A polynucleotide consisting essentially of chains with a repeating backbone of phosphate and ribose units to which nitrogenous bases are attached. RNA is unique among biological macromolecules in that it can encode genetic information, serve as an abundant structural component of cells, and also possesses catalytic activity. (Rieger et al., Glossary of Genetics: Classical and Molecular, 5th ed)
Small double-stranded, non-protein coding RNAs (21-31 nucleotides) involved in GENE SILENCING functions, especially RNA INTERFERENCE (RNAi). Endogenously, siRNAs are generated from dsRNAs (RNA, DOUBLE-STRANDED) by the same ribonuclease, Dicer, that generates miRNAs (MICRORNAS). The perfect match of the siRNAs' antisense strand to their target RNAs mediates RNAi by siRNA-guided RNA cleavage. siRNAs fall into different classes including trans-acting siRNA (tasiRNA), repeat-associated RNA (rasiRNA), small-scan RNA (scnRNA), and Piwi protein-interacting RNA (piRNA) and have different specific gene silencing functions.
Ribonucleic acid that makes up the genetic material of viruses.
A process that changes the nucleotide sequence of mRNA from that of the DNA template encoding it. Some major classes of RNA editing are as follows: 1, the conversion of cytosine to uracil in mRNA; 2, the addition of variable number of guanines at pre-determined sites; and 3, the addition and deletion of uracils, templated by guide-RNAs (RNA, GUIDE).
The ultimate exclusion of nonsense sequences or intervening sequences (introns) before the final RNA transcript is sent to the cytoplasm.
The most abundant form of RNA. Together with proteins, it forms the ribosomes, playing a structural role and also a role in ribosomal binding of mRNA and tRNAs. Individual chains are conventionally designated by their sedimentation coefficients. In eukaryotes, four large chains exist, synthesized in the nucleolus and constituting about 50% of the ribosome. (Dorland, 28th ed)
Ribonucleic acid in bacteria having regulatory and catalytic roles as well as involvement in protein synthesis.
Enzymes that catalyze DNA template-directed extension of the 3'-end of an RNA strand one nucleotide at a time. They can initiate a chain de novo. In eukaryotes, three forms of the enzyme have been distinguished on the basis of sensitivity to alpha-amanitin, and the type of RNA synthesized. (From Enzyme Nomenclature, 1992).
Viruses whose genetic material is RNA.
A gene silencing phenomenon whereby specific dsRNAs (RNA, DOUBLE-STRANDED) trigger the degradation of homologous mRNA (RNA, MESSENGER). The specific dsRNAs are processed into SMALL INTERFERING RNA (siRNA) which serves as a guide for cleavage of the homologous mRNA in the RNA-INDUCED SILENCING COMPLEX. DNA METHYLATION may also be triggered during this process.
RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.
RNA consisting of two strands as opposed to the more prevalent single-stranded RNA. Most of the double-stranded segments are formed from transcription of DNA by intramolecular base-pairing of inverted complementary sequences separated by a single-stranded loop. Some double-stranded segments of RNA are normal in all organisms.
RNA that has catalytic activity. The catalytic RNA sequence folds to form a complex surface that can function as an enzyme in reactions with itself and other molecules. It may function even in the absence of protein. There are numerous examples of RNA species that are acted upon by catalytic RNA, however the scope of this enzyme class is not limited to a particular type of substrate.
The processes of RNA tertiary structure formation.
A DNA-dependent RNA polymerase present in bacterial, plant, and animal cells. It functions in the nucleoplasmic structure and transcribes DNA into RNA. It has different requirements for cations and salt than RNA polymerase I and is strongly inhibited by alpha-amanitin. EC
Ribonucleic acid in fungi having regulatory and catalytic roles as well as involvement in protein synthesis.
The extent to which an RNA molecule retains its structural integrity and resists degradation by RNASE, and base-catalyzed HYDROLYSIS, under changing in vivo or in vitro conditions.
A family of proteins that promote unwinding of RNA during splicing and translation.
RNA molecules which hybridize to complementary sequences in either RNA or DNA altering the function of the latter. Endogenous antisense RNAs function as regulators of gene expression by a variety of mechanisms. Synthetic antisense RNAs are used to effect the functioning of specific genes for investigative or therapeutic purposes.
Post-transcriptional biological modification of messenger, transfer, or ribosomal RNAs or their precursors. It includes cleavage, methylation, thiolation, isopentenylation, pseudouridine formation, conformational changes, and association with ribosomal protein.
The small RNA molecules, 73-80 nucleotides long, that function during translation (TRANSLATION, GENETIC) to align AMINO ACIDS at the RIBOSOMES in a sequence determined by the mRNA (RNA, MESSENGER). There are about 30 different transfer RNAs. Each recognizes a specific CODON set on the mRNA through its own ANTICODON and as aminoacyl tRNAs (RNA, TRANSFER, AMINO ACYL), each carries a specific amino acid to the ribosome to add to the elongating peptide chains.
Short chains of RNA (100-300 nucleotides long) that are abundant in the nucleus and usually complexed with proteins in snRNPs (RIBONUCLEOPROTEINS, SMALL NUCLEAR). Many function in the processing of messenger RNA precursors. Others, the snoRNAs (RNA, SMALL NUCLEOLAR), are involved with the processing of ribosomal RNA precursors.
RNA transcripts of the DNA that are in some unfinished stage of post-transcriptional processing (RNA PROCESSING, POST-TRANSCRIPTIONAL) required for function. RNA precursors may undergo several steps of RNA SPLICING during which the phosphodiester bonds at exon-intron boundaries are cleaved and the introns are excised. Consequently a new bond is formed between the ends of the exons. Resulting mature RNAs can then be used; for example, mature mRNA (RNA, MESSENGER) is used as a template for protein production.
RNA which does not code for protein but has some enzymatic, structural or regulatory function. Although ribosomal RNA (RNA, RIBOSOMAL) and transfer RNA (RNA, TRANSFER) are also untranslated RNAs they are not included in this scope.
The spatial arrangement of the atoms of a nucleic acid or polynucleotide that results in its characteristic 3-dimensional shape.
Nucleic acid structures found on the 5' end of eukaryotic cellular and viral messenger RNA and some heterogeneous nuclear RNAs. These structures, which are positively charged, protect the above specified RNAs at their termini against attack by phosphatases and other nucleases and promote mRNA function at the level of initiation of translation. Analogs of the RNA caps (RNA CAP ANALOGS), which lack the positive charge, inhibit the initiation of protein synthesis.
A multistage process that includes cloning, physical mapping, subcloning, sequencing, and information analysis of an RNA SEQUENCE.
Ribonucleic acid in plants having regulatory and catalytic roles as well as involvement in protein synthesis.
Ribonucleic acid in protozoa having regulatory and catalytic roles as well as involvement in protein synthesis.
The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.
RNA present in neoplastic tissue.
An enzyme that catalyzes the conversion of linear RNA to a circular form by the transfer of the 5'-phosphate to the 3'-hydroxyl terminus. It also catalyzes the covalent joining of two polyribonucleotides in phosphodiester linkage. EC
A large family of RNA helicases that share a common protein motif with the single letter amino acid sequence D-E-A-D (Asp-Glu-Ala-Asp). In addition to RNA helicase activity, members of the DEAD-box family participate in other aspects of RNA metabolism and regulation of RNA function.
A DNA-dependent RNA polymerase present in bacterial, plant, and animal cells. It functions in the nucleoplasmic structure where it transcribes DNA into RNA. It has specific requirements for cations and salt and has shown an intermediate sensitivity to alpha-amanitin in comparison to RNA polymerase I and II. EC
Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.
A DNA-dependent RNA polymerase present in bacterial, plant, and animal cells. The enzyme functions in the nucleolar structure and transcribes DNA into RNA. It has different requirements for cations and salts than RNA polymerase II and III and is not inhibited by alpha-amanitin. EC
RNA molecules found in the nucleus either associated with chromosomes or in the nucleoplasm.
Small kinetoplastid mitochondrial RNA that plays a major role in RNA EDITING. These molecules form perfect hybrids with edited mRNA sequences and possess nucleotide sequences at their 5'-ends that are complementary to the sequences of the mRNA's immediately downstream of the pre-edited regions.
Constituent of the 60S subunit of eukaryotic ribosomes. 28S rRNA is involved in the initiation of polypeptide synthesis in eukaryotes.
Constituent of the 40S subunit of eukaryotic ribosomes. 18S rRNA is involved in the initiation of polypeptide synthesis in eukaryotes.
Proteins that bind to RNA molecules. Included here are RIBONUCLEOPROTEINS and other proteins whose function is to bind specifically to RNA.
Constituent of 50S subunit of prokaryotic ribosomes containing about 3200 nucleotides. 23S rRNA is involved in the initiation of polypeptide synthesis.
The process of moving specific RNA molecules from one cellular compartment or region to another by various sorting and transport mechanisms.
The small RNAs which provide spliced leader sequences, SL1, SL2, SL3, SL4 and SL5 (short sequences which are joined to the 5' ends of pre-mRNAs by TRANS-SPLICING). They are found primarily in primitive eukaryotes (protozoans and nematodes).
Small, linear single-stranded RNA molecules functionally acting as molecular parasites of certain RNA plant viruses. Satellite RNAs exhibit four characteristic traits: (1) they require helper viruses to replicate; (2) they are unnecessary for the replication of helper viruses; (3) they are encapsidated in the coat protein of the helper virus; (4) they have no extensive sequence homology to the helper virus. Thus they differ from SATELLITE VIRUSES which encode their own coat protein, and from the genomic RNA; (=RNA, VIRAL); of satellite viruses. (From Maramorosch, Viroids and Satellites, 1991, p143)
Constituent of 30S subunit prokaryotic ribosomes containing 1600 nucleotides and 21 proteins. 16S rRNA is involved in initiation of polypeptide synthesis.
The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.
Ribonucleic acid in archaea having regulatory and catalytic roles as well as involvement in protein synthesis.
Widely used technique which exploits the ability of complementary sequences in single-stranded DNAs or RNAs to pair with each other to form a double helix. Hybridization can take place between two complimentary DNA sequences, between a single-stranded DNA and a complementary RNA, or between two RNA sequences. The technique is used to detect and isolate specific sequences, measure homology, or define other characteristics of one or both strands. (Kendrew, Encyclopedia of Molecular Biology, 1994, p503)
The biosynthesis of PEPTIDES and PROTEINS on RIBOSOMES, directed by MESSENGER RNA, via TRANSFER RNA that is charged with standard proteinogenic AMINO ACIDS.
Established cell cultures that have the potential to propagate indefinitely.
The process of intracellular viral multiplication, consisting of the synthesis of PROTEINS; NUCLEIC ACIDS; and sometimes LIPIDS, and their assembly into a new infectious particle.
A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.
A reaction that severs one of the sugar-phosphate linkages of the phosphodiester backbone of RNA. It is catalyzed enzymatically, chemically, or by radiation. Cleavage may be exonucleolytic, or endonucleolytic.
Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.
A group of ribonucleotides (up to 12) in which the phosphate residues of each ribonucleotide act as bridges in forming diester linkages between the ribose moieties.
Nuclear nonribosomal RNA larger than about 1000 nucleotides, the mass of which is rapidly synthesized and degraded within the cell nucleus. Some heterogeneous nuclear RNA may be a precursor to mRNA. However, the great bulk of total hnRNA hybridizes with nuclear DNA rather than with mRNA.
The biosynthesis of RNA carried out on a template of DNA. The biosynthesis of DNA from an RNA template is called REVERSE TRANSCRIPTION.
Small RNAs found in the cytoplasm usually complexed with proteins in scRNPs (RIBONUCLEOPROTEINS, SMALL CYTOPLASMIC).
The steps that generate the 3' ends of mature RNA molecules. For most mRNAs (RNA, MESSENGER), 3' end processing referred to as POLYADENYLATION includes the addition of POLY A.
Macromolecular molds for the synthesis of complementary macromolecules, as in DNA REPLICATION; GENETIC TRANSCRIPTION of DNA to RNA, and GENETIC TRANSLATION of RNA into POLYPEPTIDES.
Short RNA, about 200 base pairs in length or shorter, that does not code for protein.
The first continuously cultured human malignant CELL LINE, derived from the cervical carcinoma of Henrietta Lacks. These cells are used for VIRUS CULTIVATION and antitumor drug screening assays.
Complexes of RNA-binding proteins with ribonucleic acids (RNA).
Enzymes that catalyze the hydrolysis of ester bonds within RNA. EC 3.1.-.
A group of adenine ribonucleotides in which the phosphate residues of each adenine ribonucleotide act as bridges in forming diester linkages between the ribose moieties.
The complete genetic complement contained in a DNA or RNA molecule in a virus.
Constituent of the 60S subunit of eukaryotic ribosomes. 5.8S rRNA is involved in the initiation of polypeptide synthesis in eukaryotes.
A deoxyribonucleotide polymer that is the primary genetic material of all cells. Eukaryotic and prokaryotic organisms normally contain DNA in a double-stranded state, yet several important biological processes transiently involve single-stranded regions. DNA, which consists of a polysugar-phosphate backbone possessing projections of purines (adenine and guanine) and pyrimidines (thymine and cytosine), forms a double helix that is held together by hydrogen bonds between these purines and pyrimidines (adenine to thymine and guanine to cytosine).
A class of untranslated RNA molecules that are typically greater than 200 nucleotides in length and do not code for proteins. Members of this class have been found to play roles in transcriptional regulation, post-transcriptional processing, CHROMATIN REMODELING, and in the epigenetic control of chromatin.
Small nuclear RNAs that are involved in the processing of pre-ribosomal RNA in the nucleolus. Box C/D containing snoRNAs (U14, U15, U16, U20, U21 and U24-U63) direct site-specific methylation of various ribose moieties. Box H/ACA containing snoRNAs (E2, E3, U19, U23, and U64-U72) direct the conversion of specific uridines to pseudouridine. Site-specific cleavages resulting in the mature ribosomal RNAs are directed by snoRNAs U3, U8, U14, U22 and the snoRNA components of RNase MRP and RNase P.
The parts of a macromolecule that directly participate in its specific combination with another molecule.
The process in which substances, either endogenous or exogenous, bind to proteins, peptides, enzymes, protein precursors, or allied compounds. Specific protein-binding measures are often used as assays in diagnostic assessments.
Synthetic transcripts of a specific DNA molecule or fragment, made by an in vitro transcription system. This cRNA can be labeled with radioactive uracil and then used as a probe. (King & Stansfield, A Dictionary of Genetics, 4th ed)
DNA sequences which are recognized (directly or indirectly) and bound by a DNA-dependent RNA polymerase during the initiation of transcription. Highly conserved sequences within the promoter include the Pribnow box in bacteria and the TATA BOX in eukaryotes.
A family of enzymes that catalyze the endonucleolytic cleavage of RNA. It includes EC 3.1.26.-, EC 3.1.27.-, EC 3.1.30.-, and EC 3.1.31.-.
Within a eukaryotic cell, a membrane-limited body which contains chromosomes and one or more nucleoli (CELL NUCLEOLUS). The nuclear membrane consists of a double unit-type membrane which is perforated by a number of pores; the outermost membrane is continuous with the ENDOPLASMIC RETICULUM. A cell may contain more than one nucleus. (From Singleton & Sainsbury, Dictionary of Microbiology and Molecular Biology, 2d ed)
Ribonucleic acid in chloroplasts having regulatory and catalytic roles as well as involvement in protein synthesis.
Models used experimentally or theoretically to study molecular shape, electronic properties, or interactions; includes analogous molecules, computer-generated graphics, and mechanical structures.
Extrachromosomal, usually CIRCULAR DNA molecules that are self-replicating and transferable from one organism to another. They are found in a variety of bacterial, archaeal, fungal, algal, and plant species. They are used in GENETIC ENGINEERING as CLONING VECTORS.
A variation of the PCR technique in which cDNA is made from RNA via reverse transcription. The resultant cDNA is then amplified using standard PCR protocols.
The rate dynamics in chemical or physical systems.
Enzymes that catalyze the endonucleolytic cleavage of single-stranded regions of DNA or RNA molecules while leaving the double-stranded regions intact. They are particularly useful in the laboratory for producing "blunt-ended" DNA molecules from DNA with single-stranded ends and for sensitive GENETIC TECHNIQUES such as NUCLEASE PROTECTION ASSAYS that involve the detection of single-stranded DNA and RNA.
Pairing of purine and pyrimidine bases by HYDROGEN BONDING in double-stranded DNA or RNA.
Ribonucleic acid in helminths having regulatory and catalytic roles as well as involvement in protein synthesis.
Viruses parasitic on plants higher than bacteria.
Short sequences (generally about 10 base pairs) of DNA that are complementary to sequences of messenger RNA and allow reverse transcriptases to start copying the adjacent sequences of mRNA. Primers are used extensively in genetic and molecular biology techniques.
Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control (induction or repression) of gene action at the level of transcription or translation.
A species of the genus SACCHAROMYCES, family Saccharomycetaceae, order Saccharomycetales, known as "baker's" or "brewer's" yeast. The dried form is used as a dietary supplement.
Endogenous substances, usually proteins, which are effective in the initiation, stimulation, or termination of the genetic transcription process.
A transfer RNA which is specific for carrying phenylalanine to sites on the ribosomes in preparation for protein synthesis.
A transfer RNA which is specific for carrying lysine to sites on the ribosomes in preparation for protein synthesis.
Multicomponent ribonucleoprotein structures found in the CYTOPLASM of all cells, and in MITOCHONDRIA, and PLASTIDS. They function in PROTEIN BIOSYNTHESIS via GENETIC TRANSLATION.
Detection of RNA that has been electrophoretically separated and immobilized by blotting on nitrocellulose or other type of paper or nylon membrane followed by hybridization with labeled NUCLEIC ACID PROBES.
Deoxyribonucleic acid that makes up the genetic material of viruses.
In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships.
Polymers made up of a few (2-20) nucleotides. In molecular genetics, they refer to a short sequence synthesized to match a region where a mutation is known to occur, and then used as a probe (OLIGONUCLEOTIDE PROBES). (Dorland, 28th ed)
Interruption or suppression of the expression of a gene at transcriptional or translational levels.
The sequence at the 5' end of the messenger RNA that does not code for product. This sequence contains the ribosome binding site and other transcription and translation regulating sequences.
A transfer RNA which is specific for carrying tyrosine to sites on the ribosomes in preparation for protein synthesis.
The sequential correspondence of nucleotides in one nucleic acid molecule with those of another nucleic acid molecule. Sequence homology is an indication of the genetic relatedness of different organisms and gene function.
The sequence at the 3' end of messenger RNA that does not code for product. This region contains transcription and translation regulating sequences.
Cyclic peptides extracted from carpophores of various mushroom species. They are potent inhibitors of RNA polymerases in most eukaryotic species, blocking the production of mRNA and protein synthesis. These peptides are important in the study of transcription. Alpha-amanitin is the main toxin from the species Amanitia phalloides, poisonous if ingested by humans or animals.
The functional hereditary units of VIRUSES.
Disruption of the secondary structure of nucleic acids by heat, extreme pH or chemical treatment. Double strand DNA is "melted" by dissociation of the non-covalent hydrogen bonds and hydrophobic interactions. Denatured DNA appears to be a single-stranded flexible structure. The effects of denaturation on RNA are similar though less pronounced and largely reversible.
The uptake of naked or purified DNA by CELLS, usually meaning the process as it occurs in eukaryotic cells. It is analogous to bacterial transformation (TRANSFORMATION, BACTERIAL) and both are routinely employed in GENE TRANSFER TECHNIQUES.
An enzyme catalyzing the endonucleolytic cleavage of RNA at the 3'-position of a guanylate residue. EC
The sum of the weight of all the atoms in a molecule.
The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.
Within most types of eukaryotic CELL NUCLEUS, a distinct region, not delimited by a membrane, in which some species of rRNA (RNA, RIBOSOMAL) are synthesized and assembled into ribonucleoprotein subunits of ribosomes. In the nucleolus rRNA is transcribed from a nucleolar organizer, i.e., a group of tandemly repeated chromosomal genes which encode rRNA and which are transcribed by RNA polymerase I. (Singleton & Sainsbury, Dictionary of Microbiology & Molecular Biology, 2d ed)
The type species of LENTIVIRUS and the etiologic agent of AIDS. It is characterized by its cytopathic effect and affinity for the T4-lymphocyte.
A fractionated cell extract that maintains a biological function. A subcellular fraction isolated by ultracentrifugation or other separation techniques must first be isolated so that a process can be studied free from all of the complex side reactions that occur in a cell. The cell-free system is therefore widely used in cell biology. (From Alberts et al., Molecular Biology of the Cell, 2d ed, p166)
The level of protein structure in which combinations of secondary protein structures (alpha helices, beta sheets, loop regions, and motifs) pack together to form folded shapes called domains. Disulfide bridges between cysteines in two different parts of the polypeptide chain along with other interactions between the chains play a role in the formation and stabilization of tertiary structure. Small proteins usually consist of only one domain but larger proteins may contain a number of domains connected by segments of polypeptide chain which lack regular secondary structure.
Single-stranded complementary DNA synthesized from an RNA template by the action of RNA-dependent DNA polymerase. cDNA (i.e., complementary DNA, not circular DNA, not C-DNA) is used in a variety of molecular cloning experiments as well as serving as a specific hybridization probe.
Any of the processes by which cytoplasmic factors influence the differential control of gene action in viruses.
A category of nucleic acid sequences that function as units of heredity and which code for the basic instructions for the development, reproduction, and maintenance of organisms.
A sequence of amino acids in a polypeptide or of nucleotides in DNA or RNA that is similar across multiple species. A known set of conserved sequences is represented by a CONSENSUS SEQUENCE. AMINO ACID MOTIFS are often composed of conserved sequences.
Proteins encoded by a VIRAL GENOME that are produced in the organisms they infect, but not packaged into the VIRUS PARTICLES. Some of these proteins may play roles within the infected cell during VIRUS REPLICATION or act in regulation of virus replication or VIRUS ASSEMBLY.
Intermediates in protein biosynthesis. The compounds are formed from amino acids, ATP and transfer RNA, a reaction catalyzed by aminoacyl tRNA synthetase. They are key compounds in the genetic translation process.
The phenotypic manifestation of a gene or genes by the processes of GENETIC TRANSCRIPTION and GENETIC TRANSLATION.
Sequences of DNA in the genes that are located between the EXONS. They are transcribed along with the exons but are removed from the primary gene transcript by RNA SPLICING to leave mature RNA. Some introns code for separate genes.
Nucleotide sequences located at the ends of EXONS and recognized in pre-messenger RNA by SPLICEOSOMES. They are joined during the RNA SPLICING reaction, forming the junctions between exons.
A transfer RNA which is specific for carrying alanine to sites on the ribosomes in preparation for protein synthesis.
A species of ENTEROVIRUS which is the causal agent of POLIOMYELITIS in humans. Three serotypes (strains) exist. Transmission is by the fecal-oral route, pharyngeal secretions, or mechanical vector (flies). Vaccines with both inactivated and live attenuated virus have proven effective in immunizing against the infection.
Cells propagated in vitro in special media conducive to their growth. Cultured cells are used to study developmental, morphologic, metabolic, physiologic, and genetic processes, among others.
A plant genus of the family SOLANACEAE. Members contain NICOTINE and other biologically active chemicals; its dried leaves are used for SMOKING.
An RNA-containing enzyme that plays an essential role in tRNA processing by catalyzing the endonucleolytic cleavage of TRANSFER RNA precursors. It removes the extra 5'-nucleotides from tRNA precursors to generate mature tRNA molecules.
Separation of particles according to density by employing a gradient of varying densities. At equilibrium each particle settles in the gradient at a point equal to its density. (McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed)
The part of a cell that contains the CYTOSOL and small structures excluding the CELL NUCLEUS; MITOCHONDRIA; and large VACUOLES. (Glick, Glossary of Biochemistry and Molecular Biology, 1990)
The monomeric units from which DNA or RNA polymers are constructed. They consist of a purine or pyrimidine base, a pentose sugar, and a phosphate group. (From King & Stansfield, A Dictionary of Genetics, 4th ed)
Viruses which produce a mottled appearance of the leaves of plants.
An enzyme that synthesizes DNA on an RNA template. It is encoded by the pol gene of retroviruses and by certain retrovirus-like elements. EC
A compound composed of a two CYCLIC PEPTIDES attached to a phenoxazine that is derived from STREPTOMYCES parvullus. It binds to DNA and inhibits RNA synthesis (transcription), with chain elongation more sensitive than initiation, termination, or release. As a result of impaired mRNA production, protein synthesis also declines after dactinomycin therapy. (From AMA Drug Evaluations Annual, 1993, p2015)
A sequence of successive nucleotide triplets that are read as CODONS specifying AMINO ACIDS and begin with an INITIATOR CODON and end with a stop codon (CODON, TERMINATOR).
The determination of the pattern of genes expressed at the level of GENETIC TRANSCRIPTION, under specific circumstances or in a specific cell.
A genus of FLAVIVIRIDAE causing parenterally-transmitted HEPATITIS C which is associated with transfusions and drug abuse. Hepatitis C virus is the type species.
Electrophoresis in which a polyacrylamide gel is used as the diffusion medium.
A transfer RNA which is specific for carrying aspartic acid to sites on the ribosomes in preparation for protein synthesis.
A transfer RNA which is specific for carrying methionine to sites on the ribosomes. During initiation of protein synthesis, tRNA(f)Met in prokaryotic cells and tRNA(i)Met in eukaryotic cells binds to the start codon (CODON, INITIATOR).
The relationships of groups of organisms as reflected by their genetic makeup.
A genus of tripartite plant viruses in the family BROMOVIRIDAE. Transmission is by beetles. Brome mosaic virus is the type species.
Proteins prepared by recombinant DNA technology.
A characteristic feature of enzyme activity in relation to the kind of substrate on which the enzyme or catalytic molecule reacts.
A ribonuclease that specifically cleaves the RNA moiety of RNA:DNA hybrids. It has been isolated from a wide variety of prokaryotic and eukaryotic organisms as well as RETROVIRUSES.
Proteins found in the nucleus of a cell. Do not confuse with NUCLEOPROTEINS which are proteins conjugated with nucleic acids, that are not necessarily present in the nucleus.
Theoretical representations that simulate the behavior or activity of genetic processes or phenomena. They include the use of mathematical equations, computers, and other electronic equipment.
Sequences within RNA that regulate the processing, stability (RNA STABILITY) or translation (TRANSLATION, GENETIC) of RNA.
A multiribosomal structure representing a linear array of RIBOSOMES held together by messenger RNA; (RNA, MESSENGER); They represent the active complexes in cellular protein synthesis and are able to incorporate amino acids into polypeptides both in vivo and in vitro. (From Rieger et al., Glossary of Genetics: Classical and Molecular, 5th ed)
A cell line derived from cultured tumor cells.
The outer protein protective shell of a virus, which protects the viral nucleic acid.
A family of enzymes that catalyze the exonucleolytic cleavage of RNA. It includes EC 3.1.13.-, EC 3.1.14.-, EC 3.1.15.-, and EC 3.1.16.-. EC 3.1.-
The property of objects that determines the direction of heat flow when they are placed in direct thermal contact. The temperature is the energy of microscopic motions (vibrational and translational) of the particles of atoms.
Proteins found in any species of bacterium.
Use of restriction endonucleases to analyze and generate a physical map of genomes, genes, or other segments of DNA.
A transfer RNA which is specific for carrying glycine to sites on the ribosomes in preparation for protein synthesis.
A transfer RNA which is specific for carrying histidine to sites on the ribosomes in preparation for protein synthesis.
Proteins obtained from the species SACCHAROMYCES CEREVISIAE. The function of specific proteins from this organism are the subject of intense scientific interest and have been used to derive basic understanding of the functioning similar proteins in higher eukaryotes.
A transfer RNA which is specific for carrying valine to sites on the ribosomes in preparation for protein synthesis.
A group of uridine ribonucleotides in which the phosphate residues of each uridine ribonucleotide act as bridges in forming diester linkages between the ribose moieties.
A family of RNA viruses infecting insects and fish. There are two genera: Alphanodavirus and Betanodavirus.
Use for nucleic acid precursors in general or for which there is no specific heading.
The assembly of VIRAL STRUCTURAL PROTEINS and nucleic acid (VIRAL DNA or VIRAL RNA) to form a VIRUS PARTICLE.
Viruses which lack a complete genome so that they cannot completely replicate or cannot form a protein coat. Some are host-dependent defectives, meaning they can replicate only in cell systems which provide the particular genetic function which they lack. Others, called SATELLITE VIRUSES, are able to replicate only when their genetic defect is complemented by a helper virus.
Deletion of sequences of nucleic acids from the genetic material of an individual.
A transfer RNA which is specific for carrying arginine to sites on the ribosomes in preparation for protein synthesis.
Ribonucleic acid in algae having regulatory and catalytic roles as well as involvement in protein synthesis.
A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.
A family of ribonucleoproteins that were originally found as proteins bound to nascent RNA transcripts in the form of ribonucleoprotein particles. Although considered ribonucleoproteins they are primarily classified by their protein component. They are involved in a variety of processes such as packaging of RNA and RNA TRANSPORT within the nucleus. A subset of heterogeneous-nuclear ribonucleoproteins are involved in additional functions such as nucleocytoplasmic transport (ACTIVE TRANSPORT, CELL NUCLEUS) of RNA and mRNA stability in the CYTOPLASM.
Proteins obtained from ESCHERICHIA COLI.
The restriction of a characteristic behavior, anatomical structure or physical system, such as immune response; metabolic response, or gene or gene variant to the members of one species. It refers to that property which differentiates one species from another but it is also used for phylogenetic levels higher or lower than the species.
A process whereby multiple RNA transcripts are generated from a single gene. Alternative splicing involves the splicing together of other possible sets of EXONS during the processing of some, but not all, transcripts of the gene. Thus a particular exon may be connected to any one of several alternative exons to form a mature RNA. The alternative forms of mature MESSENGER RNA produce PROTEIN ISOFORMS in which one part of the isoforms is common while the other parts are different.
The infective system of a virus, composed of the viral genome, a protein core, and a protein coat called a capsid, which may be naked or enclosed in a lipoprotein envelope called the peplos.
Highly conserved nuclear RNA-protein complexes that function in RNA processing in the nucleus, including pre-mRNA splicing and pre-mRNA 3'-end processing in the nucleoplasm, and pre-rRNA processing in the nucleolus (see RIBONUCLEOPROTEINS, SMALL NUCLEOLAR).
A defective virus, containing particles of RNA nucleoprotein in virion-like form, present in patients with acute hepatitis B and chronic hepatitis. It requires the presence of a hepadnavirus for full replication. This is the lone species in the genus Deltavirus.
Proteins found in ribosomes. They are believed to have a catalytic function in reconstituting biologically active ribosomal subunits.
A transfer RNA which is specific for carrying tryptophan to sites on the ribosomes in preparation for protein synthesis.
Hybridization of a nucleic acid sample to a very large set of OLIGONUCLEOTIDE PROBES, which have been attached individually in columns and rows to a solid support, to determine a BASE SEQUENCE, or to detect variations in a gene sequence, GENE EXPRESSION, or for GENE MAPPING.
DNA sequences recognized as signals to end GENETIC TRANSCRIPTION.
Recombinant proteins produced by the GENETIC TRANSLATION of fused genes formed by the combination of NUCLEIC ACID REGULATORY SEQUENCES of one or more genes with the protein coding sequences of one or more genes.
Compounds and molecular complexes that consist of very large numbers of atoms and are generally over 500 kDa in size. In biological systems macromolecular substances usually can be visualized using ELECTRON MICROSCOPY and are distinguished from ORGANELLES by the lack of a membrane structure.
Multicellular, eukaryotic life forms of kingdom Plantae (sensu lato), comprising the VIRIDIPLANTAE; RHODOPHYTA; and GLAUCOPHYTA; all of which acquired chloroplasts by direct endosymbiosis of CYANOBACTERIA. They are characterized by a mainly photosynthetic mode of nutrition; essentially unlimited growth at localized regions of cell divisions (MERISTEMS); cellulose within cells providing rigidity; the absence of organs of locomotion; absence of nervous and sensory systems; and an alternation of haploid and diploid generations.
Elements of limited time intervals, contributing to particular results or situations.
Genetically engineered MUTAGENESIS at a specific site in the DNA molecule that introduces a base substitution, or an insertion or deletion.
Process of generating a genetic MUTATION. It may occur spontaneously or be induced by MUTAGENS.
A bacteriophage genus of the family LEVIVIRIDAE, whose viruses contain the short version of the genome and have a separate gene for cell lysis.
Identification of proteins or peptides that have been electrophoretically separated by blot transferring from the electrophoresis gel to strips of nitrocellulose paper, followed by labeling with antibody probes.
A hemoflagellate subspecies of parasitic protozoa that causes nagana in domestic and game animals in Africa. It apparently does not infect humans. It is transmitted by bites of tsetse flies (Glossina).
Enzymes that are part of the restriction-modification systems. They catalyze the endonucleolytic cleavage of DNA sequences which lack the species-specific methylation pattern in the host cell's DNA. Cleavage yields random or specific double-stranded fragments with terminal 5'-phosphates. The function of restriction enzymes is to destroy any foreign DNA that invades the host cell. Most have been studied in bacterial systems, but a few have been found in eukaryotic organisms. They are also used as tools for the systematic dissection and mapping of chromosomes, in the determination of base sequences of DNAs, and have made it possible to splice and recombine genes from one organism into the genome of another. EC 3.21.1.
Theoretical representations that simulate the behavior or activity of biological processes or diseases. For disease models in living animals, DISEASE MODELS, ANIMAL is available. Biological models include the use of mathematical equations, computers, and other electronic equipment.
The parts of a transcript of a split GENE remaining after the INTRONS are removed. They are spliced together to become a MESSENGER RNA or other functional RNA.
Any of the processes by which cytoplasmic or intercellular factors influence the differential control of gene action in bacteria.
A genus of plant viruses that infects ANGIOSPERMS. Transmission occurs mechanically and through soil, with one species transmitted via a fungal vector. The type species is Tomato bushy stunt virus.
A purine nucleoside that has guanine linked by its N9 nitrogen to the C1 carbon of ribose. It is a component of ribonucleic acid and its nucleotides play important roles in metabolism. (From Dorland, 28th ed)
The addition of a tail of polyadenylic acid (POLY A) to the 3' end of mRNA (RNA, MESSENGER). Polyadenylation involves recognizing the processing site signal, (AAUAAA), and cleaving of the mRNA to create a 3' OH terminal end to which poly A polymerase (POLYNUCLEOTIDE ADENYLYLTRANSFERASE) adds 60-200 adenylate residues. The 3' end processing of some messenger RNAs, such as histone mRNA, is carried out by a different process that does not include the addition of poly A as described here.
A transfer RNA which is specific for carrying leucine to sites on the ribosomes in preparation for protein synthesis.
The outward appearance of the individual. It is the product of interactions between genes, and between the GENOTYPE and the environment.
The relationship between the chemical structure of a compound and its biological or pharmacological activity. Compounds are often classed together because they have structural characteristics in common including shape, size, stereochemical arrangement, and distribution of functional groups.
Addition of methyl groups. In histo-chemistry methylation is used to esterify carboxyl groups and remove sulfate groups by treating tissue sections with hot methanol in the presence of hydrochloric acid. (From Stedman, 25th ed)

Zygosaccharomyces lentus sp. nov., a new member of the yeast genus Zygosaccharomyces Barker. (1/1400)

Unusual growth characteristics of a spoilage yeast, originally isolated from spoiled whole-orange drink and previously identified as Zygosaccharomyces bailii, prompted careful re-examination of its taxonomic position. Small-subunit rRNA gene sequences were determined for this strain and for four other strains also originally described as Z. bailii but which, in contrast to other strains of this species, grew poorly or not at all under aerobic conditions with agitation, failed to grow in the presence of 1% acetic acid and failed to grow at 30 degrees C. Comparative sequence analysis revealed that these strains represented a phylogenetically distinct taxon closely related to, but distinct from, Z. bailii and Zygosaccharomyces bisporus. Furthermore, sequence analysis of the internal transcribed spacer (ITS) region showed that, while all five strains had identical ITS2 sequences, they could be subdivided into two groups based on ITS1 sequences. Despite such minor inter-strain sequence variation, these yeasts could readily be distinguished from all other currently described Zygosaccharomyces species by using ITS sequences. On the basis of the phylogenetic results presented, a new species comprising the five strains, Zygosaccharomyces lentus sp. nov., is described and supporting physiological data are discussed, including a demonstration that growth of this species is particularly sensitive to the presence of oxygen. The type strain of Z. lentus is NCYC D2627T.  (+info)

Semi-nested, multiplex polymerase chain reaction for detection of human malaria parasites and evidence of Plasmodium vivax infection in Equatorial Guinea. (2/1400)

A semi-nested, multiplex polymerase chain reaction (PCR) based on the amplification of the sequences of the 18S small subunit ribosomal RNA (ssrRNA) gene was tested in a field trial in Equatorial Guinea (a hyperendemic focus of malaria in west central Africa). The method uses a primary PCR amplification reaction with a universal reverse primer and two forward primers specific for the genus Plasmodium and to mammals (the mammalian-specific primer was included as a positive control to distinguish uninfected cases from inhibition of the PCR). The second amplification is carried out with the same Plasmodium genus-specific forward primer and four specific reverse primers for each human Plasmodium species. The PCR amplified products are differentiated by fragment size after electrophoresis on a 2% agarose gel. Four villages from three regions of the island of Bioko (Equatorial Guinea) and two suspected Plasmodium vivax-P. ovale infections from the hospital of Malabo were tested by microscopy and PCR. The PCR method showed greater sensitivity and specificity than microscopic examination and confirmed the existence of a focus of P. vivax infections in Equatorial Guinea suspected by microscopic examination. It also provided evidence of several mixed infections, mainly P. falciparum and P. malariae, the two predominant species causing malaria in Equatorial Guinea.  (+info)

Acoel flatworms: earliest extant bilaterian Metazoans, not members of Platyhelminthes. (3/1400)

Because of their simple organization the Acoela have been considered to be either primitive bilaterians or descendants of coelomates through secondary loss of derived features. Sequence data of 18S ribosomal DNA genes from non-fast evolving species of acoels and other metazoans reveal that this group does not belong to the Platyhelminthes but represents the extant members of the earliest divergent Bilateria, an interpretation that is supported by recent studies on the embryonic cleavage pattern and nervous system of acoels. This study has implications for understanding the evolution of major body plans, and for perceptions of the Cambrian evolutionary explosion.  (+info)

Nop58p is a common component of the box C+D snoRNPs that is required for snoRNA stability. (4/1400)

Eukaryotic nucleoli contain a large family of box C+D small nucleolar RNA (snoRNA) species, all of which are associated with a common protein Nop1p/fibrillarin. Nop58p was identified in a screen for synthetic lethality with Nop1p and shown to be an essential nucleolar protein. Here we report that a Protein A-tagged version of Nop58p coprecipitates all tested box C+D snoRNAs and that genetic depletion of Nop58p leads to the loss of all tested box C+D snoRNAs. The box H+ACA class of snoRNAs are not coprecipitated with Nop58p, and are not codepleted. The yeast box C+D snoRNAs include two species, U3 and U14, that are required for the early cleavages in pre-rRNA processing. Consistent with this, Nop58p depletion leads to a strong inhibition of pre-rRNA processing and 18S rRNA synthesis. Unexpectedly, depletion of Nop58p leads to the accumulation of 3' extended forms of U3 and U24, showing that the protein is also involved in snoRNA synthesis. Nop58p is the second common component of the box C+D snoRNPs to be identified and the first to be shown to be required for the stability and for the synthesis of these snoRNAs.  (+info)

The Cryptosporidium "mouse" genotype is conserved across geographic areas. (5/1400)

A 298-bp region of the Cryptosporidium parvum 18S rRNA gene and a 390-bp region of the acetyl coenzyme A synthetase gene were sequenced for a range of Cryptosporidium isolates from wild house mice (Mus domesticus), a bat (Myotus adversus), and cattle from different geographical areas. Previous research has identified a distinct genotype, referred to as the "mouse"-derived Cryptosporidium genotype, common to isolates from Australian mice. Comparison of a wider range of Australian mouse isolates with United Kingdom and Spanish isolates from mice and cattle and also an Australian bat-derived Cryptosporidium isolate revealed that the "mouse" genotype is conserved across geographic areas. Mice are also susceptible to infection with the "cattle" Cryptosporidium genotype, which has important implications for their role as reservoirs of infection for humans and domestic animals.  (+info)

Cystofilobasidiales, a new order of basidiomycetous yeasts. (6/1400)

The order Cystofilobasidiales is described for teleomorphic basidiomycetous yeasts with holobasidia and teliospores. Their septa have dolipores, but lack parenthesomes. D-Glucuronate, nitrate and nitrite are assimilated and myoinositol is usually assimilated. Coenzyme Q has 8 or 10 isoprenologues. 25S and 18S rDNA sequence analysis indicates a monophyletic branch within the Tremellomycetidae of the Hymenomycetes. Cystofilobasidium is the type genus.  (+info)

Simultaneous detection of bovine Theileria and Babesia species by reverse line blot hybridization. (7/1400)

A reverse line blot (RLB) assay was developed for the identification of cattle carrying different species of Theileria and Babesia simultaneously. We included Theileria annulata, T. parva, T. mutans, T. taurotragi, and T. velifera in the assay, as well as parasites belonging to the T. sergenti-T. buffeli-T. orientalis group. The Babesia species included were Babesia bovis, B. bigemina, and B. divergens. The assay employs one set of primers for specific amplification of the rRNA gene V4 hypervariable regions of all Theileria and Babesia species. PCR products obtained from blood samples were hybridized to a membrane onto which nine species-specific oligonucleotides were covalently linked. Cross-reactions were not observed between any of the tested species. No DNA sequences from Bos taurus or other hemoparasites (Trypanosoma species, Cowdria ruminantium, Anaplasma marginale, and Ehrlichia species) were amplified. The sensitivity of the assay was determined at 0.000001% parasitemia, enabling detection of the carrier state of most parasites. Mixed DNAs from five different parasites were correctly identified. Moreover, blood samples from cattle experimentally infected with two different parasites reacted only with the corresponding species-specific oligonucleotides. Finally, RLB was used to screen blood samples collected from carrier cattle in two regions of Spain. T. annulata, T. orientalis, and B. bigemina were identified in these samples. In conclusion, the RLB is a versatile technique for simultaneous detection of all bovine tick-borne protozoan parasites. We recommend its use for integrated epidemiological monitoring of tick-borne disease, since RLB can also be used for screening ticks and can easily be expanded to include additional hemoparasite species.  (+info)

The 5' end of the 18S rRNA can be positioned from within the mature rRNA. (8/1400)

In yeast, the 5' end of the mature 18S rRNA is generated by endonucleolytic cleavage at site A1, the position of which is specified by two distinct signals. An evolutionarily conserved sequence immediately upstream of the cleavage site has previously been shown to constitute one of these signals. We report here that a conserved stem-loop structure within the 5' region of the 18S rRNA is recognized as a second positioning signal. Mutations predicted to either extend or destabilize the stem inhibited the normal positioning of site A1 from within the 18S rRNA sequence, as did substitution of the loop nucleotides. In addition, these mutations destabilized the mature 18S rRNA, indicating that recognition of the stem-loop structure is also required for 18S rRNA stability. Several mutations tested reduced the efficiency of pre-rRNA cleavage at site A1. There was, however, a poor correlation between the effects of the different mutations on the efficiency of cleavage and on the choice of cleavage site, indicating that these involve recognition of the stem-loop region by distinct factors. In contrast, the cleavages at sites A1 and A2 are coupled and the positioning signals appear to be similar, suggesting that both cleavages may be carried out by the same endonuclease.  (+info)

|ul| |li|Handle|/li| |li|Semi detachable + adjustable backstraps|/li| |li|1 front pocket (zipped)|/li| |li|2 compartments (phone + wallet)|/li| |li|1 main compartment (zipped)|/li| |li|1 inside pocket (zipped)|/li| |li|1 back pocket (open)|/li| |li|2 side
Če postopka (klasično križanje vs gensko modificiranje) zreduciraš na sestavne gradnike, torej na DNA, sta si postopka v bistvu podobna. Razlika je, da je klasično križanje podobno možganski operaciji, kjer kirurg uporablja sekiro, genetski inženiring pa je ista operacija z uporabo mikroskopa in ostalih modernih medicinskih inštrumentov. Pri klasičnem križanju uporabiš za starše primerke, ki imajo želene lastnosti in upaš, da bo določen delež potomcev izrazil lastnosti obeh staršev. To potem plemenitiš in križaš naprej, dokler nisi približno zadovoljen z rezultatom. Na molekulskem nivoju to pomeni rekombiniranje velikih področij DNA, pri čemer upaš na majhne spremembe in izločanje neželenih alelov. Kot rečeno, možganska operacija s sekiro. Poleg tega si pri križanju omejen na obstoječe gene in na naključne mutacije. Čisto možno je, da bi zaradi naključne mutacije koruza dobila gen, ki bi proizvajal Bt toksin (pustimo zdaj detajl, da bi najverjetneje takšna ...
From psychedelic soap-film bubbles to cancer cells that appear as flowery pom-poms, here are the winners of Nikon's Small World competition.
Zoznamka stretni narodil malý Filipko, išla som Badoo Zadarmo kmotru. MS v Kovačici Divadelné predstavenie Zoznamka Výtvarný tábor pre deti s. Uľahčuje klientovi My Dvaja zoznamka tým, že Presov Zoznamka umožňuje Zoznamenie pre Přivítejte dobrého vílu Seznamovací agentury Dohnala!
கிரீத்தேசியம் அல்லது கிரீத்தேசியக் காலம் (உச்சரிப்பு /kriːˈteɪʃəs/, கலைச்சொல் கற்பொடிக் காலம்) என்பது ஜூராசிக் காலத்தின் (. ± 4 மில்லியன் ஆண்டுகளுக்கு முன்) முடிவிலிருந்து பலியோசீன் காலத் (66 ± 4 Ma) தொடக்கம் வரையான நிலவியல் காலப் பகுதியையும், முறைமையையும் குறிக்கும். இதுவே மெசோசோயிக் ஊழியின் கடைசி காலப் பகுதியாகும். 80 மில்லியன் ஆண்டுகளைக் கொண்ட இக் காலப்பகுதியே பனரோசோயிக் பேருழியின் ...
KRR1小鼠单克隆抗体[2437C1a](ab58661)可与人样本反应并经WB, Dot实验严格验证。中国75%以上现货,所有产品均提供质保服务,可通过电话、电邮或微信获得本地专属技术支持。
In the drinking water samples taken at 5 tap locations in the same drinking water distribution network (Fig. S1,† TP1-TP5), different eukaryotic communities were identified within each of the tap water samples. These differences may reflect the existence of a variety of microhabitats defined by complex environmental conditions existing in the distribution network (reservoir, pipes and premise plumbing) that affect the eukaryotic community composition and structure. Both the number of shared eukaryotic groups and their relative abundance varied between the PW (drinking water feeding the network) and each of the tap water samples in the network (except Gastrotrich detected only in TP4). In addition, the taxonomic diversity of the fungal community in the network was higher than observed in the PW (Fig. S4†). Results showed that the core community shared between the PW and the all combined tap water samples was composed of 84 OTUs (28.1%). The core community between the PW and each of the tap ...
An idea related to plagiarized mistakes is the basis on which it is built: percent similarities. Evolutionists often hide behind the idea of percent similarity at the DNA level on a number of issues (ERVs are no exception). However, biologists often use the word similarity in a very different way than the general public perceives it. Biologists have three working definitions for the word similar: similar-similar, similar-dissimilar, and dissimilar-dissimilar. Similar-similar means identical and is like comparing an orange to an orange. Similar-dissimilar means that there are slight differences, but it is mostly identical, like comparing an orange to a lemon (i.e., theyre both citrus). Dissimilar-dissimilar means that there are no identical regions and that it is completely different, like comparing an orange to an apple. The analogy of different fruits works in a common understanding of percent similarity, but it breaks down horribly at the DNA level because these different kinds of ...
S small little boy - Story Worldwide - Home. World Plus Med Online Pharmacy specialize in supplying generic medecines. World Plus Med Online Pharmacy is the great deals on your pills and fast shipping.
ZAŠTITA OSOBNIH PODATAKA I PRIVATNOSTI GRADSKOG DRUŠTVA CRVENOG KRIŽA KNIN Dana 25. svibnja 2018. godine u Republici Hrvatskoj stupaju na snagu Uredba (EU) 2016/679 Europskog parlamenta i Vijeća od 27. travnja 2016. o zaštiti pojedinaca u vezi s obradom osobnih podataka i o slobodnom kretanju takvih podataka te o stavljanju izvan snage Direktive 95/46/EZ (Opća uredba o zaštiti podataka) te Zakon o provedbi Opće uredbe o zaštiti podataka (NN broj 42/18). Voditelj obrade osobnih podataka: Hrvatski Crveni križ, Gradsko društvo Crvenog križa Knin fra. Filipa Grabovca 1,22 300 Knin Telefon: 022/ 662-019 e-mail: [email protected] Izjava o obradi i zaštiti osobnih podataka Gradskog društva Crvenog križa Knin odnosi se na zaštitu i obradu osobnih podataka i privatnosti fizičkih osoba korisnika usluga Gradskog društva Crvenog križa Knin, fizičkih osoba, sudionika i korisnika usluga programa i projekata financiranih iz fondova Europske unije i proračuna Republike Hrvatske koje provodi ...
Next click on Cluster Analysis, set your threshold and click Start. You will now see a cluster analysis processing job in your work list and can monitor its progress. The time it takes to complete the analysis will depend on the number of items in your case. Typically this goes pretty quick. To give you a benchmark I have a demo case with approximately 6,000 items in it and clustering takes about 5 minutes to complete.. Analyzing Results So what does this thing do??? Cluster analysis will identify groups, or clusters, of documents with similar content. For every cluster there will be a Pivot document which is like the root of the cluster and each similar item in the cluster will be given a Percent Similarity score. This Similarity to Pivot score tells you how similar the item is in relation to the pivot document. Another key feature of cluster analysis is that it will also identify email threads or conversations. After cluster analysis is performed the results can be viewed in the ...
Europes small-scale wine producers, usually in competition with one another, have come together to fight what they see as the two biggest threats to their industry: the EU and multinational corporations.
New Order - Primitive Notion Lyrics. It doesnt take a lot to confuse me Im not aware of the passing of time And Id like to say to those who accuse me Could you do it while yo
WASHINGTON - U.S. service firms grew at a faster pace in May, driven by a jump in new orders. But a measure of hiring showed companies added fewer jobs.The Institute for Supply Management said Wednesd...
2G BIO-ENERGIETECHNIK AG (FRA:2GB) 2G Energy AG: New order intake up by more than 20 % in Q2 to EUR 47.8 million, Informations réglementées, informations financières, directive transparence
New Order - Close Range (tradução) (música para ouvir e letra da música com legenda em português)! By 4 OClock (Its gonna change) / You were pretty high (Its gonna change) / Right on the floor (Its gonna change) / Looking at the sky (Its gonna change)
TEMPE, Ariz., March 1, 2017 /PRNewswire/ -- PMI® at 57.7%; February Manufacturing ISM® Report On Business®; New Orders, Production and Employment Growing;...
Demonstration: computing areas between all molecules in large complexes, RNA polymerase 1k83. Human ribosome 4v6x. Graph of all contact areas between 87 molecular components takes 8 seconds ...
RRBP1 - RRBP1 (untagged)-Human ribosome binding protein 1 homolog 180kDa (dog) (RRBP1), transcript variant 1 available for purchase from OriGene - Your Gene Company.
For IE6, press ALT+V → X → (G) max. (L) large (M) medium (S) small (A) min. to choose a font size. For IE7 or Firefox, press Ctrl+ (+) or (-) to change the font size ...
Today, I noticed that the longer I work from home, the more inclined my mother is to interrupting it every five or ten minutes. She says I can...
Phylogenetic relationships between 19 environmental Basidiomycete sequences recovered from a maple-dominated hardwood site (Site D,
US factory activity increased more than expected in December, boosted by a surge in new orders growth, in a further sign of strong economic momentum at the end
As of now you can pick up (new) orders in a DPD Pickup parcelshop again. Bear in mind that not all collection points will be open for business yet due to corona. Brouwland works with an adjusted level of staffing to protect its workforce and the society. We do our utmost to deliver all orders as soon as possible. At the moment, however, please take into account a delay of 4 days. We will keep you informed when this changes.. ...
Heterotrophic flagellates play fundamental roles in marine ecosystems as picoplankton grazers. This recognized importance contrasts with our ignorance of the taxonomic composition of this functional group, which remains mostly unidentified by microscopical and culturing approaches. Recent molecular marine surveys based on 18S rDNA genes have retrieved many sequences unrelated to cultured organisms and marine stramenopiles were among the first reported uncultured eukaryotes. However, little is known about the organisms corresponding to these sequences. Here we determine the abundance of several marine stramenopile lineages in surface marine waters using molecular probes and fluorescent in situ hybridization. We show that these protists are free-living bacterivorous heterotrophic flagellates. They were widely distributed, occurring in the five world oceans, and accounted for a significant fraction (up to 35%) of heterotrophic flagellates in diverse geographic regions. A single group, MAST-4, ...
Definition of saccharomycetaceae in the Definitions.net dictionary. Meaning of saccharomycetaceae. What does saccharomycetaceae mean? Information and translations of saccharomycetaceae in the most comprehensive dictionary definitions resource on the web.
Pertschy B., Schneider C., Gnadig M., Schafer T., Tollervey D., Hurt E.. Many RNA nucleases and helicases participate in ribosome biogenesis, but how they cooperate with each other is largely unknown. Here we report that in vivo cleavage of the yeast pre-rRNA at site D, the 3-end of the 18 S rRNA, requires functional interactions between PIN (PilT N terminus) domain protein Nob1 and the DEAH box RNA helicase Prp43. Nob1 showed specific cleavage on a D-site substrate analogue in vitro, which was abolished by mutations in the Nob1 PIN domain or the RNA substrate. Genetic analyses linked Nob1 to the late pre-40 S-associated factor Ltv1, the RNA helicase Prp43, and its cofactor Pfa1. In strains lacking Ltv1, mutation of Prp43 or Pfa1 led to a striking accumulation of 20 S pre-rRNA in the cytoplasm due to inhibition of site D cleavage. This phenotype was suppressed by increased dosage of wild-type Nob1 but not by Nob1 variants mutated in the catalytic site. In ltv1/pfa1 mutants the 20 S pre-rRNA was ...
Starobogatov, Y. I. (1995). The position of flagellated protists in the system of lower eukaryotes. In: The biology of free-living heterotrophic flagellates (ed. S.A. Karpov), Cytology, 37 (11): 1030-7, [29]. Also in: Abstracts of the Second International Symposium on the Biology of Free-living Heterotrophic Flagellates: 14th - 20th August 1994 - St. Petersburg, Russia. Europ. J. Protistol. 31, 109-118, [30].. Eukaryota. ...
Issatchenkia orientalis ATCC ® 6258™ Designation: [ATCC 749, CBS 573, CCRC 20514, IFO 1064, IFO 1395, JCM 1609, NRRL Y-413, NRRL Y-7179] Application: Assay of itraconzaole Assay of ketoconazole Quality control Quality control strain Sterility testing Susceptibility disc testing Susceptibility testing Quality control strain for API products Antifungal susceptibility testing Ref Ref
Issatchenkia orientalis ATCC ® 6258™ Designation: [ATCC 749, CBS 573, CCRC 20514, IFO 1064, IFO 1395, JCM 1609, NBRC 1395, NRRL Y-413, NRRL Y-7179] Application: Assay of itraconzaole Assay of ketoconazole Quality control Quality control strain Sterility testing Susceptibility disc testing Susceptibility testing Quality control strain for API products Antifungal susceptibility testing Ref   Ref
Graph and download economic data for Current New Orders; Diffusion Index for New York (NOCDINA066MNFRBNY) from Jul 2001 to Jan 2020 about diffusion, new orders, orders, NY, new, manufacturing, and indexes.
Moradian N, Ochs HD, Sedikies C, Hamblin MR, Camargo CA Jr, Martinez JA, Biamonte JD, Abdollahi M, Torres PJ, Nieto JJ, Ogino S, Seymour JF, Abraham A, Cauda V, Gupta S, Ramakrishna S, Sellke FW, Sorooshian A, Wallace Hayes A, Martinez-Urbistondo M, Gupta M, Azadbakht L, Esmaillzadeh A, Kelishadi R, Esteghamati A, Emam-Djomeh Z, Majdzadeh R, Palit P, Badali H, Rao I, Saboury AA, Jagan Mohan Rao L, Ahmadieh H, Montazeri A, Fadini GP, Pauly D, Thomas S, Moosavi-Movahed AA, Aghamohammadi A, Behmanesh M, Rahimi-Movaghar V, Ghavami S, Mehran R, Uddin LQ, Von Herrath M, Mobasher B, Rezaei N. ...
INGETEAM has received a new order from Italian company MER-MEC. For the second time, both companies will co-operate in the supply of traction systems for special vehicles. INGETEAM will design and supply the traction system for a new diagnostic vehicle for 3 kVdc and 25 kV ac. The traction soultion will be based on an INGETRAC Low Power converter module.. To succesfully meet customer expectations, INGETEAM will adapt the equipment to be fitted on a reduced space and will deliver a traction solution that will bring to the vehicle the versatility required by the market, by being adapted to different voltages.. ...
Graph and download economic data from Jan 1954 to Dec 1963 about diffusion, new orders, 1-month, orders, durable goods, new, Net, goods, manufacturing, industry, indexes, and USA.
We are currently accepting new orders, but because of high order volume and COVID-19 safety measures on-site, we have limited the number of new orders we will accept each day. Once our daily limit is reached, we will begin taking new orders the following day at 8:30 AM CT. ...
Memories of a 1950s small town family, as seen through the eyes of a little girl who doesnt miss anything, characters you want to hug, and those you want to smack. A mother fights to have her own voice in a time only the mans opinion counted.
But our most first download electron belongs that, mental to defects, technologies were more permanently been and put by oral scientists than noted. Although they together here resolved sequences of project, sources here shifted the epidemiology for a s small agrave. But from the download electron backscatter diffraction in materials mood, they tried also in a product in which consumers of justification within the ontological quot converted finding more local, interesting and indeterminate.
Kaj se zgodi pri darovanju krvne plazme? Pri darovanju krvne plazme, potuje kri preko igle v sterilnem, zaprtem, enocevnem sistemu na aparat za odvzem krvne plazme, kjer se kri filtrira in centrifugira, s tem procesom dosežemo, da se glavni sestavni deli krvi ločijo od plazme. Plazma teče v vrečo za plazmo, nakar se izmenično kri vrne nazaj po sistemu preko igle v žilo. Darovana količina plazme je odvisna od teže darovalca. Darovanje traja približno 45 minut. Kdo vse lahko daruje krvno plazmo?. Vsak človek, ki je dopolnil 18 let in ni starejši od 60 let ter ima vsaj 50kg in ne več kot 150kg ter je telesno in psihično sposoben za darovanje. O sposobnosti za darovanje presodi zdravnik. Kako pogosto se lahko daruje krvna plazma?. Darovanje krvne plazme bistveno ne vpliva na telo, zato lahko v enem letu darujemo 50 krat. Vendar je potrebno upoštevati predpise o darovanju. Med dvemi darovanji mora preteči 72ur, v enem tednu lahko darujete do 2 krat, v dveh tednih 3 krat in v enem ...
The best economic data site with over 400,000 series. Users have the ability to make their own custom charts, XY plots, regressions, and get data in excel files, or in copy & paste format for dumping to other computer programs
The best economic data site with over 400,000 series. Users have the ability to make their own custom charts, XY plots, regressions, and get data in excel files, or in copy & paste format for dumping to other computer programs
Kričala Samantha na toho sexy blonďáčika v Sexe v Meste. Kubrick) 1965: Čo nového, mačička? Na krížovej výprave voči módu Capture the Babe si nevšimne, že sex je aj v Dragon mimozrkadlom našej generácie a vypovedá aj zemského lesbického sexu.
Shukri al-Kuwatli (es); Choukri al-Kouatli (fr); Şükrü el Kuvvetli (tr); Choukri al-Kuwatli (hr); Choukri al-Kuwatli (it); Choukri al-Kuwatli (nl); Shukri al-Kuwatli (ast); Аль-Куатли, Шукри (ru); Shukri al-Kuwatli (qu); Schukri al-Quwatli (de); Shukri al-Quwatli (pt); Shukri al-Quwatli (ga); شکری قوتلی (fa); 舒克里·库阿特利 (zh); Shukri al-Quwatli (en); შუქრი კუათლი (ka); شکری القوتلی (ur); Shukri al-Quwatli (pt-br); Shukri al-Quwatli (sco); Shukri al-Quwatli (sv); Szukri al-Kuwatli (pl); שוכרי אל-קוותלי (he); Şükri əl-Qüvvətli (az); Shukri al-Quwatli (ms); Shukri al-Kuwatli (hu); シュクリー・アル=クーワトリー (ja); Shukri al-Quwatli (ca); Куатли Шукри (kk); شكري القوتلي (ar); Syukri al-Quwatli (id); شكري القوتلي (aeb-arab) politico siriano (it); personnalité politique syrien (fr); politikari siriarra (eu); políticu siriu (ast); polític sirià (ca); syrischer ...
Advances in Computer Science and Information Technology (ACSIT) p-ISSN: 2393-9907; e-ISSN: 2393-9915; Volume 3, Issue 2; January-March, 2016, pp. 104-109 © Kri…
Spano, F.; Putignani, L.; McLauchlin, J.; Casemore, D.P.; Crisanti, A., 1997: PCR-RFLP analysis of the Cryptosporidium oocyst wall protein (COWP) gene discriminates between C. wrairi and C. parvum, and between C. parvum isolates of human and animal origin
Epizootic shell disease (ESD) is a recently described form of shell disease affecting the American lobster (Homarus americanus, H. Milne Edwards). The disease has caused serious losses to the American lobster fishery. Affected lobsters are unmarketable as a result of the severe biofouling present on the carapace surface. Eukaryotic micro- and macro-organisms have been observed in ESD lesions, but their identity and the extent of their presence has not been determined. We amplified 18S rRNA gene sequences from eukaryotic communities in ESD lesions and separated them for sequencing using denaturing gradient gel electrophoresis. The diversity of the eukaryotic communities was surprisingly high, with as many as 7 different organisms detected in a number of lesions. The eukaryotes identified belonged to broad taxa, including Metazoa, Protozoa, and Fungi. Some organisms were detected in a number of samples and may have a specific role in ESD lesion development and biofouling, including the nematode
The near-atomic structure of the Chaetomium thermophilum 90S preribosome explains how assembly factors and pre-rRNA guide folding of pre-40S domains and suggests a proofreading model for the 90S-pre-40S transition. The 40S small ribosomal subunit is cotranscriptionally assembled in the nucleolus as part of a large chaperone complex called the 90S preribosome or small-subunit processome. Here, we present the 3.2-Å-resolution structure of the Chaetomium thermophilum 90S preribosome, which allowed us to build atomic structures for 34 assembly factors, including the Mpp10 complex, Bms1, Utp14 and Utp18, and the complete U3 small nucleolar ribonucleoprotein. Moreover, we visualized the U3 RNA heteroduplexes with a 5′ external transcribed spacer (5′ ETS) and pre-18S RNA, and their stabilization by 90S factors. Overall, the structure explains how a highly intertwined network of assembly factors and pre-rRNA guide the sequential, independent folding of the individual pre-40S domains while the RNA regions
Offered by 圣彼得堡国立大学. Life on Earth appears to be dominated by higher plants and animals. Yet an immense variety of microbial eukaryotes swarm in the foliage, grass, soil, bogs, ponds, streams, lakes, and oceans. These inconspicuous organisms are flagellates, algae, ciliates, sarcodines, slime molds, apicomplexans. This assemblage is generally termed the protists. Our course is to build a comprehensive picture of protistan diversity. The major steps of eukaryotic evolution will be in focus. By tracking phylogenetic affinities in protistan lineages we will elucidate the major branches on the tree of eukaryotic life. Many protists are unicellular. This single cell is simultaneously a self-sufficient organism, which is able to sense, move, feed, and repulse an attack on its own. Therefore, protistan cells often demonstrate greater complexity of organelles, structures, and controls than the specialized cells of metazoan animals and higher plants. We will explore how free-living and
A sequence-specific modification of the human 5.8 S rRNA in isolated 60 S subunits, non-programmed 80 S ribosomes and ribosomes complexed with mRNA and tRNAs was studied with the use of a derivative of the nonaribonucleotide UCUGUGUUU bearing a perfluorophenylazide group on the C-5 atom of the 5′-terminal uridine. Part of the oligonucleotide moiety of the derivative was complementary to the 5.8 S rRNA sequence ACACA in positions 82-86 flanked by two guanines at the 5′-terminus. The target for the cross-linking was identified as nucleotide G89 on the 5.8 S RNA. In addition, several ribosomal proteins were modified by the oligonucleotide derivative bound to the 5.8 S rRNA and proteins L6 and L8 were among them. Application of these results to known cryo-electron microscopy images of eukaryotic 60 S subunits made it possible to suggest that the central part of the 5.8 S rRNA containing the sequence 82-86 and proteins L6 and L8 are located at the base of the L1 stalk of the 60 S subunit. The ...
Allen Institute for Brain Science Announces First Comprehensive Gene Map of the Human Brain The Allen Human Brain Atlas reveals more than 90 percent similarity among humans and details genes at work
Flesh Consumed New Order Of Intelligence Lyrics. New Order Of Intelligence lyrics performed by Flesh Consumed: Machines target their creator for extinction Gears of automated
Systematic hypotheses for Ulvaceae were tested using sequences for the chloroplast gene encoding the large subunit of RUBISCO (rbc L) and nuclear small subunit ribosomal DNA (18S rDNA). Ulvaceae sensu Floyd and OKelly ...
This epidsode will address our procrastination in making that change that we KNOW will improve our lives. Get up, get out and get moving. Girl in town visits Sea Girt, New Jersey - the shore!
Buy Album CDs New Order and get the best deals at the lowest prices on eBay! Great Savings & Free Delivery / Collection on many items
A New Order Rises Poem by Vision Ghost. Read Vision Ghost poem:This damned determination as my rebellion is strong I can crush you with this voice without fist or spear No more can I induce of your lies and deceit.
Angiogenin is a potent angiogenic protein whose inhibition is known to prevent human tumor growth in athymic mice. It is secreted by both tumor and normal cells; and interacts with endothelial and smooth muscle cells to induce a wide range of cellular responses including cell migration and invasion, …
Blaž Nardin, Boštjan Žagar, Andrej Glojek, Dejan Križaj, Adaptive system for electrically driven thermoregulation of moulds for injection moulding, J. mater. process. technol., vol. 187-188, str. 690-693, 12. jun. 2007. [COBISS.SI-ID 13822261],. Dejan Križaj, Iztok Mihevc, Prenosni merilni sistem za merjenje pospeškov, Šport (Ljublj.), letn. 55, št. 4, str. 58-64, 2007. [COBISS.SI-ID 3223729]. Boštjan Žagar, Blaž Nardin, Dejan Križaj, Gašper Gantar, System for electricaly driven thermoregulation of moulds for injection moulding, V: Conference proceedings, Karl Kuzman, ur., Celje, TECOS, Slovenian Tool and Die Development Centre, 2007, str. 197-202. [COBISS.SI-ID 10187035] Boštjan Žagar, Blaž Nardin, Andrej Glojek, Dejan Križaj, Adaptivni sistem za temperiranje orodij za brizganje plastike s pomočjo termoelektričnih modulov, V: Rast obsega - potrebni pogoj za uspeh : dobavitelj - kupec - orodjar : zbornik posvetovanja, Portorož, 10.-12. oktober 2006, Andrej Polajnar, ...
Blaž Nardin, Boštjan Žagar, Andrej Glojek, Dejan Križaj, Adaptive system for electrically driven thermoregulation of moulds for injection moulding, J. mater. process. technol., vol. 187-188, str. 690-693, 12. jun. 2007. [COBISS.SI-ID 13822261],. Dejan Križaj, Iztok Mihevc, Prenosni merilni sistem za merjenje pospeškov, Šport (Ljublj.), letn. 55, št. 4, str. 58-64, 2007. [COBISS.SI-ID 3223729]. Boštjan Žagar, Blaž Nardin, Dejan Križaj, Gašper Gantar, System for electricaly driven thermoregulation of moulds for injection moulding, V: Conference proceedings, Karl Kuzman, ur., Celje, TECOS, Slovenian Tool and Die Development Centre, 2007, str. 197-202. [COBISS.SI-ID 10187035] Boštjan Žagar, Blaž Nardin, Andrej Glojek, Dejan Križaj, Adaptivni sistem za temperiranje orodij za brizganje plastike s pomočjo termoelektričnih modulov, V: Rast obsega - potrebni pogoj za uspeh : dobavitelj - kupec - orodjar : zbornik posvetovanja, Portorož, 10.-12. oktober 2006, Andrej Polajnar, ...
This page is a Tree of Life Branch Page.. Each ToL branch page provides a synopsis of the characteristics of a group of organisms representing a branch of the Tree of Life. The major distinction between a branch and a leaf of the Tree of Life is that each branch can be further subdivided into descendent branches, that is, subgroups representing distinct genetic lineages.. For a more detailed explanation of the different ToL page types, have a look at the Structure of the Tree of Life page.. close box ...
James,T.Y., Letcher,P.M., Longcore,J.E., Mozley-Standridge,S.E., Porter,D., Powell,M.J., Griffith,G.W. and Vilgalys,R.. (2006) Mycologia 98:(6)860-871 ...
InterPro provides functional analysis of proteins by classifying them into families and predicting domains and important sites. We combine protein signatures from a number of member databases into a single searchable resource, capitalising on their individual strengths to produce a powerful integrated database and diagnostic tool.
Despite violence against them, representatives of Turkey's small Catholic minority insist they'll resist intimidation and are counting on the Islamist government to provide protection. 
The nation’s small businesses can expect a wave of capital from a new generation of investors following the launch of a campaign to more than double the number of active angels backing UK firms by 2019.
Persoonia aims to publish papers dealing with molecular phylogeny and evolution of fungi. A further aim is to promote fungal taxonomy by employing a polythetic approach to clarify the true phylogeny and relationships within the kingdom Fungi. The journal publishes high-quality papers elucidating known and novel fungal taxa at the DNA level, and also strives to present novel insights into evolutionary processes and relationships. Papers to be considered include research articles and reviews ...
Persoonia aims to publish papers dealing with molecular phylogeny and evolution of fungi. A further aim is to promote fungal taxonomy by employing a polythetic approach to clarify the true phylogeny and relationships within the kingdom Fungi. The journal publishes high-quality papers elucidating known and novel fungal taxa at the DNA level, and also strives to present novel insights into evolutionary processes and relationships. Papers to be considered include research articles and reviews ...
Mycocosm Portal version:12.122 jgi-myco-web-4.nersc.gov Release Date:14-Sep-2020 17:09:45 PST Current Date:29-Sep-2020 22:59:33.52 PDT ...
They are University of Toronto alumni, faculty and honorary grads - writers, doctors, lawyers, philanthropists and scholars. Now, they are also some of the countrys newest recipients of the Order of Canada.
Australian manufacturer Tritium announced a second order for ultra-fast DC fast chargers (up to 350 kW) from IONITY in Europe (for a total at least of 220 stations).
This is a rather homespun comic-satire on everyday life in Red China (as against his first two novels which had a San Francisco Chinatown setting).
The Manufacturers Shipments, Inventories, and Orders report shows a -0.5% new orders decrease for June. The last three of four months in manufacturing new orders have shown declines. May revised down, from +0.7% to +0.5%. This Census statistical release is called Factory Orders by the press and covers both durable and non-durable manufacturing orders, shipments and
Purchasing managers index will boost hopesWashington - U.S. manufacturing grew for the first time in four months, buoyed by a jump in new orders
Virus človeške imunske pomanjkljivosti (HIV) se nahaja v telesnih tekočinah. V krvi, spermi, predsemenski tekočini, izločkih nožnice/materničnega vratu in v mleku se nahaja v takšni količini, da je okužba možna ne le pri analnem in vaginalnem seksu, temveč tudi pri oralno-genitalnem odnosu.. V slini, solzah in seču se nahaja v bistveno manjši količini, zato po dosedaj znanih podatkih okužba z izmenjavo omenjenih telesnih tekočin ni zabeležena. Nevarnost za prenos virusa z omenjenimi telesnimi tekočinami (slina, seč) bi obstajala le v primeru, da se v njih nahaja kri. HIV se ne prenaša s poljubljanjem, vzajemnim masturbiranjem, objemanjem, pitjem iz iste skodelice, z souporabo posteljnjine ali brisače.. Pri 50 do 90% okuženih se prvi simptomi in znaki HIV okužbe pokažejo kot akutni HIV sindrom. Od rizičnega dogodka do pojava akutnega HIV sindroma običajno mine 1- do 6-tednov. Težave, ki jih navajajo okuženi so lahko zelo različne, od blagih, podobnih prehladu z ...
Pedagogu profesionālās pilnveides kursi Teātra mākslas pamati skolotājiem (24 stundas) - lektore Inga Krišāne 28.09.plkst.10.00 15.10. plkst.10.00. 23.11. plkst.10.00. 21.12. plkst. 10.00. Pieteikties šeit!. Pedagogu profesionālās pilnveides kursi Mācību stundu plānošana matemātikā jaunā mācību satura kontekstā (24 stundas) - lektori J. Vilciņš, G. Lāce, L. Zinberga,. ...
Zajedavske stenice dosežejo med 4 in 12 mm v dolžino ter imajo reducirana krila. Vse so rjavo obarvane, večinoma ponoči aktivne živali s sploščenim ovalnim telesom, ki se podnevi skrivajo v različnih špranjah, ponoči (predvsem tik pred zoro) pa prilezejo na plano in sesajo kri. Obustni aparat, ki pri večini drugih stenic služi za sesanje rastlinskih sokov, je tu prilagojen za sesanje krvi. Oblikovan je v kljunec (rostrum), znotraj katerega potekata dva kanala, enako kot pri ostalih vrstah. Razlika je v tem, da eden od njiju namesto za izločanje prebavnih sokov služi izločanju sredstva proti strjevanju krvi in blagega anestetika. Značilen zanje je način oploditve, pri katerem samec s svojim ostrim penisom predre samičin zadek in vnese vanjo spermo mimo običajnih poti oploditve. Domnevajo, da se na ta način delno izogne samičini izbiri samca, saj imajo pri sorodnih žuželkah samice posebne organe za shranjevanje sperme, s katerimi lahko izbirajo, katera bo oplodila jajčeca. ...
Farmaceutisch Analytisch Laboratorium Duiven B.V. (FAL Duiven) was founded in 1982, as a privately owned company and moved to the present purpose built premises in 1997.
"Escherichia coli 16S ribosomal RNA". "Halobacterium salinarum 16S ribosomal RNA". "Homo sapiens 18S ribosomal RNA (nuclear)". ... Small subunit ribosomal ribonucleic acid (SSU rRNA) is the smallest of the two major RNA components of the ribosome. Associated ... "Arabidopsis thaliana 16S ribosomal RNA (chloroplast)". Woese CR, Kandler O, Wheelis ML (June 1990). "Towards a natural system ... LSU rRNA: the large subunit ribosomal ribonucleic acid. " ... with a number of ribosomal proteins, the SSU rRNA forms the ...
North Carolina dog' 18S ribosomal RNA gene, partial sequence". 11 January 2001. Retrieved 1 January 2019 - via NCBI Nucleotide ... North Carolina dog' is an unclassified species of Babesia, identified from a 18S ribosomal gene partial sequence performed in ...
"Botryosphaeria rhodina isolate MAMB 05 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal ... RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence". 2004-04-29. Cite ...
These regions code for 5.8S, 18S, and 28S ribosomal RNA. The NORs are "sandwiched" between the repetitive, heterochromatic DNA ... However, it is known that NORs contain tandem copies of ribosomal DNA (rDNA) genes. Some sequences of flanking sequences ... Kupriyanova NS, Netchvolodov KK, Sadova AA, Cherepanova MD, Ryskov AP (2015). "Non-canonical ribosomal DNA segments in the ...
"Torula herbarum strain HBUM07134 18S ribosomal RNA gene, partial seque - Nucleotide - NCBI". www.ncbi.nlm.nih.gov. July 2018. ... "Torula herbarum strain CBS 246.57 large subunit ribosomal RNA gene, pa - Nucleotide - NCBI". www.ncbi.nlm.nih.gov. 2018-11-08 ... ISBN 978-3-319-29135-2. "Torula herbarum isolate KNU17-5 large subunit ribosomal RNA gene, part - Nucleotide - NCBI". www.ncbi. ...
Kudryavtsev A, Bernhard D, Schlegel M, Chao EE, Cavalier-Smith T (August 2005). "18S ribosomal RNA gene sequences of ...
Other markers that can be used are ribosomal RNA genes 16S and 18S. Moreover, sorting invertebrates into different size ...
doi:10.1111/j.1096-3642.1985.tb01802.x. Stock, D. W.; Whitt, G. S. (1992). "Evidence from 18S ribosomal RNA that lampreys and ... Stock, D.W.; Whitt, G.S. (1992). "Evidence from 18S ribosomal RNA sequences that lampreys and hagfishes form a natural group". ...
Kudryavtsev, A.; Bernhard, D.; Schlegel, M.; Chao, E. E.; Cavalier-Smith, T. (2005). "18S ribosomal RNA gene sequences of ...
Researchers investigated gene sequences of the 18S ribosomal RNA gene, common to all cells. The identity of new organisms can ...
Stock, D.; Whitt, G.S. (7 August 1992). "Evidence from 18S ribosomal RNA sequences that lampreys and hagfish form a natural ...
Stock, David; Whitt GS (7 August 1992). "Evidence from 18S ribosomal RNA sequences that lampreys and hagfishes form a natural ...
"Evidence from 18S ribosomal RNA sequences that lampreys and hagfishes form a natural group". Science. 257 (5071): 787-9. doi: ...
Stock, David; Whitt GS (7 August 1992). "Evidence from 18S ribosomal RNA sequences that lampreys and hagfishes form a natural ... Gürsoy, Halil-Cem; Koper, Dorota; Benecke, Bernd-Joachim (May 2000). "The Vertebrate 7S K RNA Separates Hagfish (Myxine ...
Stock, D.; Whitt, G.S. (7 August 1992). "Evidence from 18S ribosomal RNA sequences that lampreys and hagfish form a natural ... The beginning of life may have included self-replicating molecules such as RNA and the assembly of simple cells. In 2016 ... Joyce, Gerald F. (11 July 2002). "The antiquity of RNA-based evolution". Nature. 418 (6894): 214-221. Bibcode:2002Natur.418.. ... so molecular techniques have been used to compare the DNA or RNA of viruses and are a useful means of investigating how they ...
... evidence from nuclear 18S ribosomal RNA gene sequences". Mycologia. 87 (2): 203-209. doi:10.2307/3760906. JSTOR 3760906. James ...
Stock DW, Whitt GS (August 1992). "Evidence from 18S ribosomal RNA sequences that lampreys and hagfishes form a natural group ... Stock DW, Whitt GS (August 1992). "Evidence from 18S ribosomal RNA sequences that lampreys and hagfishes form a natural group ... Mallatt J, Sullivan J (December 1998). "28S and 18S rDNA sequences support the monophyly of lampreys and hagfishes". Molecular ...
Berbee, Mary L.; Taylor, John W. (1992-03-01). "18S Ribosomal RNA gene sequence characters place the human pathogenSporothrix ... White, T.J.; Bruns, T.; Lee, S.; Taylor, J. (1990), "Amplification and Direct Sequencing of Fungal Ribosomal RNA Genes for ... inferred from the internal transcribed spacers of ribosomal DNA". Molecular Biology and Evolution. 9 (4): 636-653. doi:10.1093/ ...
A binding site for RNA polymerase *RNA polymerase I: transcribes genes encoding 18s 5.8s 28s ribosomal RNA ... RNA polymerase III: transcribes genes encoding transfer RNA, 5s ribosomal RNAs and other small RNAs ... RNA polymerase II: transcribes genes encoding messenger RNA and certain small nuclear RNAs and microRNA ... For transcription to take place, the enzyme that synthesizes RNA, known as RNA polymerase, must attach to the DNA near a gene. ...
"Homo sapiens 18S ribosomal RNA". National Center for Biotechnology Information. "Homo sapiens 5S ribosomal RNA". National ... "Homo sapiens 28S ribosomal RNA". National Center for Biotechnology Information. "Homo sapiens 5.8S ribosomal RNA". National ... and via 30S to 18S, as shown in the diagram. 18S is a component of the ribosomal 40S subunit. 28S, 5.8S and 5S, which is ... Prokaryotic and eukaryotic ribosomes both contain a scaffold of ribosomal RNA (rRNA) on which are arrayed an extensive variety ...
Comparison of 18S ribosomal RNA sequences indicated that pterobranchs are closely related to enteropneust hemichordates. Class ... 1995). "The Phylogenetic Position of the Pterobranch Hemichordates Based on 18S rDNA Sequence Data". Molecular Phylogenetics ...
"New hosts of Simplicimonas similis and Trichomitus batrachorum identified by 18S ribosomal RNA gene sequences". Journal of ...
"Molecular Phylogeny of Labyrinthulids and Thraustochytrids Based On the Sequencing of 18s Ribosomal Rna Gene". Journal of ...
"Analysis of Environmental 18S Ribosomal RNA Sequences reveals Unknown Diversity of the Cosmopolitan Phylum Telonemia". Protist ... Shalchian-Tabrizi et al say that 18S rDNA sequences in the phylum formed two major groups, Group 1 and 2, including T. subtilis ... "Telonemia-specific environmental 18S rDNA PCR reveals unknown diversity and multiple marine-freshwater colonizations". BMC ...
The phylogenetic tree of the Sternorrhyncha is inferred from analysis of small subunit (18S) ribosomal RNA. The phylogenetic ...
... based on nuclear 18S ribosomal RNA sequences" (PDF). Molecular Phylogenetics and Evolution. 32 (3): 770-777. doi:10.1016/j. ...
Phylogenetic analysis based on 18S ribosomal RNA gene sequences supports the existence of class Polyacanthocephala ( ...
Phylogenetic analysis using the 18S ribosomal RNA demonstrated the affinity of the species to the genus. Frolov also argued ...
Dugesiidae and Geoplanidae share a duplication of the cluster that codifies for the 18S ribosomal RNA. Phylogenetic supertree ...
... preliminary evidence from the 18S ribosomal RNA gene" (PDF). Berliner Paläobiologische Abhandlungen. 3: 253-260. Strugnell, J ...
DU-DC2 18S ribosomal RNA genes, partial sequence. *AH009061.2Rhizophydium sp. UGA-F15 18S ribosomal RNA genes, partial sequence ... JEL183 18S ribosomal RNA genes, partial sequence. *AH009065.2Physocladia obscura strain JEL137 18S ribosomal RNA genes, partial ... Fungi 18S ribosomal RNA genes, partial sequence. Fungi 18S ribosomal RNA genes, partial sequence.. PopSet: 1032519594 ... AH009069.2Cunninghamella elegans 18S ribosomal RNA genes, partial sequence. *AH009068.2Catenaria anguillulae strain JEL194 18S ...
18S ribosomal RNA (abbreviated 18S rRNA) is a part of the ribosomal RNA. The S in 18S represents Svedberg units. 18S rRNA is an ... 18S rRNA is the eukaryotic cytosolic homologue of 16S ribosomal RNA in prokaryotes and mitochondria. The genes coding for 18S ... The 18S gene is part of the ribosomal functional core and is exposed to similar selective forces in all living beings. Thus, ... SSU rRNA, a component of the eukaryotic ribosomal small subunit (40S). 18S rRNA is the structural RNA for the small component ...
RNA, 18S ribosomal is a protein that in humans is encoded by the LOC109910383 gene. "Human PubMed Reference:". National Center ... "Entrez Gene: RNA, 18S ribosomal". Retrieved 2017-06-08. CS1 maint: discouraged parameter (link) v t e. ...
ASM journals are the most prominent publications in the field, delivering up-to-date and authoritative coverage of both basic and clinical microbiology.. About ASM , Contact Us , Press Room. ASM is a member of. ...
A physical map of the 5S and 18S-26S rRNA genes was determined using bi-color fluorescence in situ hybridization technique in A ... Genome differentiation inAegilops. 2. Physical mapping of 5S and 18S-26S ribosomal RNA gene families in diploid species.Genome ... Physical mapping of 5S and 18S-26S ribosomal RNA gene families inAllium victorialis var.platyphyllum ... Detection of ribosomal RNA genes in soybean,Glycine max (L.) Merr., byin situ hybridization.Genome 32: 1091-1095.Google Scholar ...
18S ribosomal RNA is a widely used control for qRT-PCR analyses because of its invariant expression across tissues, cells, and ... Why is 18S ribosomal RNA (rRNA) used as a housekeeping gene to normalize sample-to-sample, systematic variation in qPCR assays ... However, due to its extremely high expression in most cell types, it can sometimes be challenging to use 18S rRNA as an ...
Haptophyte Diversity and Vertical Distribution Explored by 18S and 28S Ribosomal RNA Gene Metabarcoding and Scanning Electron ... Total RNA/cDNA was amplified by haptophyte‐specific primers targeting the V4 region of the 18S, and the D1‐D2 region of the 28S ... The 18S rRNA data set also contained OTUs assigned to eight supported and defined clades consisting of environmental sequences ... Our results contribute to link morphological and molecular data and 28S to 18S rRNA gene sequences of haptophytes without ...
Phylogenetic analysis based on 18S ribosomal RNA gene sequences supports the existence of class Polyacanthocephala ( ... Phylogenetic analysis based on 18S ribosomal RNA gene sequences supports the existence of class Polyacanthocephala ( ... We sequenced the near complete 18S rRNA gene of Polyacanthorhynchus caballeroi (Polyacanthocephala) and Rhadinorhynchus sp. ( ...
... Abstract. We present the first report of the ... The transcribed 18S and 25S rDNA [ver mas...] We present the first report of the transcribed 18S-25S ribosomal DNA (rDNA) unit ... The transcribed 18S and 25S rDNA genes of yerba mate are the first in the genus to be characterized, combined with the 5.8S ... transcribed 18S-25S ribosomal DNA (rDNA) unit of the South American crop Ilex paraguariensis. This tree is consumed as an ...
RNA, Ribosomal, 18S/genetics. *Turtles/parasitology*. Substance. *RNA, Ribosomal, 18S. LinkOut - more resources. Full Text ... and by the partial 18S rDNA sequence analysis of the DNA isolated from organs of the experimentally infected animals and from a ...
The expression of 18S ribosomal RNA was used as an internal control. The primers used were XBP1u; forward; GGATCCTGACGAGGTTCCAG ... TCGCTTCCACAGCTGCCTGA and 18S ribosomal RNA; forward; GGGAGCCTGAGAAACGGC, reverse; GGGTCGGGAGTGGGTAATTTT.. Statistical analysis ... were determined by quantitative RT-PCR using the High Capacity RNA to cDNA Master Mix (Applied Biosystems, Foster City, CA) and ...
PCR amplification and phylogenetic analysis of 18S rRNA gene and ITS. The 18S ribosomal RNA (18S rRNA) gene and the internal ... For molecular characterization, 18S ribosomal RNA (rRNA) gene, the internal transcribed spacer (ITS) and 8 maxicircle DNA ... aNAD7, NADH-dehydrogenase subunit 7; Cox2, Cytochrome oxidase subunit 2; A6, ATPase subunit 6; 12S rRNA, 12S ribosomal RNA; ND7 ... 12S ribosomal RNA (12S rRNA; 1597 bp in T. b. brucei GUTat3.1 strain and T. equiperdum STIB818 strain, 1415 bp in T. equiperdum ...
40S ribosomal protein S3. D. 243. Homo sapiens. Mutation(s): 0 Gene Names: RPS3, OK/SW-cl.26. EC: ... 40S ribosomal protein S4, X isoform. E. 263. Homo sapiens. Mutation(s): 0 Gene Names: RPS4X, CCG2, RPS4, SCAR. ... 40S ribosomal protein S6. G. 249. Homo sapiens. Mutation(s): 0 Gene Names: RPS6, OK/SW-cl.2. ... 40S ribosomal protein S8. I. 208. Homo sapiens. Mutation(s): 0 Gene Names: RPS8, OK/SW-cl.83. ...
18S ribosomal RNA. B [auth 1]. 1800. Saccharomyces cerevisiae S288C. Find similar nucleic acids by: Sequence *100% ... Ribosomal RNA-processing protein 9. OA [auth g]. 573. Saccharomyces cerevisiae S288C. Mutation(s): 0 Gene Names: RRP9, YPR137W ... Ribosomal RNA small subunit methyltransferase NEP1. RA [auth j], SA [auth k]. 252. Saccharomyces cerevisiae S288C. Mutation(s) ... spacer and U3 small nucleolar RNA in providing an intertwined RNA-protein assembly platform for the separate maturation of 18S ...
... mRNA and 18S ribosomal RNA (18S) (ΔCt). On the basis of the Ct values, 18S and GAPDH mRNA expression were stable across the ... RNA isolation and analysis. Total RNA extraction and real-time PCR were performed as described previously (Liu et al., 2014). ... 2009), snap-frozen in liquid nitrogen and stored at −80°C until RNA extraction. ...
18S. 18S ribosomal RNA. DGGE. denaturing gradient gel electrophoresis. EF1α. elongation factor-1, isoform alpha. FBPase. ... An amount of 1 μg of total RNA was used for cDNA synthesis. The NCode™ VILO™ miRNA cDNA Synthesis Kit (Invitrogen) or the ... Relative gene expression of mRNA and miRNA was determined by quantitative real-time RT-PCR on RNAs extracted from whole body ( ... Gene expression analyses were performed on total RNA extracted from whole larval body, sampled 3 h after the last meal. Data ...
RNA, Ribosomal, 18S / genetics* * Species Specificity Substances * DNA, Plant * DNA, Ribosomal * Fluorescent Dyes ... Karyotypes, Heterochromatin, and Physical Mapping of 18S-26S rDNA in Cactaceae Cytogenet Genome Res. 2009;124(1):72-80. doi: ... The locations of the 18S-26S rDNA sites in all species coincided with CMA(+)/DAPI(-) bands; the same occurred with the sizes ...
RNA, Protozoan / genetics* * RNA, Ribosomal, 18S / genetics * RNA, Spliced Leader / genetics* * Sequence Analysis, DNA ... Here we have used PCR-based genotyping of spliced leader RNA gene repeats to analyse several novel species of insect ...
18S/28S ribosomal RNA; LSU/SSU; RNA hybridization; environmental water samples ... RNA Extraction. RNA extraction was done with minor changes to that presented in Kegel et al. [16]. Briefly, acid-washed glass ... akashiwo RNA. Some probes showed no sensitivity below 5 or even 25 ng of RNA, i.e., more than 700 cells are required to get a S ... RNA was fragmented by adding 1/10 volume of RNA fragmentation buffer (100 mM ZnCl2 in 100 mM Tris-HCL, pH 7.0) and an ...
This study aims to discuss the importance of two genes of Theileria annulata 18S ribosomal RNA (18S rRNA) and Theileria ... The 18S rRNA and Tams1 gene sequences were investigated by phylogenetic analysis after DNA extraction, PCR, and DNA sequencing ... Sequence fragments of about 1410 to 1412 bp of the complete 18S rRNA gene and 778 nucleotides of Tams1 gene sequences were used ... The results of the study revealed, the 18S rRNA is informative in estimation of relationships among Theileria species and ...
28S and 18S ribosomal RNAs are shown. (B) Cell extracts prepared from BME cells, incubated in the presence of hVEGF-B186, VEGF ... RNA Preparation, in Vitro Transcription, and Northern Blot Hybridization.. Cytokines were added to confluent monolayers of BME ... RNA integrity and uniformity of loading were determined by staining the filters with methylene blue after transfer and cross- ... Total cellular RNA was prepared after indicated times by using Trizol reagent (Life Technologies, Basel, Switzerland). Northern ...
Saccharomyces cerevisiae strain ALI 308 18S ribosomal RNA gene, partial sequence. 18S ribosomal RNA. AY242063 AY242063 1578bp ...
RNARNA Polymerase II • RNA, Fungal • RNA, RibosomalRNA, Ribosomal, 18SRNA, Ribosomal, 28S • Rosacea • Sequence ... from phylogenetic analyses of three ribosomal RNA- and two protein-coding genes, Mycologia, vol. 98 no. 6 (2006), pp. 1090-1103 ... Ribosomal • DNA, Ribosomal Spacer • Ecosystem • Endonucleases • Eukaryota • Europe • Eurotiales • Evolution, Molecular • Fungal ...
A binding site for RNA polymerase *RNA polymerase I: transcribes genes encoding 18s 5.8s 28s ribosomal RNA ... RNA polymerase III: transcribes genes encoding transfer RNA, 5s ribosomal RNAs and other small RNAs ... RNA polymerase II: transcribes genes encoding messenger RNA and certain small nuclear RNAs and microRNA ... For transcription to take place, the enzyme that synthesizes RNA, known as RNA polymerase, must attach to the DNA near a gene. ...
RNA-sequencing, and other methods. The Ambion® WT Expression Kit for RNA amplification prior to microarray analysis circumvents ... Enrichment of whole transcriptome RNA by depleting ribosomal RNA (rRNA) species using our RiboMinus™ technology has the ... Drosophila 28S ribosomal RNA is processed into 2 fragments that migrate in a similar manner to the 18S rRNA. ... Enrichment of whole transcriptome RNA by depleting ribosomal RNA (rRNA) species using our RiboMinus™ technology has the ...
18S-ribosomal RNA-related sequence 6; Zp1, zona pellucida glycoprotein 1; Lpc1, lipocortin 1; and Pcsk5, proprotein convertase ... DNA and RNA Analyses.. GenBank database searches and nucleotide sequence analysis were performed by using the National Center ... Analysis of gene expression utilized the Human RNA Master Blot and Multiple Tissue Northern blot (CLONTECH) according to ...
Parasite DNA extraction and 18S ribosomal RNA gene PCR. qPCR for P. falciparum 18S ribosomal RNA (18S rRNA) gene was performed ... 18S qPCR targeting ribosomal RNA (18S rRNA) gene confirmed this subject was successfully infected with malaria parasites [29]. ... Parasite RNA extraction and cDNA synthesis. Parasite RNA extraction and cDNA synthesis was performed as previously described [ ... Primers targeting the individual var genes in 3D7 [39] were not used as the amount of parasite RNA material available for ...
Proteins that are stably associated, such as RNA polymerase I subunits and small nuclear ribonucleoprotein particle complexes, ... exit from or accumulate in the nucleolus with similar kinetics, whereas protein components of the large and small ribosomal ... The nucleolus is a key organelle that coordinates the synthesis and assembly of ribosomal subunits and forms in the nucleus ... around the repeated ribosomal gene clusters. Because the production of ribosomes is a major metabolic activity, the function of ...
18S indicates 18S ribosomal RNA. The results are representative of 3 similar experiments. B, Cardiomyocytes were stimulated ...
  • The genes coding for 18S rRNA are referred to as 18S rRNA genes. (wikipedia.org)
  • The small subunit (SSU) 18S rRNA gene is one of the most frequently used genes in phylogenetic studies and an important marker for random target polymerase chain reaction (PCR) in environmental biodiversity screening. (wikipedia.org)
  • Fungi 18S ribosomal RNA genes, partial sequence. (nih.gov)
  • A physical map of the 5S and 18S-26S rRNA genes was determined using bi-color fluorescence in situ hybridization technique in A. victorialis var. (springer.com)
  • Two major loci of the 18S-26S rRNA genes were detected in the secondary constrictions flanking with a pair of satellite and terminal region of short arm in chromosome 4. (springer.com)
  • 1979. Cloning and characterisation of ribosomal RNA genes from wheat and barley. (springer.com)
  • Chromosomal localization of 18S and 5S rRNA genes in garlic, Allium sativum . (springer.com)
  • The transcribed 18S and 25S rDNA genes of yerba mate are the first in the genus to be characterized, combined with the 5.8S that is identical to the consensus sequence of Ilex. (gob.ar)
  • In this study , 18s rDNA , 28s rDNA, and COI genes of 25 stomatopod species from 10 families and four superfamilies were sequenced to build a molecular phylogeny for these stomatopods . (umbc.edu)
  • This study aims to discuss the importance of two genes of Theileria annulata 18S ribosomal RNA (18S rRNA) and Theileria annulata merozoite surface antigen (Tams1) for phylogenetic analysis of molecular data. (ac.ir)
  • Lactose is inhibiting the repressor, allowing the RNA polymerase to bind with the promoter and express the genes, which synthesize lactase. (wikipedia.org)
  • Haplotype network analyses of sequences from 2 P. knowlesi genes, type A small subunit ribosomal 18S RNA and cytochrome c oxidase subunit I, showed 2 genetically distinct divergent clusters, 1 from each of the 2 regions of Malaysia. (cdc.gov)
  • The analysis of chromosomes was performed through Ag-staining, C-banding, chromomycin A3 and DAPI staining, and fluorescent in situ hybridization with ribosomal genes. (biomedsearch.com)
  • These are transcribed by RNA polymerase I. 5S occurs in tandem arrays (~200-300 true 5S genes and many dispersed pseudogenes), the largest one on the chromosome 1q41-42. (bionity.com)
  • Thirty clones derived from twenty isolates of heterotrophic nanoflagellates originating from a variety of marine and freshwater environments were examined by restriction fragment length polymorphism analysis of small subunit ribosomal RNA genes amplified by the polymerase chain reaction (riboprinting). (bioone.org)
  • In this group, the RNA extraction and RT-PCR methods differed, which attested that these genes remained the most reliable whatever the method used to extract the RNA, generate complementary DNA or amplify it. (ersjournals.com)
  • 3) 18s is diluted much more than that of other genes, so it has less inhibitors because of more dilution. (protocol-online.org)
  • An operon is a group of key nucleotide sequences including an operator, a common promoter, and one or more structural genes that are controlled as a unit to produce messenger RNA (mRNA). (statemaster.com)
  • in 1997, based mainly on trees constructed using 18S ribosomal RNA genes. (eol.org)
  • The main function of RNA is to carry information of amino acid sequence from the genes to where proteins are assembled on ribosomes in the cytoplasm . (wikipedia.org)
  • There are a number of RNAs which regulate genes, that is, they regulate the rate at which genes are transcribed or translated. (wikipedia.org)
  • Thus, when the first large-scale phylogenetic studies based on 18S sequences were published (e.g. by Field et al. (wikipedia.org)
  • 18S sequences later provided evidence for the splitting of Ecdysozoa and Lophotrochozoa clades (monophyletic group of organisms composed of a common ancestor and all its lineal descendants), thus contributing to the most recent revolutionary change in our understanding of metazoan relationships. (wikipedia.org)
  • Failure to obtain 18S sequences of single taxa is considered a common phenomenon but is rarely ever reported. (wikipedia.org)
  • 1980. Molecular and chromosomal organization of DNA sequences coding for the ribosomal RNAs in cereals. (springer.com)
  • The 18S rRNA data set also contained OTUs assigned to eight supported and defined clades consisting of environmental sequences only, possibly representing novel lineages from family to class. (uio.no)
  • Our results contribute to link morphological and molecular data and 28S to 18S rRNA gene sequences of haptophytes without cultured representatives, and to improve metabarcoding methodology. (uio.no)
  • Nucleotide sequences of the small subunit ribosomal RNA-encoding gene from Opisthorchis viverrini . (springer.com)
  • Sequence fragments of about 1410 to 1412 bp of the complete 18S rRNA gene and 778 nucleotides of Tams1 gene sequences were used in the analysis of nucleotide diversity. (ac.ir)
  • by using two two \"18S ribosomal RNA\" and \"Theileria annulata merozoite surface antigen\" gene sequences', Archives of Razi Institute , 68(1), pp. 47-52. (ac.ir)
  • Promoters contain specific DNA sequences such as response elements that provide a secure initial binding site for RNA polymerase and for proteins called transcription factors that recruit RNA polymerase. (wikipedia.org)
  • New DNA Sequences ======================= AF548094 AF548094 1693bp linear PLN 04-SEP-2003 Saccharomyces cerevisiae strain ALI 308 18S ribosomal RNA gene, partial sequence. (bio.net)
  • Reverse transcription-polymerase chain reaction (RT-PCR) was used to quantify the levels of MT-III mRNA relative to the levels of three constitutive RNAs: β-actin, glyceraldehyde-3-phosphate dehydrogenase (G3PHD), and ribosomal RNA 18S (rRNA 18S). (springer.com)
  • 5) Ribosomal RNA is resistant to degradation much more than mRNA. (protocol-online.org)
  • After testing numerous candidate mRNAs, the spliced female Pf3D7_0630000 mRNA was selected as a Plasmodium falciparum gametocyte-specific biomarker compatible with Plasmodium 18S rRNA RT-PCR. (biomedcentral.com)
  • PF3D7_0630000 multiplexed with Plasmodium 18S rRNA RT-PCR was more sensitive than other spliced mRNA targets for one-step RT-PCR gametocyte detection. (biomedcentral.com)
  • As non-coding RNA, rRNA itself is not translated into a protein, but it does provide a mechanism for decoding messenger RNA ( mRNA ) into amino acids and interacting with the transfer RNAs ( tRNAs ) during translation by providing peptidyl transferase activity. (newworldencyclopedia.org)
  • The formation of proteins by rRNA, mRNA, and tRNA is remarkably complex, involving transcription of the various RNAs from DNA, the movement of RNA within a cell, different types of rRNA, and the process of assembling the amino acids in a precise order. (newworldencyclopedia.org)
  • It is at the site of the ribosome that messenger RNA's (mRNA) code for linking amino acids together to form new proteins and where transfer RNAs (tRNA) transfer specific amino acids to the growing polypeptide chain during the translation of the mRNA into a protein. (newworldencyclopedia.org)
  • This is done by messenger RNA (mRNA). (wikipedia.org)
  • Micro RNAs (miRNA) act by joining an enzyme and blocking mRNA, or speeding its breakdown. (wikipedia.org)
  • In homologous chromosome 4 showing 18S-26S rDNA hybridization signals revealed also distinct CMA, positive band. (springer.com)
  • We present the first report of the transcribed 18S-25S ribosomal DNA (rDNA) unit of the South American crop Ilex paraguariensis. (gob.ar)
  • We screened liver samples from 441 specimens belonging to 20 different species of murine rodents from 2 mountain ranges on Sulawesi, using polymerase chin reaction (PCR) primers targeting the conserved 18S rDNA region across the protozoan class Kinetoplastea. (bioone.org)
  • Transfer RNA (abbreviated tRNA) is a small RNA chain (74-93 nucleotides) that transfers a specific amino acid to a growing polypeptide chain at the ribosomal site of protein synthesis during translation. (statemaster.com)
  • They are transfer RNA (tRNA) and ribosomal RNA (rRNA). (wikipedia.org)
  • Transfer RNA ( tRNA ) is a short molecule of about 80 nucleotides which carries a specific amino acid to the polypeptide chain at a ribosome . (wikipedia.org)
  • Total RNA/cDNA was amplified by haptophyte‐specific primers targeting the V4 region of the 18S, and the D1‐D2 region of the 28S rRNA. (uio.no)
  • We sequenced the near complete 18S rRNA gene of Polyacanthorhynchus caballeroi (Polyacanthocephala) and Rhadinorhynchus sp. (umd.edu)
  • Allodiploid nature of Allium wakegi Araki revealed by genomic in situ hybridization and localization of 5S and 18S rDNAs. (springer.com)
  • Equal blotting was verified by hybridization with the 18S-rRNA probe. (plantphysiol.org)
  • The nucleolus is a key organelle that coordinates the synthesis and assembly of ribosomal subunits and forms in the nucleus around the repeated ribosomal gene clusters. (nature.com)
  • Proteins that are stably associated, such as RNA polymerase I subunits and small nuclear ribonucleoprotein particle complexes, exit from or accumulate in the nucleolus with similar kinetics, whereas protein components of the large and small ribosomal subunits leave the nucleolus with markedly different kinetics. (nature.com)
  • It forms a complex with Nop14p that mediates maturation and nuclear export of 40S ribosomal subunits [ PMID: 12446671 , PMID: 15590835 , PMID: 16159874 ]. (ebi.ac.uk)
  • A Noc complex specifically involved in the formation and nuclear export of ribosomal 40 S subunits. (ebi.ac.uk)
  • While the ribosomal subunits are quite similar between prokaryotes and eukaryotes, the 70S ribosomes contain proportionally more RNA than protein, while the 80S ribosomes are composed of less RNA than protein. (newworldencyclopedia.org)
  • Nucleotide sequence of a crustacean 18s ribosomal RNA gene and secondary structure of eukaryotic small subunit ribosomal RNAs. (springer.com)
  • The small subunit (SSU) processome, a large ribonucleoprotein particle, organizes the assembly of the eukaryotic small ribosomal subunit by coordinating the folding, cleavage, and modification of nascent pre-ribosomal RNA (rRNA). (rcsb.org)
  • A large nucleolar U3 ribonucleoprotein required for 18S ribosomal RNA biogenesis. (ebi.ac.uk)
  • Yamamoto, R. T., Nogi, Y., Dodd, J. A. & Nomura, M. RRN3 gene of Saccharomyces cerevisiae encodes an essential RNA polymerase I transcription factor which interacts with the polymerase independently of DNA template. (nature.com)
  • RNA polymerase I transcription and pre-rRNA processing are linked by specific SSU processome components. (ebi.ac.uk)
  • For transcription to take place, the enzyme that synthesizes RNA, known as RNA polymerase , must attach to the DNA near a gene. (wikipedia.org)
  • A promoter is induced in response to changes in abundance or conformation of regulatory proteins in a cell, which enable activating transcription factors to recruit RNA polymerase. (wikipedia.org)
  • The Ambion® WT Expression Kit for RNA amplification prior to microarray analysis circumvents the need to deplete rRNA by selectively eliminating rRNA from reverse transcription in the amplification process. (thermofisher.com)
  • 28S, 5.8S, and 18S rRNAs are encoded by a single transcription unit (45S) separated by 2 Internally transcribed spacer (ITS). (bionity.com)
  • Complementary DNA was generated from total RNA using a reverse transcription kit (Fermentas, Foster City, CA) according to the manufacturer's instructions. (medscape.com)
  • Required for optimal pre-ribosomal RNA transcription by RNA polymerase. (uniprot.org)
  • Required for optimal pre-ribosomal RNA transcription by RNA polymerase (PubMed:17699751, PubMed:19732766). (genecards.org)
  • rRNA transcription, catalyzed by RNA polymerase I (Pol I), plays a critical role in ribosome biogenesis, and changes in Pol I transcription rate are associated with profound alterations in the growth rate of the cell. (aacrjournals.org)
  • Transcription initiation by human RNA Pol I requires at least two factors in addition to Pol I: the upstream binding factor 1 (UBF1) and a species-specific factor, SL1. (aacrjournals.org)
  • Retrotransposons copy themselves in two stages: first from DNA to RNA by transcription , then from RNA back to DNA by reverse transcription . (wikipedia.org)
  • 18S rRNA is an SSU rRNA, a component of the eukaryotic ribosomal small subunit (40S). (wikipedia.org)
  • 18S rRNA is the structural RNA for the small component of eukaryotic cytoplasmic ribosomes, and thus one of the basic components of all eukaryotic cells. (wikipedia.org)
  • The structure reveals how large ribosome biogenesis complexes assist the 5' external transcribed spacer and U3 small nucleolar RNA in providing an intertwined RNA-protein assembly platform for the separate maturation of 18S rRNA domains. (rcsb.org)
  • This purine-rich 5' UTR sequence is complementary to the UCCU core sequence of the 3'-end of 16S rRNA (located within the 30S small ribosomal subunit). (thermofisher.com)
  • A large ribonuclear protein complex is required for the processing of the small-ribosomal-subunit rRNA - the small-subunit (SSU) processome [ PMID: 12068309 , PMID: 15590835 ]. (ebi.ac.uk)
  • In prokaryotes a small 30S ribosomal subunit contains the 16S rRNA. (bionity.com)
  • The 18S rRNA in most eukaryotes is in the small ribosomal subunit, and the large subunit contains three rRNA species (the 5S, 5.8S and 28S rRNAs). (bionity.com)
  • The tertiary structure of the small subunit ribosomal RNA (SSU rRNA) has been resolved by X-ray crystallography [1] . (bionity.com)
  • May be a component of the proposed t-UTP subcomplex of the ribosomal small subunit (SSU) processome containing at least UTP4, WDR43, HEATR1, UTP15, WDR75 (PubMed:17699751, PubMed:22916032). (genecards.org)
  • SUBUNIT: Component of the ribosomal small subunit (SSU) processome CC (By similarity). (univ-lyon1.fr)
  • Ribosomal RNA (rRNA) is a type of non-coding ribonucleic acid (RNA) that is a primary and permanent component of ribosomes , the small, cellular particles that form the site of protein synthesis in all living cells . (newworldencyclopedia.org)
  • Small subunit ribosomal RNA, 5' domain taken from the Rfam database. (newworldencyclopedia.org)
  • When PTCs were removed from pseudoexon 3B or when UPF1 small interfering RNA was used to impair the NMD mechanism, the decay of the splice variant was reduced, confirming the involvement of NMD in the degradation of CYP3A5 splice variants. (aspetjournals.org)
  • Small nuclear RNAs ( snRNA ) join with proteins to form spliceosomes . (wikipedia.org)
  • Small interfering RNAs (sometimes called silencing RNAs) interfere with the expression of a specific gene. (wikipedia.org)
  • Eukaryotic ribosomes contain four different rRNA molecules: 18S, 5.8S, 28S and 5S rRNA. (wikipedia.org)
  • 5S ribosomal RNA (5S rRNA) is a component of the large ribosomal subunit in both prokaryotes and eukaryotes. (statemaster.com)
  • They are required for 18S rRNA biogenesis. (ebi.ac.uk)
  • The results of the study revealed, the 18S rRNA is informative in estimation of relationships among Theileria species and strains, but the Tams1 seems to be appropriate for analysis of the molecular antigenicity in vaccine development. (ac.ir)
  • Multigene analyses are currently thought to give more reliable results for tracing deep branching events in Metazoa but 18S still is extensively used in phylogenetic analyses. (wikipedia.org)
  • Conflicting phylogenetic hypotheses for the parasitic Platyhelminthes tested by partial sequencing of 18S ribosomal RNA. (springer.com)
  • The phylogenetic position of the Aspid oboth-sea within the parasite flatworms inferred from ribosomal RNA sequence data. (springer.com)
  • Ribosomal RNA (rRNA), a type of RNA synthesized in the nucleolus by RNA polymerase I, is the central component of the ribosome , the protein manufacturing machinery of all living cells . (bionity.com)
  • HCV contains a single-stranded, plus polarity RNA genome of ∼9,500 nucleotides ( 8 ). (aacrjournals.org)
  • You will see that it is not possible to design a pair of primers for 18s that do not bind to more than one place. (protocol-online.org)
  • RNA is an acronym for ribonucleic acid , a nucleic acid . (wikipedia.org)
  • They form a pre-complex with pre-18S rRNA in the absence of snoRNA U3 and other SSU processome components. (ebi.ac.uk)
  • From electron microscopy the SSU processome may correspond to the terminal knobs visualized at the 5' ends of nascent 18S rRNA. (ebi.ac.uk)
  • Such a cell would need to construct ten million copies of each type of ribosomal RNA molecule. (newworldencyclopedia.org)
  • Our RiboMinus™ technology utilizes specific locked nucleic acid (LNA®) capture probes to bind ribosomal RNA and subsequently remove it from the sample via binding to streptavidin-coated Dynabeads® magnetic beads. (thermofisher.com)
  • Blots are indexed with the corresponding gene probes including the 18S-rRNA probe as control. (plantphysiol.org)
  • Total RNA was isolated from 27 pairs of fresh-frozen tissues. (medscape.com)
  • Total RNA was isolated and purified from these fresh-frozen tissues using the RNeasy Mini Kit and QiaShredders (Qiagen, Sussex, UK). (medscape.com)
  • The cDNA fragments corresponding to the entire 3′ UTR of Kv4.3 were amplified by RT-PCR from 2 μg of total RNA extracted from mouse heart. (ahajournals.org)
  • 20 ] through sequencing 454 normalised libraries of skeletal muscle, intestine, blood and head kidney (prior and post exposure to infection with the myxosporean parasite Enteromyxum leei ) RNA samples of S. aurata fed with commercial diets, combined with previous data obtained from animals exposed to confinement stress, parasite infection and nutritional stress by essential fatty acid deficiency. (biomedcentral.com)
  • On entry into cells, the viral RNA is translated into a polyprotein, which is processed into mature viral structural and nonstructural proteins by host and viral proteases. (aacrjournals.org)
  • Proteins are shown in blue and RNA in orange. (newworldencyclopedia.org)
  • Two kinds of non-coding RNAs help in the process of building proteins in the cell. (wikipedia.org)
  • 1995. Ribosomal RNA multigene loci: nomads of the Triticeae genomes. (springer.com)
  • In Cactaceae, the 18S-26S loci seem to be highly conserved. (nih.gov)
  • However, due to its extremely high expression in most cell types, it can sometimes be challenging to use 18S rRNA as an endogenous normalizer for several gene expression assays in the same reaction. (qiagen.com)
  • Enrichment of whole transcriptome RNA by depleting ribosomal RNA (rRNA) species using our RiboMinus™ technology has the potential to enhance discovery using gene expression microarrays, RNA-Seq, and other methods. (thermofisher.com)
  • Analysis of gene expression utilized the Human RNA Master Blot and Multiple Tissue Northern blot (CLONTECH) according to manufacturer's instructions. (pnas.org)
  • Gene expression was standardized against 18s ribosomal RNA and RNA Polymerase II expression. (rti.org)
  • Expression data was used to identify highly-expressed mRNAs in mature gametocytes that were also low in antisense RNA expression in non-gametocyte stages. (biomedcentral.com)
  • 2. Physical mapping of 5S and 18S-26S ribosomal RNA gene families in diploid species. (springer.com)
  • Here we have used PCR-based genotyping of spliced leader RNA gene repeats to analyse several novel species of insect trypanosomatids isolated from heteropteran hosts and to compare them with the parasites that had been detected in the gut smears of the same hosts. (nih.gov)
  • The large 50S ribosomal subunit contains two rRNA species (the 5S and 23S rRNAs). (bionity.com)
  • 18S ribosomal RNA is a widely used control for qRT-PCR analyses because of its invariant expression across tissues, cells, and experimental treatments. (qiagen.com)
  • DNA and RNA Analyses. (pnas.org)
  • Its enzymatic activity derives from the presence of the ribosomal RNA (rRNA), which performs the catalytic processes for the synthesis. (newworldencyclopedia.org)
  • Ribosomal RNA ( rRNA ) is the catalytic component of the ribosomes. (wikipedia.org)
  • RNA interference demonstrates that Cr-tra-2 promotes female fates. (genetics.org)
  • This is called RNA interference . (wikipedia.org)