sequence-specific gene knockdown. As DNA-based expression of short hairpin RNA (shRNA) for RNAi may offer some advantages over chemical and in vitro synthesised siRNA, a number of vectors for expression of shRNA have been developed. These often feature polymerase III (pol. III) promoters of either mouse or human origin. To develop a shRNA expression vector specifically for bovine RNAi applications, we identified and characterised a novel bovine U6 small nuclear RNA (snRNA) promoter from bovine sequence data. This promoter is the putative bovine homologue of the human U6-8 snRNA promoter, and features a number of functional sequence elements that are characteristic of these types of pol. III promoters. A PCR based cloning strategy was used to incorporate this promoter sequence into plasmid vectors along with shRNA sequences for RNAi. The
https://bmcbiotechnol.biomedcentral.com/articles/10.1186/1472-6750-5-13
Contribution of natural antisense transcription to an endogenous siRNA signature in human cells | BMC Genomics | Full TextContribution of natural antisense transcription to an endogenous siRNA signature in human cells | BMC Genomics | Full Text
Eukaryotic cells express a complex layer of noncoding RNAs. An intriguing family of regulatory RNAs includes transcripts from the opposite strand of protein coding genes, so called natural antisense transcripts (NATs). Here, we test the hypothesis that antisense transcription triggers RNA interference and gives rise to endogenous short RNAs (endo-siRNAs). We used cloned human embryonic kidney cells (HEK293) followed by short RNAseq to investigate the small genic RNA transcriptome. 378 genes gave rise to short RNA reads that mapped to exons of RefSeq genes. The length profile of short RNAs showed a broad peak of 20-24 nucleotides, indicative of endo-siRNAs. Collapsed reads mapped predominantly to the first and the last exon of genes (74%). RNAs reads were intersected with sequences occupied by RNAPII or bound to Argonaute (AGO1 by crosslinking, ligation, and sequencing of hybrids, CLASH). In the first exon, 94% of the reads correlated with RNAPII occupancy with an average density of 130 (relative units);
https://bmcgenomics.biomedcentral.com/articles/10.1186/1471-2164-15-19
Contribution of Small RNA Pathway Components in Plant ImmunityContribution of Small RNA Pathway Components in Plant Immunity
Molecular Plant-Microbe Interactions 26:617-625...Jang-Kyun Seo,1 Jianguo Wu,2 Yifan Lii,1 Yi Li,2 and Hailing Jin1...© 2013 The American Phytopathological Society...Small RNAs regulate a multitude of cellular processes, including development, stress responses, metabolism, and maintenance of genome integrity, in a sequence-specific manner. Accumulating evidence reveals that host endogenous small RNAs and small RNA pathway components play important roles in plan...
https://www.apsnet.org/publications/mpmi/2013/June/Pages/26_6_617.aspx
De Novo Reconstruction of Consensus Master Genomes of Plant RNA and DNA Viruses from siRNAsDe Novo Reconstruction of Consensus Master Genomes of Plant RNA and DNA Viruses from siRNAs
Virus-infected plants accumulate abundant, 21-24 nucleotide viral siRNAs which are generated by the evolutionary conserved RNA interference (RNAi) machinery that regulates gene expression and defends against invasive nucleic acids. Here we show that, similar to RNA viruses, the entire genome sequences of DNA viruses are densely covered with siRNAs in both sense and antisense orientations. This implies pervasive transcription of both coding and non-coding viral DNA in the nucleus, which generates double-stranded RNA precursors of viral siRNAs. Consistent with our finding and hypothesis, we demonstrate that the complete genomes of DNA viruses from Caulimoviridae and Geminiviridae families can be reconstructed by deep sequencing and de novo assembly of viral siRNAs using bioinformatics tools. Furthermore, we prove that this siRNA omics approach can be used for reliable identification of the consensus master genome and its microvariants in viral quasispecies. Finally, we utilized this approach to
http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0088513
Patenting RNA Interference Technology - Law360Patenting RNA Interference Technology - Law360
Goodwin Procter associate Daniel Wilson looks into patenting strategies for a powerful new tool for treating disease as well as for creating models of disease.
https://www.law360.com/articles/3425/patenting-rna-interference-technology
Signal Mediated Amplification of RNA Technology - Resistant StaphylococcusSignal Mediated Amplification of RNA Technology - Resistant Staphylococcus
Signal-mediated amplification of RNA technology (SMART) is a novel isothermal amplification technology that uses a three-way junction (3WJ) structure to
https://www.americorpshealth.biz/resistant-staphylococcus-2/signalmediated-amplification-of-rna-technology.html
Custom shRNA Constructs - CellectaCustom shRNA Constructs - Cellecta
To make an lentiviral shRNA construct, we only need to know the RefSeq number. We typically design and clone 3-5 constructs that target your transcript. Our proprietary shRNA design delivers approximately 70% shRNAs that generate ,70% transcript knockdown in standard cell lines as measured by qRT-PCR so it is likely that at least 2 of 3 or 3 of 5 constructs will be effective.. We make the inserst, clone them, and sequence the constructs to verify correct construction. You receive several of our best-designed constructs to test and characterize to see which best matches your experimental needs. We can provide the plasmid constructs, or you have the option to also package the constructs as ready-to-transduce lentiviral particles.. We do not guarantee this level for any specific target, and the percentage of highly effective shRNAs will vary from target to target.. ...
https://cellecta.com/collections/shrna-vectors-and-constructs/products/custom-shrna-constructs
Plus itPlus it
Attempts to target mutant KRAS have been unsuccessful. Most of the current therapeutic approaches are indirect, mainly via inhibiting KRAS down-stream signaling, which have been marginally successful. Here we report the identification of Smad ubiquitination regulatory factor 2 (SMURF2), a HECT-type ubiquitin ligase (E3) as a critical regulator of mutant KRAS protein stability. We show that the loss of SMURF2 either by si-/sh-RNA mediated gene silencing or by overexpression of a catalytically inactive SMURF2 Cys716Ala (CA) mutant, can cause lysosome-mediated KRAS degradation; whereas, overexpression of wild type SMURF2 enhances KRAS protein stability. Most importantly, we found that mutant KRAS protein is more susceptible to SMURF2 alterations in that mutant protein half-life decreased from ,12h in control siRNA-treated cells to ,3h with Smurf2 siRNA treatment, whereas only marginal differences were noted for wild-type KRAS protein upon similar treatments. Importantly, this loss of mutant KRAS ...
http://mcr.aacrjournals.org/content/12/12_Supplement/B48
A System for Stable Expression of Short Interfering RNAs in Mammalian Cells | ScienceA System for Stable Expression of Short Interfering RNAs in Mammalian Cells | Science
To further test the vector system, we designed both a synthetic siRNA and a pSUPER vector that target the same 19-nt sequence in theCDC20 transcript. As for CDH1, efficient suppression of endogenous CDC20 expression was achieved with both synthetic siRNA and with pSUPER-CDC20 (Fig. 2B). To measure the level of gene suppression accurately by the pSUPER system, we designed a construct to target polo like kinase-1 (PLK1). Introduction of pSUPER-PLK1 led to a significant decrease in PLK1 protein levels and a reduction in PLK1 kinase activity by a factor of 10 [Supplementary fig. 1A (4)]. To date, we were successful in knocking down the expression of more than 10 genes for which we designed a pSUPER siRNA vector, highlighting the efficiency with which genes can be targeted using this vector (6).. Next, we asked whether suppression of gene expression by the pSUPER vector is sufficient to affect cellular physiology. We designed a construct to knockdown p53, a transcription factor that is stabilized ...
https://science.sciencemag.org/content/296/5567/550?ijkey=a6a5431b4619ab25227e24fdab0b26a2daaeae03&keytype2=tf_ipsecsha
RFP-TrapRFP-Trap
RNAi refers to dsRNA-induced gene silencing, a cellular process that degrades RNA homologous to one strand of the dsRNA [1, 2]. The intermediates of long dsRNA-initiated RNAi are double-stranded small interfering RNAs (siRNA), typically 21-23 nucleotide (nt) long. The siRNAs, when introduced into cells, can be used to silence genes in mammalian systems where long dsRNAs prompt protein kinase R (PKR), RNase L, and interferon activities that result in non-specific RNA degradation and general shutdown of protein synthesis [3]. siRNAs can either be chemically synthesized then directly transfected into cells or can be generated inside the cell by introducing vectors that express short-hairpin RNA (shRNA) precursors of siRNAs. The process of shRNA into functional siRNA involves cellular RNAi machinery that naturally process genome encoded microRNAs (miRNA) that are responsible for cellular regulation of gene expression by modulating mRNA stability, translation, and chromatin structures ...
http://blog.allelebiotech.com/tag/rfp-trap/
RNA interference- a novel approach for plant disease managementRNA interference- a novel approach for plant disease management
RNA interference (RNAi) is an incredible revolution in the field of functional genomics, a breakthrough in plant molecular genetics. This technology will generate enormous potential for engineering control of gene expres-sion. The success of managing biotic stress using RNAi technology will prove to be biologically and environmentally safe. It is therapeutic in approach as the resistance induced by RNAi is triggered by ds RNA that results in silencing of specific genes before being translated in a homology dependent manner. Over the time, RNAi is significantly proving it as one of the most promiscent management strategy which eliminates certain risks associated with the development of transgenic plants. This review gives an insight into the probability of management of plant diseases caused by various biotic agents viz. fungi, bacteria and viruses using RNA interference technique and host-pathogen related targeted sites ...
http://agris.fao.org/agris-search/search.do?recordID=IN2018800053
Selleck Chemicals Blog-Inactivation of PBX3 and HOXA9 by down-regulating H3K79 methylation represses NPM1-mutated leukemic cell...Selleck Chemicals Blog-Inactivation of PBX3 and HOXA9 by down-regulating H3K79 methylation represses NPM1-mutated leukemic cell...
Acute myeloid leukemia (AML) with an NPM1 mutation (NPMc+) has a distinct gene expression signature and displays molecular abnormalities similar to mixed lineage leukemia (MLL), including aberrant expression of the PBX3 and HOXA gene cluster. However, it is unclear if the aberrant expression of PBX3 and HOXA is essential for the survival of NPM1-mutated leukemic cells. Methods: Using the gene expression profiling of TCGA and E-MTAB-3444 datasets, we screened for high co-expression of PBX3 and HOXA9 in NPMc+ leukemia patients. We performed NPMc+ depletion and overexpression experiments to examine aberrant H3K79 methylation through epigenetic regulation. Through RNA interference technology and small-molecule inhibitor treatment, we evaluated the effect of methyl-modified H3K79 on cell survival and explored the possible underlying mechanism. Results: We showed that NPMc+ increased the expression of PBX3 and HOXA9, which are both poor prognosis indicators in AML. High PBX3 and HOXA9 expression was ...
https://www.selleckchem.com/blog/Inactivation-of-PBX3-and-HOXA9-by-down-regulating-H3K79-methylation-represses-NPM1-mutated-leukemic-cell-survival.html
Human siGENOME RTF - G Protein-coupled ReceptorsHuman siGENOME RTF - G Protein-coupled Receptors
The Human siGENOME RTF G Protein-Coupled Receptor (GPCR) siRNA Library includes SMARTpool siRNA reagents targeting genes encoding GPCRs, transmembrane proteins required for the transduction of extracellular signals from a wide variety of ligands, including neurotransmitters, hormones, and other small molecules. This siRNA Library does not include olefactory or taste receptors.. RTF siRNA libraries are provided as multiple single-use plate sets - just rehydrate and add cells. This unique pre-plated format reduces hands-on time for faster screening results.. siGENOME siRNAs are designed with the proprietary SMARTselection design algorithm for high-efficiency, guaranteed silencing. They also incorporate rational strand bias with application of ON-TARGET modifications to optimize antisense strand loading into RISC for effective target knockdown.. ...
https://horizondiscovery.com/en/products/screening/screening-libraries/Gene-modulation-screening-libraries/siRNA/PIFs/Human-siGENOME-RTF-G-Protein-coupled-Receptors
riboxx RNA Technologies - riboxxFECT transfection reagent for potent delivery of RNA, siRNA or miRNA mimicsriboxx RNA Technologies - riboxxFECT transfection reagent for potent delivery of RNA, siRNA or miRNA mimics
riboxxFECT is a reagent dedicated for transfection of all formats of siRNA, microRNA mimics and RNA in primary cells, adherent cells or cells in suspension.
https://www.riboxx.com/product-riboxxfect.html
AID 506767 - Binding affinity to SAP145 in SAP145-targeting siRNA-treated human HeLa cells at 1 uM by fluorescent microscopy -...AID 506767 - Binding affinity to SAP145 in SAP145-targeting siRNA-treated human HeLa cells at 1 uM by fluorescent microscopy -...
BioAssay record AID 506767 submitted by ChEMBL: Binding affinity to SAP145 in SAP145-targeting siRNA-treated human HeLa cells at 1 uM by fluorescent microscopy.
https://pubchem.ncbi.nlm.nih.gov/bioassay/506767
polymer/DSPC/cholesterol/PEG lipid/siRNA nanoparticlespolymer/DSPC/cholesterol/PEG lipid/siRNA nanoparticles
Page contains details about polymer/DSPC/cholesterol/PEG lipid/siRNA nanoparticles . It has composition images, properties, Characterization methods, synthesis, applications and reference articles : nano.nature.com
http://nano.nature.com/nano/GR-M5961660
PEG-ECO/siRNA nanoparticlesPEG-ECO/siRNA nanoparticles
Page contains details about PEG-ECO/siRNA nanoparticles . It has composition images, properties, Characterization methods, synthesis, applications and reference articles : nano.nature.com
http://nano.nature.com/nano/GR-M8693471
Stimuli-responsive siRNA carriers for efficient gene silencing in tumors via systemic delivery - Biomaterials Science (RSC...Stimuli-responsive siRNA carriers for efficient gene silencing in tumors via systemic delivery - Biomaterials Science (RSC...
Development of efficient carriers for small interfering RNA (siRNA) delivery and validation tools for assessing in vivo RNA interference (RNAi) efficiency is crucial to advance RNAi-based therapeutics to the clinic. Here, acid-degradable ketalized linear polyethylenimine (KL-PEI) designed for efficient, stim
http://pubs.rsc.org/en/content/articlelanding/2014/bm/c3bm60187k
Gates Funding RNA Treatment for HIV Infection | Science and EnterpriseGates Funding RNA Treatment for HIV Infection | Science and Enterprise
The Gates Foundation is backing a biotechnology companys early development of antibodies to treat human immunodeficiency virus or HIV based on RNA.
https://sciencebusiness.technewslit.com/?p=28339
jetPRIME - DNA / siRNA transfection reagent - Polyplus-transfectionjetPRIME - DNA / siRNA transfection reagent - Polyplus-transfection
Looking for a powerful and versatile DNA and siRNA transfection reagent? Try jetPRIME to obtain efficient and reliable scientific results! Request your jetPRIME sample immediately!
https://www.polyplus-transfection.com/products/jetprime/
Paramutation of tobacco transgenes by small RNA-mediated transcriptio…Paramutation of tobacco transgenes by small RNA-mediated transcriptio…
Detail záznamu - Paramutation of tobacco transgenes by small RNA-mediated transcriptional gene silencing - Detail záznamu - Knihovna Akademie věd České republiky
https://asep.lib.cas.cz/arl-cav/m-sk/detail-cav_un_epca-0360303-Paramutation-of-tobacco-transgenes-by-small-RNAmediated-transcriptional-gene-silencing/
Measuring siRNA-mediated knockdown of IL-8 mRNA ( By Genospectra Inc. 6519 Dumbart...)Measuring siRNA-mediated knockdown of IL-8 mRNA ( By Genospectra Inc. 6519 Dumbart...)
...By Genospectra Inc. 6519 Dumbarton Circle Fremont CA 94555. ... ... A critical step in siRNA-mediated gene expression knockdown st... INTRODUCTION There are many sources of exp...,Measuring,siRNA-mediated,knockdown,of,IL-8,mRNA,biological,advanced biology technology,biology laboratory technology,biology device technology,latest biology technology
http://www.bio-medicine.org/biology-technology/Measuring-siRNA-mediated-knockdown-of-IL-8-mRNA-1434-1/
Mechanism and functions of small RNA pathways in Neurospora - Yi LiuMechanism and functions of small RNA pathways in Neurospora - Yi Liu
RNA interference (RNAi) is a post-transcriptional/transcriptional gene silencing mechanism conserved from fungi to humans. In RNAi pathways, small non-coding RN...
http://grantome.com/grant/NIH/R01-GM084283-05
Plus itPlus it
Though ZNF 746 known as Parkin-interacting substrate (PARIS) was reported to repress PGC-1α and its target gene NRF-1 leading to the neurodegeneration in Parkinsons disease, its function in tumorigenesis has not been investigated until now. Thus, in the present study, the role of ZNF746 was investigated in the invasion and epithelial to mesenchymal transition (EMT) in ZNF746 overexpressed H460 non-small cell lung cancer (NSCLC) cells. Invasion assay showed that inhibition of ZNF 746 using siRNA transfection method inhibited the invasion of H460 cells using Boyden chamber. Real-time quantitative RT-PCR (RT-qPCR) revealed that the silencing of ZNF 746 attenuated the expression of matrix metalloproteinase (MMP) 1, MMP2 and MMP 9, but not MMP7 in H460 cells. Immunoblotting assay revealed that the expressions of E-cadherin of epithelial phenotype were up-regulated, while Slug was down-regulated in ZNF746 siRNA transfected H460 cells. Consistently, mRNA expression of E-cadherin was up-regulated ...
http://clincancerres.aacrjournals.org/content/20/2_Supplement/A30
Australian RNAi technology: silencing gene expression for plant, animal and human health science - CSIROAustralian RNAi technology: silencing gene expression for plant, animal and human health science - CSIRO
We have led the way in the development of what has been hailed as a major breakthrough in molecular biology: silencing gene expression by RNA interference (RNAi). CSIROs RNAi gene silencing technology is enabling researchers around the world to protect plants and animals from diseases, and to develop new plant varieties with beneficial attributes.
https://www.csiro.au/en/Research/Farming-food/Innovation-and-technology-for-the-future/Gene-technology/RNAi
siRNA, DsiRNA and Plasmid Transfection Efficiency: siRNA-mediated gene silencingsiRNA, DsiRNA and Plasmid Transfection Efficiency: siRNA-mediated gene silencing
Dr. Josephine Lai (Professor of Pharmacology, University of Arizona) is a pioneer in developing experimental designs and methods for delivering siRNA to the CNS for gene expression analysis.She and her team have documented these in the publication ...
http://sirnatransfection.blogspot.com/2008/10/sirna-mediated-gene-silencing.html
Figures and data in A team of heterochromatin factors collaborates with small RNA pathways to combat repetitive elements and...Figures and data in A team of heterochromatin factors collaborates with small RNA pathways to combat repetitive elements and...
Genome-wide profiling and functional analyses reveal a network of heterochromatin and small RNA factors that silences repetitive elements and prevents genotoxic stress to ensure fertility.
https://elifesciences.org/articles/21666/figures
Addgene: DECIPHER Mouse shRNA Libraries - Pathway and Disease TargetsAddgene: DECIPHER Mouse shRNA Libraries - Pathway and Disease Targets
DECIPHER libraries are barcoded lentiviral shRNA libraries optimized for RNAi Genetic Screens in pooled format deposited by Chenchik and Frangou.
http://www.addgene.org/pooled-library/decipher-mouse-pathway-disease-targets/
EV Shuttle Kit with HEK293 Exosomes | System BiosciencesEV Shuttle Kit with HEK293 Exosomes | System Biosciences
Figure 3. EV Shuttles deliver functional siRNA that can knockdown protein expression in recipient cells. Human HEK293 EV Shuttles were loaded with either an anti-CD81 siRNA or a non-targeting siRNA (NT) and then added to Mouse RAWS 264.7 cells. The cell lysates were collected after 18 hours for Western blot analysis of CD81 protein expression. EV Shuttles carrying the anti-CD81 siRNA were able to reduce CD81 protein expression in the target cells by at least 50% compared to EV Shuttles carrying the NT control siRNA.. EV Shuttles can be used as a non-viral method for generating stable cell lines Because plasmids can be transfected into exosomes with the EV Shuttle System, EV Shuttles can be used to generate stable cell lines without the use of viruses. Here we show an example using our non-viral ...
https://systembio.com/shop/ev-shuttle-exosomes-from-hek293-cells/
Alnylam Continues Leadership in RNAi Technologies and Delivery with New Pre-Clinical Data Presented on Enhanced Stabilization...Alnylam Continues Leadership in RNAi Technologies and Delivery with New Pre-Clinical Data Presented on Enhanced Stabilization...
Alnylam Pharmaceuticals, Inc. (Nasdaq:ALNY), the leading RNAi therapeutics company, today announced that the Company presented new pre-clinical data highlighting its next generation
https://www.pharmiweb.com/PressReleases/pressrel.asp?ROW_ID=244845
Research programme: RNA interference therapeutics - Alnylam Pharmaceuticals/Vir Biotechnology - AdisInsightResearch programme: RNA interference therapeutics - Alnylam Pharmaceuticals/Vir Biotechnology - AdisInsight
A powerful strategy for developing microbial cell factories by employing synthetic small RNAsA powerful strategy for developing microbial cell factories by employing synthetic small RNAs
The current systems for the production of chemicals, fuels and materials heavily rely on the use of fossil resources. Due to the increasing concerns on climate change and other environmental problems, however, there has been ...
https://phys.org/print295156224.html
A two-hit trigger for siRNA biogenesis in plantsA two-hit trigger for siRNA biogenesis in plants
In Arabidopsis, microRNA-directed cleavage can define one end of RNAs that then generate phased siRNAs. However, most miRNA-targeted RNAs do not spawn siRNAs, suggesting the existence of additional determinants within those that do. We find that in moss, phased siRNAs arise from regions flanked by d …
https://pubmed.ncbi.nlm.nih.gov/17081978/?dopt=Abstract
AT-406 - Synthetic Small Molecule Inhibitors of Hh SignalingAT-406 - Synthetic Small Molecule Inhibitors of Hh Signaling
Interpreting epistatic interactions is essential for understanding evolutionary dynamics of complex genetic systems and unveiling structure and function of genetic pathways. variant libraries showing AT-406 our technique could be scaled using next-generation sequencing reliably. JigsawSeq may serve as an instant screening device for useful genomics and provide the chance to explore evolutionary trajectories of proteins variants. Functional evaluation of highly complicated mutant proteins libraries is a robust device for deep mutational checking of potential sequence-function romantic relationships. Typically arbitrary mutagenesis libraries are manufactured by error-prone polymerase chain reaction (PCR)1 random shuffling2 programmed mutagenesis3 4 or assembly of synthetic oligonucleotides5. Careful. Continue Reading. ...
http://biosweepny.com/tag/at-406/
Institute of Molecular BiotechnologyInstitute of Molecular Biotechnology
Discovery of an endogenous small interfering RNA pathway in Drosophila. 2005. Discovery of the role of angiotensin converting ... "An endogenous small interfering RNA pathway in Drosophila". Nature. 453 (7196): 798-802. doi:10.1038/nature07007. ISSN 1476- ... Julius Brennecke: Transposon silencing & heterochromatin formation by small RNAs. Pioneer in the discovery of the piRNA/Piwi ... the functions of small RNAs, and the in vitro reconstitution from stem cells of whole organs and embryos. The institute ...
https://en.wikipedia.org/wiki/Institute_of_Molecular_Biotechnology
Transcriptome in vivo analysis tagTranscriptome in vivo analysis tag
July 2007). "Transvascular delivery of small interfering RNA to the central nervous system". Nature. 448 (7149): 39-43. Bibcode ... The transcriptome is a set of all RNA, including rRNA, mRNA, tRNA, and non-coding RNA. Specifically mRNA transcripts can be ... RNA-seq uses reverse transcriptase to convert the mRNA template to cDNA. During library preparation, the cDNA is fragmented ... into small pieces, which then serve as the template for sequencing. After sequencing RNA-seq analysis can then be performed. ...
https://en.wikipedia.org/wiki/Transcriptome_in_vivo_analysis_tag
Trans-acting siRNATrans-acting siRNA
Wu L, Mao L, Qi Y (October 2012). "Roles of dicer-like and argonaute proteins in TAS-derived small interfering RNA-triggered ... Trans-acting siRNA (abbreviated "ta-siRNA" or "tasiRNA") are a class of small interfering RNA (siRNA) that repress gene ... Heisel SE, Zhang Y, Allen E, Guo L, Reynolds TL, Yang X, Kovalic D, Roberts JK (2008). "Characterization of unique small RNA ... TAS3 trans-acting short-interfering RNA targeting auxin response factors ("tasiR-ARF") is an example of a ta-siRNA that has ...
https://en.wikipedia.org/wiki/Trans-acting_siRNA
Stephen FriendStephen Friend
"Small interfering RNA screens reveal enhanced cisplatin cytotoxicity in tumor cells having both BRCA network and TP53 ...
https://en.wikipedia.org/wiki/Stephen_Friend
Cherry angiomaCherry angioma
They also found that targeting MEK1 and cyclin E1 with small interfering RNA decreased the number of endothelial cells. A study ... When they first develop, they may be only a tenth of a millimeter in diameter and almost flat, appearing as small red dots. ... Cherry angiomas are made up of clusters of capillaries at the surface of the skin, forming a small round dome ("papule"), which ... eMedicine with picture showing small red dots Pereira, José Marcos (2004). "Hemangioma rubi no couro cabeludo". Anais ...
https://en.wikipedia.org/wiki/Cherry_angioma
Appolinaire DjikengAppolinaire Djikeng
... cloning of small interfering RNAs provides evidence for retroposon-derived 24-26-nucleotide RNAs". RNA. 7 (11): 1522-1530. ISSN ... Djikeng, A.; Shi, H.; Tschudi, C.; Ullu, E. (2001-11-01). "RNA interference in Trypanosoma brucei: ... next generation sequencing and RNA interference. While working at Yale University, Djikeng started volunteering for the UNESCO ...
https://en.wikipedia.org/wiki/Appolinaire_Djikeng
Complementarity (molecular biology)Complementarity (molecular biology)
Small interfering RNAs (siRNAs) are similar in function to miRNAs; they come from other sources of RNA, but serve a similar ... MiRNAs are formed from longer sequences of RNA that are cut free by a Dicer enzyme from an RNA sequence that is from a ... DNA and RNA base pair complementarity[edit]. Complementarity between two antiparallel strands of DNA. The top strand goes from ... A complementary strand of DNA or RNA may be constructed based on nucleobase complementarity.[2] Each base pair, A=T vs. G≡C, ...
https://en.wikipedia.org/wiki/Complementarity_
COX14COX14
The knockdown of the protein COX14 involving small interfering RNA in regular human fibroblast has been shown to result in a ... This gene encodes a small single-pass transmembrane protein that localizes to mitochondria. This protein may play a role in ...
https://en.wikipedia.org/wiki/COX14
DNA damage (naturally occurring)DNA damage (naturally occurring)
This would interfere with the synthesis of the protein coded for by the gene in which the blockage occurred. Brasnjevic et al. ... Bile acids, stored in the gall bladder, are released into the small intestine in response to fat in the diet. Higher levels of ... The DDP human homologs are over-represented in known cancer drivers, and their RNAs in tumors predict heavy mutagenesis and a ... In contrast, the rad9 slides show the rad9 cells existing primarily as 3 to 8 budded colonies, and they appear smaller than the ...
https://en.wikipedia.org/wiki/DNA_damage_(naturally_occurring)
Nanotechnology in agricultureNanotechnology in agriculture
DNA nanostructures have been shown to be a highly programmable modality in terms of delivery of small interfering RNA (siRNA), ... Because many organic functions such as ion exchange and plant gene expression operate on small scales, nanomaterials offer a ... and little to no risk of DNA incorporation. Biolistics is the primary approach to plant transformation. The biolistic process ...
https://en.wikipedia.org/wiki/Nanotechnology_in_agriculture
Transposable elementTransposable element
Yang N, Kazazian HH (September 2006). "L1 retrotransposition is suppressed by endogenously encoded small interfering RNAs in ... Class I TEs are copied in two stages: first, they are transcribed from DNA to RNA, and the RNA produced is then reverse ... Jin Y, Zhang W, Li Q (June 2009). "Origins and evolution of ADAR‐mediated RNA editing". IUBMB Life. 61 (6): 572-578. doi: ... TEs also serve to generate repeating sequences that can form dsRNA to act as a substrate for the action of ADAR in RNA editing ...
https://en.wikipedia.org/wiki/Transposable_elements
Transposable elementTransposable element
Yang N, Kazazian HH (September 2006). "L1 retrotransposition is suppressed by endogenously encoded small interfering RNAs in ... Class I TEs are copied in two stages: first, they are transcribed from DNA to RNA, and the RNA produced is then reverse ... In human embryos, two types of transposons combined to form noncoding RNA that catalyzes the development of stem cells. During ... For example, after conversion of retroviral RNA into DNA inside a host cell, the newly produced retroviral DNA is integrated ...
https://en.wikipedia.org/wiki/Transposon
PatisiranPatisiran
It is the first small interfering RNA-based drug approved by the U.S. Food and Drug Administration (FDA) and the first drug ... "FDA approves first-of-its kind targeted RNA-based therapy to treat a rare disease" (Press release). U.S. Food and Drug ... It is a gene silencing drug that interferes with the production of an abnormal form of transthyretin.[medical citation needed] ...
https://en.wikipedia.org/wiki/Patisiran
Invasion (cancer)Invasion (cancer)
Based on the suppression of the expression of the relevant genes using small interfering RNAs, the specific activity of GTPases ... According to Zijl et al., the amoeboid type of invasive growth has been observed in breast cancer, lymphoma, small cell lung ... This GTPase belongs to the superfamily of small GTP hydrolases, whose members play key roles in the amoeboid type of invasion, ... The morphology of the cells that form this type of structures varies from small cells with moderate cytoplasm and round nuclei ...
https://en.wikipedia.org/wiki/Invasion_(cancer)
Spinocerebellar ataxia type 1Spinocerebellar ataxia type 1
RNAi uses very small double stranded segments of RNA called small interfering RNA which triggers degradation of the target ... in which DNA is used to generate a complementary RNA strand by RNA polymerase, and translation, in which RNA is used to produce ... A similar technique is RNA interference or RNAi. Instead of complementary 'antisense' strands of RNA, ... Small cohort studies have shown that individuals with cerebellar disorders recover coordination and have lower SARA scores ...
https://en.wikipedia.org/wiki/Spinocerebellar_ataxia_type_1
List of MeSH codes (D13)List of MeSH codes (D13)
... rna, small interfering MeSH D13.444.735.790.545 - rna, small nuclear MeSH D13.444.735.790.545.800 - rna, small nucleolar MeSH ... rna, small interfering MeSH D13.444.735.300 - rna, archaeal MeSH D13.444.735.473 - rna, bacterial MeSH D13.444.735.476 - rna, ... rna, small nuclear MeSH D13.444.735.628.818.800 - rna, small nucleolar MeSH D13.444.735.635 - rna, plant MeSH D13.444.735.635. ... rna, catalytic MeSH D13.444.735.790.400 - rna, guide MeSH D13.444.735.790.530 - rna, small cytoplasmic MeSH D13.444.735.790.537 ...
https://en.wikipedia.org/wiki/List_of_MeSH_codes_(D13)
HHV Latency Associated TranscriptHHV Latency Associated Transcript
Further research has shown that HHV-8 LAT produces RNA which interfere not with expression of TGF-β1 and SMAD3, but reducing ... Little is known about these two proteins (P17588 and P17589 in HHV-1; K4PBJ5 and Q77CA8 in BHV-1), although the loss of ORF2 in ... It was alleged that a portion of HSV-1 LAT consists of an interfering micro RNA (miRNA), termed mir-LAT. This miRNA is shown to ... The LAT RNA is produced by genetic transcription from a certain region of the viral DNA. LAT regulates the viral genome and ...
https://en.wikipedia.org/wiki/HHV_Latency_Associated_Transcript
Wiley PrizeWiley Prize
For contributions to discoveries of novel mechanisms for regulating gene expression by small interfering RNAs (siRNA). 2004 C. ... 2018 Lynne E. Maquat for elucidating the mechanism of nonsense-mediated messenger RNA decay. 2019 Svante Pääbo and David Reich ...
https://en.wikipedia.org/wiki/Wiley_Prize
TKM-EbolaTKM-Ebola
... is a combination of small interfering RNAs targeting three of the seven proteins in Ebola virus: Zaire Ebola L ...
https://en.wikipedia.org/wiki/TKM-Ebola
Alpha-AmanitinAlpha-Amanitin
This interaction interferes with the translocation of RNA and DNA needed to empty the site for the next round of RNA synthesis ... but has little effect on the affinity of pol II for nucleoside triphosphate, and a phosphodiester bond can still be formed. The ... RNA polymerase I is insensitive, RNA polymerase II is highly sensitive (inhibited at 1μg/ml), RNA polymerase III is moderately ... Gu W, Powell W, Mote J, Reines D (December 1993). "Nascent RNA cleavage by arrested RNA polymerase II does not require upstream ...
https://en.wikipedia.org/wiki/Alpha-Amanitin
Interferencia de ARN, a enciclopedia libreInterferencia de ARN, a enciclopedia libre
Tong A, Zhang Y, Nemunaitis J (2005). "Small interfering RNA for experimental cancer therapy". Curr Opin Mol Ther 7 (2): 114-24 ... Sen G, Wehrman T, Blau H (2005). "mRNA translation is not a prerequisite for small interfering RNA-mediated mRNA cleavage". ... "Caspase 8 small interfering RNA prevents acute liver failure in mice". Proc Natl Acad Sci USA 100 (13): 7797-802. PMC 164667. ... Ahlquist P (2002). "RNA-dependent RNA polymerases, viruses, and RNA silencing". Science 296 (5571): 1270-3. PMID 12016304. doi: ...
https://gl.wikipedia.org/wiki/RNAi
SCARB1SCARB1
... or small interfering RNAs. This therapy causes RNA interference, in which short segments of double stranded RNA acts to silence ...
https://en.wikipedia.org/wiki/SCARB1
RNA silencingRNA silencing
At least three primary classes of small RNA have currently been identified, namely: small interfering RNA (siRNA), microRNA ( ... including piwi-interacting RNA (piRNA) and its subspecies repeat associated small interfering RNA (rasiRNA). RNA silencing ... or exogenously derived small interfering RNA (siRNA) induces the degradation of complementary messenger RNA. Other classes of ... RNA-dependent RNA polymerases) or RDRs. Growing understanding of small RNA gene-silencing mechanisms involving dsRNA-mediated ...
https://en.wikipedia.org/wiki/RNA_silencing
RNA - Simple English Wikipedia, the free encyclopediaRNA - Simple English Wikipedia, the free encyclopedia
Small interfering RNAs (sometimes called silencing RNAs) interfere with the expression of a specific gene. They are quite small ... RNA Interference *↑ Lee R.C. & Ambros V. 2001. An extensive class of small RNAs in Caenorhabditis elegans. Science 294, 862-864 ... They are transfer RNA (tRNA) and ribosomal RNA (rRNA). tRNA[change , change source]. Transfer RNA (tRNA) is a short molecule of ... RNA is physically different from DNA: DNA contains two intercoiled strands, but RNA only contains one single strand. RNA also ...
https://simple.wikipedia.org/wiki/MRNA
Gene expression - Simple English Wikipedia, the free encyclopediaGene expression - Simple English Wikipedia, the free encyclopedia
Small interfering RNAs (sometimes called silencing RNAs) interfere with the expression of a specific gene. They are quite small ... Micro RNAs (miRNA) act by joining an enzyme and blocking mRNA (messenger RNA), or speeding its breakdown. This is called RNA ... Regulatory RNAs[change , change source]. There are a number of RNAs which regulate genes, that is, they regulate the rate at ... Hamilton A & Baulcombe D (1999). "A species of small antisense RNA in posttranscriptional gene silencing in plants". Science ...
https://simple.wikipedia.org/wiki/Gene_expression
Piwi-interacting RNAPiwi-interacting RNA
Further, it is thought that piRNA and endogenous small interfering RNA (endo-siRNA) may have comparable and even redundant ... Piwi-interacting RNA (piRNA) is the largest class of small non-coding RNA molecules expressed in animal cells. piRNAs form RNA- ... Due to their small size, expression and amplification of small RNAs can be challenging, so specialised PCR-based methods have ... Ozata DM, Gainetdinov I, Zoch A, Phillip D, Zamore PD (2019). "PIWI-interacting RNAs: small RNAs with big functions". Nature ...
https://en.wikipedia.org/wiki/Piwi-interacting_RNA
Coxiella burnetiiCoxiella burnetii
In bacteria small regulatory RNAs are activated during stress and virulence conditions. Coxiella burnetii small RNAs (CbSRs 1, ... survival is enhanced because these proteins interfere with fusion of the bacteria-containing vacuole with the host's ... "Identification of novel small RNAs and characterization of the 6S RNA of Coxiella burnetii". PLOS ONE. 9 (6): e100147. Bibcode: ... These characteristics are attributed to a small cell variant form of the organism that is part of a biphasic developmental ...
https://en.wikipedia.org/wiki/Coxiella_burnetii
EIF2C2 - ويكيبيدياEIF2C2 - ويكيبيديا
"Small interfering RNAs containing full 2'-O-methylribonucleotide-modified sense strands display Argonaute2/eIF2C2-dependent ... single-stranded RNA binding. • double-stranded RNA binding. • RNA polymerase II core binding. • ربط حمض نووي. • mRNA binding. • ... "RNA. 12 (6): 943-7. PMC 1464859. . PMID 16611939. doi:10.1261/rna.20806. الوسيط ,السنة=. تم تجاهله (مساعدة); الوسيط ,الصفحات=. ... "RNA. 10 (3): 387-94. PMC 1370934. . PMID 14970384. doi:10.1261/rna.5181104. الوسيط ,السنة=. تم تجاهله (مساعدة); الوسيط ,الصفحات ...
https://ar.wikipedia.org/wiki/EIF2C2
Plant disease resistancePlant disease resistance
... which are known as small interfering RNAs and microRNAs. Among the thousands of species of plant pathogenic microorganisms, ... Expression of viral coat protein gene sequences conferred virus resistance via small RNAs. This proved to be a widely ... translation repression and chromatin remodelling through small non-coding RNAs. Mechanistically, the silencing processes are ... In a small number of cases, plant genes are effective against an entire pathogen species, even though that species that is ...
https://en.wikipedia.org/wiki/Plant_disease_resistance
Circadian clockCircadian clock
also employed a genome-wide small interfering RNA screen in U2OS cell line to identify additional clock genes and modifiers ... the authors used small interfering RNA (siRNA) to induce dose-dependent changes in gene expression of clock components within ... "RNA-methylation-dependent RNA processing controls the speed of the circadian clock". Cell. 155 (4): 793-806. doi:10.1016/j.cell ... The SCN itself is located in the hypothalamus, a small region of the brain situated directly above the optic chiasm, where it ...
https://en.wikipedia.org/wiki/Circadian_clock
Marine mammalMarine mammal
By-catch affects all cetaceans, both small and big, in all habitat types. However, smaller cetaceans and pinnipeds are most ... Tourism boats designed for whale and dolphin watching can also negatively impact on marine mammals by interfering with their ... "Phylogenetic relationships of artiodactyls and cetaceans as deduced from the comparison of cytochrome b and 12S RNA ... These small cetaceans are more often than not kept in theme parks and dolphinariums, such as SeaWorld. Bottlenose dolphins are ...
https://en.wikipedia.org/wiki/Marine_mammal
AutophagyAutophagy
... detecting single stranded RNA. Following activation of the toll-like receptor, intracellular signaling cascades are initiated, ... great efforts are invested to identify and characterize small synthetic or natural molecules that can regulate it. Biology ... proteins have proteolytic and post-translational activity such as phosphorylation and ubiquitination and can interfere with the ... "Subversion of cellular autophagosomal machinery by RNA viruses". PLOS Biology. 3 (5): e156. doi:10.1371/journal.pbio.0030156. ...
https://en.wikipedia.org/wiki/Autophagy
Glossary of diabetesGlossary of diabetes
Capillaries are always tiny, the others vary from large (centimeters in diameter) to quite small (slightly smaller than the ... An agent which interferes with the renin (kidney-lung-heart blood pressure control) cycle. An example is Atacand. (See ACE ... In humans and other multi-cellular organisms, the exceptions all use RNA, which is a very closely related molecule. DNA is ... The rest of the world uses mmol/l) Microaneurysm A small swelling that forms on the side of tiny blood vessels. These small ...
https://en.wikipedia.org/wiki/Glossary_of_diabetes
Gas vesicleGas vesicle
It is unknown exactly what controls the diameter but it may be a molecule that interferes with GvpA or the shape of GvpA may ... Halobacterium salinarum produce little or no vesicles under anaerobic conditions due to reduced synthesis of mRNA transcripts ... flagella-based motility and gas vesicle production are regulated oppositely by a single RNA binding protein, RsmA, suggesting ... It appears that gas vesicles begin their existence as small biconical (two cones with the flat bases joined together) ...
https://en.wikipedia.org/wiki/Gas_vesicle
Exosome complexExosome complex
Substrates of the exosome include messenger RNA, ribosomal RNA, and many species of small RNAs. The exosome has an ... It is presumed that this system prevents aberrant complexes from interfering with important cellular processes such as protein ... and of several small nucleolar RNAs. Although most cells have other enzymes that can degrade RNA, either from the 3' or from ... RNA. 13 (7): 1027-35. doi:10.1261/rna.575107. PMC 1894934. PMID 17545563. Carpousis AJ, AJ (2002). "The Escherichia coli RNA ...
https://en.wikipedia.org/wiki/Exosome_complex
IfosfamideIfosfamide
It works by disrupting the duplication of DNA and the creation of RNA. Ifosfamide was approved for medical use in the United ... This includes testicular cancer, soft tissue sarcoma, osteosarcoma, bladder cancer, small cell lung cancer, cervical cancer, ... this can interfere with neurological development. Apart from the brain, ifosfamide can also affect peripheral nerves. The ...
https://en.wikipedia.org/wiki/Ifosfamide
Surface-enhanced Raman spectroscopySurface-enhanced Raman spectroscopy
The gold nanoparticles facilitate the formation of a silver coating on the dye-labeled regions of DNA or RNA, allowing SERS to ... Particles that are too small lose their electrical conductance and cannot enhance the field. When the particle size approaches ... Each spectrum was specific, which is advantageous over fluorescence detection; some fluorescent markers overlap and interfere ... SERS can be used to target specific DNA and RNA sequences using a combination of gold and silver nanoparticles and Raman-active ...
https://en.wikipedia.org/wiki/Surface-enhanced_Raman_spectroscopy
ChIP sequencingChIP sequencing
Darnell RB (2010). "HITS-CLIP: panoramic views of protein-RNA regulation in living cells". Wiley Interdisciplinary Reviews. RNA ... Oligonucleotide adaptors are then added to the small stretches of DNA that were bound to the protein of interest to enable ... low-complexity regions should removed as they are not informative and may interfere with mapping in the reference genome. ... The cross-links are made between the protein and DNA, but also between RNA and other proteins. The second step is the process ...
https://en.wikipedia.org/wiki/ChIP_sequencing
Rice hoja blanca tenuivirusRice hoja blanca tenuivirus
... using an RNA-dependent RNA polymerase to convert to positive-sense RNA, and using the host's cellular machinery to produce ... Research shows that RNA3 interferes with the cell's siRNA's by binding to them, which in turn suppresses their ability to ... de Miranda, J.R.; Espinoza, A.M.; Hull, R. (January 1996). "Rapid, small scale purification of rice hoja blanca and Echinochloa ... encoding for the viral RNA-dependent RNA polymerase, which is used by the virus to help synthesize a complementary RNA strand. ...
https://en.wikipedia.org/wiki/Rice_hoja_blanca_tenuivirus
New England BiolabsNew England Biolabs
The kits offer specific depletion of the RNA species that interfere with the analysis of coding and non-coding RNAs. That same ... It received approximately $1.7 million in Small Business Innovation Research (SBIR) grants between 2009 and 2013 for this ... RNA isolation kits were also used to develop assays to detect SARS-CoV-2. NEB's Monarch Total RNA Miniprep Kit was not designed ... Purification of RNA from mouse samples in a study identifying a pathway that selectively regulates cancer stem cells, which may ...
https://en.wikipedia.org/wiki/New_England_Biolabs
Guanosine pentaphosphateGuanosine pentaphosphate
If a mutant bacterium is relA− it is said to be relaxed and no regulation of RNA production due to amino acid absence is seen. ... ppGpp can bind with Obg protein which belongs to the conserved, small GTPase protein family. Obg protein interacts with several ... ppGpp inhibits IF2-mediated fMet-Phe initiation dipeptide formation, probably by interfering with 30S and 50S subunit ... It is thought that (p)ppGpp may affect the stability of the open complex formed by RNA polymerase on DNA and therefore affect ...
https://en.wikipedia.org/wiki/Guanosine_pentaphosphate
HMS Curacoa (D41)HMS Curacoa (D41)
Little happened until 1945, when the case went to trial in June; it was adjourned to November and then to December 1946. Mr. ... These chaps are used to escorting; they will keep out of your way and won't interfere with you." At 14:04, Queen Mary started ... In association with John Cyril Porte's birthday and a medal ceremony at RNAS Felixstowe, her crew was inspected by King George ... The ship was assigned to the Harwich Force during the war, but saw little action as she was completed less than a year before ...
https://en.wikipedia.org/wiki/HMS_Curacoa_(D41)
Colony collapse disorderColony collapse disorder
RNA from all organisms in a colony was sequenced and compared with sequence databases to detect the presence of pathogens. All ... Neonicotinoids may interfere with bees' natural homing abilities, causing them to become disoriented and preventing them from ... "State notes small increase in pesticide use". westernfarmpress.com. Archived from the original on 20 November 2008. "Pesticide ... Sixty-five different RNA transcripts have been determined as potential signs for CCD status. Genetic expression of these ...
https://en.wikipedia.org/wiki/Colony_collapse_disorder
EnoxacinEnoxacin
"Small molecule enoxacin is a cancer-specific growth inhibitor that acts by enhancing TAR RNA-binding protein 2-mediated ... Quinolones and fluoroquinolones are bactericidal drugs, eradicating bacteria by interfering with DNA replication. Like other ... A small amount of a dose of drug administered is excreted in the bile. High concentrations of the fluoroquinolone are reached ...
https://en.wikipedia.org/wiki/Enoxacin
PolyphosphatePolyphosphate
Conversely, a complex mix of polymers is produced when a small amount of water is added to phosphorus pentoxide. Polyphosphates ... an RNA-polymerase subunit which is responsible for the expression of a large group of genes involved in adjustments to the ... "Bacterial polyphosphates interfere with the innate host defense to infection". Nature Communications. 11 (1): 4035. doi:10.1038 ...
https://en.wikipedia.org/wiki/Polyphosphate
Epigenetics of human developmentEpigenetics of human development
Some imprinted genes code for regulatory RNA elements such as lncRNA, small nucleolar RNA, and micro RNA, so the expression of ... non-coding RNAs, and interfering RNAs. A single evolutionary purpose of imprinting is still unknown, since the mechanisms and ... Long non-coding RNAs, or lncRNAs, are RNA transcripts produced by RNA polymerase II that are not translated but participate in ... Recent research has shown that a repeat element in the RNA of Xist causes PRC2 to bind to the RNA. Another part of the RNA ...
https://en.wikipedia.org/wiki/Epigenetics_of_human_development
Hepatitis BHepatitis B
... have very little viral multiplication and hence may be at little risk of long-term complications or of transmitting infection ... Because the virus multiplies via RNA made by a host enzyme, the viral genomic DNA has to be transferred to the cell nucleus by ... Hepatitis B virus primarily interferes with the functions of the liver by replicating in hepatocytes. A functional receptor is ... The virus is one of the smallest enveloped animal viruses. The 42 nm virions, which are capable of infecting liver cells known ...
https://en.wikipedia.org/wiki/Hepatitis_B
Eukaryotic initiation factor 3Eukaryotic initiation factor 3
... by interacting with pre-termination complexes and interfering with decoding. eIF3 binds the small ribosomal subunit (40S) at ... Several subunits of eIF3 contain RNA recognition motifs (RRMs) and other RNA binding domains to form a multisubunit RNA binding ... eIF3 has also been shown to specifically bind m6A modified RNA within 5'UTRs to promote cap-independent translation. All five ... Lee, Amy S.Y.; Kranusch, Philip J.; Cate, Jamie H.D. (2015). "eIF3 targets cell-proliferation messenger RNAs for translational ...
https://en.wikipedia.org/wiki/Eukaryotic_initiation_factor_3
Vickers K machine gunVickers K machine gun
The high rate of fire was needed for the small period of time when the gunner would be able to fire at an attacking aircraft. ... The gun continued in service with the Fleet Air Arm and its last recorded use by the navy was by 812 Squadron RNAS Barracudas ... However, the wide pan would have caused problems to accommodate, since it would have interfered with wing structures. When the ... MG 81 machine gun ShKAS machine gun Weeks, John, World War II Small Arms, New York: Galahad Books (1979), ISBN 0-88365-403-2, p ...
https://en.wikipedia.org/wiki/Vickers_K_machine_gun
AnatomyOrganismsDiseasesChemicals and DrugsAnalytical, Diagnostic and Therapeutic Techniques and EquipmentPhenomena and ProcessesDisciplines and OccupationsTechnology, Industry, AgricultureInformation ScienceHealth Care
RNARNA, Small InterferingRNA, ViralRNA EditingRNA SplicingRNA, RibosomalRNA, BacterialDNA-Directed RNA PolymerasesRNA VirusesRNA InterferenceRNA, MessengerRNA, Double-StrandedRNA, CatalyticRNA FoldingRNA Polymerase IIRNA, FungalRNA StabilityRNA HelicasesRNA, AntisenseRNA Processing, Post-TranscriptionalRNA, TransferRNA, Small NuclearRNA PrecursorsRNA, UntranslatedNucleic Acid ConformationRNA CapsSequence Analysis, RNARNA, PlantRNA, ProtozoanBase SequenceRNA, NeoplasmRNA Ligase (ATP)DEAD-box RNA HelicasesRNA Polymerase IIIMolecular Sequence DataRNA Polymerase IRNA, NuclearRNA, GuideRNA, Ribosomal, 28SRNA, Ribosomal, 18SRNA-Binding ProteinsRNA, Ribosomal, 23SRNA TransportRNA, Spliced LeaderRNA, SatelliteRNA, Ribosomal, 16SAmino Acid SequenceRNA, ArchaealNucleic Acid HybridizationProtein BiosynthesisCell LineVirus ReplicationEscherichia coliRNA CleavageMutationOligoribonucleotidesRNA, Heterogeneous NuclearTranscription, GeneticRNA, Small CytoplasmicRNA 3' End ProcessingTemplates, GeneticRNA, Small UntranslatedHeLa CellsRibonucleoproteinsRibonucleasesPoly AGenome, ViralRNA, Ribosomal, 5.8SDNARNA, Long NoncodingRNA, Small NucleolarBinding SitesRNA Virus InfectionsProtein BindingRNA, ComplementaryUridinePromoter Regions, GeneticEndoribonucleasesCell NucleusRNA, ChloroplastModels, MolecularPlasmidsReverse Transcriptase Polymerase Chain ReactionKineticsSingle-Strand Specific DNA and RNA EndonucleasesBase PairingRNA, HelminthPlant VirusesDNA PrimersGene Expression RegulationSaccharomyces cerevisiaeTranscription FactorsRNA, Transfer, PheRNA, Transfer, LysRibosomesBlotting, NorthernDNA, ViralPolymerase Chain ReactionOligonucleotidesGene Silencing5' Untranslated RegionsRNA, Transfer, TyrSequence Homology, Nucleic Acid3' Untranslated RegionsAmanitinsGenes, ViralNucleic Acid DenaturationTransfectionRibonuclease T1Molecular WeightSequence Homology, Amino AcidCell NucleolusHIV-1Cell-Free SystemProtein Structure, TertiaryDNA, ComplementaryGene Expression Regulation, ViralGenesConserved SequenceViral Nonstructural ProteinsRNA, Transfer, Amino AcylGene ExpressionIntronsRNA Splice SitesRNA, Transfer, AlaPoliovirusCells, CulturedTobaccoRibonuclease PCentrifugation, Density GradientCytoplasmNucleotidesMosaic VirusesRNA-Directed DNA PolymeraseDactinomycinOpen Reading FramesGene Expression ProfilingHepacivirusElectrophoresis, Polyacrylamide GelRNA, Transfer, AspTritiumRNA, Transfer, MetPhylogenyBromovirusRecombinant ProteinsSubstrate SpecificityRibonuclease HNuclear ProteinsModels, GeneticRegulatory Sequences, Ribonucleic AcidPolyribosomesCell Line, TumorCapsidExoribonucleasesTemperatureBacterial ProteinsRestriction MappingRNA, Transfer, GlyRNA, Transfer, HisSaccharomyces cerevisiae ProteinsRNA, Transfer, ValPoly UNodaviridaeNucleic Acid PrecursorsVirus AssemblyDefective VirusesSequence DeletionRNA, Transfer, ArgRNA, AlgalSequence Analysis, DNAHeterogeneous-Nuclear RibonucleoproteinsEscherichia coli ProteinsSpecies SpecificityAlternative SplicingVirionRibonucleoproteins, Small NuclearHepatitis Delta VirusRibosomal ProteinsRNA, Transfer, TrpOligonucleotide Array Sequence AnalysisTerminator Regions, GeneticRecombinant Fusion ProteinsMacromolecular SubstancesPlantsTime FactorsMutagenesis, Site-DirectedMutagenesisLevivirusBlotting, WesternPolynucleotidesTrypanosoma brucei bruceiDNA Restriction EnzymesModels, BiologicalExonsGene Expression Regulation, BacterialTombusvirusGuanosinePolyadenylationRNA, Transfer, LeuPhenotypeStructure-Activity RelationshipMethylationPlants, ToxicTranscriptional Elongation FactorsOligonucleotide ProbesGenetic VectorsSigma FactorEvolution, MolecularOperonArgonaute ProteinsCricetinaeLiverNucleoproteinsGene Knockdown TechniquesMagnesiumGene LibraryDNA, RibosomalUridine MonophosphateBase CompositionRNA-Induced Silencing ComplexIn Situ HybridizationTetrahymenaDrosophila melanogasterGenetic CodeDNA, BacterialCercopithecus aethiopsRNA Cap AnalogsViroidsChromatinSindbis VirusSignal TransductionViral LoadProtoplastsRNA, Transfer, ProDown-RegulationAmino Acid MotifsCrystallography, X-RaySpliceosomesTobacco Mosaic VirusNucleic Acid HeteroduplexesPlant DiseasesCytidineGenetic Complementation TestThermodynamicsGenes, ReporterCapsid ProteinsPolynucleotide AdenylyltransferaseDNA, RecombinantRNA, Transfer, SerAdenosine DeaminasePhosphorylationBacillus subtilisProteinsRNA, Transfer, Amino Acid-SpecificChromosome MappingProtein ConformationRecombination, GeneticPhosphorus IsotopesFungal ProteinsGenes, FungalCarrier ProteinsPolyribonucleotide NucleotidyltransferaseConsensus SequenceEndonucleasesRNA, Messenger, StoredSignal Recognition ParticleRegulatory Sequences, Nucleic AcidPhosphorus RadioisotopesOocytesPoint MutationReverse TranscriptionUracilT-PhagesDimerizationTumor Cells, CulturedDrosophilaRNA Polymerase Sigma 54Peptide Chain Initiation, TranslationalPseudouridineHistonesCatalysisCucumovirusElectrophoresis, Agar GelProtein SubunitsHost Factor 1 ProteinTranscriptional ActivationRNA 3' Polyadenylation SignalsRepressor ProteinstRNA MethyltransferasesGenes, BacterialTelomeraseHelper VirusesGene DeletionReticulocytesDNA ReplicationDrosophila ProteinsCycloheximideDNA ProbesComputational BiologyTransfer RNA AminoacylationXenopusMethyltransferasesFibroblastsGreen Fluorescent ProteinsPicornaviridaeArabidopsisUltraviolet RaysMicroscopy, ElectronNucleocapsidRiboswitchGlobinsPolyribonucleotidesPlant ProteinsHEK293 CellsRNA, Transfer, IleHydrogen BondingPlants, Genetically ModifiedCarmovirusEncephalomyocarditis virusAntiviral AgentsMurine hepatitis virusUridine TriphosphateCarbon IsotopesCross-Linking ReagentsNucleoside-TriphosphataseXenopus laevisTombusviridaeExosome Multienzyme Ribonuclease ComplexGene Expression Regulation, DevelopmentalGene Expression Regulation, Planttat Gene Products, Human Immunodeficiency VirusAdenineImmunoprecipitationCattleNucleotidyltransferasesRNA Cap-Binding ProteinsReal-Time Polymerase Chain ReactionTranscriptomeCatalytic DomainRetroviridaeInsect VirusesMitochondriaTrans-ActivatorsAvian Sarcoma VirusesmRNA Cleavage and Polyadenylation FactorsHot TemperatureRNA, Transfer, GluPrecipitin TestsInfluenza A virusSuppression, GeneticNucleocytoplasmic Transport ProteinsHydrolysisReoviridaePotexvirusTranscription Factors, TFIIPolynucleotide LigasesAvian leukosis virusGene Products, tatGene Expression Regulation, NeoplasticOligonucleotides, AntisenseSELEX Aptamer TechniqueTrans-SplicingHost-Pathogen InteractionsInosineAdenosine TriphosphateRibonucleoprotein, U1 Small NuclearUntranslated RegionsDNA, Single-StrandedAvian myeloblastosis virusUp-RegulationSoftwareHoloenzymesApoptosisTriticumBlotting, SouthernDNA, FungalRibonuclease, PancreaticVero CellsRifampinAllolevivirusBunyaviridaePol1 Transcription Initiation Complex ProteinsTATA-Box Binding ProteinRNA, Transfer, ThrGene Expression Regulation, EnzymologicChickensDatabases, Nucleic AcidPuromycinRNA, Transfer, GlnCell ProliferationMengovirusGene Expression Regulation, FungalDNA Mutational AnalysisRabbitsViral Structural ProteinsNuclear Magnetic Resonance, BiomolecularCytosine NucleotidesTranscription Factors, GeneralTwo-Hybrid System TechniquesAdenosine TriphosphatasesAlgorithmsGene Products, revHepatitis delta AntigensGenetic TechniquesYeastsChick EmbryoPeptidesRiboseCaenorhabditis elegansPoly CGene Products, gagActive Transport, Cell NucleusInterferonsRetroelementsSensitivity and SpecificityChromatin ImmunoprecipitationPeptide BiosynthesisKidneyPoly I-Crev Gene Products, Human Immunodeficiency VirusGuanosine MonophosphateQ beta ReplicasePoly GVirologyChloroplastsImmunoblottingGuanosine TriphosphateTranscription Initiation SiteProtein TransportManganeseAdenosineMoloney murine leukemia virusGenes, PlantAcid Anhydride HydrolasesNucleotide MappingGenotypeNeoplasm ProteinsMembrane ProteinsMultigene FamilyGenes, RegulatorTetrahymena thermophilaCell DivisionBacteriophagesMicroscopy, FluorescenceCentrifugation, ZonalAutoradiographyCell DifferentiationDichlororibofuranosylbenzimidazoleChromatography, AffinityCytidine TriphosphateAdenoviruses, HumanArabidopsis ProteinsProtein Structure, SecondaryExosomesReproducibility of ResultsPoly(A)-Binding ProteinsChromatographyZinc FingersDNA, CatalyticLuciferasesPeptide Elongation FactorsOrgan SpecificityImmunohistochemistryMice, Inbred C57BLModels, StructuralBiological EvolutionDNA HelicasesGuaninePeptide Initiation FactorsRNA, Transfer, CysAdenine NucleotidesTymovirusVesiculovirusSchizosaccharomycesEukaryotic CellsBinding, CompetitiveCell FractionationVaccinia virusSequence AnalysisHepatitis AntigensSequence HomologyMutagenesis, InsertionalFluorescent Antibody TechniqueViral Plaque AssayPlant LeavesPhosphoproteinsEnterovirusViral InterferenceEnzyme ActivationHu Paraneoplastic Encephalomyelitis AntigensEukaryotic Initiation FactorsAdenoviridaeProtein IsoformsFrameshifting, RibosomalElectrophoresisMolecular StructureAutoantigensCulture TechniquesTATA BoxChloramphenicol O-AcetyltransferaseTranscription Factor TFIIBCell SurvivalBacteriophage lambdaSimian virus 40DNA VirusesTranscription Factor TFIIIBGenetic EngineeringClosterovirusProtozoan ProteinsFramycetinViremiaAnti-HIV AgentsAmino AcidsDNA FootprintingEnhancer Elements, GeneticGammaretrovirusCell ExtractsProtein Processing, Post-TranslationalProtein-Serine-Threonine KinasesGenes, gagTransgenesRibonucleoproteins, Small NucleolarHordeumRibonucleosidesNucleic Acid Synthesis InhibitorsDeoxyribonucleasesEnterovirus B, HumanLeucineRibonucleoproteins, Small CytoplasmicAnticodonBiogenesisMethionineAlphavirusAllelesNucleosidesRhinovirusHIVOrotic AcidChenopodium quinoaProtein PrecursorsSemliki forest virusTranscription Initiation, GeneticPotassium PermanganateDengue VirusMagnetic Resonance SpectroscopyGenomicsPeptide Chain Elongation, TranslationalOrthomyxoviridaeDose-Response Relationship, DrugBiological TransportMammalsChromosomal Proteins, Non-HistoneTranscription Elongation, GeneticCD4 Lymphocyte CountBrainCell Cycle ProteinsOncogenic VirusesHIV Reverse TranscriptaseTranscription Factors, TFIIILuteovirusHaplorhiniCodon, InitiatorEmbryo, Nonmammaliangag Gene Products, Human Immunodeficiency VirusPotyvirusGenomeThiouridineCell Transformation, ViralArchaeal ProteinsMice, Inbred BALB CProtein Interaction Domains and MotifsRNA, Transfer, AsnDNA, MitochondrialOligoribonucleotides, AntisensePurinesCarcinoma, Krebs 2VirusesChromatography, Ion ExchangeNIH 3T3 CellsAlpha-AmanitinCucumis sativusMolecular Probe TechniquesTranscription Termination, GeneticPolynucleotide 5'-Hydroxyl-KinaseInterferon-betaLentivirusIn Situ Hybridization, FluorescenceBacteriaAlu ElementsTissue DistributionBunyamwera virusRibonucleoprotein, U4-U6 Small NuclearModels, ChemicalGuanine NucleotidesTranscription Factor TFIIHNuclease Protection AssaysGuanosine TetraphosphateMediator ComplexFlaviviridaeLigandsCell Transformation, NeoplasticRotavirusLuminescent ProteinsCytosineChromosome DeletionSatellite VirusesNerve Tissue ProteinsDNA, IntergenicSubcellular FractionsProtein KinasesCluster AnalysisPositive Transcriptional Elongation Factor Bbeta-GalactosidaseWest Nile virusHydrogen-Ion ConcentrationCaenorhabditis elegans ProteinsCodon, TerminatorChemistryDiarrhea Viruses, Bovine ViralRauscher VirusTranscription Factor TFIIDTATA-Binding Protein Associated FactorsMicroarray AnalysisMicroinjectionsTrioxsalenVirus CultivationLysineChimeraCations, DivalentChloramphenicolEukaryotaDeoxyribonuclease ITransformation, GeneticComputer SimulationSulfuric Acid EstersGenes, InsectToll-Like Receptor 3HepatovirusArchaeaEukaryotic Initiation Factor-4AS-AdenosylmethionineInterferon-alphaGene AmplificationTobamovirusMolecular ChaperonesDeoxyadenosinesChemical PhenomenaFormaldehydeEncephalitis Viruses, JapaneseVirulenceThermus thermophilusCell Line, TransformedChromatography, DEAE-CelluloseInsect ProteinsSpecimen HandlingAntisense Elements (Genetics)Oryza sativaAntigens, ViralPlant Viral Movement ProteinsProvirusesEmbryo, MammalianCircular DichroismFlow CytometryG-QuadruplexesAnimals, Genetically ModifiedReagent Kits, DiagnosticPoly A-UChromatography, GelMice, KnockoutNuclear Matrix-Associated Proteins
Small Interfering RNA-Mediated Silencing of Cytochrome P450 3A4 Gene | Drug Metabolism & DispositionSmall Interfering RNA-Mediated Silencing of Cytochrome P450 3A4 Gene | Drug Metabolism & Disposition
ABBREVIATIONS: RNAi, RNA interference; siRNA, small interfering RNA; RISC, RNA-induced silencing complex; P450, cytochrome P450 ... Small Interfering RNA-Mediated Silencing of Cytochrome P450 3A4 Gene. Jie Chen, Xiao-Xia Yang, Min Huang, Ze-Ping Hu, Ming He, ... Small Interfering RNA-Mediated Silencing of Cytochrome P450 3A4 Gene. Jie Chen, Xiao-Xia Yang, Min Huang, Ze-Ping Hu, Ming He, ... Small Interfering RNA-Mediated Silencing of Cytochrome P450 3A4 Gene. Jie Chen, Xiao-Xia Yang, Min Huang, Ze-Ping Hu, Ming He, ...
https://dmd.aspetjournals.org/content/34/9/1650
Antitumor Activity of Small Interfering RNA/Cationic Liposome Complex in Mouse Models of Cancer | Clinical Cancer ResearchAntitumor Activity of Small Interfering RNA/Cationic Liposome Complex in Mouse Models of Cancer | Clinical Cancer Research
Although the RNA interference effect, which is mediated by small interfering RNA (siRNA) or micro-RNA, has potential ... Small interfering RNAs (siRNAs), which are small double-stranded RNA (dsRNA) oligonucleotides with or without overhangs, are ... Small interfering RNA functions by binding to RNA-induced silencing complex in the cytosol, so that the delivery of siRNA ... Vickers TA, Koo S, Bennet CF, et al Efficient reduction of target RNAs by small interfering RNA and RNase H-dependent antisense ...
http://clincancerres.aacrjournals.org/content/10/22/7721
Small interfering RNA - WikipediaSmall interfering RNA - Wikipedia
Small interfering RNA (siRNA), sometimes known as short interfering RNA or silencing RNA, is a class of double-stranded RNA non ... Jensen K, Anderson JA, Glass EJ (April 2014). "Comparison of small interfering RNA (siRNA) delivery into bovine monocyte- ... Li L (2008). "Small RNA-Mediated Gene Activation". In Morris KV (ed.). RNA and the Regulation of Gene Expression: A Hidden ... Dicer cuts the long dsRNA to form short interfering RNA or siRNA; this is what enables the molecules to form the RNA-Induced ...
https://en.wikipedia.org/wiki/Small_interfering_RNA
Genomewide view of gene silencing by small interfering RNAs | PNASGenomewide view of gene silencing by small interfering RNAs | PNAS
Abbreviations: RNAi, RNA interference; dsRNA, double-stranded RNA; siRNA, small interfering RNA; miRNA, microRNA; YFP, yellow ... cells that directs the degradation of messenger RNAs homologous to short double-stranded RNAs termed small interfering RNA ( ... Genomewide view of gene silencing by small interfering RNAs. Jen-Tsan Chi, Howard Y. Chang, Nancy N. Wang, Dustin S. Chang, ... Genomewide view of gene silencing by small interfering RNAs. Jen-Tsan Chi, Howard Y. Chang, Nancy N. Wang, Dustin S. Chang, ...
https://www.pnas.org/content/100/11/6343?ijkey=af24d1e5235d4100a3fcd67ed065c4f2583ec651&keytype2=tf_ipsecsha
Poly(Ester Amine)-Mediated, Aerosol-Delivered Akt1 Small Interfering RNA Suppresses Lung Tumorigenesis - RedorbitPoly(Ester Amine)-Mediated, Aerosol-Delivered Akt1 Small Interfering RNA Suppresses Lung Tumorigenesis - Redorbit
Poly(ester amine) carrier may serve as an effective carrier, and aerosol delivery of Akt1 small interfering RNA may be a ... Poly(Ester Amine)-Mediated, Aerosol-Delivered Akt1 Small Interfering RNA Suppresses Lung Tumorigenesis. by Sam Savage ... were used for in vivo effects of aerosol-delivered Akt1 small interfering RNA (siRNA) in lung tumorigenesis. In K-ras^sup LA1^ ... To demonstrate the feasibility and emphasize the importance of noninvasive aerosol delivery of Akt1 small interfering RNA ( ...
http://www.redorbit.com/news/health/1459846/polyester_aminemediated_aerosoldelivered_akt1_small_interfering_rna_suppresses_lung_tumorigenesis/
Phys.org - small interfering rnaPhys.org - small interfering rna
Small interfering RNA. Small interfering RNA (siRNA), sometimes known as short interfering RNA or silencing RNA, is a class of ... Approval of first RNA interference drug - why the excitement?. Small interfering RNA sounds like something from a science ... attaching antibody-like RNA nanoparticles to microvesicles can deliver effective RNA therapeutics such as small interfering RNA ... The group published their findings in Science in a paper titled "A species of small antisense RNA in posttranscriptional gene ...
https://phys.org/tags/small+interfering+rna/
Viral small interfering RNAs target host genes to mediate disease symptoms in plants. - PubMed - NCBIViral small interfering RNAs target host genes to mediate disease symptoms in plants. - PubMed - NCBI
We show that the yellowing symptoms are a result of small interfering RNA (siRNA)-directed RNA silencing of the chlorophyll ... Viral small interfering RNAs target host genes to mediate disease symptoms in plants.. Smith NA1, Eamens AL, Wang MB. ... Viral Small Interfering RNAs Target Host Genes to Mediate Disease Symptoms in Plants ... Viral Small Interfering RNAs Target Host Genes to Mediate Disease Symptoms in Plants ...
https://www.ncbi.nlm.nih.gov/pubmed/21573142?dopt=Abstract
Small interfering RNA (siRNA)Small interfering RNA (siRNA)
... Predesigned siRNA product lines. Guaranteed to silence target gene ... Predesigned for Human and Mouse long noncoding RNA (lncRNA). +. Recommended for transfectable mammalian cells in culture. +. + ... Lincode siRNA Highly specific knockdown of long noncoding RNA (lncRNA). Accell siRNA Target silencing in difficult-to-transfect ... siRNAs for efficient knockdown of long, noncoding RNA (lncRNA) genes with modifications to ensure specificity. ...
https://horizondiscovery.com/en/products/gene-modulation/knockdown-reagents/controls/PIFs/~/link.aspx?_id=4799651F-176A-43F6-BB5E-0816A8B4EBAB&_z=z
IJMS | Free Full-Text | Prevention of Tendon Adhesions by ERK2 Small Interfering RNAs | HTMLIJMS | Free Full-Text | Prevention of Tendon Adhesions by ERK2 Small Interfering RNAs | HTML
Using a chicken model, we have examined the effects of a small interfering RNA (siRNA) targeting ERK2 delivered by a lentiviral ... RNA interference (RNAi) is an evolutionarily conserved process in which cells employ small interfering RNA (siRNA) duplexes to ... Prevention of Tendon Adhesions by ERK2 Small Interfering RNAs. Hongjiang Ruan †, Shen Liu †, Fengfeng Li, Xujun Li and Cunyi ... Using a chicken model, we have examined the effects of a small interfering RNA (siRNA) targeting ERK2 delivered by a lentiviral ...
http://www.mdpi.com/1422-0067/14/2/4361/htm
IJMS | Free Full-Text | Prevention of Tendon Adhesions by ERK2 Small Interfering RNAs | NotesIJMS | Free Full-Text | Prevention of Tendon Adhesions by ERK2 Small Interfering RNAs | Notes
Using a chicken model, we have examined the effects of a small interfering RNA (siRNA) targeting ERK2 delivered by a lentiviral ... Small Regulatory RNAs in the Control of Motility and Biofilm Formation in E. coli and Salmonella ...
http://www.mdpi.com/1422-0067/14/2/4361/notes
Identification of essential genes in cultured mammalian cells using small interfering RNAs. - PubMed - NCBIIdentification of essential genes in cultured mammalian cells using small interfering RNAs. - PubMed - NCBI
Identification of essential genes in cultured mammalian cells using small interfering RNAs.. Harborth J1, Elbashir SM, Bechert ... We report the first RNAi-induced phenotypes in mammalian cultured cells using RNA interference mediated by duplexes of 21-nt ... Genes were classified as essential or nonessential depending on impaired cell growth after RNA silencing. Phenotypes also ... RNAs. The 21 gene products studied have different functions and subcellular localizations. Knockdown experiments monitored by ...
https://www.ncbi.nlm.nih.gov/pubmed/11792820?dopt=Abstract
Production of transgenic pigs that express porcine endogenous retrovirus small interfering RNAsProduction of transgenic pigs that express porcine endogenous retrovirus small interfering RNAs
Small interfering RNAs (siRNA) were expressed as short hairpin RNAs (shRNA) against the gag and pol PERV genes, respectively, ... Production of transgenic pigs that express porcine endogenous retrovirus small interfering RNAs Xenotransplantation. May-Jun ... PERV knockdown was achieved whether the shRNA was expressed under the control of a RNA pol III, or a pol II promoter. Three ... The recently developed RNA interference (RNAi) technology to knockdown/silence post-transcriptional gene expression, offers a ...
https://pubmed.ncbi.nlm.nih.gov/19566656/
Transgene suppression in plants by foliar application of in vitro-synthesized small interfering RNAs | SpringerLinkTransgene suppression in plants by foliar application of in vitro-synthesized small interfering RNAs | SpringerLink
Transgene suppression in plants by foliar application of in vitro-synthesized small interfering RNAs. *Alexandra S. Dubrovina. ... Transgene suppression in plants by foliar application of in vitro-synthesized small interfering RNAs. Appl Microbiol Biotechnol ... Singh A, Gautam V, Singh S, Sarkar Das S, Verma S, Mishra V, Mukherjee S, Sarkar AK (2018) Plant small RNAs: advancement in the ... Borges F, Martienssen RA (2015) The expanding world of small RNAs in plants. Nat Rev Mol Cell Biol 16:727-741 ...
https://link.springer.com/article/10.1007%2Fs00253-020-10355-y
Systematic coarse-grained modeling of complexation between small interfering RNA and polycations (Journal Article) | SciTech...Systematic coarse-grained modeling of complexation between small interfering RNA and polycations (Journal Article) | SciTech...
Here, we systematically develop such a model for the complexation of small interfering RNA (siRNA) and grafted ... Journal Article: Systematic coarse-grained modeling of complexation between small interfering RNA and polycations ... Title: Systematic coarse-grained modeling of complexation between small interfering RNA and polycations ...
https://www.osti.gov/scitech/biblio/22493384-systematic-coarse-grained-modeling-complexation-between-small-interfering-rna-polycations
Testing Novel Compounds for Noninvasive Delivery of Small Interfering RNA into CNS | Parkinsons DiseaseTesting Novel Compounds for Noninvasive Delivery of Small Interfering RNA into CNS | Parkinson's Disease
Small interfering RNA (siRNA) molecules have been successfully used to target specific genes in cell culture. However, the lack ... Testing Novel Compounds for Noninvasive Delivery of Small Interfering RNA into CNS. Rapid Response Innovation Awards, 2011. ... Gene expression can be specifically modulated by molecules named small interfering RNAs (siRNAs). Although siRNAs have emerged ... Recently, we have designed non-viral vectors that can deliver functional small interfering siRNAs specifically into cultured ...
https://www.michaeljfox.org/foundation/grant-detail.php?grant_id=929
Combined Small Interfering RNA Therapy and In Vivo Magnetic Resonance Imaging in Islet Transplantation | DiabetesCombined Small Interfering RNA Therapy and In Vivo Magnetic Resonance Imaging in Islet Transplantation | Diabetes
Combined Small Interfering RNA Therapy and In Vivo Magnetic Resonance Imaging in Islet Transplantation. ... Combined Small Interfering RNA Therapy and In Vivo Magnetic Resonance Imaging in Islet Transplantation ... Combined Small Interfering RNA Therapy and In Vivo Magnetic Resonance Imaging in Islet Transplantation ... Combined Small Interfering RNA Therapy and In Vivo Magnetic Resonance Imaging in Islet Transplantation ...
http://diabetes.diabetesjournals.org/content/60/2/565
Small interfering RNA-mediated translation repression alters ribosome by Xinrong Ma"Small interfering RNA-mediated translation repression alters ribosome " by Xinrong Ma
We demonstrated that small RNAs (sRNAs) generated from exogenously introduced inverted repeat transgenes, with perfect ... RNA interference (RNAi) is an evolutionarily conserved gene silencing mechanism in eukaryotes, with regulatory roles in a ... Ma, Xinrong, "Small interfering RNA-mediated translation repression alters ribosome sensitivity to inhibition by cycloheximide ... Small interfering RNA-mediated translation repression alters ribosome sensitivity to inhibition by cycloheximide in ...
https://digitalcommons.unl.edu/dissertations/AAI3558863/
Inhibition of HIV-1 Infection by Small Interfering RNA-Mediated RNA Interference | The Journal of ImmunologyInhibition of HIV-1 Infection by Small Interfering RNA-Mediated RNA Interference | The Journal of Immunology
Inhibition of HIV-1 Infection by Small Interfering RNA-Mediated RNA Interference. John Capodici, Katalin Karikó and Drew ... Inhibition of HIV-1 Infection by Small Interfering RNA-Mediated RNA Interference ... Inhibition of HIV-1 Infection by Small Interfering RNA-Mediated RNA Interference ... Inhibition of HIV-1 Infection by Small Interfering RNA-Mediated RNA Interference ...
http://www.jimmunol.org/content/169/9/5196
Evaluation of Small Interfering RNA Delivery into Cells by Reverse Transfection in Suspension with Cationic LiposomesEvaluation of Small Interfering RNA Delivery into Cells by Reverse Transfection in Suspension with Cationic Liposomes
Successful gene silencing by small interfering RNA (siRNA) requires efficient uptake of siRNA into targeted cells. For in vitro ... Synthetic small interfering RNAs (siRNAs), which are small, double-stranded RNAs, are substrates for the RNA-induced silencing ... Evaluation of Small Interfering RNA Delivery into Cells by Reverse Transfection in Suspension with Cationic Liposomes () ... Successful gene silencing by small interfering RNA (siRNA) requires efficient uptake of siRNA into targeted cells. For in vitro ...
https://www.scirp.org/journal/paperinformation.aspx?paperid=76143
A Theranostic Small Interfering RNA Nanoprobe Protects Pancreatic Islet Grafts From Adoptively Transferred Immune Rejection |...A Theranostic Small Interfering RNA Nanoprobe Protects Pancreatic Islet Grafts From Adoptively Transferred Immune Rejection |...
Combined small interfering RNA therapy and in vivo magnetic resonance imaging in islet transplantation. Diabetes 2011;60:565- ... A Theranostic Small Interfering RNA Nanoprobe Protects Pancreatic Islet Grafts From Adoptively Transferred Immune Rejection. ... A Theranostic Small Interfering RNA Nanoprobe Protects Pancreatic Islet Grafts From Adoptively Transferred Immune Rejection ... Here, we used a dual-purpose therapy/imaging small interfering (si)RNA magnetic nanoparticle (MN) probe that targets β2 ...
http://diabetes.diabetesjournals.org/content/61/12/3247
JCI - Citations to Stable expression of small interfering RNA sensitizes TEL-PDGFβR to inhibition with imatinib or rapamycinJCI - Citations to Stable expression of small interfering RNA sensitizes TEL-PDGFβR to inhibition with imatinib or rapamycin
Stable expression of small interfering RNA sensitizes TEL-PDGFβR to inhibition with imatinib or rapamycin. ... Stable expression of small interfering RNA sensitizes TEL-PDGFβR to inhibition with imatinib or rapamycin. ... which is mediated by small interfering RNA (siRNA). We developed a retroviral system for stable expression of siRNA directed to ... Small molecule inhibitors, such as imatinib, are effective therapies for tyrosine kinase fusions BCR-ABL-TEL-PDGFβR-mediated ...
https://www.jci.org/articles/view/20673/citations
Therapeutic EphA2 Gene Targeting In vivo Using Neutral Liposomal Small Interfering RNA Delivery | Cancer ResearchTherapeutic EphA2 Gene Targeting In vivo Using Neutral Liposomal Small Interfering RNA Delivery | Cancer Research
Therapeutic EphA2 Gene Targeting In vivo Using Neutral Liposomal Small Interfering RNA Delivery. Charles N. Landen Jr., Arturo ... Small interfering RNA constructs and in vitro delivery. siRNA was purchased from Qiagen (Valencia, CA) in three formulations. A ... Small interfering RNA (siRNA) targeting VEGF effectively inhibits ocular neovascularization in a mouse model. Mol Vis 2003; 9: ... Small interfering RNA targeting heme oxygenase-1 enhances ischemia-reperfusion-induced lung apoptosis. J Biol Chem 2004; 279: ...
https://cancerres.aacrjournals.org/content/65/15/6910?ijkey=a5453de73cf4a9a389e8c7daee010a5f2ed0c539&keytype2=tf_ipsecsha
Safety and Efficacy Study of Small Interfering RNA Molecule (Cand5) to Treat Diabetic Macular Edema - Full Text View -...Safety and Efficacy Study of Small Interfering RNA Molecule (Cand5) to Treat Diabetic Macular Edema - Full Text View -...
Safety and Efficacy Study of Small Interfering RNA Molecule (Cand5) to Treat Diabetic Macular Edema. The safety and scientific ... Cand5 is a small interfering RNA molecule that selectively silences the mRNA encoding for VEGF. The target population are ... The molecule is a duplex formed by the hybridization of two partially complementary single strand RNAs in which the 3 end are ... Cand5 is a synthetic double stranded RNA (dsRNA) oligonucleotide. ...
https://clinicaltrials.gov/ct2/show/NCT00306904?intr=%22Cand5%22&rank=2
Safety and Efficacy Study of Small Interfering Ribonucleic Acid (RNA) Molecule (Cand5) to Treat Wet Age-Related Macular...Safety and Efficacy Study of Small Interfering Ribonucleic Acid (RNA) Molecule (Cand5) to Treat Wet Age-Related Macular...
Cand5, a small interfering RNA molecule that selectively silences the mRNA encoding for VEGF. ... Safety and Efficacy Study of Small Interfering Ribonucleic Acid (RNA) Molecule (Cand5) to Treat Wet Age-Related Macular ...
https://clinicaltrials.gov/ct2/show/NCT00259753
Atu027, a Liposomal Small Interfering RNA Formulation Targeting Protein Kinase N3, Inhibits Cancer Progression | Cancer ResearchAtu027, a Liposomal Small Interfering RNA Formulation Targeting Protein Kinase N3, Inhibits Cancer Progression | Cancer Research
We have previously described a small interfering RNA (siRNA) delivery system (AtuPLEX) for RNA interference (RNAi) in the ... Atu027, a Liposomal Small Interfering RNA Formulation Targeting Protein Kinase N3, Inhibits Cancer Progression. Manuela Aleku, ... Therapeutic EphA2 gene targeting in vivo using neutral liposomal small interfering RNA delivery. Cancer Res 2005; 65: 6910-8. ... Novel cationic cardiolipin analogue-based liposome for efficient DNA and small interfering RNA delivery in vitro and in vivo. ...
http://cancerres.aacrjournals.org/content/68/23/9788?ijkey=e1f1d94f19d9e6d8e880c828e46770cf9c308c82&keytype2=tf_ipsecsha
Phased, Secondary, Small Interfering RNAs in Posttranscriptional Regulatory Networks | Plant CellPhased, Secondary, Small Interfering RNAs in Posttranscriptional Regulatory Networks | Plant Cell
... small interfering RNAs (phasiRNAs), originally designated as trans-acting small interfering RNAs or tasiRNAs. PhasiRNA ... small interfering RNAs (phasiRNAs); and natural antisense transcript small interfering RNAs (NAT-siRNAs). These categories are ... Small interfering RNAs (siRNAs) are defined by the dependency of their biogenesis on an RNA-dependent RNA polymerase (RDR). The ... 2012). RNA polymerase V-dependent small RNAs in Arabidopsis originate from small, intergenic loci including most SINE repeats. ...
http://www.plantcell.org/content/25/7/2400.full
Evaluation of locked nucleic acid-modified small interfering RNA in vitro and in vivo | Molecular Cancer TherapeuticsEvaluation of locked nucleic acid-modified small interfering RNA in vitro and in vivo | Molecular Cancer Therapeutics
RNA interference has become widely used as an experimental tool to study gene function. In addition, small interfering RNA ( ... ATP requirements and small interfering RNA structure in the RNA interference pathway. Cell 2001;107:309-21. ... Sequence, chemical, and structural variation of small interfering RNAs and short hairpin RNAs and the effect on mammalian gene ... Evaluation of locked nucleic acid-modified small interfering RNA in vitro and in vivo. Olaf R. Mook, Frank Baas, Marit B. de ...
http://mct.aacrjournals.org/content/6/3/833.long
Kallikrein gene knock-down by small interfering RNA transfection induces a profibrotic phenotype in rat mesangial cells.Kallikrein gene 'knock-down' by small interfering RNA transfection induces a profibrotic phenotype in rat mesangial cells.
RNA, Messenger / antagonists & inhibitors, genetics. RNA, Small Interfering / pharmacology*. Rats. Rats, Wistar. Receptor, ... 0/Culture Media, Conditioned; 0/Fibronectins; 0/LDL-Receptor Related Protein 1; 0/RNA, Messenger; 0/RNA, Small Interfering; 0/ ... its expression using specific small interfering RNAs (siRNA). METHODS: Rat mesangial cells were treated with 12, 60, 120 nmol/l ...
http://www.biomedsearch.com/nih/Kallikrein-gene-knock-down-by/18090545.html
Characterization and evaluation of amphipathic, cationic peptides for small interfering RNA deliveryCharacterization and evaluation of amphipathic, cationic peptides for small interfering RNA delivery
Characterization and evaluation of amphipathic, cationic peptides for small interfering RNA delivery. ... Baoling Chen (2015). Characterization and evaluation of amphipathic, cationic peptides for small interfering RNA delivery. ... which can be triggered by small interfering RNA. The efficiency and specificity of this process makes siRNA a powerful tool for ... In the human non-small cell lung tumor xenograft model, the STR-HK-siRNA complexes induced the highest tumor inhibition rate ( ...
https://uwspace.uwaterloo.ca/handle/10012/9447
Chemical Modification Patterns Compatible with High Potency Dicer-Substrate Small Interfering RNAsChemical Modification Patterns Compatible with High Potency Dicer-Substrate Small Interfering RNAs
Dicer-substrate small interfering RNAs (DsiRNAs) are synthetic RNA duplexes that are processed by Dicer into 21-mer species and ... O-methyl RNA, phosphorothioates and small interfering RNA. Nucleic Acids Res. 2003;31:3185-3193. [PMC free article] [PubMed] ... called small interfering RNAs (siRNAs), are the actual molecular triggers of RNAi and direct target specificity of the RNA- ... and structural variation of small interfering RNAs and short hairpin RNAs and the effect on mammalian gene silencing. Antisense ...
http://pubmedcentralcanada.ca/pmcc/articles/PMC2582043/
Oral History | CSHL | Research | Ron Plasterk on Small Interfering RNAsOral History | CSHL | Research | Ron Plasterk on Small Interfering RNAs
Actually I think that at the core of it more important that double-stranded RNA are the small interfering RNAs - the SiRNAs - ... Small Interfering RNAs (Ron Plasterk) Then use your browsers back button to return ... these small RNAs that were made by the dicer-protein so you have long double stranded RNA which is diced by these dicer-RNAs ... RNA Induced Silencing Complex - and that can find the messenger RNA and base pair to it. And if it base pairs to it ...
http://library.cshl.edu/oralhistory/interview/cshl/research/small-interfering-rnas/
AnatomyOrganismsDiseasesChemicals and DrugsAnalytical, Diagnostic and Therapeutic Techniques and EquipmentPhenomena and ProcessesDisciplines and OccupationsTechnology, Industry, AgricultureInformation ScienceHealth Care
RNARNA, Small InterferingRNA, ViralRNA EditingRNA SplicingRNA, RibosomalRNA, BacterialDNA-Directed RNA PolymerasesRNA VirusesRNA InterferenceRNA, MessengerRNA, Double-StrandedRNA, CatalyticRNA FoldingRNA Polymerase IIRNA, FungalRNA StabilityRNA HelicasesRNA, AntisenseRNA Processing, Post-TranscriptionalRNA, TransferRNA, Small NuclearRNA PrecursorsRNA, UntranslatedNucleic Acid ConformationRNA CapsSequence Analysis, RNARNA, PlantRNA, ProtozoanBase SequenceRNA, NeoplasmRNA Ligase (ATP)DEAD-box RNA HelicasesRNA Polymerase IIIMolecular Sequence DataRNA Polymerase IRNA, NuclearRNA, GuideRNA, Ribosomal, 28SRNA, Ribosomal, 18SRNA-Binding ProteinsRNA, Ribosomal, 23SRNA TransportRNA, Spliced LeaderRNA, SatelliteRNA, Ribosomal, 16SAmino Acid SequenceRNA, ArchaealNucleic Acid HybridizationProtein BiosynthesisCell LineVirus ReplicationEscherichia coliRNA CleavageMutationOligoribonucleotidesRNA, Heterogeneous NuclearTranscription, GeneticRNA, Small CytoplasmicRNA 3' End ProcessingTemplates, GeneticRNA, Small UntranslatedHeLa CellsRibonucleoproteinsRibonucleasesPoly AGenome, ViralRNA, Ribosomal, 5.8SDNARNA, Long NoncodingRNA, Small NucleolarBinding SitesRNA Virus InfectionsProtein BindingRNA, ComplementaryUridinePromoter Regions, GeneticEndoribonucleasesCell NucleusRNA, ChloroplastModels, MolecularPlasmidsReverse Transcriptase Polymerase Chain ReactionKineticsSingle-Strand Specific DNA and RNA EndonucleasesBase PairingRNA, HelminthPlant VirusesDNA PrimersGene Expression RegulationSaccharomyces cerevisiaeTranscription FactorsRNA, Transfer, PheRNA, Transfer, LysRibosomesBlotting, NorthernDNA, ViralPolymerase Chain ReactionOligonucleotidesGene Silencing5' Untranslated RegionsRNA, Transfer, TyrSequence Homology, Nucleic Acid3' Untranslated RegionsAmanitinsGenes, ViralNucleic Acid DenaturationTransfectionRibonuclease T1Molecular WeightSequence Homology, Amino AcidCell NucleolusHIV-1Cell-Free SystemProtein Structure, TertiaryDNA, ComplementaryGene Expression Regulation, ViralGenesConserved SequenceViral Nonstructural ProteinsRNA, Transfer, Amino AcylGene ExpressionIntronsRNA Splice SitesRNA, Transfer, AlaPoliovirusCells, CulturedTobaccoRibonuclease PCentrifugation, Density GradientCytoplasmNucleotidesMosaic VirusesRNA-Directed DNA PolymeraseDactinomycinOpen Reading FramesGene Expression ProfilingHepacivirusElectrophoresis, Polyacrylamide GelRNA, Transfer, AspTritiumRNA, Transfer, MetPhylogenyBromovirusRecombinant ProteinsSubstrate SpecificityRibonuclease HNuclear ProteinsModels, GeneticRegulatory Sequences, Ribonucleic AcidPolyribosomesCell Line, TumorCapsidExoribonucleasesTemperatureBacterial ProteinsRestriction MappingRNA, Transfer, GlyRNA, Transfer, HisSaccharomyces cerevisiae ProteinsRNA, Transfer, ValPoly UNodaviridaeNucleic Acid PrecursorsVirus AssemblyDefective VirusesSequence DeletionRNA, Transfer, ArgRNA, AlgalSequence Analysis, DNAHeterogeneous-Nuclear RibonucleoproteinsEscherichia coli ProteinsSpecies SpecificityAlternative SplicingVirionRibonucleoproteins, Small NuclearHepatitis Delta VirusRibosomal ProteinsRNA, Transfer, TrpOligonucleotide Array Sequence AnalysisTerminator Regions, GeneticRecombinant Fusion ProteinsMacromolecular SubstancesPlantsTime FactorsMutagenesis, Site-DirectedMutagenesisLevivirusBlotting, WesternPolynucleotidesTrypanosoma brucei bruceiDNA Restriction EnzymesModels, BiologicalExonsGene Expression Regulation, BacterialTombusvirusGuanosinePolyadenylationRNA, Transfer, LeuPhenotypeStructure-Activity RelationshipMethylationPlants, ToxicTranscriptional Elongation FactorsOligonucleotide ProbesGenetic VectorsSigma FactorEvolution, MolecularOperonArgonaute ProteinsCricetinaeLiverNucleoproteinsGene Knockdown TechniquesMagnesiumGene LibraryDNA, RibosomalUridine MonophosphateBase CompositionRNA-Induced Silencing ComplexIn Situ HybridizationTetrahymenaDrosophila melanogasterGenetic CodeDNA, BacterialCercopithecus aethiopsRNA Cap AnalogsViroidsChromatinSindbis VirusSignal TransductionViral LoadProtoplastsRNA, Transfer, ProDown-RegulationAmino Acid MotifsCrystallography, X-RaySpliceosomesTobacco Mosaic VirusNucleic Acid HeteroduplexesPlant DiseasesCytidineGenetic Complementation TestThermodynamicsGenes, ReporterCapsid ProteinsPolynucleotide AdenylyltransferaseDNA, RecombinantRNA, Transfer, SerAdenosine DeaminasePhosphorylationBacillus subtilisProteinsRNA, Transfer, Amino Acid-SpecificChromosome MappingProtein ConformationRecombination, GeneticPhosphorus IsotopesFungal ProteinsGenes, FungalCarrier ProteinsPolyribonucleotide NucleotidyltransferaseConsensus SequenceEndonucleasesRNA, Messenger, StoredSignal Recognition ParticleRegulatory Sequences, Nucleic AcidPhosphorus RadioisotopesOocytesPoint MutationReverse TranscriptionUracilT-PhagesDimerizationTumor Cells, CulturedDrosophilaRNA Polymerase Sigma 54Peptide Chain Initiation, TranslationalPseudouridineHistonesCatalysisCucumovirusElectrophoresis, Agar GelProtein SubunitsHost Factor 1 ProteinTranscriptional ActivationRNA 3' Polyadenylation SignalsRepressor ProteinstRNA MethyltransferasesGenes, BacterialTelomeraseHelper VirusesGene DeletionReticulocytesDNA ReplicationDrosophila ProteinsCycloheximideDNA ProbesComputational BiologyTransfer RNA AminoacylationXenopusMethyltransferasesFibroblastsGreen Fluorescent ProteinsPicornaviridaeArabidopsisUltraviolet RaysMicroscopy, ElectronNucleocapsidRiboswitchGlobinsPolyribonucleotidesPlant ProteinsHEK293 CellsRNA, Transfer, IleHydrogen BondingPlants, Genetically ModifiedCarmovirusEncephalomyocarditis virusAntiviral AgentsMurine hepatitis virusUridine TriphosphateCarbon IsotopesCross-Linking ReagentsNucleoside-TriphosphataseXenopus laevisTombusviridaeExosome Multienzyme Ribonuclease ComplexGene Expression Regulation, DevelopmentalGene Expression Regulation, Planttat Gene Products, Human Immunodeficiency VirusAdenineImmunoprecipitationCattleNucleotidyltransferasesRNA Cap-Binding ProteinsReal-Time Polymerase Chain ReactionTranscriptomeCatalytic DomainRetroviridaeInsect VirusesMitochondriaTrans-ActivatorsAvian Sarcoma VirusesmRNA Cleavage and Polyadenylation FactorsHot TemperatureRNA, Transfer, GluPrecipitin TestsInfluenza A virusSuppression, GeneticNucleocytoplasmic Transport ProteinsHydrolysisReoviridaePotexvirusTranscription Factors, TFIIPolynucleotide LigasesAvian leukosis virusGene Products, tatGene Expression Regulation, NeoplasticOligonucleotides, AntisenseSELEX Aptamer TechniqueTrans-SplicingHost-Pathogen InteractionsInosineAdenosine TriphosphateRibonucleoprotein, U1 Small NuclearUntranslated RegionsDNA, Single-StrandedAvian myeloblastosis virusUp-RegulationSoftwareHoloenzymesApoptosisTriticumBlotting, SouthernDNA, FungalRibonuclease, PancreaticVero CellsRifampinAllolevivirusBunyaviridaePol1 Transcription Initiation Complex ProteinsTATA-Box Binding ProteinRNA, Transfer, ThrGene Expression Regulation, EnzymologicChickensDatabases, Nucleic AcidPuromycinRNA, Transfer, GlnCell ProliferationMengovirusGene Expression Regulation, FungalDNA Mutational AnalysisRabbitsViral Structural ProteinsNuclear Magnetic Resonance, BiomolecularCytosine NucleotidesTranscription Factors, GeneralTwo-Hybrid System TechniquesAdenosine TriphosphatasesAlgorithmsGene Products, revHepatitis delta AntigensGenetic TechniquesYeastsChick EmbryoPeptidesRiboseCaenorhabditis elegansPoly CGene Products, gagActive Transport, Cell NucleusInterferonsRetroelementsSensitivity and SpecificityChromatin ImmunoprecipitationPeptide BiosynthesisKidneyPoly I-Crev Gene Products, Human Immunodeficiency VirusGuanosine MonophosphateQ beta ReplicasePoly GVirologyChloroplastsImmunoblottingGuanosine TriphosphateTranscription Initiation SiteProtein TransportManganeseAdenosineMoloney murine leukemia virusGenes, PlantAcid Anhydride HydrolasesNucleotide MappingGenotypeNeoplasm ProteinsMembrane ProteinsMultigene FamilyGenes, RegulatorTetrahymena thermophilaCell DivisionBacteriophagesMicroscopy, FluorescenceCentrifugation, ZonalAutoradiographyCell DifferentiationDichlororibofuranosylbenzimidazoleChromatography, AffinityCytidine TriphosphateAdenoviruses, HumanArabidopsis ProteinsProtein Structure, SecondaryExosomesReproducibility of ResultsPoly(A)-Binding ProteinsChromatographyZinc FingersDNA, CatalyticLuciferasesPeptide Elongation FactorsOrgan SpecificityImmunohistochemistryMice, Inbred C57BLModels, StructuralBiological EvolutionDNA HelicasesGuaninePeptide Initiation FactorsRNA, Transfer, CysAdenine NucleotidesTymovirusVesiculovirusSchizosaccharomycesEukaryotic CellsBinding, CompetitiveCell FractionationVaccinia virusSequence AnalysisHepatitis AntigensSequence HomologyMutagenesis, InsertionalFluorescent Antibody TechniqueViral Plaque AssayPlant LeavesPhosphoproteinsEnterovirusViral InterferenceEnzyme ActivationHu Paraneoplastic Encephalomyelitis AntigensEukaryotic Initiation FactorsAdenoviridaeProtein IsoformsFrameshifting, RibosomalElectrophoresisMolecular StructureAutoantigensCulture TechniquesTATA BoxChloramphenicol O-AcetyltransferaseTranscription Factor TFIIBCell SurvivalBacteriophage lambdaSimian virus 40DNA VirusesTranscription Factor TFIIIBGenetic EngineeringClosterovirusProtozoan ProteinsFramycetinViremiaAnti-HIV AgentsAmino AcidsDNA FootprintingEnhancer Elements, GeneticGammaretrovirusCell ExtractsProtein Processing, Post-TranslationalProtein-Serine-Threonine KinasesGenes, gagTransgenesRibonucleoproteins, Small NucleolarHordeumRibonucleosidesNucleic Acid Synthesis InhibitorsDeoxyribonucleasesEnterovirus B, HumanLeucineRibonucleoproteins, Small CytoplasmicAnticodonBiogenesisMethionineAlphavirusAllelesNucleosidesRhinovirusHIVOrotic AcidChenopodium quinoaProtein PrecursorsSemliki forest virusTranscription Initiation, GeneticPotassium PermanganateDengue VirusMagnetic Resonance SpectroscopyGenomicsPeptide Chain Elongation, TranslationalOrthomyxoviridaeDose-Response Relationship, DrugBiological TransportMammalsChromosomal Proteins, Non-HistoneTranscription Elongation, GeneticCD4 Lymphocyte CountBrainCell Cycle ProteinsOncogenic VirusesHIV Reverse TranscriptaseTranscription Factors, TFIIILuteovirusHaplorhiniCodon, InitiatorEmbryo, Nonmammaliangag Gene Products, Human Immunodeficiency VirusPotyvirusGenomeThiouridineCell Transformation, ViralArchaeal ProteinsMice, Inbred BALB CProtein Interaction Domains and MotifsRNA, Transfer, AsnDNA, MitochondrialOligoribonucleotides, AntisensePurinesCarcinoma, Krebs 2VirusesChromatography, Ion ExchangeNIH 3T3 CellsAlpha-AmanitinCucumis sativusMolecular Probe TechniquesTranscription Termination, GeneticPolynucleotide 5'-Hydroxyl-KinaseInterferon-betaLentivirusIn Situ Hybridization, FluorescenceBacteriaAlu ElementsTissue DistributionBunyamwera virusRibonucleoprotein, U4-U6 Small NuclearModels, ChemicalGuanine NucleotidesTranscription Factor TFIIHNuclease Protection AssaysGuanosine TetraphosphateMediator ComplexFlaviviridaeLigandsCell Transformation, NeoplasticRotavirusLuminescent ProteinsCytosineChromosome DeletionSatellite VirusesNerve Tissue ProteinsDNA, IntergenicSubcellular FractionsProtein KinasesCluster AnalysisPositive Transcriptional Elongation Factor Bbeta-GalactosidaseWest Nile virusHydrogen-Ion ConcentrationCaenorhabditis elegans ProteinsCodon, TerminatorChemistryDiarrhea Viruses, Bovine ViralRauscher VirusTranscription Factor TFIIDTATA-Binding Protein Associated FactorsMicroarray AnalysisMicroinjectionsTrioxsalenVirus CultivationLysineChimeraCations, DivalentChloramphenicolEukaryotaDeoxyribonuclease ITransformation, GeneticComputer SimulationSulfuric Acid EstersGenes, InsectToll-Like Receptor 3HepatovirusArchaeaEukaryotic Initiation Factor-4AS-AdenosylmethionineInterferon-alphaGene AmplificationTobamovirusMolecular ChaperonesDeoxyadenosinesChemical PhenomenaFormaldehydeEncephalitis Viruses, JapaneseVirulenceThermus thermophilusCell Line, TransformedChromatography, DEAE-CelluloseInsect ProteinsSpecimen HandlingAntisense Elements (Genetics)Oryza sativaAntigens, ViralPlant Viral Movement ProteinsProvirusesEmbryo, MammalianCircular DichroismFlow CytometryG-QuadruplexesAnimals, Genetically ModifiedReagent Kits, DiagnosticPoly A-UChromatography, GelMice, KnockoutNuclear Matrix-Associated Proteins
RNAiSiRNAsGene expressionInterference-basedSiRNAInterferenceInhibitionMicroRNAsProteinVivoMechanismInducesHairpinComplementaryMoleculeSpecificityAntisense2017ApoptosisDuplexesKnockdownSynthesisMammalianViralSilencingGenomePathwaysSubstratesComplexRibonucleic AcidSpecificEukaryoticDeliverySequencesGenomic
RNAi1
SiRNAs1
  • In the present study, we investigated whether vector-expressed small interfering RNAs (siRNAs) altered the CYP3A4 expression and function using the Chinese hamster cell line (V79) overexpressing CYP3A4 (CHL-3A4). (aspetjournals.org)
Gene expression1
Interference-based1
  • Background: RNA interference-based gene silencing has recently been applied as an efficient tool for functional gene analysis. (sid.ir)
SiRNA67
  • Small interfering RNA (siRNA), sometimes known as short interfering RNA or silencing RNA, is a class of double-stranded RNA non-coding RNA molecules, typically 20-27 base pairs in length, similar to miRNA, and operating within the RNA interference (RNAi) pathway. (wikipedia.org)
  • citation needed] The mechanism by which natural siRNA causes gene silencing through repression of translation occurs as follows: Long dsRNA (which can come from hairpin, complementary RNAs, and RNA-dependent RNA polymerases) is cleaved by an endo-ribonuclease called Dicer. (wikipedia.org)
  • siRNA is also similar to miRNA, however, miRNAs are derived from shorter stemloop RNA products, typically silence genes by repression of translation, and have broader specificity of action, while siRNAs typically work by cleaving the mRNA before translation, and have 100% complementarity, thus very tight target specificity. (wikipedia.org)
  • The resulting transcript is a short hairpin RNA (shRNA), which can be processed into a functional siRNA by Dicer in its usual fashion. (wikipedia.org)
  • RNA interference (RNAi) is an evolutionarily conserved mechanism in plant and animal cells that directs the degradation of messenger RNAs homologous to short double-stranded RNAs termed small interfering RNA (siRNA). (pnas.org)
  • Studies over the last several years have demonstrated that RNAi is mediated by the generation of 21- to 23-nt dsRNA molecules, termed small interfering RNA (siRNA). (pnas.org)
  • The enzymatic machinery for generating siRNA also appears to be used for the production of a second class of endogenously encoded, small RNA molecules termed microRNAs (miRNAs). (pnas.org)
  • In this model, the antisense strand of siRNA hybridizes to the target mRNA and primes an RNA-dependent RNA polymerase reaction to generate double stranded RNA 5′ of sense sequence. (pnas.org)
  • Objectives: To demonstrate the feasibility and emphasize the importance of noninvasive aerosol delivery of Akt1 small interfering RNA (siRNA) as an effective and selective option for lung cancer treatment. (redorbit.com)
  • A new study shows that attaching antibody-like RNA nanoparticles to microvesicles can deliver effective RNA therapeutics such as small interfering RNA (siRNA) specifically to cancer cells. (phys.org)
  • Small interfering RNA ( siRNA ), sometimes known as short interfering RNA or silencing RNA , is a class of double-stranded RNA molecules, 20-25 nucleotides in length, that play a variety of roles in biology. (phys.org)
  • Most notably, siRNA is involved in the RNA interference (RNAi) pathway, where it interferes with the expression of a specific gene. (phys.org)
  • We show that the yellowing symptoms are a result of small interfering RNA (siRNA)-directed RNA silencing of the chlorophyll biosynthetic gene, CHLI. (nih.gov)
  • The bottom two panels are of a small RNA northern blot gel hybridized with a 21-nt Locked Nucleic Acids (LNA) probe (5′ ATGAGAAATGCAGAGCTGAAA 3′) complementary to the CHLI-targeting Y-Sat siRNA (from nt. (nih.gov)
  • Using a chicken model, we have examined the effects of a small interfering RNA (siRNA) targeting ERK2 delivered by a lentiviral system on tendon adhesion formation with an adhesion scoring system, histological assessment, and biomechanical evaluation. (mdpi.com)
  • RNA interference (RNAi) is an evolutionarily conserved process in which cells employ small interfering RNA (siRNA) duplexes to destroy target messenger mRNAs, so as to silence the activity of corresponding genes [ 9 , 10 ]. (mdpi.com)
  • Small interfering RNAs (siRNA) were expressed as short hairpin RNAs (shRNA) against the gag and pol PERV genes, respectively, under the control of a RNA polymerase III (pol III), or a pol II promoter. (nih.gov)
  • Here, we systematically develop such a model for the complexation of small interfering RNA (siRNA) and grafted polyethyleneimine copolymers, a promising candidate for siRNA delivery. (osti.gov)
  • Small interfering RNA (siRNA) molecules have been successfully used to target specific genes in cell culture. (michaeljfox.org)
  • Both issues were addressed by utilizing a dual-purpose therapy/imaging small interfering RNA (siRNA)-nanoparticle probe targeting apoptotic-related gene caspase-3. (diabetesjournals.org)
  • Successful gene silencing by small interfering RNA (siRNA) requires efficient uptake of siRNA into targeted cells. (scirp.org)
  • Here, we used a dual-purpose therapy/imaging small interfering (si)RNA magnetic nanoparticle (MN) probe that targets β 2 microglobulin (B2M), a key component of the major histocompatibility class I complex (MHC I). In addition to serving as a siRNA carrier, this MN-siB2M probe enables monitoring of graft persistence noninvasively using magnetic resonance imaging (MRI). (diabetesjournals.org)
  • The unique fusion junctions of these molecules are attractive candidates for molecularly targeted therapeutic intervention using RNA interference (RNAi), which is mediated by small interfering RNA (siRNA). (jci.org)
  • Inducing destruction of specific mRNA using small interfering RNA (siRNA) is a powerful tool in analysis of protein function, but its use as a therapeutic modality has been limited by inefficient or impractical delivery systems. (aacrjournals.org)
  • Since its description in Caenorhabditis elegans ( 1 ) and mammalian cells ( 2 ), use of small interfering RNA (siRNA) as a method of gene silencing has rapidly become a powerful tool in protein function delineation, gene discovery, and drug development ( 3 ). (aacrjournals.org)
  • The promise of specific RNA degradation has also generated much excitement for possible use as a therapeutic modality, but in vivo siRNA delivery has proven difficult ( 4 ). (aacrjournals.org)
  • We have previously described a small interfering RNA (siRNA) delivery system (AtuPLEX) for RNA interference (RNAi) in the vasculature of mice. (aacrjournals.org)
  • In particular, chemically synthesized, small interfering RNAs (siRNA) are currently used as a new class of therapeutic molecules, allowing the controlled down-regulation of pathologically relevant gene expression as for oncogenes in cancer ( 4 ). (aacrjournals.org)
  • In addition, small interfering RNA (siRNA) may have great potential for the treatment of diseases. (aacrjournals.org)
  • Small interfering RNA (siRNA) molecules are the key intermediates in this process, which can potentially inhibit the expression of any given target gene. (aacrjournals.org)
  • The aim of the current investigation was to delineate the role of kallikrein in the regulation of fibrosis, by 'knocking down' its expression using specific small interfering RNAs (siRNA). (biomedsearch.com)
  • C6M3-siRNA complexes displayed a particle diameter of 80-100 nm, which was smaller than that of C6-siRNA complexes. (uwaterloo.ca)
  • Effective in vivo RNAi was achieved in a human non-small lung tumor xenograft model through intratumoral injection of the C6M3-Bcl-2 siRNA complexes (molar ratio: 60/1). (uwaterloo.ca)
  • Three different siRNA oligonucleotides (3A4I, 3A4II, and 3A4III) were designed and tested for their ability to interfere with CYP3A4 gene expression. (aspetjournals.org)
  • In the present study, we showed that natural halloysite nanotube (HNT)-assisted delivery of an active small interfering RNA (siRNA) targeting receptor-interacting protein kinase 4 ( RIPK4 ) efficiently silenced its expression to treat bladder cancer. (sciencemag.org)
  • Small interfering RNA (siRNA) has shown potential as a molecular approach to down-regulate specific gene expression in cancer cells ( 1 , 2 ). (sciencemag.org)
  • This study was to explore the effects of specific small interfering RNA (siRNA) targeting HPA-1 combined with heparin on invasiveness of mouse hepatocellular carcinoma cells. (biomedsearch.com)
  • Therefore, we implemented a small interfering RNA (siRNA) synthetic lethal screen targeting 5520 unique druggable genes to identify novel chemosensitivity nodes for vinblastine, a microtubule-destabilizing agent used clinically. (aspetjournals.org)
  • Druggable genome siRNA libraries comprising siRNAs against gene products that are theoretical targets for drug development have the potential to streamline the identification of small molecule inhibitors. (aspetjournals.org)
  • Although the RNA interference effect, which is mediated by small interfering RNA (siRNA) or micro-RNA, has potential application to human therapy, the hydrodynamic method usually used for rapid administration of oligonucleotides is unsuitable for use in humans. (aacrjournals.org)
  • Small interfering RNAs or siRNA expression plasmid vectors have been administered intravenously to mice by hydrodynamic injection, which accomplishes a rapid infusion of siRNA solution in a volume of 1 mL per 10 g of body weight (15 , 16 , 17 , 18) but is unsuitable for use in humans. (aacrjournals.org)
  • Here, we studied whether antagonizing the Fas receptor (FasR) pathway by small-interfering RNA (siRNA) applied after SM exposure would prevent apoptosis and, thus, airway injury. (aspetjournals.org)
  • Here, we showed a high cytosine DNA methylation status at ta-siRNA -generating loci in Arabidopsis ( Arabidopsis thaliana ), which is dependent on RDR6, SGS3, and DNA-DIRECTED RNA POLYMERASE V (PolV). (plantphysiol.org)
  • Based upon these findings, we propose a novel ta-siRNA pathway that acts at both the messenger RNA and chromatin level. (plantphysiol.org)
  • To inhibit HIF1alpha expression, we used small interference RNA (siRNA) expression vectors in this study. (nih.gov)
  • We have used a targeted small interfering RNA (siRNA) library to identify key cellular genes involved in cytoskeletal dynamics and endosome trafficking that are important for RSV infection. (asm.org)
  • To better investigate the role of checkpoint kinase 1 (Chk1) in cellular response to different anticancer agents, Chk1 was knocked down in HCT-116 cell line and in its p53-deficient subline by using small interfering RNAs (siRNA). (aacrjournals.org)
  • In Neurospora crassa , the introduction of a transgene can lead to small interfering RNA (siRNA)-mediated posttranscriptional gene silencing (PTGS) of homologous genes. (asm.org)
  • however, the precise role that P-bodies and their component proteins play in small interfering RNA (siRNA)-mediated RNAi remains unclear. (pubmedcentralcanada.ca)
  • Response of Human Retinal Endothelial Cells (HRECs) to Small Interfering RNA (SiRNA) Silencing of Notch-1, Delta-Like Ligand 4 (Dll4), and Jagged-1 During Hyperoxia with Intermittent Hypoxia (IH). (arvojournals.org)
  • Basal levels of antiviral RNA silencing and siRNA biogenesis were detected in mutants lacking RDR1, RDR2, and RDR6, indicating an alternate route to form double-stranded RNA that does not depend on the three previously characterized RDR proteins. (plantcell.org)
  • Initiation consists of the recognition of the trigger RNA and formation of primary small interfering RNAs (siRNAs), while amplification is characterized by the synthesis of double-stranded RNA (dsRNA) by one or more RNA-dependent RNA polymerases and the formation of secondary siRNA. (plantcell.org)
  • Dicer-like ribonucleases (DCLs), Argonaute (AGO) proteins, dsRNA binding proteins (DRBs), and RNA-dependent RNA polymerase (RDR) proteins are core components of plant RNA silencing pathways involved in siRNA biogenesis or effector pathways. (plantcell.org)
  • A major antiviral pathway in the mosquito vector is the exogenous small interfering RNA (exo-siRNA) pathway, which is induced by arbovirus-derived double-stranded RNA in infected cells. (pasteur.fr)
  • These cargoes include small interfering RNAs (siRNA) that are not naturally internalized by cells. (diva-portal.org)
  • In the current study, we sought to investigate the efficacy of deliver small interference RNA (siRNA) to the mouse cornea epithelium by eye drops that contain siRNA and different cationic complexing agents. (arvojournals.org)
  • In addition, the transfection of the infected-cell polypeptide 4-targeting small interfering RNA (ICP4-siRNA) in mouse herpes simplex keratitis (HSK) was examined using the above method. (arvojournals.org)
  • Despite the vast amount of sequencing data available on the GM12878 cell line through the ENCODE Project, including transcriptome, chromatin immunoprecipitation-sequencing for histone marks, and transcription factors, no small interfering siRNA-mediated knockdown studies have been performed in the GM12878 cell line, as cationic lipid-mediated transfection methods are inefficient for lymphoid cell lines. (escholarship.org)
  • To account for HIV-1 variability, we selected multiple RNAi triggers, including a short hairpin RNA (shRNA), generating one single small interfering RNA (siRNA) against either the CCR5 cellular gene (shCCR5) or the vif viral gene (shvif), and a long hairpin RNA, giving rise to two different siRNAs against the viral tat and rev overlapping first exons (lhtat/rev). (unipd.it)
  • We have conducted a small interfering RNA (siRNA) screen of 200 genes involved in DNA damage repair aimed at identifying genes whose knockdown increased tumor radiosensitivity. (ox.ac.uk)
  • We also examined the molecular mechanisms that promote apoptosis of LNCaP cells after infection with small interfering RNA (siRNA) targeting HMGN5 (siRNA-HMGN5). (antibody-antibodies.com)
  • To further the investigation on the efficacy of gene silencing, small interference RNA (siRNA) specific for the NR2B subunit was designed and administered in the striatum of 6-OHDA-lesioned rats. (hku.hk)
  • We observed a gradual increase of paternal siRNA expression in the early stages of kernels and an expected 2:1 maternal to paternal ratio in 7-DAP endosperm via sequencing of small interfering RNA (siRNA) transcriptomes in developing kernels (0, 3 and 5 days after pollination (DAP)) and endosperms (7, 10 and 15 DAP) from the maize B73 and Mo17 reciprocal crosses. (biomedcentral.com)
  • [2] The most common and well-studied example is RNA interference ( RNAi ), in which endogenously expressed microRNA ( miRNA ) or exogenously derived small interfering RNA ( siRNA ) induces the degradation of complementary messenger RNA . (wikipedia.org)
  • The RNAi pathway is triggered in mammalian cells by the presence of dsRNA or in the presence of short 19-22nt dsRNA fragments termed small interfering RNA molecules (siRNA). (biomedcentral.com)
  • Small interfering RNA (siRNA), sometimes known as short interfering RNA or silencing RNA, are a class of 20-25 nucleotide-long double-stranded RNA molecules that play a variety of roles in biology. (blogspot.com)
  • Microphthalmia-associated transcription factor (MITF)-Tfe transcription factors were blocked using either a pan MITF-Tfe dominant negative or specific small interfering RNA (siRNA). (molvis.org)
Interference39
  • RNA interference (RNAi) is an evolutionarily conserved mechanism of gene silencing that is thought to inhibit the replication and expression of selfish DNA elements and viruses (reviewed in refs. (pnas.org)
  • Approval of first RNA interference drug - why the excitement? (phys.org)
  • Transformation of tobacco with a RNA interference (RNAi) vector targeting CHLI induced Y-Sat-like symptoms. (nih.gov)
  • We report the first RNAi-induced phenotypes in mammalian cultured cells using RNA interference mediated by duplexes of 21-nt RNAs. (nih.gov)
  • The recently developed RNA interference (RNAi) technology to knockdown/silence post-transcriptional gene expression, offers a promising alternative to achieving this goal. (nih.gov)
  • Dheemanth TL, Ramachandra RK, Chavan M, Prakash BG (2017) RNA interference in crop improvement. (springer.com)
  • RNA interference (RNAi) is an evolutionarily conserved gene silencing mechanism in eukaryotes, with regulatory roles in a variety of biological processes, including cell cycle, cell differentiation, physiological and metabolic pathways, and stress responses. (unl.edu)
  • RNA interference (RNAi) is an ancient antiviral response that processes dsRNA and associates it into a nuclease complex that identifies RNA with sequence homology and specifically cleaves it. (jimmunol.org)
  • Downregulation of factors that mediate immune rejection using RNA interference holds promise for improving islet graft resistance to damaging factors after transplantation. (diabetesjournals.org)
  • Reduction or downregulation of MHC class I protein expression using RNA interference (RNAi) ( 19 ) has shown some success in overcoming the limitations of immune rejection in cell-based therapies. (diabetesjournals.org)
  • RNA interference (RNAi) can be used as novel therapeutic modality through specific silencing of therapeutically relevant genes in vivo ( 1 - 3 ). (aacrjournals.org)
  • RNA interference has become widely used as an experimental tool to study gene function. (aacrjournals.org)
  • RNA interference (RNAi) is a natural process that affects gene silencing in eukaryotic systems at transcriptional, posttranscriptional, and/or translational levels ( 1 ). (aacrjournals.org)
  • RNA interference (RNAi) is a highly efficient and specific posttranscriptional gene silencing process, which can be triggered by small interfering RNA. (uwaterloo.ca)
  • Dicer-substrate small interfering RNAs (DsiRNAs) are synthetic RNA duplexes that are processed by Dicer into 21-mer species and show improved potency as triggers of RNA interference, particularly when used at low dose. (pubmedcentralcanada.ca)
  • RNA interference (RNAi) is a specific and powerful tool used to manipulate gene expression and study gene function. (aspetjournals.org)
  • RNA interference (RNAi) technology can specifically silence the expression of a target gene and has emerged as a promising therapeutic method to treat cancer. (sciencemag.org)
  • The RNA interference effect is an alternative to antisense DNA as an experimental method of down-regulating a specific target protein. (aacrjournals.org)
  • More recently, efforts have focused on the RNA interference effect as a tool to knock down the expression of a target protein. (aacrjournals.org)
  • Adenoviral-mediated RNA interference against MMP-2 has significant therapeutic potential for lung cancer and exerts some of this effect by inhibiting angiogenesis. (aacrjournals.org)
  • Small RNAs ( sRNAs ) are key players in eukaryotic RNA interference phenomena ( Baulcombe, 2004 ). (plantphysiol.org)
  • Given its stable and sustained efficacy, lasting weeks, RNA interference may offer a unique approach to improving therapy adherence and treating hypertension. (investorvillage.com)
  • Inactivation at the posttranscriptional level has been detected in plants, where it is called cosuppression ( 30 ), fungi, where it is called quelling ( 37 ), and animals, where it is called RNA interference (RNAi) and is triggered by the introduction of double-stranded RNA ( 16 ). (asm.org)
  • RNA interference (RNAi) is a powerful homology-based gene silencing mechanism directed by small RNAs, including small interfering RNAs (siRNAs) and microRNAs (miRNAs). (pubmedcentralcanada.ca)
  • They add functional insights to previous observations of this protein's antiviral and RNA interference regulatory activities in Drosophila melanogasterIMPORTANCE Female Aedes aegypti mosquitoes are vectors of human-infecting arthropod-borne viruses (arboviruses). (pasteur.fr)
  • BACKGROUND/AIMS RNA interference has considerable therapeutic potential, particularly for anti-viral therapy. (semanticscholar.org)
  • HuUO-44 RNA interference (RNAi) resulted in the inhibition of cell growth and proliferation. (nus.edu.sg)
  • To this end, several anti-HIV-1 genes have been developed and tested both in preclinical and clinical settings and, among these, RNA interference (RNAi)-based approaches represent one of the most powerful tools. (unipd.it)
  • Introduction of small interfering RNAs (siRNAs) into a cell can cause a specific interference of gene expression known as RNA interference (RNAi). (ucsf.edu)
  • RNA silencing or RNA interference refers to a family of gene silencing effects by which gene expression is negatively regulated by non-coding RNAs such as microRNAs . (wikipedia.org)
  • Despite early focus in the literature on RNA interference ( RNAi ) as a core mechanism which occurs at the level of messenger RNA translation, others have since been identified in the broader family of conserved RNA silencing pathways acting at the DNA and chromatin level. (wikipedia.org)
  • RNA interference is an endogenous cellular mechanism in which short interfering RNAs (siRNAs) elicit the sequence-specific degradation of a complementary mRNA target. (biomedcentral.com)
  • RNA interference is an evolutionary conserved immune response mechanism that can be used as a tool to provide novel insights into gene function and structure. (biomedcentral.com)
  • RNA interference (RNAi) is an evolutionary conserved sequence-specific RNA silencing mechanism found as an anti-viral response in invertebrates, plants and mammalian cells [ 1 ]. (biomedcentral.com)
  • RNA interference (RNAi), which has facilitated functional characterization of mosquito neural development genes such as the axon guidance regulator semaphorin-1a (sema1a) , could one day be applied as a new means of vector control. (biomedcentral.com)
  • The discovery of RNA interference phenomenon (RNAi) and understanding of its mechanisms has revolutionized our views on many molecular processes in the living cell. (beds.ac.uk)
  • Intense genomic repeat propagation into the genome would inevitably cause bidirectional transcription of these sequences, and the resulting double-stranded RNAs may be recognized and processed by the RNA interference enzymatic machinery. (beds.ac.uk)
  • The discovery of RNA interference (RNAi) and understanding of its mechanisms has opened a new era in molecular genetics. (beds.ac.uk)
  • This phenomenon attracts growing attention and studying RNA interference is probably one of the most rapidly developing fields of modern science. (beds.ac.uk)
Inhibition5
  • The inhibition occurred at two points in the viral life cycle, after fusion and before reverse transcription and during transcription of viral RNA from integrated provirus. (jimmunol.org)
  • Knockdown of ki-67 by dicer-substrate small interfering RNA sensitizes bladder cancer cells to curcumin-induced tumor inhibition. (jefferson.edu)
  • We found that c2 transcription occurs in nuclei of C2-Idf/C2 heterozygotes, but mRNA does not accumulate, suggesting that the inhibition is mediated by RNA silencing. (genetics.org)
  • Infection of C2-Idf/C2 heterozygotes with viruses that carry suppressors of RNA silencing relieved the phenotypic inhibition, restoring pigment production and mRNA levels. (genetics.org)
  • Inhibition of BTK in primary human CLL cells by small interfering RNA promotes apoptosis. (bloodjournal.org)
MicroRNAs1
  • Plant microRNAs ( miRNAs ) are transcribed by RNA polymerase II and processed by DICER-LIKE1 (DCL1) protein in the nucleus from stem-loop structures, then associated with AGO1 according to their 5′-terminal uridine nucleotide to efficiently form RISCs in cytoplasm and perform target mRNA cleavage or translation repression ( Voinnet, 2009 ). (plantphysiol.org)
Protein5
  • The Cucumber mosaic virus (CMV) Y-satellite RNA (Y-Sat) has a small non-protein-coding RNA genome that induces yellowing symptoms in infected Nicotiana tabacum (tobacco). (nih.gov)
  • We demonstrated that small RNAs (sRNAs) generated from exogenously introduced inverted repeat transgenes, with perfect complementarity to the 3'UTR of a target transcript, can inhibit protein synthesis, without or with only minimal mRNA destabilization. (unl.edu)
  • Double-stranded RNA-activated protein kinase-like ER kinase (PERK), inositol requiring kinase 1 (IRE1), and activating transcription factor (ATF)-6 are three critical ER membrane-associated ER stress sensors that regulate the unfolded protein response 6 . (nature.com)
  • Transfer RNA (tRNA), that mediates recognition of the codon and provides the corresponding amino acid, and ribosomal RNA (rRNA), that is the central component of the ribosome's protein-manufacturing machinery. (wikipedia.org)
  • Consistent with these findings, L-165,041 increased 14-3-3ε mRNA and protein level, whereas PPARδ small interfering RNA suppressed both basal and L-165,041-dependent YWHAE transcription and 14-3-3ε protein expression. (ahajournals.org)
Vivo1
  • In vivo studies included serial MRI of NOD-SCID mice transplanted with MN-small interfering (si)Caspase-3-labeled human islets under the left kidney capsule and MN-treated islets under the right kidney capsule. (diabetesjournals.org)
Mechanism4
  • In plants and some animal lineages, such as insects, RNA silencing is a potent defense mechanism against viruses and has remarkable specificity and adaptability ( Ding and Voinnet, 2007 ). (plantcell.org)
  • The institute comprises 15 laboratories led by (in alphabetical order): Stefan Ameres: Mechanism and biology of RNA silencing. (wikipedia.org)
  • This protective effect was reversed by the glucocorticoid receptor (GR) antagonist (11, 17)-11-[4-(dimethylamino)phenyl]-17-hydroxy-17-(1-propynyl)estra-4,9-dien-3-one (RU486) and small interfering RNA directed against GR, suggesting a receptor-dependent mechanism. (jneurosci.org)
  • RNA silencing as an antiviral defense mechanism has been implicated in this process. (biomedcentral.com)
Induces1
  • How this RNA pathogen induces such symptoms has been a longstanding question. (nih.gov)
Hairpin2
  • The delivery of short hairpin RNA to HeLa cells resulted in a selective and permanent silencing of MHC class I by up to 90%, even under inflammatory conditions ( 20 ). (diabetesjournals.org)
  • miRNAs are typically processed from a hairpin-like secondary structure of a noncoding mRNA (ncRNA), with a precursor mRNA generated by RNA polymerase II (Pol II). (plantcell.org)
Complementary2
  • The molecule is a duplex formed by the hybridization of two partially complementary single strand RNAs in which the 3' end are capped with 2 deoxyribose (dT) units. (clinicaltrials.gov)
  • Recent experimental studies demonstrate few cases of viral replication suppression via complementary interactions between the mammalian small RNAs and viral transcripts. (beds.ac.uk)
Molecule3
  • Small molecule inhibitors, such as imatinib, are effective therapies for tyrosine kinase fusions BCR-ABL-TEL-PDGFβR-mediated human leukemias, but resistance may develop. (jci.org)
  • Cand5 is a small interfering RNA molecule that selectively silences the mRNA encoding for VEGF. (clinicaltrials.gov)
  • Polyadenylation is the covalent linkage of a polyadenylyl moiety to a messenger RNA molecule. (wikipedia.org)
Specificity1
  • Taken together, these findings provide the first demonstration of small RNA-mediated viral disease symptom production and offer an explanation of the species specificity of the viral disease. (nih.gov)
Antisense1
  • In one embodiment of this invention, these oligonucleotides hybridize with the sense or with the antisense mitochondrial chimeric RNAs, and the result of the hybridization is useful to differentiate between normal proliferating cells, pre-cancer cells and cancer cells. (freepatentsonline.com)
20171
  • 2017. Development of SLAM-Seq for the high-resolution assessment of RNA expression dynamics 2017. (wikipedia.org)
Apoptosis1
  • Targeting Mcl-1 in these melanoma cell lines with specific small interfering RNA was sufficient to sensitize them to both anti-Fas mAb-induced apoptosis and activation of caspase-9. (aacrjournals.org)
Duplexes1
Knockdown3
  • Finally, we demonstrate that knockdown of lamin A/C expression using small interfering RNA also rescues the PKmut phenotype in 293 cells. (asm.org)
  • Knockdown of ki-67 by dicer-substrate small interfering RNA sensitizes" by Sivakamasundari Pichu, Swapna Krishnamoorthy et al. (jefferson.edu)
  • Subsequent investigations showed that POLQ knockdown resulted in radiosensitization of a panel of tumor cell lines from different primary sites while having little or no effect on normal tissue cell lines. (ox.ac.uk)
Synthesis1
  • Telomerase is a ribonucleoprotein complex consisting minimally of RNA template and catalytic reverse transcriptase subunits responsible for de novo synthesis of telomeric repeats ( 10 ). (pnas.org)
Mammalian3
  • How many antiviral small interfering RNAs may be encoded by the mammalian genomes? (beds.ac.uk)
  • We propose a hypothesis that mammalian DNAs encode thousands RNA motifs that may serve for antiviral protection. (beds.ac.uk)
  • This hypothesis proposes that mammalian organisms may use their own genomes as sources of thousands of putative interfering RNA motifs that can be recruited to repress intracellular pathogens like proliferating viruses. (beds.ac.uk)
Viral3
  • During the viral life cycle, viral RNA is present in the cytoplasm of cells after fusion and before reverse transcription, which presents a target that when acted on can inhibit infection before proviral integration. (jimmunol.org)
  • Viral particles are present in two forms, a long filamentous variant of up to 1 μm in length and a smaller, spherical particle of 100 nm in diameter. (asm.org)
  • To understand if high temperature-mediated acceleration of the host antiviral gene silencing system in the meristem tip facilitates virus-derived small interfering RNAs (vsiRNA) accumulation to reduce the viral RNA titer in the fruit tree meristem tip cells, we used the Apple stem grooving virus (ASGV)- Pyrus pyrifolia pathosystem to explore the possible roles of vsiRNA in thermotherapy. (biomedcentral.com)
Silencing15
  • Dalakouras A, Wassenegger M, McMillan JN, Cardoza V, Maegele I, Dadami E, Runne M, Krczal G, Wassenegger M (2016) Induction of silencing in plants by high-pressure spraying of in vitro-synthesized small RNAs. (springer.com)
  • Plants respond to virus infections by activation of RNA-based silencing, which limits infection at both the single-cell and system levels. (plantcell.org)
  • Small interfering RNA-mediated gene silencing in T lymphocytes. (ucsf.edu)
  • Julius Brennecke: Transposon silencing & heterochromatin formation by small RNAs. (wikipedia.org)
  • [1] RNA silencing mechanisms are highly conserved in most eukaryotes . (wikipedia.org)
  • While some functions of RNA silencing and its machinery are understood, many are not. (wikipedia.org)
  • For example, RNA silencing has been shown to be important in the regulation of development and in the control of transposition events. (wikipedia.org)
  • [14] RNA silencing has been shown to play a role in antiviral protection in plants as well as insects. (wikipedia.org)
  • [15] Also in yeast, RNA silencing has been shown to maintain heterochromatin structure. (wikipedia.org)
  • RNA silencing functions by repressing translation or by cleaving messenger RNA ( mRNA ), depending on the amount of complementarity of base-pairing. (wikipedia.org)
  • [19] Since then, various other classes of RNA silencing have been identified and characterized. (wikipedia.org)
  • [8] It has also been observed that the major RNA silencing pathways currently identified have mechanisms of action which may involve both post-transcriptional gene silencing (PTGS) [22] as well as chromatin-dependent gene silencing (CDGS) pathways. (wikipedia.org)
  • [4] CDGS involves the assembly of small RNA complexes on nascent transcripts and is regarded as encompassing mechanisms of action which implicate transcriptional gene silencing (TGS) and co-transcriptional gene silencing (CTGS) events. (wikipedia.org)
  • Together, our results indicate that the inhibitory effect of C2-Idf occurs through RNA silencing. (genetics.org)
  • In the model plant Arabidopsis , among the four relatively well-studied DCLs, DCL4 and DCL2 function in RNA silencing against RNA viruses by producing 21- and 22-nt vsiRNAs, respectively. (biomedcentral.com)
Genome1
  • RSV is a paramyxovirus with a 15-kb, negative sense, single-stranded RNA genome. (asm.org)
Pathways2
  • Plant genomes are the source of large numbers of small RNAs, generated via a variety of genetically separable pathways. (plantcell.org)
  • Several of these pathways converge in the production of phased, secondary, small interfering RNAs (phasiRNAs), originally designated as trans -acting small interfering RNAs or tasiRNAs. (plantcell.org)
Substrates1
Complex1
  • Shortly after the start of transcription, the 5' end of the mRNA being synthesized is bound by a cap-synthesizing complex associated with RNA polymerase . (wikipedia.org)
Ribonucleic Acid1
Specific2
  • TAS) emerge as a class of plant-specific small RNAs that are initiated from microRNA-mediated cleavage of TAS gene transcripts. (plantphysiol.org)
  • This relationship was suggested by the observation that the down-regulation of p8 or CHOP by specific small interfering RNAs attenuated both WIN-mediated DR5 up-regulation and the cytotoxicity induced by WIN/TRAIL cotreatment. (aspetjournals.org)
Eukaryotic2
  • One notable difference, however, is that eukaryotic RNA polymerase associates with mRNA-processing enzymes during transcription so that processing can proceed quickly after the start of transcription. (wikipedia.org)
  • A 5' cap (also termed an RNA cap, an RNA 7-methylguanosine cap, or an RNA m 7 G cap) is a modified guanine nucleotide that has been added to the "front" or 5' end of a eukaryotic messenger RNA shortly after the start of transcription. (wikipedia.org)
Delivery2
  • Liver target delivery of small interfering RNA to the HCV gene by lactosylated cationic liposome. (semanticscholar.org)
  • Delivery of small interfering RNA by peptide-targeted mesoporous silica nanoparticle-supported lipid bilayers. (unm.edu)
Sequences1
  • A range of diverse functions have been proposed for a growing number of characterized small RNA sequences-e.g., regulation of developmental, neuronal cell fate, cell death, proliferation, fat storage, haematopoietic cell fate, insulin secretion. (wikipedia.org)
Genomic1
  • We also presume that the evolutional success of some groups of genomic repeats and, in particular, of transposable elements (TEs) may be due to their ability to provide antiviral RNA motifs to the host organism. (beds.ac.uk)