Rna small interfering. Medical search

A polynucleotide consisting essentially of chains with a repeating backbone of phosphate and ribose units to which nitrogenous bases are attached. RNA is unique among biological macromolecules in that it can encode genetic information, serve as an abundant structural component of cells, and also possesses catalytic activity. (Rieger et al., Glossary of Genetics: Classical and Molecular, 5th ed)

Small double-stranded, non-protein coding RNAs (21-31 nucleotides) involved in GENE SILENCING functions, especially RNA INTERFERENCE (RNAi). Endogenously, siRNAs are generated from dsRNAs (RNA, DOUBLE-STRANDED) by the same ribonuclease, Dicer, that generates miRNAs (MICRORNAS). The perfect match of the siRNAs' antisense strand to their target RNAs mediates RNAi by siRNA-guided RNA cleavage. siRNAs fall into different classes including trans-acting siRNA (tasiRNA), repeat-associated RNA (rasiRNA), small-scan RNA (scnRNA), and Piwi protein-interacting RNA (piRNA) and have different specific gene silencing functions.

Ribonucleic acid that makes up the genetic material of viruses.

A process that changes the nucleotide sequence of mRNA from that of the DNA template encoding it. Some major classes of RNA editing are as follows: 1, the conversion of cytosine to uracil in mRNA; 2, the addition of variable number of guanines at pre-determined sites; and 3, the addition and deletion of uracils, templated by guide-RNAs (RNA, GUIDE).

The ultimate exclusion of nonsense sequences or intervening sequences (introns) before the final RNA transcript is sent to the cytoplasm.

The most abundant form of RNA. Together with proteins, it forms the ribosomes, playing a structural role and also a role in ribosomal binding of mRNA and tRNAs. Individual chains are conventionally designated by their sedimentation coefficients. In eukaryotes, four large chains exist, synthesized in the nucleolus and constituting about 50% of the ribosome. (Dorland, 28th ed)

Ribonucleic acid in bacteria having regulatory and catalytic roles as well as involvement in protein synthesis.

Enzymes that catalyze DNA template-directed extension of the 3'-end of an RNA strand one nucleotide at a time. They can initiate a chain de novo. In eukaryotes, three forms of the enzyme have been distinguished on the basis of sensitivity to alpha-amanitin, and the type of RNA synthesized. (From Enzyme Nomenclature, 1992).

Viruses whose genetic material is RNA.

A gene silencing phenomenon whereby specific dsRNAs (RNA, DOUBLE-STRANDED) trigger the degradation of homologous mRNA (RNA, MESSENGER). The specific dsRNAs are processed into SMALL INTERFERING RNA (siRNA) which serves as a guide for cleavage of the homologous mRNA in the RNA-INDUCED SILENCING COMPLEX. DNA METHYLATION may also be triggered during this process.

RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.

RNA consisting of two strands as opposed to the more prevalent single-stranded RNA. Most of the double-stranded segments are formed from transcription of DNA by intramolecular base-pairing of inverted complementary sequences separated by a single-stranded loop. Some double-stranded segments of RNA are normal in all organisms.

RNA that has catalytic activity. The catalytic RNA sequence folds to form a complex surface that can function as an enzyme in reactions with itself and other molecules. It may function even in the absence of protein. There are numerous examples of RNA species that are acted upon by catalytic RNA, however the scope of this enzyme class is not limited to a particular type of substrate.

The processes of RNA tertiary structure formation.

A DNA-dependent RNA polymerase present in bacterial, plant, and animal cells. It functions in the nucleoplasmic structure and transcribes DNA into RNA. It has different requirements for cations and salt than RNA polymerase I and is strongly inhibited by alpha-amanitin. EC 2.7.7.6.

Ribonucleic acid in fungi having regulatory and catalytic roles as well as involvement in protein synthesis.

The extent to which an RNA molecule retains its structural integrity and resists degradation by RNASE, and base-catalyzed HYDROLYSIS, under changing in vivo or in vitro conditions.

A family of proteins that promote unwinding of RNA during splicing and translation.

RNA molecules which hybridize to complementary sequences in either RNA or DNA altering the function of the latter. Endogenous antisense RNAs function as regulators of gene expression by a variety of mechanisms. Synthetic antisense RNAs are used to effect the functioning of specific genes for investigative or therapeutic purposes.

Post-transcriptional biological modification of messenger, transfer, or ribosomal RNAs or their precursors. It includes cleavage, methylation, thiolation, isopentenylation, pseudouridine formation, conformational changes, and association with ribosomal protein.

The small RNA molecules, 73-80 nucleotides long, that function during translation (TRANSLATION, GENETIC) to align AMINO ACIDS at the RIBOSOMES in a sequence determined by the mRNA (RNA, MESSENGER). There are about 30 different transfer RNAs. Each recognizes a specific CODON set on the mRNA through its own ANTICODON and as aminoacyl tRNAs (RNA, TRANSFER, AMINO ACYL), each carries a specific amino acid to the ribosome to add to the elongating peptide chains.

Short chains of RNA (100-300 nucleotides long) that are abundant in the nucleus and usually complexed with proteins in snRNPs (RIBONUCLEOPROTEINS, SMALL NUCLEAR). Many function in the processing of messenger RNA precursors. Others, the snoRNAs (RNA, SMALL NUCLEOLAR), are involved with the processing of ribosomal RNA precursors.

RNA transcripts of the DNA that are in some unfinished stage of post-transcriptional processing (RNA PROCESSING, POST-TRANSCRIPTIONAL) required for function. RNA precursors may undergo several steps of RNA SPLICING during which the phosphodiester bonds at exon-intron boundaries are cleaved and the introns are excised. Consequently a new bond is formed between the ends of the exons. Resulting mature RNAs can then be used; for example, mature mRNA (RNA, MESSENGER) is used as a template for protein production.

RNA which does not code for protein but has some enzymatic, structural or regulatory function. Although ribosomal RNA (RNA, RIBOSOMAL) and transfer RNA (RNA, TRANSFER) are also untranslated RNAs they are not included in this scope.

The spatial arrangement of the atoms of a nucleic acid or polynucleotide that results in its characteristic 3-dimensional shape.

Nucleic acid structures found on the 5' end of eukaryotic cellular and viral messenger RNA and some heterogeneous nuclear RNAs. These structures, which are positively charged, protect the above specified RNAs at their termini against attack by phosphatases and other nucleases and promote mRNA function at the level of initiation of translation. Analogs of the RNA caps (RNA CAP ANALOGS), which lack the positive charge, inhibit the initiation of protein synthesis.

A multistage process that includes cloning, physical mapping, subcloning, sequencing, and information analysis of an RNA SEQUENCE.

Ribonucleic acid in plants having regulatory and catalytic roles as well as involvement in protein synthesis.

Ribonucleic acid in protozoa having regulatory and catalytic roles as well as involvement in protein synthesis.

The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.

RNA present in neoplastic tissue.

An enzyme that catalyzes the conversion of linear RNA to a circular form by the transfer of the 5'-phosphate to the 3'-hydroxyl terminus. It also catalyzes the covalent joining of two polyribonucleotides in phosphodiester linkage. EC 6.5.1.3.

A large family of RNA helicases that share a common protein motif with the single letter amino acid sequence D-E-A-D (Asp-Glu-Ala-Asp). In addition to RNA helicase activity, members of the DEAD-box family participate in other aspects of RNA metabolism and regulation of RNA function.

A DNA-dependent RNA polymerase present in bacterial, plant, and animal cells. It functions in the nucleoplasmic structure where it transcribes DNA into RNA. It has specific requirements for cations and salt and has shown an intermediate sensitivity to alpha-amanitin in comparison to RNA polymerase I and II. EC 2.7.7.6.

Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.

A DNA-dependent RNA polymerase present in bacterial, plant, and animal cells. The enzyme functions in the nucleolar structure and transcribes DNA into RNA. It has different requirements for cations and salts than RNA polymerase II and III and is not inhibited by alpha-amanitin. EC 2.7.7.6.

RNA molecules found in the nucleus either associated with chromosomes or in the nucleoplasm.

Small kinetoplastid mitochondrial RNA that plays a major role in RNA EDITING. These molecules form perfect hybrids with edited mRNA sequences and possess nucleotide sequences at their 5'-ends that are complementary to the sequences of the mRNA's immediately downstream of the pre-edited regions.

Constituent of the 60S subunit of eukaryotic ribosomes. 28S rRNA is involved in the initiation of polypeptide synthesis in eukaryotes.

Constituent of the 40S subunit of eukaryotic ribosomes. 18S rRNA is involved in the initiation of polypeptide synthesis in eukaryotes.

Proteins that bind to RNA molecules. Included here are RIBONUCLEOPROTEINS and other proteins whose function is to bind specifically to RNA.

Constituent of 50S subunit of prokaryotic ribosomes containing about 3200 nucleotides. 23S rRNA is involved in the initiation of polypeptide synthesis.

The process of moving specific RNA molecules from one cellular compartment or region to another by various sorting and transport mechanisms.

The small RNAs which provide spliced leader sequences, SL1, SL2, SL3, SL4 and SL5 (short sequences which are joined to the 5' ends of pre-mRNAs by TRANS-SPLICING). They are found primarily in primitive eukaryotes (protozoans and nematodes).

Small, linear single-stranded RNA molecules functionally acting as molecular parasites of certain RNA plant viruses. Satellite RNAs exhibit four characteristic traits: (1) they require helper viruses to replicate; (2) they are unnecessary for the replication of helper viruses; (3) they are encapsidated in the coat protein of the helper virus; (4) they have no extensive sequence homology to the helper virus. Thus they differ from SATELLITE VIRUSES which encode their own coat protein, and from the genomic RNA; (=RNA, VIRAL); of satellite viruses. (From Maramorosch, Viroids and Satellites, 1991, p143)

Constituent of 30S subunit prokaryotic ribosomes containing 1600 nucleotides and 21 proteins. 16S rRNA is involved in initiation of polypeptide synthesis.

The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.

Ribonucleic acid in archaea having regulatory and catalytic roles as well as involvement in protein synthesis.

Widely used technique which exploits the ability of complementary sequences in single-stranded DNAs or RNAs to pair with each other to form a double helix. Hybridization can take place between two complimentary DNA sequences, between a single-stranded DNA and a complementary RNA, or between two RNA sequences. The technique is used to detect and isolate specific sequences, measure homology, or define other characteristics of one or both strands. (Kendrew, Encyclopedia of Molecular Biology, 1994, p503)

The biosynthesis of PEPTIDES and PROTEINS on RIBOSOMES, directed by MESSENGER RNA, via TRANSFER RNA that is charged with standard proteinogenic AMINO ACIDS.

Established cell cultures that have the potential to propagate indefinitely.

The process of intracellular viral multiplication, consisting of the synthesis of PROTEINS; NUCLEIC ACIDS; and sometimes LIPIDS, and their assembly into a new infectious particle.

A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.

A reaction that severs one of the sugar-phosphate linkages of the phosphodiester backbone of RNA. It is catalyzed enzymatically, chemically, or by radiation. Cleavage may be exonucleolytic, or endonucleolytic.

Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.

A group of ribonucleotides (up to 12) in which the phosphate residues of each ribonucleotide act as bridges in forming diester linkages between the ribose moieties.

Nuclear nonribosomal RNA larger than about 1000 nucleotides, the mass of which is rapidly synthesized and degraded within the cell nucleus. Some heterogeneous nuclear RNA may be a precursor to mRNA. However, the great bulk of total hnRNA hybridizes with nuclear DNA rather than with mRNA.

The biosynthesis of RNA carried out on a template of DNA. The biosynthesis of DNA from an RNA template is called REVERSE TRANSCRIPTION.

Small RNAs found in the cytoplasm usually complexed with proteins in scRNPs (RIBONUCLEOPROTEINS, SMALL CYTOPLASMIC).

The steps that generate the 3' ends of mature RNA molecules. For most mRNAs (RNA, MESSENGER), 3' end processing referred to as POLYADENYLATION includes the addition of POLY A.

Macromolecular molds for the synthesis of complementary macromolecules, as in DNA REPLICATION; GENETIC TRANSCRIPTION of DNA to RNA, and GENETIC TRANSLATION of RNA into POLYPEPTIDES.

Short RNA, about 200 base pairs in length or shorter, that does not code for protein.

The first continuously cultured human malignant CELL LINE, derived from the cervical carcinoma of Henrietta Lacks. These cells are used for VIRUS CULTIVATION and antitumor drug screening assays.

Complexes of RNA-binding proteins with ribonucleic acids (RNA).

Enzymes that catalyze the hydrolysis of ester bonds within RNA. EC 3.1.-.

A group of adenine ribonucleotides in which the phosphate residues of each adenine ribonucleotide act as bridges in forming diester linkages between the ribose moieties.

The complete genetic complement contained in a DNA or RNA molecule in a virus.

Constituent of the 60S subunit of eukaryotic ribosomes. 5.8S rRNA is involved in the initiation of polypeptide synthesis in eukaryotes.

A deoxyribonucleotide polymer that is the primary genetic material of all cells. Eukaryotic and prokaryotic organisms normally contain DNA in a double-stranded state, yet several important biological processes transiently involve single-stranded regions. DNA, which consists of a polysugar-phosphate backbone possessing projections of purines (adenine and guanine) and pyrimidines (thymine and cytosine), forms a double helix that is held together by hydrogen bonds between these purines and pyrimidines (adenine to thymine and guanine to cytosine).

A class of untranslated RNA molecules that are typically greater than 200 nucleotides in length and do not code for proteins. Members of this class have been found to play roles in transcriptional regulation, post-transcriptional processing, CHROMATIN REMODELING, and in the epigenetic control of chromatin.

Small nuclear RNAs that are involved in the processing of pre-ribosomal RNA in the nucleolus. Box C/D containing snoRNAs (U14, U15, U16, U20, U21 and U24-U63) direct site-specific methylation of various ribose moieties. Box H/ACA containing snoRNAs (E2, E3, U19, U23, and U64-U72) direct the conversion of specific uridines to pseudouridine. Site-specific cleavages resulting in the mature ribosomal RNAs are directed by snoRNAs U3, U8, U14, U22 and the snoRNA components of RNase MRP and RNase P.

The parts of a macromolecule that directly participate in its specific combination with another molecule.

The process in which substances, either endogenous or exogenous, bind to proteins, peptides, enzymes, protein precursors, or allied compounds. Specific protein-binding measures are often used as assays in diagnostic assessments.

Synthetic transcripts of a specific DNA molecule or fragment, made by an in vitro transcription system. This cRNA can be labeled with radioactive uracil and then used as a probe. (King & Stansfield, A Dictionary of Genetics, 4th ed)

DNA sequences which are recognized (directly or indirectly) and bound by a DNA-dependent RNA polymerase during the initiation of transcription. Highly conserved sequences within the promoter include the Pribnow box in bacteria and the TATA BOX in eukaryotes.

A family of enzymes that catalyze the endonucleolytic cleavage of RNA. It includes EC 3.1.26.-, EC 3.1.27.-, EC 3.1.30.-, and EC 3.1.31.-.

Within a eukaryotic cell, a membrane-limited body which contains chromosomes and one or more nucleoli (CELL NUCLEOLUS). The nuclear membrane consists of a double unit-type membrane which is perforated by a number of pores; the outermost membrane is continuous with the ENDOPLASMIC RETICULUM. A cell may contain more than one nucleus. (From Singleton & Sainsbury, Dictionary of Microbiology and Molecular Biology, 2d ed)

Ribonucleic acid in chloroplasts having regulatory and catalytic roles as well as involvement in protein synthesis.

Models used experimentally or theoretically to study molecular shape, electronic properties, or interactions; includes analogous molecules, computer-generated graphics, and mechanical structures.

Extrachromosomal, usually CIRCULAR DNA molecules that are self-replicating and transferable from one organism to another. They are found in a variety of bacterial, archaeal, fungal, algal, and plant species. They are used in GENETIC ENGINEERING as CLONING VECTORS.

A variation of the PCR technique in which cDNA is made from RNA via reverse transcription. The resultant cDNA is then amplified using standard PCR protocols.

The rate dynamics in chemical or physical systems.

Enzymes that catalyze the endonucleolytic cleavage of single-stranded regions of DNA or RNA molecules while leaving the double-stranded regions intact. They are particularly useful in the laboratory for producing "blunt-ended" DNA molecules from DNA with single-stranded ends and for sensitive GENETIC TECHNIQUES such as NUCLEASE PROTECTION ASSAYS that involve the detection of single-stranded DNA and RNA.

Pairing of purine and pyrimidine bases by HYDROGEN BONDING in double-stranded DNA or RNA.

Ribonucleic acid in helminths having regulatory and catalytic roles as well as involvement in protein synthesis.

Viruses parasitic on plants higher than bacteria.

Short sequences (generally about 10 base pairs) of DNA that are complementary to sequences of messenger RNA and allow reverse transcriptases to start copying the adjacent sequences of mRNA. Primers are used extensively in genetic and molecular biology techniques.

Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control (induction or repression) of gene action at the level of transcription or translation.

A species of the genus SACCHAROMYCES, family Saccharomycetaceae, order Saccharomycetales, known as "baker's" or "brewer's" yeast. The dried form is used as a dietary supplement.

Endogenous substances, usually proteins, which are effective in the initiation, stimulation, or termination of the genetic transcription process.

A transfer RNA which is specific for carrying phenylalanine to sites on the ribosomes in preparation for protein synthesis.

A transfer RNA which is specific for carrying lysine to sites on the ribosomes in preparation for protein synthesis.

Multicomponent ribonucleoprotein structures found in the CYTOPLASM of all cells, and in MITOCHONDRIA, and PLASTIDS. They function in PROTEIN BIOSYNTHESIS via GENETIC TRANSLATION.

Detection of RNA that has been electrophoretically separated and immobilized by blotting on nitrocellulose or other type of paper or nylon membrane followed by hybridization with labeled NUCLEIC ACID PROBES.

Deoxyribonucleic acid that makes up the genetic material of viruses.

In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships.

Polymers made up of a few (2-20) nucleotides. In molecular genetics, they refer to a short sequence synthesized to match a region where a mutation is known to occur, and then used as a probe (OLIGONUCLEOTIDE PROBES). (Dorland, 28th ed)

Interruption or suppression of the expression of a gene at transcriptional or translational levels.

The sequence at the 5' end of the messenger RNA that does not code for product. This sequence contains the ribosome binding site and other transcription and translation regulating sequences.

A transfer RNA which is specific for carrying tyrosine to sites on the ribosomes in preparation for protein synthesis.

The sequential correspondence of nucleotides in one nucleic acid molecule with those of another nucleic acid molecule. Sequence homology is an indication of the genetic relatedness of different organisms and gene function.

The sequence at the 3' end of messenger RNA that does not code for product. This region contains transcription and translation regulating sequences.

Cyclic peptides extracted from carpophores of various mushroom species. They are potent inhibitors of RNA polymerases in most eukaryotic species, blocking the production of mRNA and protein synthesis. These peptides are important in the study of transcription. Alpha-amanitin is the main toxin from the species Amanitia phalloides, poisonous if ingested by humans or animals.

The functional hereditary units of VIRUSES.

Disruption of the secondary structure of nucleic acids by heat, extreme pH or chemical treatment. Double strand DNA is "melted" by dissociation of the non-covalent hydrogen bonds and hydrophobic interactions. Denatured DNA appears to be a single-stranded flexible structure. The effects of denaturation on RNA are similar though less pronounced and largely reversible.

The uptake of naked or purified DNA by CELLS, usually meaning the process as it occurs in eukaryotic cells. It is analogous to bacterial transformation (TRANSFORMATION, BACTERIAL) and both are routinely employed in GENE TRANSFER TECHNIQUES.

An enzyme catalyzing the endonucleolytic cleavage of RNA at the 3'-position of a guanylate residue. EC 3.1.27.3.

The sum of the weight of all the atoms in a molecule.

The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.

Within most types of eukaryotic CELL NUCLEUS, a distinct region, not delimited by a membrane, in which some species of rRNA (RNA, RIBOSOMAL) are synthesized and assembled into ribonucleoprotein subunits of ribosomes. In the nucleolus rRNA is transcribed from a nucleolar organizer, i.e., a group of tandemly repeated chromosomal genes which encode rRNA and which are transcribed by RNA polymerase I. (Singleton & Sainsbury, Dictionary of Microbiology & Molecular Biology, 2d ed)

The type species of LENTIVIRUS and the etiologic agent of AIDS. It is characterized by its cytopathic effect and affinity for the T4-lymphocyte.

A fractionated cell extract that maintains a biological function. A subcellular fraction isolated by ultracentrifugation or other separation techniques must first be isolated so that a process can be studied free from all of the complex side reactions that occur in a cell. The cell-free system is therefore widely used in cell biology. (From Alberts et al., Molecular Biology of the Cell, 2d ed, p166)

The level of protein structure in which combinations of secondary protein structures (alpha helices, beta sheets, loop regions, and motifs) pack together to form folded shapes called domains. Disulfide bridges between cysteines in two different parts of the polypeptide chain along with other interactions between the chains play a role in the formation and stabilization of tertiary structure. Small proteins usually consist of only one domain but larger proteins may contain a number of domains connected by segments of polypeptide chain which lack regular secondary structure.

Single-stranded complementary DNA synthesized from an RNA template by the action of RNA-dependent DNA polymerase. cDNA (i.e., complementary DNA, not circular DNA, not C-DNA) is used in a variety of molecular cloning experiments as well as serving as a specific hybridization probe.

Any of the processes by which cytoplasmic factors influence the differential control of gene action in viruses.

A category of nucleic acid sequences that function as units of heredity and which code for the basic instructions for the development, reproduction, and maintenance of organisms.

A sequence of amino acids in a polypeptide or of nucleotides in DNA or RNA that is similar across multiple species. A known set of conserved sequences is represented by a CONSENSUS SEQUENCE. AMINO ACID MOTIFS are often composed of conserved sequences.

Proteins encoded by a VIRAL GENOME that are produced in the organisms they infect, but not packaged into the VIRUS PARTICLES. Some of these proteins may play roles within the infected cell during VIRUS REPLICATION or act in regulation of virus replication or VIRUS ASSEMBLY.

Intermediates in protein biosynthesis. The compounds are formed from amino acids, ATP and transfer RNA, a reaction catalyzed by aminoacyl tRNA synthetase. They are key compounds in the genetic translation process.

The phenotypic manifestation of a gene or genes by the processes of GENETIC TRANSCRIPTION and GENETIC TRANSLATION.

Sequences of DNA in the genes that are located between the EXONS. They are transcribed along with the exons but are removed from the primary gene transcript by RNA SPLICING to leave mature RNA. Some introns code for separate genes.

Nucleotide sequences located at the ends of EXONS and recognized in pre-messenger RNA by SPLICEOSOMES. They are joined during the RNA SPLICING reaction, forming the junctions between exons.

A transfer RNA which is specific for carrying alanine to sites on the ribosomes in preparation for protein synthesis.

A species of ENTEROVIRUS which is the causal agent of POLIOMYELITIS in humans. Three serotypes (strains) exist. Transmission is by the fecal-oral route, pharyngeal secretions, or mechanical vector (flies). Vaccines with both inactivated and live attenuated virus have proven effective in immunizing against the infection.

Cells propagated in vitro in special media conducive to their growth. Cultured cells are used to study developmental, morphologic, metabolic, physiologic, and genetic processes, among others.

A plant genus of the family SOLANACEAE. Members contain NICOTINE and other biologically active chemicals; its dried leaves are used for SMOKING.

An RNA-containing enzyme that plays an essential role in tRNA processing by catalyzing the endonucleolytic cleavage of TRANSFER RNA precursors. It removes the extra 5'-nucleotides from tRNA precursors to generate mature tRNA molecules.

Separation of particles according to density by employing a gradient of varying densities. At equilibrium each particle settles in the gradient at a point equal to its density. (McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)

The part of a cell that contains the CYTOSOL and small structures excluding the CELL NUCLEUS; MITOCHONDRIA; and large VACUOLES. (Glick, Glossary of Biochemistry and Molecular Biology, 1990)

The monomeric units from which DNA or RNA polymers are constructed. They consist of a purine or pyrimidine base, a pentose sugar, and a phosphate group. (From King & Stansfield, A Dictionary of Genetics, 4th ed)

Viruses which produce a mottled appearance of the leaves of plants.

An enzyme that synthesizes DNA on an RNA template. It is encoded by the pol gene of retroviruses and by certain retrovirus-like elements. EC 2.7.7.49.

A compound composed of a two CYCLIC PEPTIDES attached to a phenoxazine that is derived from STREPTOMYCES parvullus. It binds to DNA and inhibits RNA synthesis (transcription), with chain elongation more sensitive than initiation, termination, or release. As a result of impaired mRNA production, protein synthesis also declines after dactinomycin therapy. (From AMA Drug Evaluations Annual, 1993, p2015)

A sequence of successive nucleotide triplets that are read as CODONS specifying AMINO ACIDS and begin with an INITIATOR CODON and end with a stop codon (CODON, TERMINATOR).

The determination of the pattern of genes expressed at the level of GENETIC TRANSCRIPTION, under specific circumstances or in a specific cell.

A genus of FLAVIVIRIDAE causing parenterally-transmitted HEPATITIS C which is associated with transfusions and drug abuse. Hepatitis C virus is the type species.

Electrophoresis in which a polyacrylamide gel is used as the diffusion medium.

A transfer RNA which is specific for carrying aspartic acid to sites on the ribosomes in preparation for protein synthesis.

A transfer RNA which is specific for carrying methionine to sites on the ribosomes. During initiation of protein synthesis, tRNA(f)Met in prokaryotic cells and tRNA(i)Met in eukaryotic cells binds to the start codon (CODON, INITIATOR).

The relationships of groups of organisms as reflected by their genetic makeup.

A genus of tripartite plant viruses in the family BROMOVIRIDAE. Transmission is by beetles. Brome mosaic virus is the type species.

Proteins prepared by recombinant DNA technology.

A characteristic feature of enzyme activity in relation to the kind of substrate on which the enzyme or catalytic molecule reacts.

A ribonuclease that specifically cleaves the RNA moiety of RNA:DNA hybrids. It has been isolated from a wide variety of prokaryotic and eukaryotic organisms as well as RETROVIRUSES.

Proteins found in the nucleus of a cell. Do not confuse with NUCLEOPROTEINS which are proteins conjugated with nucleic acids, that are not necessarily present in the nucleus.

Theoretical representations that simulate the behavior or activity of genetic processes or phenomena. They include the use of mathematical equations, computers, and other electronic equipment.

Sequences within RNA that regulate the processing, stability (RNA STABILITY) or translation (TRANSLATION, GENETIC) of RNA.

A multiribosomal structure representing a linear array of RIBOSOMES held together by messenger RNA; (RNA, MESSENGER); They represent the active complexes in cellular protein synthesis and are able to incorporate amino acids into polypeptides both in vivo and in vitro. (From Rieger et al., Glossary of Genetics: Classical and Molecular, 5th ed)

A cell line derived from cultured tumor cells.

The outer protein protective shell of a virus, which protects the viral nucleic acid.

A family of enzymes that catalyze the exonucleolytic cleavage of RNA. It includes EC 3.1.13.-, EC 3.1.14.-, EC 3.1.15.-, and EC 3.1.16.-. EC 3.1.-

The property of objects that determines the direction of heat flow when they are placed in direct thermal contact. The temperature is the energy of microscopic motions (vibrational and translational) of the particles of atoms.

Proteins found in any species of bacterium.

Use of restriction endonucleases to analyze and generate a physical map of genomes, genes, or other segments of DNA.

A transfer RNA which is specific for carrying glycine to sites on the ribosomes in preparation for protein synthesis.

A transfer RNA which is specific for carrying histidine to sites on the ribosomes in preparation for protein synthesis.

Proteins obtained from the species SACCHAROMYCES CEREVISIAE. The function of specific proteins from this organism are the subject of intense scientific interest and have been used to derive basic understanding of the functioning similar proteins in higher eukaryotes.

A transfer RNA which is specific for carrying valine to sites on the ribosomes in preparation for protein synthesis.

A group of uridine ribonucleotides in which the phosphate residues of each uridine ribonucleotide act as bridges in forming diester linkages between the ribose moieties.

A family of RNA viruses infecting insects and fish. There are two genera: Alphanodavirus and Betanodavirus.

Use for nucleic acid precursors in general or for which there is no specific heading.

The assembly of VIRAL STRUCTURAL PROTEINS and nucleic acid (VIRAL DNA or VIRAL RNA) to form a VIRUS PARTICLE.

Viruses which lack a complete genome so that they cannot completely replicate or cannot form a protein coat. Some are host-dependent defectives, meaning they can replicate only in cell systems which provide the particular genetic function which they lack. Others, called SATELLITE VIRUSES, are able to replicate only when their genetic defect is complemented by a helper virus.

Deletion of sequences of nucleic acids from the genetic material of an individual.

A transfer RNA which is specific for carrying arginine to sites on the ribosomes in preparation for protein synthesis.

Ribonucleic acid in algae having regulatory and catalytic roles as well as involvement in protein synthesis.

A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.

A family of ribonucleoproteins that were originally found as proteins bound to nascent RNA transcripts in the form of ribonucleoprotein particles. Although considered ribonucleoproteins they are primarily classified by their protein component. They are involved in a variety of processes such as packaging of RNA and RNA TRANSPORT within the nucleus. A subset of heterogeneous-nuclear ribonucleoproteins are involved in additional functions such as nucleocytoplasmic transport (ACTIVE TRANSPORT, CELL NUCLEUS) of RNA and mRNA stability in the CYTOPLASM.

Proteins obtained from ESCHERICHIA COLI.

The restriction of a characteristic behavior, anatomical structure or physical system, such as immune response; metabolic response, or gene or gene variant to the members of one species. It refers to that property which differentiates one species from another but it is also used for phylogenetic levels higher or lower than the species.

A process whereby multiple RNA transcripts are generated from a single gene. Alternative splicing involves the splicing together of other possible sets of EXONS during the processing of some, but not all, transcripts of the gene. Thus a particular exon may be connected to any one of several alternative exons to form a mature RNA. The alternative forms of mature MESSENGER RNA produce PROTEIN ISOFORMS in which one part of the isoforms is common while the other parts are different.

The infective system of a virus, composed of the viral genome, a protein core, and a protein coat called a capsid, which may be naked or enclosed in a lipoprotein envelope called the peplos.

Highly conserved nuclear RNA-protein complexes that function in RNA processing in the nucleus, including pre-mRNA splicing and pre-mRNA 3'-end processing in the nucleoplasm, and pre-rRNA processing in the nucleolus (see RIBONUCLEOPROTEINS, SMALL NUCLEOLAR).

A defective virus, containing particles of RNA nucleoprotein in virion-like form, present in patients with acute hepatitis B and chronic hepatitis. It requires the presence of a hepadnavirus for full replication. This is the lone species in the genus Deltavirus.

Proteins found in ribosomes. They are believed to have a catalytic function in reconstituting biologically active ribosomal subunits.

A transfer RNA which is specific for carrying tryptophan to sites on the ribosomes in preparation for protein synthesis.

Hybridization of a nucleic acid sample to a very large set of OLIGONUCLEOTIDE PROBES, which have been attached individually in columns and rows to a solid support, to determine a BASE SEQUENCE, or to detect variations in a gene sequence, GENE EXPRESSION, or for GENE MAPPING.

DNA sequences recognized as signals to end GENETIC TRANSCRIPTION.

Recombinant proteins produced by the GENETIC TRANSLATION of fused genes formed by the combination of NUCLEIC ACID REGULATORY SEQUENCES of one or more genes with the protein coding sequences of one or more genes.

Compounds and molecular complexes that consist of very large numbers of atoms and are generally over 500 kDa in size. In biological systems macromolecular substances usually can be visualized using ELECTRON MICROSCOPY and are distinguished from ORGANELLES by the lack of a membrane structure.

Multicellular, eukaryotic life forms of kingdom Plantae (sensu lato), comprising the VIRIDIPLANTAE; RHODOPHYTA; and GLAUCOPHYTA; all of which acquired chloroplasts by direct endosymbiosis of CYANOBACTERIA. They are characterized by a mainly photosynthetic mode of nutrition; essentially unlimited growth at localized regions of cell divisions (MERISTEMS); cellulose within cells providing rigidity; the absence of organs of locomotion; absence of nervous and sensory systems; and an alternation of haploid and diploid generations.

Elements of limited time intervals, contributing to particular results or situations.

Genetically engineered MUTAGENESIS at a specific site in the DNA molecule that introduces a base substitution, or an insertion or deletion.

Process of generating a genetic MUTATION. It may occur spontaneously or be induced by MUTAGENS.

A bacteriophage genus of the family LEVIVIRIDAE, whose viruses contain the short version of the genome and have a separate gene for cell lysis.

Identification of proteins or peptides that have been electrophoretically separated by blot transferring from the electrophoresis gel to strips of nitrocellulose paper, followed by labeling with antibody probes.

A hemoflagellate subspecies of parasitic protozoa that causes nagana in domestic and game animals in Africa. It apparently does not infect humans. It is transmitted by bites of tsetse flies (Glossina).

Enzymes that are part of the restriction-modification systems. They catalyze the endonucleolytic cleavage of DNA sequences which lack the species-specific methylation pattern in the host cell's DNA. Cleavage yields random or specific double-stranded fragments with terminal 5'-phosphates. The function of restriction enzymes is to destroy any foreign DNA that invades the host cell. Most have been studied in bacterial systems, but a few have been found in eukaryotic organisms. They are also used as tools for the systematic dissection and mapping of chromosomes, in the determination of base sequences of DNAs, and have made it possible to splice and recombine genes from one organism into the genome of another. EC 3.21.1.

Theoretical representations that simulate the behavior or activity of biological processes or diseases. For disease models in living animals, DISEASE MODELS, ANIMAL is available. Biological models include the use of mathematical equations, computers, and other electronic equipment.

The parts of a transcript of a split GENE remaining after the INTRONS are removed. They are spliced together to become a MESSENGER RNA or other functional RNA.

Any of the processes by which cytoplasmic or intercellular factors influence the differential control of gene action in bacteria.

A genus of plant viruses that infects ANGIOSPERMS. Transmission occurs mechanically and through soil, with one species transmitted via a fungal vector. The type species is Tomato bushy stunt virus.

A purine nucleoside that has guanine linked by its N9 nitrogen to the C1 carbon of ribose. It is a component of ribonucleic acid and its nucleotides play important roles in metabolism. (From Dorland, 28th ed)

The addition of a tail of polyadenylic acid (POLY A) to the 3' end of mRNA (RNA, MESSENGER). Polyadenylation involves recognizing the processing site signal, (AAUAAA), and cleaving of the mRNA to create a 3' OH terminal end to which poly A polymerase (POLYNUCLEOTIDE ADENYLYLTRANSFERASE) adds 60-200 adenylate residues. The 3' end processing of some messenger RNAs, such as histone mRNA, is carried out by a different process that does not include the addition of poly A as described here.

A transfer RNA which is specific for carrying leucine to sites on the ribosomes in preparation for protein synthesis.

The outward appearance of the individual. It is the product of interactions between genes, and between the GENOTYPE and the environment.

The relationship between the chemical structure of a compound and its biological or pharmacological activity. Compounds are often classed together because they have structural characteristics in common including shape, size, stereochemical arrangement, and distribution of functional groups.

Addition of methyl groups. In histo-chemistry methylation is used to esterify carboxyl groups and remove sulfate groups by treating tissue sections with hot methanol in the presence of hydrochloric acid. (From Stedman, 25th ed)

Absence of RNASE III alters the pathway by which RNAI, the antisense inhibitor of ColE1 replication, decays. (1/22353)

RNAI is a short RNA, 108 nt in length, which regulates the replication of the plasmid ColE1. RNAI turns over rapidly, enabling plasmid replication rate to respond quickly to changes in plasmid copy number. Because RNAI is produced in abundance, is easily extracted and turns over quickly, it has been used as a model for mRNA in studying RNA decay pathways. The enzymes polynucleotide phosphorylase, poly(A) polymerase and RNase E have been demonstrated to have roles in both messenger and RNAI decay; it is reported here that these enzymes can work independently of one another to facilitate RNAI decay. The roles in RNAI decay of two further enzymes which facilitate mRNA decay, the exonuclease RNase II and the endonuclease RNase III, are also examined. RNase II does not appear to accelerate RNAI decay but it is found that, in the absence of RNase III, polyadenylated RNAI, unprocessed by RNase E, accumulates. It is also shown that RNase III can cut RNAI near nt 82 or 98 in vitro. An RNAI fragment corresponding to the longer of these can be found in extracts of an mc+ pcnB strain (which produces RNase III) but not of an rnc pcnB strain, suggesting that RNAI may be a substrate for RNase III in vivo. A possible pathway for the early steps in RNAI decay which incorporates this information is suggested. (+info)

The CafA protein required for the 5'-maturation of 16 S rRNA is a 5'-end-dependent ribonuclease that has context-dependent broad sequence specificity. (2/22353)

The CafA protein, which was initially described as having a role in either Escherichia coli cell division or chromosomal segregation, has recently been shown to be required for the maturation of the 5'-end of 16 S rRNA. The sequence of CafA is similar to that of the N-terminal ribonucleolytic half of RNase E, an essential E. coli enzyme that has a central role in the processing of rRNA and the decay of mRNA and RNAI, the antisense regulator of ColE1-type plasmids. We show here that a highly purified preparation of CafA is sufficient in vitro for RNA cutting. We detected CafA cleavage of RNAI and a structured region from the 5'-untranslated region of ompA mRNA within segments cleavable by RNaseE, but not CafA cleavage of 9 S RNA at its "a" RNase E site. The latter is consistent with the finding that the generation of 5 S rRNA from its 9 S precursor can be blocked by inactivation of RNase E in cells that are wild type for CafA. Interestingly, however, a decanucleotide corresponding in sequence to the a site of 9 S RNA was cut efficiently indicating that cleavage by CafA is regulated by the context of sites within structured RNAs. Consistent with this notion is our finding that although 23 S rRNA is stable in vivo, a segment from this RNA is cut efficient by CafA at multiple sites in vitro. We also show that, like RNase E cleavage, the efficiency of cleavage by CafA is dependent on the presence of a monophosphate group on the 5'-end of the RNA. This finding raises the possibility that the context dependence of cleavage by CafA may be due at least in part to the separation of a cleavable sequence from the 5'-end of an RNA. Comparison of the sites surrounding points of CafA cleavage suggests that this enzyme has broad sequence specificity. Together with the knowledge that CafA can cut RNAI and ompA mRNA in vitro within segments whose cleavage in vivo initiates the decay of these RNAs, this finding suggests that CafA may contribute at some point during the decay of many RNAs in E. coli. (+info)

RNAi: double-stranded RNA directs the ATP-dependent cleavage of mRNA at 21 to 23 nucleotide intervals. (3/22353)

Double-stranded RNA (dsRNA) directs the sequence-specific degradation of mRNA through a process known as RNA interference (RNAi). Using a recently developed Drosophila in vitro system, we examined the molecular mechanism underlying RNAi. We find that RNAi is ATP dependent yet uncoupled from mRNA translation. During the RNAi reaction, both strands of the dsRNA are processed to RNA segments 21-23 nucleotides in length. Processing of the dsRNA to the small RNA fragments does not require the targeted mRNA. The mRNA is cleaved only within the region of identity with the dsRNA. Cleavage occurs at sites 21-23 nucleotides apart, the same interval observed for the dsRNA itself, suggesting that the 21-23 nucleotide fragments from the dsRNA are guiding mRNA cleavage. (+info)

Caenorhabditis elegans beta-G spectrin is dispensable for establishment of epithelial polarity, but essential for muscular and neuronal function. (4/22353)

The Caenorhabditis elegans genome encodes one alpha spectrin subunit, a beta spectrin subunit (beta-G), and a beta-H spectrin subunit. Our experiments show that the phenotype resulting from the loss of the C. elegans alpha spectrin is reproduced by tandem depletion of both beta-G and beta-H spectrins. We propose that alpha spectrin combines with the beta-G and beta-H subunits to form alpha/beta-G and alpha/beta-H heteromers that perform the entire repertoire of spectrin function in the nematode. The expression patterns of nematode beta-G spectrin and vertebrate beta spectrins exhibit three striking parallels including: (1) beta spectrins are associated with the sites of cell-cell contact in epithelial tissues; (2) the highest levels of beta-G spectrin occur in the nervous system; and (3) beta spectrin-G in striated muscle is associated with points of attachment of the myofilament apparatus to adjacent cells. Nematode beta-G spectrin associates with plasma membranes at sites of cell-cell contact, beginning at the two-cell stage, and with a dramatic increase in intensity after gastrulation when most cell proliferation has been completed. Strikingly, depletion of nematode beta-G spectrin by RNA-mediated interference to undetectable levels does not affect the establishment of structural and functional polarity in epidermis and intestine. Contrary to recent speculation, beta-G spectrin is not associated with internal membranes and depletion of beta-G spectrin was not associated with any detectable defects in secretion. Instead beta-G spectrin-deficient nematodes arrest as early larvae with progressive defects in the musculature and nervous system. Therefore, C. elegans beta-G spectrin is required for normal muscle and neuron function, but is dispensable for embryonic elongation and establishment of early epithelial polarity. We hypothesize that heteromeric spectrin evolved in metazoans in response to the needs of cells in the context of mechanically integrated tissues that can withstand the rigors imposed by an active organism. (+info)

Flagellum ontogeny in trypanosomes studied via an inherited and regulated RNA interference system. (5/22353)

The African trypanosome, Trypanosoma brucei possesses a large and unique intraflagellar structure called the paraflagellar rod (PFR). The PFR is composed of 2 major proteins, PFRA and PFRC. We have generated an inducible mutant trypanosome cell line (snl-2) that expresses linked inverted copies of a PFRA gene, capable of forming a PFRA double-stranded (ds) RNA. When expression of this dsRNA was induced, new PFRA RNA and PFRA protein quickly disappeared and PFR construction was affected, resulting in cell paralysis. This inducible RNA interference (RNAi) effect was fast-acting, heritable and reversible. It allowed us to demonstrate that PFR proteins are able to enter both mature and growing flagella but appear to concentrate differentially in new flagella because of the construction process. The PFR is constructed by a polar assembly process at the distal end of the flagellum resulting in a stable cytoskeletal structure with low turn-over. The inducible RNAi approach will have widespread applicability in studies of gene function and cellular processes in parasites. (+info)

Mitotic phosphorylation of histone H3 is governed by Ipl1/aurora kinase and Glc7/PP1 phosphatase in budding yeast and nematodes. (6/22353)

Phosphorylation of histone H3 at serine 10 occurs during mitosis and meiosis in a wide range of eukaryotes and has been shown to be required for proper chromosome transmission in Tetrahymena. Here we report that Ipl1/aurora kinase and its genetically interacting phosphatase, Glc7/PP1, are responsible for the balance of H3 phosphorylation during mitosis in Saccharomyces cerevisiae and Caenorhabditis elegans. In these models, both enzymes are required for H3 phosphorylation and chromosome segregation, although a causal link between the two processes has not been demonstrated. Deregulation of human aurora kinases has been implicated in oncogenesis as a consequence of chromosome missegregation. Our findings reveal an enzyme system that regulates chromosome dynamics and controls histone phosphorylation that is conserved among diverse eukaryotes. (+info)

Double-stranded RNA injection produces nonspecific defects in zebrafish. (7/22353)

We have investigated the ability of dsRNA to inhibit gene functions in zebrafish using sequences targeted to the maternal gene pouII-1, the transgene GFP, and an intron of the zebrafish gene terra. We found that embryos injected with all of these dsRNAs at approximately 7.5 pg/embryo or higher had general growth arrest during gastrulation and displayed various nonspecific defects at 24 h postfertilization, although embryonic development was unaffected before the midblastula stage. Reducing dsRNA concentration could alleviate the global defects. Injection of GFP dsRNA (7.5-30 pg/embryo) did not inhibit GFP expression in transgenic fish, although abnormal embryos were induced. Co-injection of GFP mRNA with either GFP or non-GFP dsRNA caused reduction of GFP expression. Whole-mount in situ hybridization clearly showed that embryos injected with dsRNA degraded co-injected and endogenous mRNA without sequence specificity, indicating that dsRNA has a nonspecific effect at the posttranscriptional level. It appears that RNAi is not a viable technique for studying gene function in zebrafish embryos. (+info)

Drosophila mitochondrial transcription factor A (d-TFAM) is dispensable for the transcription of mitochondrial DNA in Kc167 cells. (8/22353)

We have cloned cDNA encoding Drosophila mitochondrial (mt) transcription factor A (d-TFAM). RNA interference (RNAi) of d-TFAM by lipofection of haemocyte-derived Kc167 cells with double-stranded RNA reduced d-TFAM to less than 5% of the normal level. Reflecting the ability of TFAM to stabilize mtDNA, RNAi of d-TFAM reduced mtDNA to 40%. Nonetheless, transcription of the ND2 and ND5 genes and their mRNAs remained unchanged for 8 days of the duration of RNAi. We thus show that d-TFAM is not essential for the transcription of Drosophila mtDNA. (+info)

Discovery of an endogenous small interfering RNA pathway in Drosophila. 2005. Discovery of the role of angiotensin converting ... "An endogenous small interfering RNA pathway in Drosophila". Nature. 453 (7196): 798-802. doi:10.1038/nature07007. ISSN 1476- ... Julius Brennecke: Transposon silencing & heterochromatin formation by small RNAs. Pioneer in the discovery of the piRNA/Piwi ... the functions of small RNAs, and the in vitro reconstitution from stem cells of whole organs and embryos. The institute ...

https://en.wikipedia.org/wiki/Institute_of_Molecular_Biotechnology

Studebaker AW, Lafuse WP, Kloesel R, Williams MV (Feb 2005). "Modulation of human dUTPase using small interfering RNA". ...

https://en.wikipedia.org/wiki/DUT_(gene)

Small interfering RNAs (siRNAs) are similar in function to miRNAs; they come from other sources of RNA, but serve a similar ... MiRNAs are formed from longer sequences of RNA that are cut free by a Dicer enzyme from an RNA sequence that is from a ... DNA and RNA base pair complementarity[edit]. Complementarity between two antiparallel strands of DNA. The top strand goes from ... A complementary strand of DNA or RNA may be constructed based on nucleobase complementarity.[2] Each base pair, A=T vs. G≡C, ...

https://en.wikipedia.org/wiki/Complementarity_

July 2007). "Transvascular delivery of small interfering RNA to the central nervous system". Nature. 448 (7149): 39-43. Bibcode ... The transcriptome is a set of all RNA, including rRNA, mRNA, tRNA, and non-coding RNA. Specifically mRNA transcripts can be ... RNA-seq uses reverse transcriptase to convert the mRNA template to cDNA. During library preparation, the cDNA is fragmented ... into small pieces, which then serve as the template for sequencing. After sequencing RNA-seq analysis can then be performed. ...

https://en.wikipedia.org/wiki/Transcriptome_in_vivo_analysis_tag

"Recognition of small interfering RNA by a viral suppressor of RNA silencing". Nature. 426 (6968): 874-878. Bibcode:2003Natur. ... In some cases overprinted proteins do have well-defined, but novel, three-dimensional structures; one example is the RNA ... Some studies attribute this observation to selective pressure toward small genome sizes mediated by the physical constraints of ... likely to greatly increase the number of potential expressible genes from a small set of viral genetic information. Genes may ...

https://en.wikipedia.org/wiki/Overlapping_gene

Small interfering RNA (siRNA) are synthetic antisense oligonucleotides to the mRNA of the gene of interest that works to ... Huynh T, Wälchli S, Sioud M (December 2006). "Transcriptional targeting of small interfering RNAs into cancer cells". Biochem. ... Survivin is 16.5 kDa large and is the smallest member of the IAP family. X-ray crystallography has shown two molecules of human ... and CTLs to eliminate and suppress the pulmonary metastases of non-small cell lung carcinoma. The activation of the immune ...

https://en.wikipedia.org/wiki/Survivin

It is a small interfering RNA that inhibits translation of the protein PCSK9. It is being developed by The Medicines Company ...

https://en.wikipedia.org/wiki/Inclisiran

Small interfering RNAs (siRNAs) are similar in function to miRNAs; they come from other sources of RNA, but serve a similar ... MiRNAs are formed from longer sequences of RNA that are cut free by a Dicer enzyme from an RNA sequence that is from a ... In addition, human immunodeficiency virus, a single-stranded RNA virus, encodes an RNA-dependent DNA polymerase (reverse ... RNA is more likely to form these kinds of structures due to base pair binding not seen in DNA, such as guanine binding with ...

https://en.wikipedia.org/wiki/Complementarity_(molecular_biology)

Yang N, Kazazian HH (September 2006). "L1 retrotransposition is suppressed by endogenously encoded small interfering RNAs in ... Class I TEs are copied in two stages: first, they are transcribed from DNA to RNA, and the RNA produced is then reverse ... Jin Y, Zhang W, Li Q (June 2009). "Origins and evolution of ADAR‐mediated RNA editing". IUBMB Life. 61 (6): 572-578. doi: ... TEs also serve to generate repeating sequences that can form dsRNA to act as a substrate for the action of ADAR in RNA editing ...

https://en.wikipedia.org/wiki/Transposable_elements

Yang N, Kazazian HH (September 2006). "L1 retrotransposition is suppressed by endogenously encoded small interfering RNAs in ... Class I TEs are copied in two stages: first, they are transcribed from DNA to RNA, and the RNA produced is then reverse ... In human embryos, two types of transposons combined to form noncoding RNA that catalyzes the development of stem cells. During ... For example, after conversion of retroviral RNA into DNA inside a host cell, the newly produced retroviral DNA is integrated ...

https://en.wikipedia.org/wiki/Transposon

"Improvement in radiosensitivity using small interfering RNA targeting p53R2 in esophageal squamous cell carcinoma". Oncology ... "ATM-mediated serine 72 phosphorylation stabilizes ribonucleotide reductase small subunit p53R2 protein against MDM2 to DNA ...

https://en.wikipedia.org/wiki/RRM2B

Removal of endogenous LYK5 by small interfering RNA abrogates LKB1-induced G1 phase arrest. STRADα stabilizes LKB1 protein both ...

https://en.wikipedia.org/wiki/LYK5

MBs have been used to deliver microRNAs, plasmids, small interfering RNA, and messenger RNA. MBs do not extravasate easily due ... They are also produced by the movement of a ship's hull through water, creating a bubble layer; this may interfere with the use ... There can be a small amount hemorrhage into brain tissue when microbubbles are used to disrupt the blood brain barrier, though ... Extremely high pressures cause small vessel destruction, but the pressure can be tuned to only create transient pores in vivo. ...

https://en.wikipedia.org/wiki/Microbubble

Small interfering RNA-mediated down regulation of Sperm-Associated Antigen 9 inhibits cervix tumor growth. Garg M, Kanojia D, ...

https://en.wikipedia.org/wiki/Anil_Suri

Since 2014 Mill has established a cilia-focussed programme that uses Small interfering RNA screening. She works with clinical ...

https://en.wikipedia.org/wiki/Pleasantine_Mill

"Hairpin RNA induces secondary small interfering RNA synthesis and silencing in trans in fission yeast". EMBO Reports. 11 (2): ... He has provided insight into how transcription and resulting non-coding RNA might influence the assembly of specialised CENP-A ... Ard, Ryan; Tong, Pin; Allshire, Robin C (2014). "Long non-coding RNA-mediated transcriptional interference of a permease gene ... He has investigated how RNA interference (RNAi) mediates heterochromatin formation and shown that splicing fators contribute to ...

https://en.wikipedia.org/wiki/Robin_Allshire

piRNAs have thus been classified as repeat-associated small interfering RNAs (rasiRNAs). Although their biogenesis is not yet ... phosphate of RNA; and the C-terminal PIWI domain acts as an RNase H endonuclease that can cleave RNA. The small RNA partners of ... Kim VN (2006). "Small RNAs just got bigger: Piwi-interacting RNAs (piRNAs) in mammalian testes". Genes Dev. 20 (15): 1993-7. ... Ozata DM, Gainetdinov I, Zoch A, Phillip D, Zamore PD (2019). "PIWI-interacting RNAs: small RNAs with big functions" (PDF). ...

https://en.wikipedia.org/wiki/Piwi

Zhao XF, Fjose A, Larsen N, Helvik JV, Drivenes Ø (May 2008). "Treatment with small interfering RNA affects the microRNA ... "Transcriptome-wide analysis of small RNA expression in early zebrafish development". RNA. 18 (5): 915-29. doi:10.1261/rna. ... RNA. 15 (12): 2351-63. doi:10.1261/rna.1882009. PMC 2779678. PMID 19854872. Takeda Y, Mishima Y, Fujiwara T, Sakamoto H, Inoue ... In molecular biology mir-430 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other ...

https://en.wikipedia.org/wiki/Mir-430_microRNA_precursor_family

Wu L, Mao L, Qi Y (October 2012). "Roles of dicer-like and argonaute proteins in TAS-derived small interfering RNA-triggered ... Trans-acting siRNA (abbreviated "ta-siRNA" or "tasiRNA") are a class of small interfering RNA (siRNA) that repress gene ... Heisel SE, Zhang Y, Allen E, Guo L, Reynolds TL, Yang X, Kovalic D, Roberts JK (2008). "Characterization of unique small RNA ... TAS3 trans-acting short-interfering RNA targeting auxin response factors ("tasiR-ARF") is an example of a ta-siRNA that has ...

https://en.wikipedia.org/wiki/Trans-acting_siRNA

The inactivation of Twist by small interfering RNA or chemotherapeutic approach has been demonstrated in vitro. Moreover, ... Zhuo WL, Wang Y, Zhuo XL, Zhang YS, Chen ZT (May 2008). "Short interfering RNA directed against TWIST, a novel zinc finger ...

https://en.wikipedia.org/wiki/Twist_transcription_factor

"Auxin regulation of the microRNA390-dependent transacting small interfering RNA pathway in Arabidopsis lateral root development ... "High-throughput sequencing of RNA silencing-associated small RNAs in olive (Olea europaea L.)". PLOS ONE. 6 (11): e27916. ... Takeda A, Iwasaki S, Watanabe T, Utsumi M, Watanabe Y (April 2008). "The mechanism selecting the guide strand from small RNA ... Axtell MJ, Snyder JA, Bartel DP (June 2007). "Common functions for diverse small RNAs of land plants". The Plant Cell. 19 (6): ...

https://en.wikipedia.org/wiki/Mir-390_microRNA_precursor_family

Small interfering RNA (siRNA) can induce a selective degradation of the mRNA of the protein of interest. Infusion of siRNA ... Another strategy for interfering with CREB function is the use of a dominant negative transgenic strategy. In this strategy, a ... The resulting transgenic protein was engineered to interfere with the normal function of CREB by competing with wild type (non- ... To regulate when the dominant negative CREB fragment interfered with normal CREB function, the mutant DNA was used to generate ...

https://en.wikipedia.org/wiki/CREB_in_cognition

Park C, Lee I, Kang WK (2007). "Influence of small interfering RNA corresponding to ets homologous factor on senescence- ...

https://en.wikipedia.org/wiki/EHF_(gene)

Collins CS, Hong J, Sapinoso L, Zhou Y, Liu Z, Micklash K, Schultz PG, Hampton GM (March 2006). "A small interfering RNA screen ... Collins CS, Hong J, Sapinoso L, Zhou Y, Liu Z, Micklash K, Schultz PG, Hampton GM (March 2006). "A small interfering RNA screen ... "An RNA interference-based screen identifies MAP4K4/NIK as a negative regulator of PPARgamma, adipogenesis, and insulin- ...

https://en.wikipedia.org/wiki/MAP4K4

2011). "Knockdown Of The Tachykinin Neurokinin 1 Receptor By Intrathecal Administration Of Small Interfering RNA In Rats". ... "A novel tachykinin NK2 receptor antagonist prevents motility-stimulating effects of neurokinin A in small intestine". Br J ...

https://en.wikipedia.org/wiki/Neurokinin_A

"Genome-scale microRNA and small interfering RNA screens identify small RNA modulators of TRAIL-induced apoptosis pathway". ... In molecular biology mir-193 microRNA is a short RNA molecule. MicroRNAs function to regulate the expression levels of other ...

https://en.wikipedia.org/wiki/Mir-193_microRNA_precursor_family

"Inhibition of Hazara nairovirus replication by small interfering RNAs and their combination with ribavirin". Virology Journal. ... The L RNA segment encodes an RNA-dependent RNA polymerase (L protein), the M RNA segment encodes two surface glycoproteins (Gc ... which are an order of enveloped negative-stranded RNA viruses with a genome split into three parts-Small (S), Middle (M) and ... Bilk, S.; Schulze, C.; Fischer, M.; Beer, M.; Hlinak, A.; Hoffmann, B. (2012). "Organ distribution of Schmallenberg virus RNA ...

https://en.wikipedia.org/wiki/Hazara_orthonairovirus

Small interfering RNAs can modulate transcriptional gene expression via epigenetic modulation of targeted promoters. Sometimes ... A smaller quantity of sperm RNA is transmitted from the father, but there is recent evidence that this epigenetic information ... sRNAs are small (50-250 nucleotides), highly structured, non-coding RNA fragments found in bacteria. They control gene ... It has been suggested that chromatin-based transcriptional regulation could be mediated by the effect of small RNAs. ...

https://en.wikipedia.org/wiki/Epigenetics

Identifying the different strands is also important in understanding small interfering RNAs, or siRNA. Sense (molecular biology ... The antisense strand is thus responsible for the RNA that is later translated to protein, while the sense strand possesses a ... Most eukaryotic RNA transcripts undergo additional editing prior to being translated for protein synthesis. This process ... The immediate product of this transcription is a resultant initial RNA transcript, which contains a sequence of nucleotides ...

https://en.wikipedia.org/wiki/Sense_strand

For example, the RNA interference (RNAi) mechanism of small interfering RNAs derived from L1 sequences can cause suppression of ... Yang N, Kazazian HH (September 2006). "L1 retrotransposition is suppressed by endogenously encoded small interfering RNAs in ... The reverse transcriptase makes a DNA copy of the LINE RNA that can be integrated into the genome at a new site. The only ... Luan DD, Korman MH, Jakubczak JL, Eickbush TH (February 1993). "Reverse transcription of R2Bm RNA is primed by a nick at the ...

https://en.wikipedia.org/wiki/Long_interspersed_nuclear_element

December 1999). "Identification of Ebola virus sequences present as RNA or DNA in organs of terrestrial small mammals of the ... Filoviral infection also interferes with proper functioning of the innate immune system.[50][52] EBOV proteins blunt the human ... Finding the virus, viral RNA, or antibodies in blood[1]. Differential diagnosis. Malaria, cholera, typhoid fever, meningitis, ... Ebolaviruses contain single-stranded, non-infectious RNA genomes.[46] Ebolavirus genomes contain seven genes including 3'-UTR- ...

https://en.m.wikipedia.org/wiki/Ebola_virus_disease

... and bi-segmented RNA. This virus has a both a large and a small genome section, with four lineages identified to date: Josiah ( ... Ribavirin is a prodrug which appears to interfere with viral replication by inhibiting RNA-dependent nucleic acid synthesis, ... Inhalation of tiny particles of infectious material (aerosol) is believed to be the most significant means of exposure. It is ... Confirmation is by laboratory testing to detect the virus's RNA, antibodies for the virus, or the virus itself in cell culture. ...

https://en.wikipedia.org/wiki/Lassa_fever

There is that little difference. We adhere to ours in practice, you don't." Whatever problems they may have had in their love ... but I am in no way hostile to religion provided it does not interfere in the lives of others or come into conflict with science ... an important milestone in understanding DNA and RNA.[272] ... Dalton discovered a little-known religious group called the ... Agnostic for me would be trying to weasel out and sound a little nicer than I am about this.. ...

https://en.wikipedia.org/wiki/List_of_atheists_

... from small catalysts to long RNA based enzymes. Particular RNAs were amplified up to 10,000 times, a first RNA version of the ... Atkins JF, Gesteland RF, Cech T (2006). The RNA world: the nature of modern RNA suggests a prebiotic RNA world. Plainview, N.Y ... of RNAs with molecular properties predicted for RNAs of the RNA World constitutes an additional argument supporting the RNA ... Properties of RNA[edit]. The properties of RNA make the idea of the RNA world hypothesis conceptually plausible, though its ...

https://en.wikipedia.org/wiki/RNA_world

RNA silencing mechanisms are also important in the plant systemic response, as they can block virus replication.[40] The ... One can see red blood cells, several knobby white blood cells including lymphocytes, a monocyte, a neutrophil, and many small ... Some viruses evade this by producing molecules which interfere with IFN production. For example, the Influenza A virus produces ... Baulcombe D (September 2004). "RNA silencing in plants". Nature. 431 (7006): 356-63. Bibcode:2004Natur.431..356B. doi:10.1038/ ...

https://en.wikipedia.org/wiki/Innate_immune_system

In addition, precious sample can be saved by utilizing a micro-volume platform where as little as 1uL of sample is required for ... Nucleic acid contamination can also interfere. This method requires a spectrophotometer capable of measuring in the UV region ... Spectrophotometry is an important technique used in many biochemical experiments that involve DNA, RNA, and protein isolation, ... If the compound is more concentrated more light will be absorbed by the sample; within small ranges, the Beer-Lambert law holds ...

https://en.wikipedia.org/wiki/Spectrophotometry

... in which a particular segment of DNA is copied into RNA by the enzyme RNA polymerase. Both RNA and DNA are nucleic acids, which ... A small structure within or sometimes external to a cell, consisting of fluid enclosed by a lipid bilayer.. vestigiality. The ... occurs when biological populations of the same species become isolated from each other to an extent that prevents or interferes ... RNA. See ribonucleic acid.. RNA polymerase. A member of a family of enzymes that are essential to life: they are found in all ...

https://en.m.wikipedia.org/wiki/Glossary_of_biology

For instance, NF-κB enhances the transcription of C-FLIP, Bcl-2, and cIAP1 / cIAP2, inhibitory proteins that interfere with ... negative regulation of transcription from RNA polymerase II promoter. • positive regulation of NF-kappaB transcription factor ... positive regulation of transcription from RNA polymerase II promoter. • positive regulation of leukocyte adhesion to arterial ...

https://en.wikipedia.org/wiki/TNF-alpha

HDAC inhibitor (small molecule) benzamide M344 MC 19 fatty acid Sodium butyrate M (y) 5, 6, 7 ; H (ny) D (y) 11 M (y) 14; R (y ... Mutations in UBQLN2 interfere with protein degradation resulting in neurodegeneration through abnormal protein aggregation.[52] ... Briefly, ncRNAs are involved in signaling cascades with epigenetic marking enzymes such as HMTs, and/or with RNA interference( ... C9orf72 likely functions as a guanine exchange factor for a small GTPase, but this is likely not related to the underlying ...

https://en.wikipedia.org/wiki/Epigenetics_of_neurodegenerative_diseases

SERS can be used to target specific DNA and RNA sequences using a combination of gold and silver nanoparticles and Raman-active ... Particles that are too small lose their electrical conductance and cannot enhance the field. When the particle size approaches ... Each spectrum was specific, which is advantageous over fluorescence detection; some fluorescent markers overlap and interfere ... The gold nanoparticles facilitate the formation of a silver coating on the dye-labeled regions of DNA or RNA, allowing SERS to ...

https://en.wikipedia.org/wiki/Surface_enhanced_Raman_spectroscopy

Small interfering RNAs (sometimes called silencing RNAs) interfere with the expression of a specific gene. They are quite small ... RNA Interference. [1]. *↑ Lee R.C. & Ambros V. 2001. An extensive class of small RNAs in Caenorhabditis elegans. Science 294, ... They are transfer RNA (tRNA) and ribosomal RNA (rRNA).. tRNA[change , change source]. Transfer RNA (tRNA) is a short molecule ... RNA is physically different from DNA: DNA contains two intercoiled strands, but RNA only contains one single strand. RNA also ...

https://simple.wikipedia.org/wiki/Ribosomal_RNA

It was first isolated in 1953 in Tanzania and is an RNA virus with a positive-sense single-stranded genome of about 11.6kb.[34] ... However, there is little evidence linking chronic Chikungunya virus disease and the development of autoimmunity. ... NS2 interferes with the JAK-STAT signaling pathway and prevents STAT from becoming phosphorylated.[52] ... In a mouse model, viral RNA was detected specifically in joint-associated tissue for at least 16 weeks after inoculation, and ...

https://en.wikipedia.org/wiki/Chikungunya_vaccine

Small interfering RNAs can modulate transcriptional gene expression via epigenetic modulation of targeted promoters.[61] ... A smaller quantity of sperm RNA is transmitted from the father, but there is recent evidence that this epigenetic information ... sRNAs are small (50-250 nucleotides), highly structured, non-coding RNA fragments found in bacteria. They control gene ... It has been suggested that chromatin-based transcriptional regulation could be mediated by the effect of small RNAs. ...

https://en.wikipedia.org/wiki/Epigenetic

Drugs that interfere with folate reactions[edit]. A number of drugs interfere with the biosynthesis of folic acid and THF. ... Folic acid is essential for the body to make DNA, RNA, and metabolise amino acids, which are required for cell division. Not ... Folic acid supplements have little established role in cancer chemotherapy.[46][47] Cases of severe adverse effects of ... RNA transcription and subsequent protein synthesis are less affected by folate deficiency, as the mRNA can be recycled and used ...

https://en.wikipedia.org/wiki/Vitamin_b9

Small interfering RNA (siRNA)Edit. Main article: siRNA. In metazoans, small interfering RNAs (siRNAs) processed by Dicer are ... MicroRNAs (miRNAs) are small RNAs that typically are partially complementary to sequences in metazoan messenger RNAs.[32] ... A 5' cap (also termed an RNA cap, an RNA 7-methylguanosine cap, or an RNA m7G cap) is a modified guanine nucleotide that has ... Messenger RNA (mRNA) is a large family of RNA molecules that convey genetic information from DNA to the ribosome, where they ...

https://en.m.wikipedia.org/wiki/MRNA

Small, electronegative molecules such as nitrogen and oxygen, which are the primary gases in air, significantly impact the ... A protein is created by ribosomes that "read" RNA that is encoded by codons in the gene and assemble the requisite amino acid ... heavy metals can interfere with folded proteins, which can strongly deter protein stability and activity. ... Nucleic acids (including RNA and DNA) are nucleotide polymers synthesized by polymerase enzymes during either transcription or ...

https://en.m.wikipedia.org/wiki/Denaturation_

Buckanovich RJ, Posner JB, Darnell RB (1993). "Nova, the paraneoplastic Ri antigen, is homologous to an RNA-binding protein and ... The purpose of this clinical case demonstrates the aggressive nature of the neuroendocrine small cell carcinoma with rapid ... paraneoplastic syndrome has been seen to interfere with standard treatments and lead to unexpected complications and clinical ... "Regression of small-cell lung carcinoma in patients with paraneoplastic neuronal antibodies", Lancet, 341 (8836): 21-22, doi: ...

https://en.wikipedia.org/wiki/Paraneoplastic_syndrome

Historical catch records suggest there could have been smaller aggression grounds in the Sea of Japan as well.[135] Along ... Solitary mature males are known to interfere and come to the aid of vulnerable groups nearby.[184] However, the bull sperm ... "Phylogenetic relationships of artiodactyls and cetaceans as deduced from the comparison of cytochrome b and 12S RNA ... in areas where the continental shelf is small and drops quickly to depths of 310 to 920 metres (1,020 to 3,020 ft).[31] Coastal ...

https://en.wikipedia.org/wiki/Sperm_whale

Despite the small structural difference between memantine and amantadine, two adamantane derivatives, the affinity for the ... To be clinically useful NMDA antagonists need to block excessive activation without interfering with normal functions. ... The detailed time course of this switch in the human cerebellum has been estimated using expression microarray and RNA seq and ... The off-rate of an antagonist from the receptors channel is an important factor as too slow off-rate can interfere with normal ...

https://en.wikipedia.org/wiki/NMDA_receptor

Only small lipophilic alkylating agents such as lomustine or temozolomide are able to cross this blood-brain barrier.[111][112] ... Many of them have a similar structure to the building blocks of DNA and RNA. The building blocks are nucleotides; a molecule ... Traditional chemotherapeutic agents are cytotoxic by means of interfering with cell division (mitosis) but cancer cells vary ... This fusion protein has enzyme activity that can be inhibited by imatinib, a small molecule drug.[119][120][121][122] ...

https://en.wikipedia.org/wiki/Chemotherapeutics

Small interfering *Piwi-interacting *Antisense *Processual *Small nuclear *Small nucleolar *Small Cajal Body RNAs ... It exists in solid form as small white crystals or white crystalline powder, has a molecular weight of 258.23 u, and has a ...

https://en.wikipedia.org/wiki/5-Methyluridine

The current estimate (excluding very tiny fragments) is a "hypertriploid chromosome number (3n+)" which means 76 to 80 total ... Through improper maintenance, they have been known to contaminate other cell cultures in the same laboratory, interfering with ... Further HeLa cells have also been used to define cancer markers in RNA, and have been used to establish an RNAi Based ...

https://en.wikipedia.org/wiki/HeLa

Anti-metabolites also affect RNA synthesis. However, because thymidine is used in DNA but not in RNA (where uracil is used ... Antimetabolites can be used in cancer treatment,[3] as they interfere with DNA production and therefore cell division and tumor ... pyrimidine analogue - mimic the structure of metabolic pyrimidines, the smaller bases incorporated into DNA as cytosine and ... Anthracyclines are anti-tumor antibiotics that interfere with enzymes involved in copying DNA during the cell cycle. [4] ...

https://en.m.wikipedia.org/wiki/Antimetabolite

Small interfering *Piwi-interacting *Antisense *Processual *Small nuclear *Small nucleolar *Small Cajal Body RNAs ... deoxyribozymes which functioned with substrates consisting of either full RNA or full DNA with a single RNA base were both able ... RNA ligases[edit]. Of particular interest are DNA ligases.[5] These molecules have demonstrated remarkable chemoselectivity in ... These first deoxyribozymes were unable to catalyze a full RNA substrate strand, but by incorporating the full RNA substrate ...

https://en.wikipedia.org/wiki/Deoxyribozyme

... interferes with transcription by binding to the β-subunit of bacterial RNA polymerase.[14] This results in the ... Rifaximin has few side effects.[7] Side effects are generally mild and uncommon;[6] this is largely because very little of the ... Rifaximin is particularly indicated where small intestine bacterial overgrowth is suspected of involvement in a person's IBS. ...

https://en.wikipedia.org/wiki/Rifaximin

... ribosomal RNA and transfer RNA). RNA can also have regulatory effects through hybridization interactions with other RNA ... Most mutations have little effect on an organism's phenotype, health, or reproductive fitness.[82] Mutations that do have an ... often by interfering with the structure of base-pairing, while UV radiation induces mutations by causing damage to the DNA ... This is a diagram showing mutations in an RNA sequence. Figure (1) is a normal RNA sequence, consisting of 4 codons. Figure (2 ...

https://en.m.wikipedia.org/wiki/Genetics

Two types of small ribonucleic acid (RNA) molecules - microRNA (miRNA) and small interfering RNA (siRNA) - are central to RNA ... The enzyme dicer trims double stranded RNA, to form small interfering RNA or microRNA. These processed RNAs are incorporated ... RNAs are the direct products of genes, and these small RNAs can direct enzyme complexes to degrade messenger RNA (mRNA) ... Natively expressed microRNA or exogenous small interfering RNA is processed by dicer and integrated into the RISC complex, ...

https://en.m.wikipedia.org/wiki/RNA_interference

Small interfering RNAs (sometimes called silencing RNAs) interfere with the expression of a specific gene. They are quite small ... Micro RNAs (miRNA) act by joining an enzyme and blocking mRNA (messenger RNA), or speeding its breakdown. This is called RNA ... Regulatory RNAsEdit. There are a number of RNAs which regulate genes, that is, they regulate the rate at which genes are ... Hamilton A & Baulcombe D (1999). "A species of small antisense RNA in posttranscriptional gene silencing in plants". Science ...

https://simple.m.wikipedia.org/wiki/Gene_expression

In addition, frequent epigenetic alterations of the DNA sequences code for small RNAs called microRNAs (or miRNAs). miRNAs do ... Some treatments can interfere with the mother's ability to give birth vaginally or to breastfeed.[219] Cervical cancer may ... July 2010). "Non-small cell lung cancer". Journal of the National Comprehensive Cancer Network. 8 (7): 740-801. PMID 20679538. ... Colon, uterine, small bowel, stomach, urinary tract Genetic testing for individuals at high-risk of certain cancers is ...

https://en.wikipedia.org/wiki/Malignant_neoplasms

The hypothesis might be very specific; for example, Einstein's equivalence principle or Francis Crick's "DNA makes RNA makes ... Therefore, science itself can have little to say about the possibility. In future, a new technique may allow for an ... can interfere with open and fair deliberation of some new research.[109] ... The particular points raised are statistical ("The smaller the studies conducted in a scientific field, the less likely the ...

https://en.wikipedia.org/wiki/Scientific_method

Abbreviations: RNAi, RNA interference; dsRNA, double-stranded RNA; siRNA, small interfering RNA; miRNA, microRNA; YFP, yellow ... cells that directs the degradation of messenger RNAs homologous to short double-stranded RNAs termed small interfering RNA ( ... Genomewide view of gene silencing by small interfering RNAs. Jen-Tsan Chi, Howard Y. Chang, Nancy N. Wang, Dustin S. Chang, ... Genomewide view of gene silencing by small interfering RNAs. Jen-Tsan Chi, Howard Y. Chang, Nancy N. Wang, Dustin S. Chang, ...

https://www.pnas.org/content/100/11/6343?ijkey=af24d1e5235d4100a3fcd67ed065c4f2583ec651&keytype2=tf_ipsecsha

Small interfering RNA (siRNA), sometimes known as short interfering RNA or silencing RNA, is a class of double-stranded RNA non ... Jensen K, Anderson JA, Glass EJ (April 2014). "Comparison of small interfering RNA (siRNA) delivery into bovine monocyte- ... Li L (2008). "Small RNA-Mediated Gene Activation". In Morris KV (ed.). RNA and the Regulation of Gene Expression: A Hidden ... Dicer cuts the long dsRNA to form short interfering RNA or siRNA; this is what enables the molecules to form the RNA-Induced ...

https://en.wikipedia.org/wiki/Small_interfering_RNA

Poly(ester amine) carrier may serve as an effective carrier, and aerosol delivery of Akt1 small interfering RNA may be a ... Poly(Ester Amine)-Mediated, Aerosol-Delivered Akt1 Small Interfering RNA Suppresses Lung Tumorigenesis. by Sam Savage ... were used for in vivo effects of aerosol-delivered Akt1 small interfering RNA (siRNA) in lung tumorigenesis. In K-ras^sup LA1^ ... To demonstrate the feasibility and emphasize the importance of noninvasive aerosol delivery of Akt1 small interfering RNA ( ...

http://www.redorbit.com/news/health/1459846/polyester_aminemediated_aerosoldelivered_akt1_small_interfering_rna_suppresses_lung_tumorigenesis/

Small interfering RNA. Small interfering RNA (siRNA), sometimes known as short interfering RNA or silencing RNA, is a class of ... Approval of first RNA interference drug - why the excitement?. Small interfering RNA sounds like something from a science ... attaching antibody-like RNA nanoparticles to microvesicles can deliver effective RNA therapeutics such as small interfering RNA ... The group published their findings in Science in a paper titled "A species of small antisense RNA in posttranscriptional gene ...

https://phys.org/tags/small+interfering+rna/

We show that the yellowing symptoms are a result of small interfering RNA (siRNA)-directed RNA silencing of the chlorophyll ... Viral small interfering RNAs target host genes to mediate disease symptoms in plants.. Smith NA1, Eamens AL, Wang MB. ... Viral Small Interfering RNAs Target Host Genes to Mediate Disease Symptoms in Plants ... Viral Small Interfering RNAs Target Host Genes to Mediate Disease Symptoms in Plants ...

https://www.ncbi.nlm.nih.gov/pubmed/21573142?dopt=Abstract

... Predesigned siRNA product lines. Guaranteed to silence target gene ... Predesigned for Human and Mouse long noncoding RNA (lncRNA). +. Recommended for transfectable mammalian cells in culture. +. + ... Lincode siRNA Highly specific knockdown of long noncoding RNA (lncRNA). Accell siRNA Target silencing in difficult-to-transfect ... siRNAs for efficient knockdown of long, noncoding RNA (lncRNA) genes with modifications to ensure specificity. ...

https://horizondiscovery.com/en/products/gene-modulation/knockdown-reagents/controls/PIFs/~/link.aspx?_id=4799651F-176A-43F6-BB5E-0816A8B4EBAB&_z=z

Using a chicken model, we have examined the effects of a small interfering RNA (siRNA) targeting ERK2 delivered by a lentiviral ... RNA interference (RNAi) is an evolutionarily conserved process in which cells employ small interfering RNA (siRNA) duplexes to ... Prevention of Tendon Adhesions by ERK2 Small Interfering RNAs. Hongjiang Ruan †, Shen Liu †, Fengfeng Li, Xujun Li and Cunyi ... Using a chicken model, we have examined the effects of a small interfering RNA (siRNA) targeting ERK2 delivered by a lentiviral ...

http://www.mdpi.com/1422-0067/14/2/4361/htm

Using a chicken model, we have examined the effects of a small interfering RNA (siRNA) targeting ERK2 delivered by a lentiviral ... Small Regulatory RNAs in the Control of Motility and Biofilm Formation in E. coli and Salmonella ...

http://www.mdpi.com/1422-0067/14/2/4361/notes

Identification of essential genes in cultured mammalian cells using small interfering RNAs.. Harborth J1, Elbashir SM, Bechert ... We report the first RNAi-induced phenotypes in mammalian cultured cells using RNA interference mediated by duplexes of 21-nt ... Genes were classified as essential or nonessential depending on impaired cell growth after RNA silencing. Phenotypes also ... RNAs. The 21 gene products studied have different functions and subcellular localizations. Knockdown experiments monitored by ...

https://www.ncbi.nlm.nih.gov/pubmed/11792820?dopt=Abstract

Small interfering RNAs (siRNA) were expressed as short hairpin RNAs (shRNA) against the gag and pol PERV genes, respectively, ... Production of transgenic pigs that express porcine endogenous retrovirus small interfering RNAs Xenotransplantation. May-Jun ... PERV knockdown was achieved whether the shRNA was expressed under the control of a RNA pol III, or a pol II promoter. Three ... The recently developed RNA interference (RNAi) technology to knockdown/silence post-transcriptional gene expression, offers a ...

https://pubmed.ncbi.nlm.nih.gov/19566656/

Transgene suppression in plants by foliar application of in vitro-synthesized small interfering RNAs. *Alexandra S. Dubrovina. ... Transgene suppression in plants by foliar application of in vitro-synthesized small interfering RNAs. Appl Microbiol Biotechnol ... Singh A, Gautam V, Singh S, Sarkar Das S, Verma S, Mishra V, Mukherjee S, Sarkar AK (2018) Plant small RNAs: advancement in the ... Borges F, Martienssen RA (2015) The expanding world of small RNAs in plants. Nat Rev Mol Cell Biol 16:727-741 ...

https://link.springer.com/article/10.1007%2Fs00253-020-10355-y

Running interference: prospects and obstacles to using small interfering RNAs as small molecule drugs. Annu. Rev. Biomed. Eng. ... Durante o seu ciclo de vida, os vírus baseados em RNA entram numa célula anfitriã e produzem RNA bicatenário. Este RNA é ... Este RNA é clivado em vários RNAs curtos com a ajuda de uma endonuclease, Dicer. Cada siRNA então se liga à Argonauta junto com ... 11.9: siRNA - Pequenos RNAs de Interferência Os RNAs de interferência pequenos, ou siRNAs, são moléculas reguladoras curtas de ...

https://www.jove.com/science-education/11629/sirna-pequenos-rnas-de-interferncia?language=Portuguese

11.10: siRNA - Small Interfering RNAs Small interfering RNAs, or siRNAs, are short regulatory RNA molecules that can silence ... Running interference: prospects and obstacles to using small interfering RNAs as small molecule drugs. Annu. Rev. Biomed. Eng. ... Durante il loro ciclo di vita, gli RNA-virus, entrano in una cellula ospite e producono RNA a doppio filamento. Questo RNA è ... Piccoli RNAs interferenti o siRNAs, sono RNAs non codificanti, lunghi circa 22 nucleotidi che regolano la sintesi e la ...

https://www.jove.com/science-education/11629/sirna-piccoli-rna-interferenti?language=Italian

Here, we systematically develop such a model for the complexation of small interfering RNA (siRNA) and grafted ... Journal Article: Systematic coarse-grained modeling of complexation between small interfering RNA and polycations ... Title: Systematic coarse-grained modeling of complexation between small interfering RNA and polycations ...

https://www.osti.gov/scitech/biblio/22493384-systematic-coarse-grained-modeling-complexation-between-small-interfering-rna-polycations

Small interfering RNA (siRNA) molecules have been successfully used to target specific genes in cell culture. However, the lack ... Testing Novel Compounds for Noninvasive Delivery of Small Interfering RNA into CNS. Rapid Response Innovation Awards, 2011. ... Gene expression can be specifically modulated by molecules named small interfering RNAs (siRNAs). Although siRNAs have emerged ... Recently, we have designed non-viral vectors that can deliver functional small interfering siRNAs specifically into cultured ...

https://www.michaeljfox.org/foundation/grant-detail.php?grant_id=929

Combined Small Interfering RNA Therapy and In Vivo Magnetic Resonance Imaging in Islet Transplantation. ... Combined Small Interfering RNA Therapy and In Vivo Magnetic Resonance Imaging in Islet Transplantation ... Combined Small Interfering RNA Therapy and In Vivo Magnetic Resonance Imaging in Islet Transplantation ... Combined Small Interfering RNA Therapy and In Vivo Magnetic Resonance Imaging in Islet Transplantation ...

http://diabetes.diabetesjournals.org/content/60/2/565

We demonstrated that small RNAs (sRNAs) generated from exogenously introduced inverted repeat transgenes, with perfect ... RNA interference (RNAi) is an evolutionarily conserved gene silencing mechanism in eukaryotes, with regulatory roles in a ... Ma, Xinrong, "Small interfering RNA-mediated translation repression alters ribosome sensitivity to inhibition by cycloheximide ... Small interfering RNA-mediated translation repression alters ribosome sensitivity to inhibition by cycloheximide in ...

https://digitalcommons.unl.edu/dissertations/AAI3558863/

Inhibition of HIV-1 Infection by Small Interfering RNA-Mediated RNA Interference. John Capodici, Katalin Karikó and Drew ... Inhibition of HIV-1 Infection by Small Interfering RNA-Mediated RNA Interference ... Inhibition of HIV-1 Infection by Small Interfering RNA-Mediated RNA Interference ... Inhibition of HIV-1 Infection by Small Interfering RNA-Mediated RNA Interference ...

http://www.jimmunol.org/content/169/9/5196

Successful gene silencing by small interfering RNA (siRNA) requires efficient uptake of siRNA into targeted cells. For in vitro ... Synthetic small interfering RNAs (siRNAs), which are small, double-stranded RNAs, are substrates for the RNA-induced silencing ... Evaluation of Small Interfering RNA Delivery into Cells by Reverse Transfection in Suspension with Cationic Liposomes () ... Successful gene silencing by small interfering RNA (siRNA) requires efficient uptake of siRNA into targeted cells. For in vitro ...

https://www.scirp.org/journal/paperinformation.aspx?paperid=76143

Combined small interfering RNA therapy and in vivo magnetic resonance imaging in islet transplantation. Diabetes 2011;60:565- ... A Theranostic Small Interfering RNA Nanoprobe Protects Pancreatic Islet Grafts From Adoptively Transferred Immune Rejection. ... A Theranostic Small Interfering RNA Nanoprobe Protects Pancreatic Islet Grafts From Adoptively Transferred Immune Rejection ... Here, we used a dual-purpose therapy/imaging small interfering (si)RNA magnetic nanoparticle (MN) probe that targets β2 ...

http://diabetes.diabetesjournals.org/content/61/12/3247

Stable expression of small interfering RNA sensitizes TEL-PDGFβR to inhibition with imatinib or rapamycin. ... Stable expression of small interfering RNA sensitizes TEL-PDGFβR to inhibition with imatinib or rapamycin. ... which is mediated by small interfering RNA (siRNA). We developed a retroviral system for stable expression of siRNA directed to ... Small molecule inhibitors, such as imatinib, are effective therapies for tyrosine kinase fusions BCR-ABL-TEL-PDGFβR-mediated ...

https://www.jci.org/articles/view/20673/citations

Therapeutic EphA2 Gene Targeting In vivo Using Neutral Liposomal Small Interfering RNA Delivery. Charles N. Landen Jr., Arturo ... Small interfering RNA constructs and in vitro delivery. siRNA was purchased from Qiagen (Valencia, CA) in three formulations. A ... Small interfering RNA (siRNA) targeting VEGF effectively inhibits ocular neovascularization in a mouse model. Mol Vis 2003; 9: ... Small interfering RNA targeting heme oxygenase-1 enhances ischemia-reperfusion-induced lung apoptosis. J Biol Chem 2004; 279: ...

https://cancerres.aacrjournals.org/content/65/15/6910?ijkey=a5453de73cf4a9a389e8c7daee010a5f2ed0c539&keytype2=tf_ipsecsha

Safety and Efficacy Study of Small Interfering RNA Molecule (Cand5) to Treat Diabetic Macular Edema. The safety and scientific ... Cand5 is a small interfering RNA molecule that selectively silences the mRNA encoding for VEGF. The target population are ... The molecule is a duplex formed by the hybridization of two partially complementary single strand RNAs in which the 3 end are ... Cand5 is a synthetic double stranded RNA (dsRNA) oligonucleotide. ...

https://clinicaltrials.gov/ct2/show/NCT00306904?intr=%22Cand5%22&rank=2

Cand5, a small interfering RNA molecule that selectively silences the mRNA encoding for VEGF. ... Safety and Efficacy Study of Small Interfering Ribonucleic Acid (RNA) Molecule (Cand5) to Treat Wet Age-Related Macular ...

https://clinicaltrials.gov/ct2/show/NCT00259753

We have previously described a small interfering RNA (siRNA) delivery system (AtuPLEX) for RNA interference (RNAi) in the ... Atu027, a Liposomal Small Interfering RNA Formulation Targeting Protein Kinase N3, Inhibits Cancer Progression. Manuela Aleku, ... Therapeutic EphA2 gene targeting in vivo using neutral liposomal small interfering RNA delivery. Cancer Res 2005; 65: 6910-8. ... Novel cationic cardiolipin analogue-based liposome for efficient DNA and small interfering RNA delivery in vitro and in vivo. ...

http://cancerres.aacrjournals.org/content/68/23/9788?ijkey=e1f1d94f19d9e6d8e880c828e46770cf9c308c82&keytype2=tf_ipsecsha

... small interfering RNAs (phasiRNAs), originally designated as trans-acting small interfering RNAs or tasiRNAs. PhasiRNA ... small interfering RNAs (phasiRNAs); and natural antisense transcript small interfering RNAs (NAT-siRNAs). These categories are ... Small interfering RNAs (siRNAs) are defined by the dependency of their biogenesis on an RNA-dependent RNA polymerase (RDR). The ... 2012). RNA polymerase V-dependent small RNAs in Arabidopsis originate from small, intergenic loci including most SINE repeats. ...

http://www.plantcell.org/content/25/7/2400.full

RNA interference has become widely used as an experimental tool to study gene function. In addition, small interfering RNA ( ... ATP requirements and small interfering RNA structure in the RNA interference pathway. Cell 2001;107:309-21. ... Sequence, chemical, and structural variation of small interfering RNAs and short hairpin RNAs and the effect on mammalian gene ... Evaluation of locked nucleic acid-modified small interfering RNA in vitro and in vivo. Olaf R. Mook, Frank Baas, Marit B. de ...

http://mct.aacrjournals.org/content/6/3/833.long

RNA, Messenger / antagonists & inhibitors, genetics. RNA, Small Interfering / pharmacology*. Rats. Rats, Wistar. Receptor, ... 0/Culture Media, Conditioned; 0/Fibronectins; 0/LDL-Receptor Related Protein 1; 0/RNA, Messenger; 0/RNA, Small Interfering; 0/ ... its expression using specific small interfering RNAs (siRNA). METHODS: Rat mesangial cells were treated with 12, 60, 120 nmol/l ...

http://www.biomedsearch.com/nih/Kallikrein-gene-knock-down-by/18090545.html

... ... Baoling Chen (2015). Characterization and evaluation of amphipathic, cationic peptides for small interfering RNA delivery. ... which can be triggered by small interfering RNA. The efficiency and specificity of this process makes siRNA a powerful tool for ... In the human non-small cell lung tumor xenograft model, the STR-HK-siRNA complexes induced the highest tumor inhibition rate ( ...

https://uwspace.uwaterloo.ca/handle/10012/9447

Dicer-substrate small interfering RNAs (DsiRNAs) are synthetic RNA duplexes that are processed by Dicer into 21-mer species and ... O-methyl RNA, phosphorothioates and small interfering RNA. Nucleic Acids Res. 2003;31:3185-3193. [PMC free article] [PubMed] ... called small interfering RNAs (siRNAs), are the actual molecular triggers of RNAi and direct target specificity of the RNA- ... and structural variation of small interfering RNAs and short hairpin RNAs and the effect on mammalian gene silencing. Antisense ...

http://pubmedcentralcanada.ca/pmcc/articles/PMC2582043/

Small interfering RNA (siRNA), sometimes known as short interfering RNA or silencing RNA, is a class of double-stranded RNA non-coding RNA molecules, typically 20-27 base pairs in length, similar to miRNA, and operating within the RNA interference (RNAi) pathway. (wikipedia.org)
citation needed] The mechanism by which natural siRNA causes gene silencing through repression of translation occurs as follows: Long dsRNA (which can come from hairpin, complementary RNAs, and RNA-dependent RNA polymerases) is cleaved by an endo-ribonuclease called Dicer. (wikipedia.org)
siRNA is also similar to miRNA, however, miRNAs are derived from shorter stemloop RNA products, typically silence genes by repression of translation, and have broader specificity of action, while siRNAs typically work by cleaving the mRNA before translation, and have 100% complementarity, thus very tight target specificity. (wikipedia.org)
The resulting transcript is a short hairpin RNA (shRNA), which can be processed into a functional siRNA by Dicer in its usual fashion. (wikipedia.org)
RNA interference (RNAi) is an evolutionarily conserved mechanism in plant and animal cells that directs the degradation of messenger RNAs homologous to short double-stranded RNAs termed small interfering RNA (siRNA). (pnas.org)
Studies over the last several years have demonstrated that RNAi is mediated by the generation of 21- to 23-nt dsRNA molecules, termed small interfering RNA (siRNA). (pnas.org)
The enzymatic machinery for generating siRNA also appears to be used for the production of a second class of endogenously encoded, small RNA molecules termed microRNAs (miRNAs). (pnas.org)
In this model, the antisense strand of siRNA hybridizes to the target mRNA and primes an RNA-dependent RNA polymerase reaction to generate double stranded RNA 5′ of sense sequence. (pnas.org)
Objectives: To demonstrate the feasibility and emphasize the importance of noninvasive aerosol delivery of Akt1 small interfering RNA (siRNA) as an effective and selective option for lung cancer treatment. (redorbit.com)
A new study shows that attaching antibody-like RNA nanoparticles to microvesicles can deliver effective RNA therapeutics such as small interfering RNA (siRNA) specifically to cancer cells. (phys.org)
Small interfering RNA ( siRNA ), sometimes known as short interfering RNA or silencing RNA , is a class of double-stranded RNA molecules, 20-25 nucleotides in length, that play a variety of roles in biology. (phys.org)
Most notably, siRNA is involved in the RNA interference (RNAi) pathway, where it interferes with the expression of a specific gene. (phys.org)
We show that the yellowing symptoms are a result of small interfering RNA (siRNA)-directed RNA silencing of the chlorophyll biosynthetic gene, CHLI. (nih.gov)
The bottom two panels are of a small RNA northern blot gel hybridized with a 21-nt Locked Nucleic Acids (LNA) probe (5′ ATGAGAAATGCAGAGCTGAAA 3′) complementary to the CHLI-targeting Y-Sat siRNA (from nt. (nih.gov)
Using a chicken model, we have examined the effects of a small interfering RNA (siRNA) targeting ERK2 delivered by a lentiviral system on tendon adhesion formation with an adhesion scoring system, histological assessment, and biomechanical evaluation. (mdpi.com)
RNA interference (RNAi) is an evolutionarily conserved process in which cells employ small interfering RNA (siRNA) duplexes to destroy target messenger mRNAs, so as to silence the activity of corresponding genes [ 9 , 10 ]. (mdpi.com)
Small interfering RNAs (siRNA) were expressed as short hairpin RNAs (shRNA) against the gag and pol PERV genes, respectively, under the control of a RNA polymerase III (pol III), or a pol II promoter. (nih.gov)
O siRNA pode ser originado a partir da célula por transcrição de DNA, pode ser processado a partir de RNA viral, ou pode ser adicionado por cientistas para fins experimentais. (jove.com)
Cada siRNA então se liga à Argonauta junto com outras proteínas que levam à formação do RNA induzido um Complexo Silenciamento Induzido-ou RISC. (jove.com)
Este RNA é reconhecido pelo Dicer e processado em siRNA. (jove.com)
No citoplasma, o siRNA é processado a partir de um RNA de cadeia dupla, que provém de transcrição endógena de DNA ou de fontes exógenas como um vírus. (jove.com)
O complexo Argonaute-siRNA liga-se então com uma helicase e outras proteínas para formar o complexo de silenciamento induzido por RNA (RISC). (jove.com)
I siRNA vengono processati da un lungo RNA a doppio filamento. (jove.com)
Questo RNA è scisso in siRNA corti multipli con l'aiuto di un'endonucleasi, Dicer. (jove.com)
Questo RNA è riconosciuto da Dicer e trasformato in siRNA. (jove.com)
Questi siRNA si legano a proteine multiple, compreso l'argonauta, per formare il complesso di silenziamento trascrizionale indotto da RNA o RITS. (jove.com)
In the cytoplasm, siRNA is processed from a double-stranded RNA, which comes from either endogenous DNA transcription or exogenous sources like a virus. (jove.com)
The Argonaute-siRNA complex then binds with a helicase and other proteins to form the RNA induced silencing complex (RISC). (jove.com)
Here, we systematically develop such a model for the complexation of small interfering RNA (siRNA) and grafted polyethyleneimine copolymers, a promising candidate for siRNA delivery. (osti.gov)
Small interfering RNA (siRNA) molecules have been successfully used to target specific genes in cell culture. (michaeljfox.org)
Both issues were addressed by utilizing a dual-purpose therapy/imaging small interfering RNA (siRNA)-nanoparticle probe targeting apoptotic-related gene caspase-3. (diabetesjournals.org)
Successful gene silencing by small interfering RNA (siRNA) requires efficient uptake of siRNA into targeted cells. (scirp.org)
Here, we used a dual-purpose therapy/imaging small interfering (si)RNA magnetic nanoparticle (MN) probe that targets β 2 microglobulin (B2M), a key component of the major histocompatibility class I complex (MHC I). In addition to serving as a siRNA carrier, this MN-siB2M probe enables monitoring of graft persistence noninvasively using magnetic resonance imaging (MRI). (diabetesjournals.org)
The unique fusion junctions of these molecules are attractive candidates for molecularly targeted therapeutic intervention using RNA interference (RNAi), which is mediated by small interfering RNA (siRNA). (jci.org)
Inducing destruction of specific mRNA using small interfering RNA (siRNA) is a powerful tool in analysis of protein function, but its use as a therapeutic modality has been limited by inefficient or impractical delivery systems. (aacrjournals.org)
Since its description in Caenorhabditis elegans ( 1 ) and mammalian cells ( 2 ), use of small interfering RNA (siRNA) as a method of gene silencing has rapidly become a powerful tool in protein function delineation, gene discovery, and drug development ( 3 ). (aacrjournals.org)
The promise of specific RNA degradation has also generated much excitement for possible use as a therapeutic modality, but in vivo siRNA delivery has proven difficult ( 4 ). (aacrjournals.org)
We have previously described a small interfering RNA (siRNA) delivery system (AtuPLEX) for RNA interference (RNAi) in the vasculature of mice. (aacrjournals.org)
In particular, chemically synthesized, small interfering RNAs (siRNA) are currently used as a new class of therapeutic molecules, allowing the controlled down-regulation of pathologically relevant gene expression as for oncogenes in cancer ( 4 ). (aacrjournals.org)
In addition, small interfering RNA (siRNA) may have great potential for the treatment of diseases. (aacrjournals.org)
Small interfering RNA (siRNA) molecules are the key intermediates in this process, which can potentially inhibit the expression of any given target gene. (aacrjournals.org)
The aim of the current investigation was to delineate the role of kallikrein in the regulation of fibrosis, by 'knocking down' its expression using specific small interfering RNAs (siRNA). (biomedsearch.com)
C6M3-siRNA complexes displayed a particle diameter of 80-100 nm, which was smaller than that of C6-siRNA complexes. (uwaterloo.ca)
Effective in vivo RNAi was achieved in a human non-small lung tumor xenograft model through intratumoral injection of the C6M3-Bcl-2 siRNA complexes (molar ratio: 60/1). (uwaterloo.ca)
Three different siRNA oligonucleotides (3A4I, 3A4II, and 3A4III) were designed and tested for their ability to interfere with CYP3A4 gene expression. (aspetjournals.org)
In the present study, we showed that natural halloysite nanotube (HNT)-assisted delivery of an active small interfering RNA (siRNA) targeting receptor-interacting protein kinase 4 ( RIPK4 ) efficiently silenced its expression to treat bladder cancer. (sciencemag.org)
Small interfering RNA (siRNA) has shown potential as a molecular approach to down-regulate specific gene expression in cancer cells ( 1 , 2 ). (sciencemag.org)
This study was to explore the effects of specific small interfering RNA (siRNA) targeting HPA-1 combined with heparin on invasiveness of mouse hepatocellular carcinoma cells. (biomedsearch.com)
Therefore, we implemented a small interfering RNA (siRNA) synthetic lethal screen targeting 5520 unique druggable genes to identify novel chemosensitivity nodes for vinblastine, a microtubule-destabilizing agent used clinically. (aspetjournals.org)
Druggable genome siRNA libraries comprising siRNAs against gene products that are theoretical targets for drug development have the potential to streamline the identification of small molecule inhibitors. (aspetjournals.org)
Although the RNA interference effect, which is mediated by small interfering RNA (siRNA) or micro-RNA, has potential application to human therapy, the hydrodynamic method usually used for rapid administration of oligonucleotides is unsuitable for use in humans. (aacrjournals.org)
Small interfering RNAs or siRNA expression plasmid vectors have been administered intravenously to mice by hydrodynamic injection, which accomplishes a rapid infusion of siRNA solution in a volume of 1 mL per 10 g of body weight (15 , 16 , 17 , 18) but is unsuitable for use in humans. (aacrjournals.org)
Here, we studied whether antagonizing the Fas receptor (FasR) pathway by small-interfering RNA (siRNA) applied after SM exposure would prevent apoptosis and, thus, airway injury. (aspetjournals.org)
Here, we showed a high cytosine DNA methylation status at ta-siRNA -generating loci in Arabidopsis ( Arabidopsis thaliana ), which is dependent on RDR6, SGS3, and DNA-DIRECTED RNA POLYMERASE V (PolV). (plantphysiol.org)
Based upon these findings, we propose a novel ta-siRNA pathway that acts at both the messenger RNA and chromatin level. (plantphysiol.org)
To inhibit HIF1alpha expression, we used small interference RNA (siRNA) expression vectors in this study. (nih.gov)
We have used a targeted small interfering RNA (siRNA) library to identify key cellular genes involved in cytoskeletal dynamics and endosome trafficking that are important for RSV infection. (asm.org)
To better investigate the role of checkpoint kinase 1 (Chk1) in cellular response to different anticancer agents, Chk1 was knocked down in HCT-116 cell line and in its p53-deficient subline by using small interfering RNAs (siRNA). (aacrjournals.org)
In Neurospora crassa , the introduction of a transgene can lead to small interfering RNA (siRNA)-mediated posttranscriptional gene silencing (PTGS) of homologous genes. (asm.org)
however, the precise role that P-bodies and their component proteins play in small interfering RNA (siRNA)-mediated RNAi remains unclear. (pubmedcentralcanada.ca)
Response of Human Retinal Endothelial Cells (HRECs) to Small Interfering RNA (SiRNA) Silencing of Notch-1, Delta-Like Ligand 4 (Dll4), and Jagged-1 During Hyperoxia with Intermittent Hypoxia (IH). (arvojournals.org)
Basal levels of antiviral RNA silencing and siRNA biogenesis were detected in mutants lacking RDR1, RDR2, and RDR6, indicating an alternate route to form double-stranded RNA that does not depend on the three previously characterized RDR proteins. (plantcell.org)
Initiation consists of the recognition of the trigger RNA and formation of primary small interfering RNAs (siRNAs), while amplification is characterized by the synthesis of double-stranded RNA (dsRNA) by one or more RNA-dependent RNA polymerases and the formation of secondary siRNA. (plantcell.org)
Dicer-like ribonucleases (DCLs), Argonaute (AGO) proteins, dsRNA binding proteins (DRBs), and RNA-dependent RNA polymerase (RDR) proteins are core components of plant RNA silencing pathways involved in siRNA biogenesis or effector pathways. (plantcell.org)
To better understand the association of the stressors with efficiency of RNAi, in the current study we tested the expression of three core genes, dicer2 (Bddcr2), r2d2 (Bdr2d2) and argonaute2 (Bdago2), of the small interfering RNA (siRNA) pathway of B. dorsalis upon various stressors. (ugent.be)
A major antiviral pathway in the mosquito vector is the exogenous small interfering RNA (exo-siRNA) pathway, which is induced by arbovirus-derived double-stranded RNA in infected cells. (pasteur.fr)
These cargoes include small interfering RNAs (siRNA) that are not naturally internalized by cells. (diva-portal.org)
In the current study, we sought to investigate the efficacy of deliver small interference RNA (siRNA) to the mouse cornea epithelium by eye drops that contain siRNA and different cationic complexing agents. (arvojournals.org)
In addition, the transfection of the infected-cell polypeptide 4-targeting small interfering RNA (ICP4-siRNA) in mouse herpes simplex keratitis (HSK) was examined using the above method. (arvojournals.org)
Despite the vast amount of sequencing data available on the GM12878 cell line through the ENCODE Project, including transcriptome, chromatin immunoprecipitation-sequencing for histone marks, and transcription factors, no small interfering siRNA-mediated knockdown studies have been performed in the GM12878 cell line, as cationic lipid-mediated transfection methods are inefficient for lymphoid cell lines. (escholarship.org)
To account for HIV-1 variability, we selected multiple RNAi triggers, including a short hairpin RNA (shRNA), generating one single small interfering RNA (siRNA) against either the CCR5 cellular gene (shCCR5) or the vif viral gene (shvif), and a long hairpin RNA, giving rise to two different siRNAs against the viral tat and rev overlapping first exons (lhtat/rev). (unipd.it)
We have conducted a small interfering RNA (siRNA) screen of 200 genes involved in DNA damage repair aimed at identifying genes whose knockdown increased tumor radiosensitivity. (ox.ac.uk)
We also examined the molecular mechanisms that promote apoptosis of LNCaP cells after infection with small interfering RNA (siRNA) targeting HMGN5 (siRNA-HMGN5). (antibody-antibodies.com)
To further the investigation on the efficacy of gene silencing, small interference RNA (siRNA) specific for the NR2B subunit was designed and administered in the striatum of 6-OHDA-lesioned rats. (hku.hk)
The perfect match of the siRNAs' antisense strand to their target RNAs mediates RNAi by siRNA-guided RNA cleavage. (rush.edu)
siRNAs fall into different classes including trans-acting siRNA (tasiRNA), repeat-associated RNA (rasiRNA), small-scan RNA (scnRNA), and Piwi protein-interacting RNA (piRNA) and have different specific gene silencing functions. (rush.edu)
[2] The most common and well-studied example is RNA interference ( RNAi ), in which endogenously expressed microRNA ( miRNA ) or exogenously derived small interfering RNA ( siRNA ) induces the degradation of complementary messenger RNA . (wikipedia.org)
The RNAi pathway is triggered in mammalian cells by the presence of dsRNA or in the presence of short 19-22nt dsRNA fragments termed small interfering RNA molecules (siRNA). (biomedcentral.com)
We recently demonstrated that a new cationic liposome formulation allowed intravenous delivery of a small interfering RNA (siRNA) targeting TNFα and efficiently restoring the immunological balance in an experiment model of RA. (biomedcentral.com)
The invention belongs to the biological technical field and particularly relates to a short and double-stranded RNA used for curing psoriasis, namely a small interfering RNA (siRNA). (rpxcorp.com)
Small interfering RNA (siRNA), sometimes known as short interfering RNA or silencing RNA, are a class of 20-25 nucleotide-long double-stranded RNA molecules that play a variety of roles in biology. (blogspot.com)
SNAI overexpression was sufficient to induce EMT, and small interfering RNA (siRNA)-mediated SNAI depletion attenuated TGFβ1-induced ATII cell migration and EMT. (bmj.com)
Microphthalmia-associated transcription factor (MITF)-Tfe transcription factors were blocked using either a pan MITF-Tfe dominant negative or specific small interfering RNA (siRNA). (molvis.org)
Natural antisense short interfering RNA (natsiRNA) is a type of siRNA. (wikipedia.org)
They are endogenous RNA regulators which are between 21 and 24 nucleotides in length, and are generated from complementary mRNA transcripts which are further processed into siRNA. (wikipedia.org)

RNA interference (RNAi) is an evolutionarily conserved mechanism of gene silencing that is thought to inhibit the replication and expression of selfish DNA elements and viruses (reviewed in refs. (pnas.org)
Approval of first RNA interference drug - why the excitement? (phys.org)
Transformation of tobacco with a RNA interference (RNAi) vector targeting CHLI induced Y-Sat-like symptoms. (nih.gov)
We report the first RNAi-induced phenotypes in mammalian cultured cells using RNA interference mediated by duplexes of 21-nt RNAs. (nih.gov)
The recently developed RNA interference (RNAi) technology to knockdown/silence post-transcriptional gene expression, offers a promising alternative to achieving this goal. (nih.gov)
Dheemanth TL, Ramachandra RK, Chavan M, Prakash BG (2017) RNA interference in crop improvement. (springer.com)
RNA interference (RNAi) is an evolutionarily conserved gene silencing mechanism in eukaryotes, with regulatory roles in a variety of biological processes, including cell cycle, cell differentiation, physiological and metabolic pathways, and stress responses. (unl.edu)
RNA interference (RNAi) is an ancient antiviral response that processes dsRNA and associates it into a nuclease complex that identifies RNA with sequence homology and specifically cleaves it. (jimmunol.org)
Downregulation of factors that mediate immune rejection using RNA interference holds promise for improving islet graft resistance to damaging factors after transplantation. (diabetesjournals.org)
Reduction or downregulation of MHC class I protein expression using RNA interference (RNAi) ( 19 ) has shown some success in overcoming the limitations of immune rejection in cell-based therapies. (diabetesjournals.org)
RNA interference (RNAi) can be used as novel therapeutic modality through specific silencing of therapeutically relevant genes in vivo ( 1 - 3 ). (aacrjournals.org)
RNA interference has become widely used as an experimental tool to study gene function. (aacrjournals.org)
RNA interference (RNAi) is a natural process that affects gene silencing in eukaryotic systems at transcriptional, posttranscriptional, and/or translational levels ( 1 ). (aacrjournals.org)
RNA interference (RNAi) is a highly efficient and specific posttranscriptional gene silencing process, which can be triggered by small interfering RNA. (uwaterloo.ca)
Dicer-substrate small interfering RNAs (DsiRNAs) are synthetic RNA duplexes that are processed by Dicer into 21-mer species and show improved potency as triggers of RNA interference, particularly when used at low dose. (pubmedcentralcanada.ca)
RNA interference (RNAi) is a specific and powerful tool used to manipulate gene expression and study gene function. (aspetjournals.org)
RNA interference (RNAi) technology can specifically silence the expression of a target gene and has emerged as a promising therapeutic method to treat cancer. (sciencemag.org)
The RNA interference effect is an alternative to antisense DNA as an experimental method of down-regulating a specific target protein. (aacrjournals.org)
More recently, efforts have focused on the RNA interference effect as a tool to knock down the expression of a target protein. (aacrjournals.org)
Adenoviral-mediated RNA interference against MMP-2 has significant therapeutic potential for lung cancer and exerts some of this effect by inhibiting angiogenesis. (aacrjournals.org)
Small RNAs ( sRNAs ) are key players in eukaryotic RNA interference phenomena ( Baulcombe, 2004 ). (plantphysiol.org)
Given its stable and sustained efficacy, lasting weeks, RNA interference may offer a unique approach to improving therapy adherence and treating hypertension. (investorvillage.com)
Inactivation at the posttranscriptional level has been detected in plants, where it is called cosuppression ( 30 ), fungi, where it is called quelling ( 37 ), and animals, where it is called RNA interference (RNAi) and is triggered by the introduction of double-stranded RNA ( 16 ). (asm.org)
RNA interference (RNAi) is a powerful homology-based gene silencing mechanism directed by small RNAs, including small interfering RNAs (siRNAs) and microRNAs (miRNAs). (pubmedcentralcanada.ca)
RNA interference (RNAi)-based technology has emerged as a potential tool for controlling insect pests, however, previous studies found that the efficiency of RNAi in Bactrocera dorsalis was variable. (ugent.be)
They add functional insights to previous observations of this protein's antiviral and RNA interference regulatory activities in Drosophila melanogasterIMPORTANCE Female Aedes aegypti mosquitoes are vectors of human-infecting arthropod-borne viruses (arboviruses). (pasteur.fr)
BACKGROUND/AIMS RNA interference has considerable therapeutic potential, particularly for anti-viral therapy. (semanticscholar.org)
HuUO-44 RNA interference (RNAi) resulted in the inhibition of cell growth and proliferation. (nus.edu.sg)
To this end, several anti-HIV-1 genes have been developed and tested both in preclinical and clinical settings and, among these, RNA interference (RNAi)-based approaches represent one of the most powerful tools. (unipd.it)
Introduction of small interfering RNAs (siRNAs) into a cell can cause a specific interference of gene expression known as RNA interference (RNAi). (ucsf.edu)
Small double-stranded, non-protein coding RNAs (21-31 nucleotides) involved in GENE SILENCING functions, especially RNA INTERFERENCE (RNAi). (rush.edu)
RNA silencing or RNA interference refers to a family of gene silencing effects by which gene expression is negatively regulated by non-coding RNAs such as microRNAs . (wikipedia.org)
Despite early focus in the literature on RNA interference ( RNAi ) as a core mechanism which occurs at the level of messenger RNA translation, others have since been identified in the broader family of conserved RNA silencing pathways acting at the DNA and chromatin level. (wikipedia.org)
RNA interference is an endogenous cellular mechanism in which short interfering RNAs (siRNAs) elicit the sequence-specific degradation of a complementary mRNA target. (biomedcentral.com)
Recent observations have provided evidence for another promising anti-gene technology-RNA interference (RNAi), in which the introduced double-stranded RNA (dsRNA), after a complicated series of processing steps, disrupts the expression of the targeted cellular gene. (current-gene-therapy.com)
RNA interference is an evolutionary conserved immune response mechanism that can be used as a tool to provide novel insights into gene function and structure. (biomedcentral.com)
RNA interference (RNAi) is an evolutionary conserved sequence-specific RNA silencing mechanism found as an anti-viral response in invertebrates, plants and mammalian cells [ 1 ]. (biomedcentral.com)
Strong association of other proinflammatory cytokines with the pathogenesis of RA prompted us to investigate which cytokine other than TNFα could be targeted for therapeutic benefit using RNA interference. (biomedcentral.com)

Naturally occurring siRNAs have a well-defined structure that is a short (usually 20 to 24-bp) double-stranded RNA (dsRNA) with phosphorylated 5' ends and hydroxylated 3' ends with two overhanging nucleotides. (wikipedia.org)
The Dicer enzyme catalyzes production of siRNAs from long dsRNAs and small hairpin RNAs. (wikipedia.org)
Small RNA sequencing and 5' RACE analyses confirmed that this 22-nt sequence was targeted for mRNA cleavage by Y-Sat-derived siRNAs. (nih.gov)
siRNAs for efficient knockdown of long, noncoding RNA (lncRNA) genes with modifications to ensure specificity. (horizondiscovery.com)
RNAs ou siRNAs interferentes pequenos são RNAs não-codificados com aproximadamente 22 nucleotídeos de comprimento que regulam a síntese e a estabilidade do mRNA. (jove.com)
Estes siRNAs ligam-se a múltiplas proteínas, incluindo a Argonauta, para formar o complexo RNA induzido com silenciamento transcricional ou complexo RITS. (jove.com)
Os RNAs de interferência pequenos, ou siRNAs, são moléculas reguladoras curtas de RNA que podem silenciar genes pós-transcricionalmente, assim como ao nível da transcrição em alguns casos. (jove.com)
Piccoli RNAs interferenti o siRNAs, sono RNAs non codificanti, lunghi circa 22 nucleotidi che regolano la sintesi e la stabilità di mRNA. (jove.com)
Small interfering RNAs, or siRNAs, are short regulatory RNA molecules that can silence genes post-transcriptionally, as well as the transcriptional level in some cases. (jove.com)
Gene expression can be specifically modulated by molecules named small interfering RNAs (siRNAs). (michaeljfox.org)
Recently, we have designed non-viral vectors that can deliver functional small interfering siRNAs specifically into cultured neuronal cells. (michaeljfox.org)
and natural antisense transcript small interfering RNAs (NAT-siRNAs). (plantcell.org)
Small interfering RNAs (siRNAs) are defined by the dependency of their biogenesis on an RNA-dependent RNA polymerase (RDR). (plantcell.org)
2001 ). These species, called small interfering RNAs (siRNAs), are the actual molecular triggers of RNAi and direct target specificity of the RNA-induced silencing complex (RISC) (Elbashir et al. (pubmedcentralcanada.ca)
2001 ). Synthetic 21-mer RNA duplexes can be introduced into cells and will function as mimics of the natural siRNAs that result from Dicer processing. (pubmedcentralcanada.ca)
To realize the full potential of siRNAs in vivo , it may be necessary to chemically modify the RNA duplexes to improve nuclease stability, alter pharmacokinetics, and prevent recognition by the innate immune system. (pubmedcentralcanada.ca)
Even though dsRNAs are more stable than single-stranded RNAs (ssRNAs), siRNAs are still rapidly degraded in serum and can benefit from chemical modification. (pubmedcentralcanada.ca)
Although extensive studies have been published relating to chemical modification of 21-mer siRNAs, similar studies exploring the modification patterns compatible with function of Dicer-substrate RNAs have not been reported. (pubmedcentralcanada.ca)
In the present study, we investigated whether vector-expressed small interfering RNAs (siRNAs) altered the CYP3A4 expression and function using the Chinese hamster cell line (V79) overexpressing CYP3A4 (CHL-3A4). (aspetjournals.org)
Small interfering RNAs (siRNAs), which are small double-stranded RNA (dsRNA) oligonucleotides with or without overhangs, are substrates for the RNA-induced silencing complex. (aacrjournals.org)
It has been revealed that ta-siRNAs are generated by the sequential activities of SUPPRESSOR OF GENE SILENCING3 (SGS3), RNA-DEPENDENT RNA POLYMERASE6 (RDR6), and DICER-LIKE4 (DCL4), and loaded into ARGONAUTE1 (AGO1) proteins to posttranscriptionally regulate several target genes by messenger RNA cleavage in trans. (plantphysiol.org)
Small interfering RNAs (siRNAs) targeting hepatic angiotensinogen ( Agt) may provide long-lasting antihypertensive effects, but the optimal approach remains unclear. (investorvillage.com)
We conclude that in Neurospora , siRNAs produced from the transgenic locus are used in the RNA-induced silencing complex-mediated PTGS pathway and do not communicate with an RNAi-induced initiation of transcriptional gene silencing complex to effect chromatin-based silencing. (asm.org)
Systematic analysis of susceptibility and small RNA formation in Arabidopsis mutants lacking combinations of RNA-dependent RNA polymerase (RDR) and DCL proteins revealed that the vast majority of virus-derived small interfering RNAs (siRNAs) were dependent on DCL4 and RDR1, although full antiviral defense also required DCL2 and RDR6. (plantcell.org)
Mouse ES cells express endogenous shRNAs, siRNAs, and other Microprocessor-independent, Dicer-dependent small RNAs. (semanticscholar.org)
To elucidate the function of HuUO-44 in cisplatin chemoresistance in ovarian cancer cell, small interfering RNAs (siRNAs) were employed to mediate HuUO-44 silencing in ovarian cancer cell line, NIH-OVCAR3. (nus.edu.sg)
Endogenously, siRNAs are generated from dsRNAs (RNA, DOUBLE-STRANDED) by the same ribonuclease, Dicer, that generates miRNAs (MICRORNAS). (rush.edu)
We investigated the effects of the downregulation of CD86 by short interfering RNAs (siRNAs) on Th2 cytokine production in the effector phase in vitro and on asthma phenotypes in ovalbumin (OVA)-sensitized and -challenged mice. (biomedcentral.com)
Finally, we detected small interfering RNAs (siRNAs) in plants carrying C2-Idf , but not in plants homozygous for the wild-type C2 allele. (genetics.org)
Further studies have indicated that small interfering RNAs (siRNAs) of generally 21 ∼ 23 nucleotides, which resemble the processing products of long dsRNA, can induce RNAi directly in mammalian cells. (current-gene-therapy.com)

In Caenorhabditis elegans , RNAi was first observed as a silencing of endogenous genes homologous to injected double-stranded RNA (dsRNA) ( 3 ). (pnas.org)
Cells harboring proviral HIV, such as reservoirs or acutely infected cells that have progressed past proviral integration, can also be targeted by RNAi-mediated inhibition of viral replication by targeting viral RNA transcripts produced from the provirus. (jimmunol.org)
Different RNA structures can also be used to suppress gene expression via RNAi. (pubmedcentralcanada.ca)
For example, short hairpin RNAs that have a 19-21 base duplex domain and a 4-9 base loop can be effective triggers of RNAi. (pubmedcentralcanada.ca)
In mammals, a single Dicer participates in biogenesis of small RNAs in microRNA (miRNA) and RNAi pathways. (semanticscholar.org)
[26] RNA silencing refers to the silencing activity of a range of small RNAs and is generally regarded as a broader category than RNAi. (wikipedia.org)
While the terms have sometimes been used interchangeably in the literature, RNAi is generally regarded as a branch of RNA silencing. (wikipedia.org)
Although the mechanism of silencing is not completely understood, the basic premise of RNAi rests on the ability of double stranded RNA (dsRNA) to specifically degrade homologous messenger RNA (mRNA). (biomedcentral.com)

It interferes with the expression of specific genes with complementary nucleotide sequences by degrading mRNA after transcription, preventing translation. (wikipedia.org)
miRNA are processed from endogenous transcripts that form hairpin structures, and miRNAs are thought to mediate the translational control of other genes by binding to the 3′ ends of their messenger RNAs in animals ( 1 , 2 ). (pnas.org)
Our previous study has proven that the poly(ester amine) carrier is less than 150 nm and offers effective delivery potential due to a biodegradable complex formation with genes with little toxicity and enhanced gene transfer efficiency (10). (redorbit.com)
Viral small interfering RNAs target host genes to mediate disease symptoms in plants. (nih.gov)
Identification of essential genes in cultured mammalian cells using small interfering RNAs. (nih.gov)
Genes were classified as essential or nonessential depending on impaired cell growth after RNA silencing. (nih.gov)
Suppression of nucleotide-binding, leucine-rich repeat ( NB -LRR ) disease resistance genes by small RNAs is particularly unusual because of a high level of redundancy. (plantcell.org)
A modification pattern involving alternating 2′- O -methyl RNA bases was developed that generally retains high potency when tested in different sites in different genes, evades activation of the innate immune system, and improves stability in serum. (pubmedcentralcanada.ca)
Influence of various stressors on the expression of core genes of the small interfering RNA pathway in the oriental fruit fly, Bactrocera dorsalis," INSECT SCIENCE , vol. 24, no. 3, pp. 418-430, 2017. (ugent.be)
A small interfering RNA screen of genes involved in DNA repair identifies tumor-specific radiosensitization by POLQ knockdown. (ox.ac.uk)
RNA has been largely investigated within its role as an intermediary in the translation of genes into proteins. (wikipedia.org)
Collectively, these results showed that upon high temperature treatment, the ASGV-infected meristem shoot tips up-regulated the expression of key genes in the RNA silencing pathway, induced the biogenesis of vsiRNAs and inhibited viral RNA accumulation. (biomedcentral.com)

Cand5 is a synthetic double stranded RNA (dsRNA) oligonucleotide. (clinicaltrials.gov)
RNA silencing may also be defined as sequence-specific regulation of gene expression triggered by double-stranded RNA ( dsRNA ). (wikipedia.org)
For example, these studies demonstrated that enzymes detect double-stranded RNA ( dsRNA ) not normally found in cells and digest it into small pieces that are not able to cause disease. (wikipedia.org)

No RISC, a fita guia RNA é separada da sua vertente complementar e permanece no complexo para que possa então emparelhar com o mRNA alvo. (jove.com)
We demonstrated that small RNAs (sRNAs) generated from exogenously introduced inverted repeat transgenes, with perfect complementarity to the 3'UTR of a target transcript, can inhibit protein synthesis, without or with only minimal mRNA destabilization. (unl.edu)
Cand5 is a small interfering RNA molecule that selectively silences the mRNA encoding for VEGF. (clinicaltrials.gov)
miRNAs are typically processed from a hairpin-like secondary structure of a noncoding mRNA (ncRNA), with a precursor mRNA generated by RNA polymerase II (Pol II). (plantcell.org)
Plant microRNAs ( miRNAs ) are transcribed by RNA polymerase II and processed by DICER-LIKE1 (DCL1) protein in the nucleus from stem-loop structures, then associated with AGO1 according to their 5′-terminal uridine nucleotide to efficiently form RISCs in cytoplasm and perform target mRNA cleavage or translation repression ( Voinnet, 2009 ). (plantphysiol.org)
RNA silencing functions by repressing translation or by cleaving messenger RNA ( mRNA ), depending on the amount of complementarity of base-pairing. (wikipedia.org)
We found that c2 transcription occurs in nuclei of C2-Idf/C2 heterozygotes, but mRNA does not accumulate, suggesting that the inhibition is mediated by RNA silencing. (genetics.org)
Infection of C2-Idf/C2 heterozygotes with viruses that carry suppressors of RNA silencing relieved the phenotypic inhibition, restoring pigment production and mRNA levels. (genetics.org)
Messenger RNA ( mRNA ) is a large family of RNA molecules that convey genetic information from DNA to the ribosome , where they specify the amino acid sequence of the protein products of gene expression . (wikipedia.org)
RNA polymerase transcribes primary transcript mRNA (known as pre-mRNA ) into processed, mature mRNA. (wikipedia.org)
During transcription, RNA polymerase makes a copy of a gene from the DNA to mRNA as needed. (wikipedia.org)
One notable difference, however, is that eukaryotic RNA polymerase associates with mRNA-processing enzymes during transcription so that processing can proceed quickly after the start of transcription. (wikipedia.org)
Shortly after the start of transcription, the 5' end of the mRNA being synthesized is bound by a cap-synthesizing complex associated with RNA polymerase . (wikipedia.org)
In eukaryotic organisms most messenger RNA (mRNA) molecules are polyadenylated at the 3' end, but recent studies have shown that short stretches of uridine (oligouridylation) are also common. (wikipedia.org)

Typical transcription cassettes use an RNA polymerase III promoter (e.g. (wikipedia.org)
Considering that the use of multiple highly active RNA polymerase III promoters can potentially saturate the endogenous microRNA biogenesis pathway, we also explored an alternative combinatorial strategy, based on the use of an extended shRNA (e-shRNA). (unipd.it)

Kallikrein gene 'knock-down' by small interfering RNA transfection induces a profibrotic phenotype in rat mesangial cells. (biomedsearch.com)

The inhibition occurred at two points in the viral life cycle, after fusion and before reverse transcription and during transcription of viral RNA from integrated provirus. (jimmunol.org)
Knockdown of ki-67 by dicer-substrate small interfering RNA sensitizes bladder cancer cells to curcumin-induced tumor inhibition. (jefferson.edu)
Inhibition of BTK in primary human CLL cells by small interfering RNA promotes apoptosis. (bloodjournal.org)

this is what enables the molecules to form the RNA-Induced Silencing Complex (RISC). (wikipedia.org)

The Aedes aegypti Domino Ortholog p400 Regulates Antiviral Exogenous Small Interfering RNA Pathway Activity and ago-2 Expression. (pasteur.fr)
GENTAUR antibody-antibodies.com The Marketplace for Antibodies : Small interfering RNA targeting HMGN5 induces apoptosis via modulation of a mitochondrial pathway and Bcl-2 family proteins in prostate cancer cells. (antibody-antibodies.com)
Small interfering RNA targeting HMGN5 induces apoptosis via modulation of a mitochondrial pathway and Bcl-2 family proteins in prostate cancer cells. (antibody-antibodies.com)

In RISC, il filamento di guida di RNA è separato dal suo filamento complementare e rimane nel complesso in modo da potersi quindi accoppiare con l'mRNA bersaglio. (jove.com)
Synthetic Dicer-substrate RNAs can have increased potency when compared with 21-mer duplexes, possibly owing to effects relating to linkage of Dicer processing and RISC loading (Kim et al. (pubmedcentralcanada.ca)

Jiang L, Ding L, He B, Shen J, Xu Z, Yin M, Zhang X (2014) Systemic gene silencing in plants triggered by fluorescent nanoparticle-delivered double-stranded RNA. (springer.com)
This double-stranded RNA is then cleaved by the ATP-dependent riboendonuclease, Dicer, into 21-23 nucleotide long fragments with two nucleotide overhangs at both ends. (jove.com)
Double-stranded RNA-activated protein kinase-like ER kinase (PERK), inositol requiring kinase 1 (IRE1), and activating transcription factor (ATF)-6 are three critical ER membrane-associated ER stress sensors that regulate the unfolded protein response 6 . (nature.com)
[1] demonstrating that double-stranded RNA could act as a trigger for gene silencing. (wikipedia.org)

In vivo studies included serial MRI of NOD-SCID mice transplanted with MN-small interfering (si)Caspase-3-labeled human islets under the left kidney capsule and MN-treated islets under the right kidney capsule. (diabetesjournals.org)
The ability to efficiently deliver small interfering RNA to modulate gene expression in vivo may provide new therapeutic approaches to currently intractable diseases. (biomedcentral.com)

The Cucumber mosaic virus (CMV) Y-satellite RNA (Y-Sat) has a small non-protein-coding RNA genome that induces yellowing symptoms in infected Nicotiana tabacum (tobacco). (nih.gov)
Transfer RNA (tRNA), that mediates recognition of the codon and provides the corresponding amino acid, and ribosomal RNA (rRNA), that is the central component of the ribosome's protein-manufacturing machinery. (wikipedia.org)

Este RNA é clivado em vários RNAs curtos com a ajuda de uma endonuclease, Dicer. (jove.com)
Este RNA de cadeia dupla é então clivado pela riboendonuclease dependente de ATP, Dicer, em fragmentos de 21-23 nucleótidos de comprimento com duas saliências de nucleótidos em ambas as extremidades. (jove.com)
Common features of all small RNAs are that members of the DICER-LIKE (DCL) family are employed to cut longer RNAs into specific smaller lengths, and the resulting small RNAs are thereafter incorporated into ARGONAUTE (AGO) family proteins to target complementary nucleotide sequences, functioning in a suppressive manner. (plantcell.org)
Another approach is to use longer synthetic linear RNA duplexes that are substrates for Dicer. (pubmedcentralcanada.ca)
We previously described optimization of unmodified RNA substrates for human Dicer (Rose et al. (pubmedcentralcanada.ca)
Knockdown of ki-67 by dicer-substrate small interfering RNA sensitizes" by Sivakamasundari Pichu, Swapna Krishnamoorthy et al. (jefferson.edu)

A tiny therapeutic delivery system that can control the body's ability to manufacture proteins has been developed by Saudi Arabia's King Abdullah University of Science and Technology (KAUST) researchers. (phys.org)
A primary transcript of the HIV provirus serves as the genomic RNA for future generations of HIV and is processed to ensure efficient translation of viral proteins. (jimmunol.org)
Viruses encode RNA silencing suppressor proteins that interfere with this response. (plantcell.org)
To counter this defense mechanism, viruses encode suppressor proteins that interfere with RNA silencing. (plantcell.org)

Addgene: New Generation of Artificial MicroRNA and Synthetic Trans-Acting Small Interfering RNA Vectors for Efficient Gene Silencing in Arabidopsis. (addgene.org)

How this RNA pathogen induces such symptoms has been a longstanding question. (nih.gov)

Taken together, these findings provide the first demonstration of small RNA-mediated viral disease symptom production and offer an explanation of the species specificity of the viral disease. (nih.gov)
In plants and some animal lineages, such as insects, RNA silencing is a potent defense mechanism against viruses and has remarkable specificity and adaptability ( Ding and Voinnet, 2007 ). (plantcell.org)

Small molecule inhibitors, such as imatinib, are effective therapies for tyrosine kinase fusions BCR-ABL-TEL-PDGFβR-mediated human leukemias, but resistance may develop. (jci.org)
The molecule is a duplex formed by the hybridization of two partially complementary single strand RNAs in which the 3' end are capped with 2 deoxyribose (dT) units. (clinicaltrials.gov)
Polyadenylation is the covalent linkage of a polyadenylyl moiety to a messenger RNA molecule. (wikipedia.org)
identified a promising solution for this problem by combining oncolytic vesicular stomatitis virus with dimethyl fumarate, a small-molecule drug that is already in use for some nonmalignant disorders and may also have direct anticancer effects. (sciencemag.org)

The delivery of short hairpin RNA to HeLa cells resulted in a selective and permanent silencing of MHC class I by up to 90%, even under inflammatory conditions ( 20 ). (diabetesjournals.org)

PERV knockdown was achieved whether the shRNA was expressed under the control of a RNA pol III, or a pol II promoter. (nih.gov)

TAS) emerge as a class of plant-specific small RNAs that are initiated from microRNA-mediated cleavage of TAS gene transcripts. (plantphysiol.org)

This protective effect was reversed by the glucocorticoid receptor (GR) antagonist (11, 17)-11-[4-(dimethylamino)phenyl]-17-hydroxy-17-(1-propynyl)estra-4,9-dien-3-one (RU486) and small interfering RNA directed against GR, suggesting a receptor-dependent mechanism. (jneurosci.org)
RNA silencing as an antiviral defense mechanism has been implicated in this process. (biomedcentral.com)

Plant genomes are the source of large numbers of small RNAs, generated via a variety of genetically separable pathways. (plantcell.org)
Several of these pathways converge in the production of phased, secondary, small interfering RNAs (phasiRNAs), originally designated as trans -acting small interfering RNAs or tasiRNAs. (plantcell.org)
RNA silencing describes several mechanistically related pathways which are involved in controlling and regulating gene expression. (wikipedia.org)
[8] It has also been observed that the major RNA silencing pathways currently identified have mechanisms of action which may involve both post-transcriptional gene silencing (PTGS) [22] as well as chromatin-dependent gene silencing (CDGS) pathways. (wikipedia.org)

Targeting Mcl-1 in these melanoma cell lines with specific small interfering RNA was sufficient to sensitize them to both anti-Fas mAb-induced apoptosis and activation of caspase-9. (aacrjournals.org)

Finally, we demonstrate that knockdown of lamin A/C expression using small interfering RNA also rescues the PKmut phenotype in 293 cells. (asm.org)
Subsequent investigations showed that POLQ knockdown resulted in radiosensitization of a panel of tumor cell lines from different primary sites while having little or no effect on normal tissue cell lines. (ox.ac.uk)

During the viral life cycle, viral RNA is present in the cytoplasm of cells after fusion and before reverse transcription, which presents a target that when acted on can inhibit infection before proviral integration. (jimmunol.org)
Viral particles are present in two forms, a long filamentous variant of up to 1 μm in length and a smaller, spherical particle of 100 nm in diameter. (asm.org)
To understand if high temperature-mediated acceleration of the host antiviral gene silencing system in the meristem tip facilitates virus-derived small interfering RNAs (vsiRNA) accumulation to reduce the viral RNA titer in the fruit tree meristem tip cells, we used the Apple stem grooving virus (ASGV)- Pyrus pyrifolia pathosystem to explore the possible roles of vsiRNA in thermotherapy. (biomedcentral.com)

Furthermore, the phenotype of the PKmut in 293 cells is substantially reversed by expression of the simian virus 40 (SV40) large (T) and small (t) T antigens. (asm.org)
We show that 293T cells have a much higher level of constitutive lamin A/C phosphorylation than do 293 cells over residues (S22 and S392) that promote phosphorylation-dependent nuclear disassembly and that both large T and small t contribute to enhanced lamin A/C phosphorylation. (asm.org)
Knocking down of UBE2T expression with small interfering RNA drastically suppressed the growth of breast cancer cells. (aacrjournals.org)
Small interfering RNA targeting βarr2 inhibited angiotensin-stimulated expression of proaneurysmal signaling mediators in primary aortic root smooth muscle cells. (physiology.org)

RSV is a paramyxovirus with a 15-kb, negative sense, single-stranded RNA genome. (asm.org)
BACKGROUND: Small RNAs are sequence-dependent negative regulators of gene expression involved in many relevant plant processes such as development, genome stability, or stress response. (usda.gov)
To the extent it is useful to craft a distinction between these related concepts, RNA silencing may be thought of as referring to the broader scheme of small RNA related controls involved in gene expression and the protection of the genome against mobile repetitive DNA sequences, retroelements, and transposons to the extent that these can induce mutations. (wikipedia.org)

Plants respond to virus infections by activation of RNA-based silencing, which limits infection at both the single-cell and system levels. (plantcell.org)

A range of diverse functions have been proposed for a growing number of characterized small RNA sequences-e.g., regulation of developmental, neuronal cell fate, cell death, proliferation, fat storage, haematopoietic cell fate, insulin secretion. (wikipedia.org)

An adenoviral vector expressing small interfering RNA against the MMP-2 gene (Ad-MMP-2) was constructed to specifically inhibit MMP-2 expression. (aacrjournals.org)
[16] However, the varied and nuanced role of RNA silencing in the regulation of gene expression remains an ongoing scientific inquiry. (wikipedia.org)
While RNA silencing is an evolving class of mechanisms, a common theme is the fundamental relationship between small RNAs and gene expression. (wikipedia.org)
Although much is known about VEGF regulation in pathologies, little is known about the control of VEGF expression under normal conditions. (molvis.org)

In grasses, two types of phased, small interfering RNAs (phasiRNAs) are expressed largely in young, developing anthers. (arizona.edu)

The CRISPR/Cas system uses guide RNAs (gRNAs) to direct sequence-specific DNA cleavage. (nature.com)

Knock down of HACS1 in a human B lymphoma cell line by small interfering ribonucleic acid did not significantly change IL-4-stimulated B cell proliferation. (rupress.org)

[4] CDGS involves the assembly of small RNA complexes on nascent transcripts and is regarded as encompassing mechanisms of action which implicate transcriptional gene silencing (TGS) and co-transcriptional gene silencing (CTGS) events. (wikipedia.org)

These results reveal that both genomic context and internal gRNA interactions can interfere with Cas9-mediated cleavage and illuminate previously uncharacterized features of Cas9-gRNA complex formation. (nature.com)
Telomerase is a ribonucleoprotein complex consisting minimally of RNA template and catalytic reverse transcriptase subunits responsible for de novo synthesis of telomeric repeats ( 10 ). (pnas.org)

[14] RNA silencing has been shown to play a role in antiviral protection in plants as well as insects. (wikipedia.org)

Liver target delivery of small interfering RNA to the HCV gene by lactosylated cationic liposome. (semanticscholar.org)
Delivery of small interfering RNA by peptide-targeted mesoporous silica nanoparticle-supported lipid bilayers. (unm.edu)

In the model plant Arabidopsis , among the four relatively well-studied DCLs, DCL4 and DCL2 function in RNA silencing against RNA viruses by producing 21- and 22-nt vsiRNAs, respectively. (biomedcentral.com)

Other classes of small RNA have been identified, including piwi-interacting RNA ( piRNA ) and its subspecies repeat associated small interfering RNA ( rasiRNA ). (wikipedia.org)

Anatomy16

Organisms27

Diseases1

Chemicals and Drugs120

Analytical, Diagnostic and Therapeutic Techniques and Equipment23

Phenomena and Processes76

Information Science4

Health Care1

Absence of RNASE III alters the pathway by which RNAI, the antisense inhibitor of ColE1 replication, decays. (1/22353)

The CafA protein required for the 5'-maturation of 16 S rRNA is a 5'-end-dependent ribonuclease that has context-dependent broad sequence specificity. (2/22353)

RNAi: double-stranded RNA directs the ATP-dependent cleavage of mRNA at 21 to 23 nucleotide intervals. (3/22353)

Caenorhabditis elegans beta-G spectrin is dispensable for establishment of epithelial polarity, but essential for muscular and neuronal function. (4/22353)

Flagellum ontogeny in trypanosomes studied via an inherited and regulated RNA interference system. (5/22353)

Mitotic phosphorylation of histone H3 is governed by Ipl1/aurora kinase and Glc7/PP1 phosphatase in budding yeast and nematodes. (6/22353)

Double-stranded RNA injection produces nonspecific defects in zebrafish. (7/22353)

Drosophila mitochondrial transcription factor A (d-TFAM) is dispensable for the transcription of mitochondrial DNA in Kc167 cells. (8/22353)

RNA

RNA, Small Interfering

RNA, Viral

RNA Editing

RNA Splicing

RNA, Ribosomal

RNA, Bacterial

DNA-Directed RNA Polymerases

RNA Viruses

RNA Interference

RNA, Messenger

RNA, Double-Stranded

RNA, Catalytic

RNA Folding

RNA Polymerase II

RNA, Fungal

RNA Stability

RNA Helicases

RNA, Antisense

RNA Processing, Post-Transcriptional

RNA, Transfer

RNA, Small Nuclear

RNA Precursors

RNA, Untranslated

Nucleic Acid Conformation

RNA Caps

Sequence Analysis, RNA

RNA, Plant

RNA, Protozoan

Base Sequence

RNA, Neoplasm

RNA Ligase (ATP)

DEAD-box RNA Helicases

RNA Polymerase III

Molecular Sequence Data

RNA Polymerase I

RNA, Nuclear

RNA, Guide

RNA, Ribosomal, 28S

RNA, Ribosomal, 18S

RNA-Binding Proteins

RNA, Ribosomal, 23S

RNA Transport

RNA, Spliced Leader

RNA, Satellite

RNA, Ribosomal, 16S

Amino Acid Sequence

RNA, Archaeal

Nucleic Acid Hybridization

Protein Biosynthesis

Cell Line

Virus Replication

Escherichia coli

RNA Cleavage

Mutation

Oligoribonucleotides

RNA, Heterogeneous Nuclear

Transcription, Genetic

RNA, Small Cytoplasmic

RNA 3' End Processing

Templates, Genetic

RNA, Small Untranslated

HeLa Cells

Ribonucleoproteins

Ribonucleases

Poly A

Genome, Viral

RNA, Ribosomal, 5.8S

DNA

RNA, Long Noncoding

RNA, Small Nucleolar

Binding Sites

RNA Virus Infections

Protein Binding

RNA, Complementary

Uridine

Promoter Regions, Genetic

Endoribonucleases

Cell Nucleus

RNA, Chloroplast