Reverse Transcriptase Polymerase Chain Reaction: A variation of the PCR technique in which cDNA is made from RNA via reverse transcription. The resultant cDNA is then amplified using standard PCR protocols.Polymerase Chain Reaction: In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships.RNA, Messenger: RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.Base Sequence: The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.Molecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.HIV Reverse Transcriptase: A reverse transcriptase encoded by the POL GENE of HIV. It is a heterodimer of 66 kDa and 51 kDa subunits that are derived from a common precursor protein. The heterodimer also includes an RNAse H activity (RIBONUCLEASE H, HUMAN IMMUNODEFICIENCY VIRUS) that plays an essential role the viral replication process.DNA Primers: Short sequences (generally about 10 base pairs) of DNA that are complementary to sequences of messenger RNA and allow reverse transcriptases to start copying the adjacent sequences of mRNA. Primers are used extensively in genetic and molecular biology techniques.RNA-Directed DNA Polymerase: An enzyme that synthesizes DNA on an RNA template. It is encoded by the pol gene of retroviruses and by certain retrovirus-like elements. EC 2.7.7.49.Gene Expression: The phenotypic manifestation of a gene or genes by the processes of GENETIC TRANSCRIPTION and GENETIC TRANSLATION.Reverse Transcriptase Inhibitors: Inhibitors of reverse transcriptase (RNA-DIRECTED DNA POLYMERASE), an enzyme that synthesizes DNA on an RNA template.Sensitivity and Specificity: Binary classification measures to assess test results. Sensitivity or recall rate is the proportion of true positives. Specificity is the probability of correctly determining the absence of a condition. (From Last, Dictionary of Epidemiology, 2d ed)Neoplastic Cells, Circulating: Exfoliate neoplastic cells circulating in the blood and associated with metastasizing tumors.RNA, Neoplasm: RNA present in neoplastic tissue.Immunohistochemistry: Histochemical localization of immunoreactive substances using labeled antibodies as reagents.Amino Acid Sequence: The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.Real-Time Polymerase Chain Reaction: Methods used for detecting the amplified DNA products from the polymerase chain reaction as they accumulate instead of at the end of the reaction.DNA, Complementary: Single-stranded complementary DNA synthesized from an RNA template by the action of RNA-dependent DNA polymerase. cDNA (i.e., complementary DNA, not circular DNA, not C-DNA) is used in a variety of molecular cloning experiments as well as serving as a specific hybridization probe.Transcription, Genetic: The biosynthesis of RNA carried out on a template of DNA. The biosynthesis of DNA from an RNA template is called REVERSE TRANSCRIPTION.Cells, Cultured: Cells propagated in vitro in special media conducive to their growth. Cultured cells are used to study developmental, morphologic, metabolic, physiologic, and genetic processes, among others.Gene Expression Profiling: The determination of the pattern of genes expressed at the level of GENETIC TRANSCRIPTION, under specific circumstances or in a specific cell.RNA, Viral: Ribonucleic acid that makes up the genetic material of viruses.Cloning, Molecular: The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.In Situ Hybridization: A technique that localizes specific nucleic acid sequences within intact chromosomes, eukaryotic cells, or bacterial cells through the use of specific nucleic acid-labeled probes.Glyceraldehyde 3-Phosphate Dehydrogenase (NADP+)Rhabdomyosarcoma, Embryonal: A form of RHABDOMYOSARCOMA arising primarily in the head and neck, especially the orbit, of children below the age of 10. The cells are smaller than those of other rhabdomyosarcomas and are of two basic cell types: spindle cells and round cells. This cancer is highly sensitive to chemotherapy and has a high cure rate with multi-modality therapy. (From Holland et al., Cancer Medicine, 3d ed, p2188)Blotting, Southern: A method (first developed by E.M. Southern) for detection of DNA that has been electrophoretically separated and immobilized by blotting on nitrocellulose or other type of paper or nylon membrane followed by hybridization with labeled NUCLEIC ACID PROBES.DNA-Directed DNA Polymerase: DNA-dependent DNA polymerases found in bacteria, animal and plant cells. During the replication process, these enzymes catalyze the addition of deoxyribonucleotide residues to the end of a DNA strand in the presence of DNA as template-primer. They also possess exonuclease activity and therefore function in DNA repair.Neoplasm Proteins: Proteins whose abnormal expression (gain or loss) are associated with the development, growth, or progression of NEOPLASMS. Some neoplasm proteins are tumor antigens (ANTIGENS, NEOPLASM), i.e. they induce an immune reaction to their tumor. Many neoplasm proteins have been characterized and are used as tumor markers (BIOMARKERS, TUMOR) when they are detectable in cells and body fluids as monitors for the presence or growth of tumors. Abnormal expression of ONCOGENE PROTEINS is involved in neoplastic transformation, whereas the loss of expression of TUMOR SUPPRESSOR PROTEINS is involved with the loss of growth control and progression of the neoplasm.Blotting, Western: Identification of proteins or peptides that have been electrophoretically separated by blot transferring from the electrophoresis gel to strips of nitrocellulose paper, followed by labeling with antibody probes.Encephalomyelitis, Western Equine: A form of arboviral encephalitis (which primarily affects horses) endemic to western and central regions of NORTH AMERICA. The causative organism (ENCEPHALOMYELITIS VIRUS, WESTERN EQUINE) may be transferred to humans via the bite of mosquitoes (CULEX tarsalis and others). Clinical manifestations include headache and influenza-like symptoms followed by alterations in mentation, SEIZURES, and COMA. DEATH occurs in a minority of cases. Survivors may recover fully or be left with residual neurologic dysfunction, including PARKINSONISM, POSTENCEPHALITIC. (From Joynt, Clinical Neurology, 1996, Ch26, pp8-9)Gene Expression Regulation, Neoplastic: Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action in neoplastic tissue.Rhabdomyosarcoma, Alveolar: A form of RHABDOMYOSARCOMA occurring mainly in adolescents and young adults, affecting muscles of the extremities, trunk, orbital region, etc. It is extremely malignant, metastasizing widely at an early stage. Few cures have been achieved and the prognosis is poor. "Alveolar" refers to its microscopic appearance simulating the cells of the respiratory alveolus. (Holland et al., Cancer Medicine, 3d ed, p2188)Monophenol Monooxygenase: An enzyme of the oxidoreductase class that catalyzes the reaction between L-tyrosine, L-dopa, and oxygen to yield L-dopa, dopaquinone, and water. It is a copper protein that acts also on catechols, catalyzing some of the same reactions as CATECHOL OXIDASE. EC 1.14.18.1.Gene Expression Regulation: Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control (induction or repression) of gene action at the level of transcription or translation.Tumor Markers, Biological: Molecular products metabolized and secreted by neoplastic tissue and characterized biochemically in cells or body fluids. They are indicators of tumor stage and grade as well as useful for monitoring responses to treatment and predicting recurrence. Many chemical groups are represented including hormones, antigens, amino and nucleic acids, enzymes, polyamines, and specific cell membrane proteins and lipids.Up-Regulation: A positive regulatory effect on physiological processes at the molecular, cellular, or systemic level. At the molecular level, the major regulatory sites include membrane receptors, genes (GENE EXPRESSION REGULATION), mRNAs (RNA, MESSENGER), and proteins.Tumor Cells, Cultured: Cells grown in vitro from neoplastic tissue. If they can be established as a TUMOR CELL LINE, they can be propagated in cell culture indefinitely.Sequence Analysis, DNA: A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.Mutation: Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.Translocation, Genetic: A type of chromosome aberration characterized by CHROMOSOME BREAKAGE and transfer of the broken-off portion to another location, often to a different chromosome.Cell Line: Established cell cultures that have the potential to propagate indefinitely.RNA: A polynucleotide consisting essentially of chains with a repeating backbone of phosphate and ribose units to which nitrogenous bases are attached. RNA is unique among biological macromolecules in that it can encode genetic information, serve as an abundant structural component of cells, and also possesses catalytic activity. (Rieger et al., Glossary of Genetics: Classical and Molecular, 5th ed)Oncogene Proteins, Fusion: The GENETIC TRANSLATION products of the fusion between an ONCOGENE and another gene. The latter may be of viral or cellular origin.Exons: The parts of a transcript of a split GENE remaining after the INTRONS are removed. They are spliced together to become a MESSENGER RNA or other functional RNA.Oligonucleotide Array Sequence Analysis: Hybridization of a nucleic acid sample to a very large set of OLIGONUCLEOTIDE PROBES, which have been attached individually in columns and rows to a solid support, to determine a BASE SEQUENCE, or to detect variations in a gene sequence, GENE EXPRESSION, or for GENE MAPPING.DNA, Viral: Deoxyribonucleic acid that makes up the genetic material of viruses.DNA: A deoxyribonucleotide polymer that is the primary genetic material of all cells. Eukaryotic and prokaryotic organisms normally contain DNA in a double-stranded state, yet several important biological processes transiently involve single-stranded regions. DNA, which consists of a polysugar-phosphate backbone possessing projections of purines (adenine and guanine) and pyrimidines (thymine and cytosine), forms a double helix that is held together by hydrogen bonds between these purines and pyrimidines (adenine to thymine and guanine to cytosine).Neoplasm, Residual: Remnant of a tumor or cancer after primary, potentially curative therapy. (Dr. Daniel Masys, written communication)Blotting, Northern: Detection of RNA that has been electrophoretically separated and immobilized by blotting on nitrocellulose or other type of paper or nylon membrane followed by hybridization with labeled NUCLEIC ACID PROBES.RNA Polymerase II: A DNA-dependent RNA polymerase present in bacterial, plant, and animal cells. It functions in the nucleoplasmic structure and transcribes DNA into RNA. It has different requirements for cations and salt than RNA polymerase I and is strongly inhibited by alpha-amanitin. EC 2.7.7.6.Genotype: The genetic constitution of the individual, comprising the ALLELES present at each GENETIC LOCUS.Time Factors: Elements of limited time intervals, contributing to particular results or situations.DNA-Binding Proteins: Proteins which bind to DNA. The family includes proteins which bind to both double- and single-stranded DNA and also includes specific DNA binding proteins in serum which can be used as markers for malignant diseases.Prognosis: A prediction of the probable outcome of a disease based on a individual's condition and the usual course of the disease as seen in similar situations.Tissue Distribution: Accumulation of a drug or chemical substance in various organs (including those not relevant to its pharmacologic or therapeutic action). This distribution depends on the blood flow or perfusion rate of the organ, the ability of the drug to penetrate organ membranes, tissue specificity, protein binding. The distribution is usually expressed as tissue to plasma ratios.Immunoenzyme Techniques: Immunologic techniques based on the use of: (1) enzyme-antibody conjugates; (2) enzyme-antigen conjugates; (3) antienzyme antibody followed by its homologous enzyme; or (4) enzyme-antienzyme complexes. These are used histologically for visualizing or labeling tissue specimens.Sequence Homology, Amino Acid: The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.Flow Cytometry: Technique using an instrument system for making, processing, and displaying one or more measurements on individual cells obtained from a cell suspension. Cells are usually stained with one or more fluorescent dyes specific to cell components of interest, e.g., DNA, and fluorescence of each cell is measured as it rapidly transverses the excitation beam (laser or mercury arc lamp). Fluorescence provides a quantitative measure of various biochemical and biophysical properties of the cell, as well as a basis for cell sorting. Other measurable optical parameters include light absorption and light scattering, the latter being applicable to the measurement of cell size, shape, density, granularity, and stain uptake.Enzyme-Linked Immunosorbent Assay: An immunoassay utilizing an antibody labeled with an enzyme marker such as horseradish peroxidase. While either the enzyme or the antibody is bound to an immunosorbent substrate, they both retain their biologic activity; the change in enzyme activity as a result of the enzyme-antibody-antigen reaction is proportional to the concentration of the antigen and can be measured spectrophotometrically or with the naked eye. Many variations of the method have been developed.Rats, Sprague-Dawley: A strain of albino rat used widely for experimental purposes because of its calmness and ease of handling. It was developed by the Sprague-Dawley Animal Company.Phylogeny: The relationships of groups of organisms as reflected by their genetic makeup.Cell Line, Tumor: A cell line derived from cultured tumor cells.Melanoma: A malignant neoplasm derived from cells that are capable of forming melanin, which may occur in the skin of any part of the body, in the eye, or, rarely, in the mucous membranes of the genitalia, anus, oral cavity, or other sites. It occurs mostly in adults and may originate de novo or from a pigmented nevus or malignant lentigo. Melanomas frequently metastasize widely, and the regional lymph nodes, liver, lungs, and brain are likely to be involved. The incidence of malignant skin melanomas is rising rapidly in all parts of the world. (Stedman, 25th ed; from Rook et al., Textbook of Dermatology, 4th ed, p2445)Sarcoma, Synovial: A malignant neoplasm arising from tenosynovial tissue of the joints and in synovial cells of tendons and bursae. The legs are the most common site, but the tumor can occur in the abdominal wall and other trunk muscles. There are two recognized types: the monophasic (characterized by sheaths of monotonous spindle cells) and the biphasic (characterized by slit-like spaces or clefts within the tumor, lined by cuboidal or tall columnar epithelial cells). These sarcomas occur most commonly in the second and fourth decades of life. (From Dorland, 27th ed; DeVita Jr et al., Cancer: Principles & Practice of Oncology, 3d ed, p1363)Gene Rearrangement: The ordered rearrangement of gene regions by DNA recombination such as that which occurs normally during development.Biopsy: Removal and pathologic examination of specimens in the form of small pieces of tissue from the living body.Transcription Factors: Endogenous substances, usually proteins, which are effective in the initiation, stimulation, or termination of the genetic transcription process.DNA, Neoplasm: DNA present in neoplastic tissue.Bone Marrow: The soft tissue filling the cavities of bones. Bone marrow exists in two types, yellow and red. Yellow marrow is found in the large cavities of large bones and consists mostly of fat cells and a few primitive blood cells. Red marrow is a hematopoietic tissue and is the site of production of erythrocytes and granular leukocytes. Bone marrow is made up of a framework of connective tissue containing branching fibers with the frame being filled with marrow cells.DNA, Bacterial: Deoxyribonucleic acid that makes up the genetic material of bacteria.Templates, Genetic: Macromolecular molds for the synthesis of complementary macromolecules, as in DNA REPLICATION; GENETIC TRANSCRIPTION of DNA to RNA, and GENETIC TRANSLATION of RNA into POLYPEPTIDES.Sarcoma, Ewing: A malignant tumor of the bone which always arises in the medullary tissue, occurring more often in cylindrical bones. The tumor occurs usually before the age of 20, about twice as frequently in males as in females.Sequence Homology, Nucleic Acid: The sequential correspondence of nucleotides in one nucleic acid molecule with those of another nucleic acid molecule. Sequence homology is an indication of the genetic relatedness of different organisms and gene function.Sequence Alignment: The arrangement of two or more amino acid or base sequences from an organism or organisms in such a way as to align areas of the sequences sharing common properties. The degree of relatedness or homology between the sequences is predicted computationally or statistically based on weights assigned to the elements aligned between the sequences. This in turn can serve as a potential indicator of the genetic relatedness between the organisms.Keratins: A class of fibrous proteins or scleroproteins that represents the principal constituent of EPIDERMIS; HAIR; NAILS; horny tissues, and the organic matrix of tooth ENAMEL. Two major conformational groups have been characterized, alpha-keratin, whose peptide backbone forms a coiled-coil alpha helical structure consisting of TYPE I KERATIN and a TYPE II KERATIN, and beta-keratin, whose backbone forms a zigzag or pleated sheet structure. alpha-Keratins have been classified into at least 20 subtypes. In addition multiple isoforms of subtypes have been found which may be due to GENE DUPLICATION.Recombinant Proteins: Proteins prepared by recombinant DNA technology.Promoter Regions, Genetic: DNA sequences which are recognized (directly or indirectly) and bound by a DNA-dependent RNA polymerase during the initiation of transcription. Highly conserved sequences within the promoter include the Pribnow box in bacteria and the TATA BOX in eukaryotes.Transfection: The uptake of naked or purified DNA by CELLS, usually meaning the process as it occurs in eukaryotic cells. It is analogous to bacterial transformation (TRANSFORMATION, BACTERIAL) and both are routinely employed in GENE TRANSFER TECHNIQUES.Down-Regulation: A negative regulatory effect on physiological processes at the molecular, cellular, or systemic level. At the molecular level, the major regulatory sites include membrane receptors, genes (GENE EXPRESSION REGULATION), mRNAs (RNA, MESSENGER), and proteins.In Situ Hybridization, Fluorescence: A type of IN SITU HYBRIDIZATION in which target sequences are stained with fluorescent dye so their location and size can be determined using fluorescence microscopy. This staining is sufficiently distinct that the hybridization signal can be seen both in metaphase spreads and in interphase nuclei.Oligodeoxyribonucleotides: A group of deoxyribonucleotides (up to 12) in which the phosphate residues of each deoxyribonucleotide act as bridges in forming diester linkages between the deoxyribose moieties.Gene Expression Regulation, Enzymologic: Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action in enzyme synthesis.DNA-Directed RNA Polymerases: Enzymes that catalyze DNA template-directed extension of the 3'-end of an RNA strand one nucleotide at a time. They can initiate a chain de novo. In eukaryotes, three forms of the enzyme have been distinguished on the basis of sensitivity to alpha-amanitin, and the type of RNA synthesized. (From Enzyme Nomenclature, 1992).Cytokines: Non-antibody proteins secreted by inflammatory leukocytes and some non-leukocytic cells, that act as intercellular mediators. They differ from classical hormones in that they are produced by a number of tissue or cell types rather than by specialized glands. They generally act locally in a paracrine or autocrine rather than endocrine manner.Phenotype: The outward appearance of the individual. It is the product of interactions between genes, and between the GENOTYPE and the environment.Telomerase: An essential ribonucleoprotein reverse transcriptase that adds telomeric DNA to the ends of eukaryotic CHROMOSOMES.Cell Proliferation: All of the processes involved in increasing CELL NUMBER including CELL DIVISION.HIV-1: The type species of LENTIVIRUS and the etiologic agent of AIDS. It is characterized by its cytopathic effect and affinity for the T4-lymphocyte.Alternative Splicing: A process whereby multiple RNA transcripts are generated from a single gene. Alternative splicing involves the splicing together of other possible sets of EXONS during the processing of some, but not all, transcripts of the gene. Thus a particular exon may be connected to any one of several alternative exons to form a mature RNA. The alternative forms of mature MESSENGER RNA produce PROTEIN ISOFORMS in which one part of the isoforms is common while the other parts are different.Liver: A large lobed glandular organ in the abdomen of vertebrates that is responsible for detoxification, metabolism, synthesis and storage of various substances.Oligonucleotides, Antisense: Short fragments of DNA or RNA that are used to alter the function of target RNAs or DNAs to which they hybridize.Mice, Inbred C57BLCattle: Domesticated bovine animals of the genus Bos, usually kept on a farm or ranch and used for the production of meat or dairy products or for heavy labor.DNA Polymerase I: A DNA-dependent DNA polymerase characterized in prokaryotes and may be present in higher organisms. It has both 3'-5' and 5'-3' exonuclease activity, but cannot use native double-stranded DNA as template-primer. It is not inhibited by sulfhydryl reagents and is active in both DNA synthesis and repair. EC 2.7.7.7.Skin Neoplasms: Tumors or cancer of the SKIN.Gene Expression Regulation, Developmental: Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action during the developmental stages of an organism.Antigens, Neoplasm: Proteins, glycoprotein, or lipoprotein moieties on surfaces of tumor cells that are usually identified by monoclonal antibodies. Many of these are of either embryonic or viral origin.Transforming Growth Factor beta: A factor synthesized in a wide variety of tissues. It acts synergistically with TGF-alpha in inducing phenotypic transformation and can also act as a negative autocrine growth factor. TGF-beta has a potential role in embryonal development, cellular differentiation, hormone secretion, and immune function. TGF-beta is found mostly as homodimer forms of separate gene products TGF-beta1, TGF-beta2 or TGF-beta3. Heterodimers composed of TGF-beta1 and 2 (TGF-beta1.2) or of TGF-beta2 and 3 (TGF-beta2.3) have been isolated. The TGF-beta proteins are synthesized as precursor proteins.Case-Control Studies: Studies which start with the identification of persons with a disease of interest and a control (comparison, referent) group without the disease. The relationship of an attribute to the disease is examined by comparing diseased and non-diseased persons with regard to the frequency or levels of the attribute in each group.Disease Outbreaks: Sudden increase in the incidence of a disease. The concept includes EPIDEMICS and PANDEMICS.Neoplasm Staging: Methods which attempt to express in replicable terms the extent of the neoplasm in the patient.Apoptosis: One of the mechanisms by which CELL DEATH occurs (compare with NECROSIS and AUTOPHAGOCYTOSIS). Apoptosis is the mechanism responsible for the physiological deletion of cells and appears to be intrinsically programmed. It is characterized by distinctive morphologic changes in the nucleus and cytoplasm, chromatin cleavage at regularly spaced sites, and the endonucleolytic cleavage of genomic DNA; (DNA FRAGMENTATION); at internucleosomal sites. This mode of cell death serves as a balance to mitosis in regulating the size of animal tissues and in mediating pathologic processes associated with tumor growth.Drug Resistance, Multiple: Simultaneous resistance to several structurally and functionally distinct drugs.Reproducibility of Results: The statistical reproducibility of measurements (often in a clinical context), including the testing of instrumentation or techniques to obtain reproducible results. The concept includes reproducibility of physiological measurements, which may be used to develop rules to assess probability or prognosis, or response to a stimulus; reproducibility of occurrence of a condition; and reproducibility of experimental results.Interleukin-1: A soluble factor produced by MONOCYTES; MACROPHAGES, and other cells which activates T-lymphocytes and potentiates their response to mitogens or antigens. Interleukin-1 is a general term refers to either of the two distinct proteins, INTERLEUKIN-1ALPHA and INTERLEUKIN-1BETA. The biological effects of IL-1 include the ability to replace macrophage requirements for T-cell activation.Oligonucleotide Probes: Synthetic or natural oligonucleotides used in hybridization studies in order to identify and study specific nucleic acid fragments, e.g., DNA segments near or within a specific gene locus or gene. The probe hybridizes with a specific mRNA, if present. Conventional techniques used for testing for the hybridization product include dot blot assays, Southern blot assays, and DNA:RNA hybrid-specific antibody tests. Conventional labels for the probe include the radioisotope labels 32P and 125I and the chemical label biotin.Tumor Necrosis Factor-alpha: Serum glycoprotein produced by activated MACROPHAGES and other mammalian MONONUCLEAR LEUKOCYTES. It has necrotizing activity against tumor cell lines and increases ability to reject tumor transplants. Also known as TNF-alpha, it is only 30% homologous to TNF-beta (LYMPHOTOXIN), but they share TNF RECEPTORS.Pregnancy: The status during which female mammals carry their developing young (EMBRYOS or FETUSES) in utero before birth, beginning from FERTILIZATION to BIRTH.Leukocytes, Mononuclear: Mature LYMPHOCYTES and MONOCYTES transported by the blood to the body's extravascular space. They are morphologically distinguishable from mature granulocytic leukocytes by their large, non-lobed nuclei and lack of coarse, heavily stained cytoplasmic granules.Skin: The outer covering of the body that protects it from the environment. It is composed of the DERMIS and the EPIDERMIS.Disease Models, Animal: Naturally occurring or experimentally induced animal diseases with pathological processes sufficiently similar to those of human diseases. They are used as study models for human diseases.Prospective Studies: Observation of a population for a sufficient number of persons over a sufficient number of years to generate incidence or mortality rates subsequent to the selection of the study group.Breast Neoplasms: Tumors or cancer of the human BREAST.Keratinocytes: Epidermal cells which synthesize keratin and undergo characteristic changes as they move upward from the basal layers of the epidermis to the cornified (horny) layer of the skin. Successive stages of differentiation of the keratinocytes forming the epidermal layers are basal cell, spinous or prickle cell, and the granular cell.Influenza, Human: An acute viral infection in humans involving the respiratory tract. It is marked by inflammation of the NASAL MUCOSA; the PHARYNX; and conjunctiva, and by headache and severe, often generalized, myalgia.Swine: Any of various animals that constitute the family Suidae and comprise stout-bodied, short-legged omnivorous mammals with thick skin, usually covered with coarse bristles, a rather long mobile snout, and small tail. Included are the genera Babyrousa, Phacochoerus (wart hogs), and Sus, the latter containing the domestic pig (see SUS SCROFA).Dose-Response Relationship, Drug: The relationship between the dose of an administered drug and the response of the organism to the drug.Rats, Wistar: A strain of albino rat developed at the Wistar Institute that has spread widely at other institutions. This has markedly diluted the original strain.P-Glycoprotein: A 170-kDa transmembrane glycoprotein from the superfamily of ATP-BINDING CASSETTE TRANSPORTERS. It serves as an ATP-dependent efflux pump for a variety of chemicals, including many ANTINEOPLASTIC AGENTS. Overexpression of this glycoprotein is associated with multidrug resistance (see DRUG RESISTANCE, MULTIPLE).Cell Differentiation: Progressive restriction of the developmental potential and increasing specialization of function that leads to the formation of specialized cells, tissues, and organs.DNA Polymerase II: A DNA-dependent DNA polymerase characterized in E. coli and other lower organisms. It may be present in higher organisms and has an intrinsic molecular activity only 5% of that of DNA Polymerase I. This polymerase has 3'-5' exonuclease activity, is effective only on duplex DNA with gaps or single-strand ends of less than 100 nucleotides as template, and is inhibited by sulfhydryl reagents. EC 2.7.7.7.Survival Analysis: A class of statistical procedures for estimating the survival function (function of time, starting with a population 100% well at a given time and providing the percentage of the population still well at later times). The survival analysis is then used for making inferences about the effects of treatments, prognostic factors, exposures, and other covariates on the function.Testis: The male gonad containing two functional parts: the SEMINIFEROUS TUBULES for the production and transport of male germ cells (SPERMATOGENESIS) and the interstitial compartment containing LEYDIG CELLS that produce ANDROGENS.Influenza A Virus, H1N1 Subtype: A subtype of INFLUENZA A VIRUS with the surface proteins hemagglutinin 1 and neuraminidase 1. The H1N1 subtype was responsible for the Spanish flu pandemic of 1918.Precursor Cell Lymphoblastic Leukemia-Lymphoma: A neoplasm characterized by abnormalities of the lymphoid cell precursors leading to excessive lymphoblasts in the marrow and other organs. It is the most common cancer in children and accounts for the vast majority of all childhood leukemias.Interleukin-6: A cytokine that stimulates the growth and differentiation of B-LYMPHOCYTES and is also a growth factor for HYBRIDOMAS and plasmacytomas. It is produced by many different cells including T-LYMPHOCYTES; MONOCYTES; and FIBROBLASTS.Predictive Value of Tests: In screening and diagnostic tests, the probability that a person with a positive test is a true positive (i.e., has the disease), is referred to as the predictive value of a positive test; whereas, the predictive value of a negative test is the probability that the person with a negative test does not have the disease. Predictive value is related to the sensitivity and specificity of the test.Chickens: Common name for the species Gallus gallus, the domestic fowl, in the family Phasianidae, order GALLIFORMES. It is descended from the red jungle fowl of SOUTHEAST ASIA.MicroRNAs: Small double-stranded, non-protein coding RNAs, 21-25 nucleotides in length generated from single-stranded microRNA gene transcripts by the same RIBONUCLEASE III, Dicer, that produces small interfering RNAs (RNA, SMALL INTERFERING). They become part of the RNA-INDUCED SILENCING COMPLEX and repress the translation (TRANSLATION, GENETIC) of target RNA by binding to homologous 3'UTR region as an imperfect match. The small temporal RNAs (stRNAs), let-7 and lin-4, from C. elegans, are the first 2 miRNAs discovered, and are from a class of miRNAs involved in developmental timing.Membrane Proteins: Proteins which are found in membranes including cellular and intracellular membranes. They consist of two types, peripheral and integral proteins. They include most membrane-associated enzymes, antigenic proteins, transport proteins, and drug, hormone, and lectin receptors.Ribonuclease H: A ribonuclease that specifically cleaves the RNA moiety of RNA:DNA hybrids. It has been isolated from a wide variety of prokaryotic and eukaryotic organisms as well as RETROVIRUSES.Protein Isoforms: Different forms of a protein that may be produced from different GENES, or from the same gene by ALTERNATIVE SPLICING.Isoenzymes: Structurally related forms of an enzyme. Each isoenzyme has the same mechanism and classification, but differs in its chemical, physical, or immunological characteristics.Lymph Nodes: They are oval or bean shaped bodies (1 - 30 mm in diameter) located along the lymphatic system.Organ Specificity: Characteristic restricted to a particular organ of the body, such as a cell type, metabolic response or expression of a particular protein or antigen.Fibroblasts: Connective tissue cells which secrete an extracellular matrix rich in collagen and other macromolecules.Epithelial Cells: Cells that line the inner and outer surfaces of the body by forming cellular layers (EPITHELIUM) or masses. Epithelial cells lining the SKIN; the MOUTH; the NOSE; and the ANAL CANAL derive from ectoderm; those lining the RESPIRATORY SYSTEM and the DIGESTIVE SYSTEM derive from endoderm; others (CARDIOVASCULAR SYSTEM and LYMPHATIC SYSTEM) derive from mesoderm. Epithelial cells can be classified mainly by cell shape and function into squamous, glandular and transitional epithelial cells.Cell Culture Techniques: Methods for maintaining or growing CELLS in vitro.Polymorphism, Restriction Fragment Length: Variation occurring within a species in the presence or length of DNA fragment generated by a specific endonuclease at a specific site in the genome. Such variations are generated by mutations that create or abolish recognition sites for these enzymes or change the length of the fragment.Multiplex Polymerase Chain Reaction: Methods for using more than one primer set in a polymerase chain reaction to amplify more than one segment of the target DNA sequence in a single reaction.DNA Polymerase III: A DNA-dependent DNA polymerase characterized in E. coli and other lower organisms but may be present in higher organisms. Use also for a more complex form of DNA polymerase III designated as DNA polymerase III* or pol III* which is 15 times more active biologically than DNA polymerase I in the synthesis of DNA. This polymerase has both 3'-5' and 5'-3' exonuclease activities, is inhibited by sulfhydryl reagents, and has the same template-primer dependence as pol II. EC 2.7.7.7.Signal Transduction: The intracellular transfer of information (biological activation/inhibition) through a signal pathway. In each signal transduction system, an activation/inhibition signal from a biologically active molecule (hormone, neurotransmitter) is mediated via the coupling of a receptor/enzyme to a second messenger system or to an ion channel. Signal transduction plays an important role in activating cellular functions, cell differentiation, and cell proliferation. Examples of signal transduction systems are the GAMMA-AMINOBUTYRIC ACID-postsynaptic receptor-calcium ion channel system, the receptor-mediated T-cell activation pathway, and the receptor-mediated activation of phospholipases. Those coupled to membrane depolarization or intracellular release of calcium include the receptor-mediated activation of cytotoxic functions in granulocytes and the synaptic potentiation of protein kinase activation. Some signal transduction pathways may be part of larger signal transduction pathways; for example, protein kinase activation is part of the platelet activation signal pathway.Cell Division: The fission of a CELL. It includes CYTOKINESIS, when the CYTOPLASM of a cell is divided, and CELL NUCLEUS DIVISION.Liver Neoplasms: Tumors or cancer of the LIVER.Chondrocytes: Polymorphic cells that form cartilage.Gene Amplification: A selective increase in the number of copies of a gene coding for a specific protein without a proportional increase in other genes. It occurs naturally via the excision of a copy of the repeating sequence from the chromosome and its extrachromosomal replication in a plasmid, or via the production of an RNA transcript of the entire repeating sequence of ribosomal RNA followed by the reverse transcription of the molecule to produce an additional copy of the original DNA sequence. Laboratory techniques have been introduced for inducing disproportional replication by unequal crossing over, uptake of DNA from lysed cells, or generation of extrachromosomal sequences from rolling circle replication.Immunoblotting: Immunologic method used for detecting or quantifying immunoreactive substances. The substance is identified by first immobilizing it by blotting onto a membrane and then tagging it with labeled antibodies.Escherichia coli: A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.RNA, Small Interfering: Small double-stranded, non-protein coding RNAs (21-31 nucleotides) involved in GENE SILENCING functions, especially RNA INTERFERENCE (RNAi). Endogenously, siRNAs are generated from dsRNAs (RNA, DOUBLE-STRANDED) by the same ribonuclease, Dicer, that generates miRNAs (MICRORNAS). The perfect match of the siRNAs' antisense strand to their target RNAs mediates RNAi by siRNA-guided RNA cleavage. siRNAs fall into different classes including trans-acting siRNA (tasiRNA), repeat-associated RNA (rasiRNA), small-scan RNA (scnRNA), and Piwi protein-interacting RNA (piRNA) and have different specific gene silencing functions.Proteins: Linear POLYPEPTIDES that are synthesized on RIBOSOMES and may be further modified, crosslinked, cleaved, or assembled into complex proteins with several subunits. The specific sequence of AMINO ACIDS determines the shape the polypeptide will take, during PROTEIN FOLDING, and the function of the protein.Cluster Analysis: A set of statistical methods used to group variables or observations into strongly inter-related subgroups. In epidemiology, it may be used to analyze a closely grouped series of events or cases of disease or other health-related phenomenon with well-defined distribution patterns in relation to time or place or both.DNA, Protozoan: Deoxyribonucleic acid that makes up the genetic material of protozoa.Electrophoresis, Agar Gel: Electrophoresis in which agar or agarose gel is used as the diffusion medium.Membrane Glycoproteins: Glycoproteins found on the membrane or surface of cells.Biological Markers: Measurable and quantifiable biological parameters (e.g., specific enzyme concentration, specific hormone concentration, specific gene phenotype distribution in a population, presence of biological substances) which serve as indices for health- and physiology-related assessments, such as disease risk, psychiatric disorders, environmental exposure and its effects, disease diagnosis, metabolic processes, substance abuse, pregnancy, cell line development, epidemiologic studies, etc.Antineoplastic Agents: Substances that inhibit or prevent the proliferation of NEOPLASMS.Mice, Inbred BALB CStatistics, Nonparametric: A class of statistical methods applicable to a large set of probability distributions used to test for correlation, location, independence, etc. In most nonparametric statistical tests, the original scores or observations are replaced by another variable containing less information. An important class of nonparametric tests employs the ordinal properties of the data. Another class of tests uses information about whether an observation is above or below some fixed value such as the median, and a third class is based on the frequency of the occurrence of runs in the data. (From McGraw-Hill Dictionary of Scientific and Technical Terms, 4th ed, p1284; Corsini, Concise Encyclopedia of Psychology, 1987, p764-5)Anti-HIV Agents: Agents used to treat AIDS and/or stop the spread of the HIV infection. These do not include drugs used to treat symptoms or opportunistic infections associated with AIDS.Interleukin-8: A member of the CXC chemokine family that plays a role in the regulation of the acute inflammatory response. It is secreted by variety of cell types and induces CHEMOTAXIS of NEUTROPHILS and other inflammatory cells.Adenocarcinoma: A malignant epithelial tumor with a glandular organization.Polymorphism, Genetic: The regular and simultaneous occurrence in a single interbreeding population of two or more discontinuous genotypes. The concept includes differences in genotypes ranging in size from a single nucleotide site (POLYMORPHISM, SINGLE NUCLEOTIDE) to large nucleotide sequences visible at a chromosomal level.DNA Probes: Species- or subspecies-specific DNA (including COMPLEMENTARY DNA; conserved genes, whole chromosomes, or whole genomes) used in hybridization studies in order to identify microorganisms, to measure DNA-DNA homologies, to group subspecies, etc. The DNA probe hybridizes with a specific mRNA, if present. Conventional techniques used for testing for the hybridization product include dot blot assays, Southern blot assays, and DNA:RNA hybrid-specific antibody tests. Conventional labels for the DNA probe include the radioisotope labels 32P and 125I and the chemical label biotin. The use of DNA probes provides a specific, sensitive, rapid, and inexpensive replacement for cell culture techniques for diagnosing infections.Interleukin-10: A cytokine produced by a variety of cell types, including T-LYMPHOCYTES; MONOCYTES; DENDRITIC CELLS; and EPITHELIAL CELLS that exerts a variety of effects on immunoregulation and INFLAMMATION. Interleukin-10 combines with itself to form a homodimeric molecule that is the biologically active form of the protein.Disease Progression: The worsening of a disease over time. This concept is most often used for chronic and incurable diseases where the stage of the disease is an important determinant of therapy and prognosis.Infant, Newborn: An infant during the first month after birth.Alleles: Variant forms of the same gene, occupying the same locus on homologous CHROMOSOMES, and governing the variants in production of the same gene product.Interferon-gamma: The major interferon produced by mitogenically or antigenically stimulated LYMPHOCYTES. It is structurally different from TYPE I INTERFERON and its major activity is immunoregulation. It has been implicated in the expression of CLASS II HISTOCOMPATIBILITY ANTIGENS in cells that do not normally produce them, leading to AUTOIMMUNE DISEASES.Zidovudine: A dideoxynucleoside compound in which the 3'-hydroxy group on the sugar moiety has been replaced by an azido group. This modification prevents the formation of phosphodiester linkages which are needed for the completion of nucleic acid chains. The compound is a potent inhibitor of HIV replication, acting as a chain-terminator of viral DNA during reverse transcription. It improves immunologic function, partially reverses the HIV-induced neurological dysfunction, and improves certain other clinical abnormalities associated with AIDS. Its principal toxic effect is dose-dependent suppression of bone marrow, resulting in anemia and leukopenia.Colorectal Neoplasms: Tumors or cancer of the COLON or the RECTUM or both. Risk factors for colorectal cancer include chronic ULCERATIVE COLITIS; FAMILIAL POLYPOSIS COLI; exposure to ASBESTOS; and irradiation of the CERVIX UTERI.Antigens, CD: Differentiation antigens residing on mammalian leukocytes. CD stands for cluster of differentiation, which refers to groups of monoclonal antibodies that show similar reactivity with certain subpopulations of antigens of a particular lineage or differentiation stage. The subpopulations of antigens are also known by the same CD designation.Brain: The part of CENTRAL NERVOUS SYSTEM that is contained within the skull (CRANIUM). Arising from the NEURAL TUBE, the embryonic brain is comprised of three major parts including PROSENCEPHALON (the forebrain); MESENCEPHALON (the midbrain); and RHOMBENCEPHALON (the hindbrain). The developed brain consists of CEREBRUM; CEREBELLUM; and other structures in the BRAIN STEM.Lymphatic Metastasis: Transfer of a neoplasm from its primary site to lymph nodes or to distant parts of the body by way of the lymphatic system.Proto-Oncogene Proteins: Products of proto-oncogenes. Normally they do not have oncogenic or transforming properties, but are involved in the regulation or differentiation of cell growth. They often have protein kinase activity.Neoplasm Metastasis: The transfer of a neoplasm from one organ or part of the body to another remote from the primary site.Drug Resistance, Viral: The ability of viruses to resist or to become tolerant to chemotherapeutic agents or antiviral agents. This resistance is acquired through gene mutation.Vascular Endothelial Growth Factor A: The original member of the family of endothelial cell growth factors referred to as VASCULAR ENDOTHELIAL GROWTH FACTORS. Vascular endothelial growth factor-A was originally isolated from tumor cells and referred to as "tumor angiogenesis factor" and "vascular permeability factor". Although expressed at high levels in certain tumor-derived cells it is produced by a wide variety of cell types. In addition to stimulating vascular growth and vascular permeability it may play a role in stimulating VASODILATION via NITRIC OXIDE-dependent pathways. Alternative splicing of the mRNA for vascular endothelial growth factor A results in several isoforms of the protein being produced.Cell Survival: The span of viability of a cell characterized by the capacity to perform certain functions such as metabolism, growth, reproduction, some form of responsiveness, and adaptability.Rabbits: The species Oryctolagus cuniculus, in the family Leporidae, order LAGOMORPHA. Rabbits are born in burrows, furless, and with eyes and ears closed. In contrast with HARES, rabbits have 22 chromosome pairs.Treatment Outcome: Evaluation undertaken to assess the results or consequences of management and procedures used in combating disease in order to determine the efficacy, effectiveness, safety, and practicability of these interventions in individual cases or series.Kinetics: The rate dynamics in chemical or physical systems.Dideoxynucleotides: The phosphate esters of DIDEOXYNUCLEOSIDES.RNA Polymerase I: A DNA-dependent RNA polymerase present in bacterial, plant, and animal cells. The enzyme functions in the nucleolar structure and transcribes DNA into RNA. It has different requirements for cations and salts than RNA polymerase II and III and is not inhibited by alpha-amanitin. EC 2.7.7.6.RNA Polymerase III: A DNA-dependent RNA polymerase present in bacterial, plant, and animal cells. It functions in the nucleoplasmic structure where it transcribes DNA into RNA. It has specific requirements for cations and salt and has shown an intermediate sensitivity to alpha-amanitin in comparison to RNA polymerase I and II. EC 2.7.7.6.Avian myeloblastosis virus: A species of ALPHARETROVIRUS causing anemia in fowl.Lung Neoplasms: Tumors or cancer of the LUNG.Homeodomain Proteins: Proteins encoded by homeobox genes (GENES, HOMEOBOX) that exhibit structural similarity to certain prokaryotic and eukaryotic DNA-binding proteins. Homeodomain proteins are involved in the control of gene expression during morphogenesis and development (GENE EXPRESSION REGULATION, DEVELOPMENTAL).Prostatic Neoplasms: Tumors or cancer of the PROSTATE.T-Lymphocytes: Lymphocytes responsible for cell-mediated immunity. Two types have been identified - cytotoxic (T-LYMPHOCYTES, CYTOTOXIC) and helper T-lymphocytes (T-LYMPHOCYTES, HELPER-INDUCER). They are formed when lymphocytes circulate through the THYMUS GLAND and differentiate to thymocytes. When exposed to an antigen, they divide rapidly and produce large numbers of new T cells sensitized to that antigen.Immunoglobulin Heavy Chains: The largest of polypeptide chains comprising immunoglobulins. They contain 450 to 600 amino acid residues per chain, and have molecular weights of 51-72 kDa.Nucleic Acid Hybridization: Widely used technique which exploits the ability of complementary sequences in single-stranded DNAs or RNAs to pair with each other to form a double helix. Hybridization can take place between two complimentary DNA sequences, between a single-stranded DNA and a complementary RNA, or between two RNA sequences. The technique is used to detect and isolate specific sequences, measure homology, or define other characteristics of one or both strands. (Kendrew, Encyclopedia of Molecular Biology, 1994, p503)DNA Polymerase beta: A DNA repair enzyme that catalyzes DNA synthesis during base excision DNA repair. EC 2.7.7.7.Neoplasm Recurrence, Local: The local recurrence of a neoplasm following treatment. It arises from microscopic cells of the original neoplasm that have escaped therapeutic intervention and later become clinically visible at the original site.Lung: Either of the pair of organs occupying the cavity of the thorax that effect the aeration of the blood.Cell Movement: The movement of cells from one location to another. Distinguish from CYTOKINESIS which is the process of dividing the CYTOPLASM of a cell.Retrospective Studies: Studies used to test etiologic hypotheses in which inferences about an exposure to putative causal factors are derived from data relating to characteristics of persons under study or to events or experiences in their past. The essential feature is that some of the persons under study have the disease or outcome of interest and their characteristics are compared with those of unaffected persons.Restriction Mapping: Use of restriction endonucleases to analyze and generate a physical map of genomes, genes, or other segments of DNA.DNA Mutational Analysis: Biochemical identification of mutational changes in a nucleotide sequence.Thymine Nucleotides: Phosphate esters of THYMIDINE in N-glycosidic linkage with ribose or deoxyribose, as occurs in nucleic acids. (From Dorland, 28th ed, p1154)Virus Replication: The process of intracellular viral multiplication, consisting of the synthesis of PROTEINS; NUCLEIC ACIDS; and sometimes LIPIDS, and their assembly into a new infectious particle.Lipopolysaccharides: Lipid-containing polysaccharides which are endotoxins and important group-specific antigens. They are often derived from the cell wall of gram-negative bacteria and induce immunoglobulin secretion. The lipopolysaccharide molecule consists of three parts: LIPID A, core polysaccharide, and O-specific chains (O ANTIGENS). When derived from Escherichia coli, lipopolysaccharides serve as polyclonal B-cell mitogens commonly used in laboratory immunology. (From Dorland, 28th ed)

Alternative sulfonylurea receptor expression defines metabolic sensitivity of K-ATP channels in dopaminergic midbrain neurons. (1/55562)

ATP-sensitive potassium (K-ATP) channels couple the metabolic state to cellular excitability in various tissues. Several isoforms of the K-ATP channel subunits, the sulfonylurea receptor (SUR) and inwardly rectifying K channel (Kir6.X), have been cloned, but the molecular composition and functional diversity of native neuronal K-ATP channels remain unresolved. We combined functional analysis of K-ATP channels with expression profiling of K-ATP subunits at the level of single substantia nigra (SN) neurons in mouse brain slices using an RT-multiplex PCR protocol. In contrast to GABAergic neurons, single dopaminergic SN neurons displayed alternative co-expression of either SUR1, SUR2B or both SUR isoforms with Kir6.2. Dopaminergic SN neurons expressed alternative K-ATP channel species distinguished by significant differences in sulfonylurea affinity and metabolic sensitivity. In single dopaminergic SN neurons, co-expression of SUR1 + Kir6.2, but not of SUR2B + Kir6.2, correlated with functional K-ATP channels highly sensitive to metabolic inhibition. In contrast to wild-type, surviving dopaminergic SN neurons of homozygous weaver mouse exclusively expressed SUR1 + Kir6.2 during the active period of dopaminergic neurodegeneration. Therefore, alternative expression of K-ATP channel subunits defines the differential response to metabolic stress and constitutes a novel candidate mechanism for the differential vulnerability of dopaminergic neurons in response to respiratory chain dysfunction in Parkinson's disease.  (+info)

Anopheles gambiae Ag-STAT, a new insect member of the STAT family, is activated in response to bacterial infection. (2/55562)

A new insect member of the STAT family of transcription factors (Ag-STAT) has been cloned from the human malaria vector Anopheles gambiae. The domain involved in DNA interaction and the SH2 domain are well conserved. Ag-STAT is most similar to Drosophila D-STAT and to vertebrate STATs 5 and 6, constituting a proposed ancient class A of the STAT family. The mRNA is expressed at all developmental stages, and the protein is present in hemocytes, pericardial cells, midgut, skeletal muscle and fat body cells. There is no evidence of transcriptional activation following bacterial challenge. However, bacterial challenge results in nuclear translocation of Ag-STAT protein in fat body cells and induction of DNA-binding activity that recognizes a STAT target site. In vitro treatment with pervanadate (vanadate and H2O2) translocates Ag-STAT to the nucleus in midgut epithelial cells. This is the first evidence of direct participation of the STAT pathway in immune responses in insects.  (+info)

Expression of novel alternatively spliced isoforms of the oct-1 transcription factor. (3/55562)

Analysis of the alternatively spliced isoforms of the human and mouse oct-1 genes, combined with their exon-intron structure, show a high level of evolutionary conservation between these two species. The differential expression of several oct-1 isoforms was examined by reverse transcription-polymerase chain reaction performed on the 3' region of the murine oct-1 cDNA. Variations in the relative levels and patterns of expression of the isoforms were found among different tissues. Three novel isoforms originating from the 3'-distal region of oct-1, were isolated and sequenced: Two were derived from testis, and one from myeloma cells. Splicing out of different exons as revealed in the structure of these isoforms results in reading frameshifts that presumably lead to the expression of shortened Oct-1 proteins, with distinct C-terminal tails. Altogether, six out of the eight known murine oct-1 isoforms may have distinct C-termini, implying that these multiple tails have different functional roles in cellular differentiation and physiology.  (+info)

Chemokine mRNA expression in gastric mucosa is associated with Helicobacter pylori cagA positivity and severity of gastritis. (4/55562)

AIM: To investigate the association between the quantity of gastric chemokine mRNA expression, severity of gastritis, and cagA positivity in Helicobacter pylori associated gastritis. METHODS: In 83 dyspeptic patients, antral and corpus biopsies were taken for semiquantitative reverse transcription polymerase chain reaction (RT-PCR) and histological grading of gastritis. Gastritis was evaluated by visual analogue scales. Quantities of chemokine (IL-8, GRO alpha, ENA-78, RANTES, MCP-1) RT-PCR products were compared with G3PDH products. Each sample was also evaluated for the presence of cagA and ureA mRNA by RT-PCR. RESULTS: mRNA expression of all five chemokines was significantly greater in H pylori positive than in H pylori negative mucosa. In H pylori positive patients, in the antrum C-X-C chemokine mRNA expression was significantly greater in cagA positive patients than in cagA negative patients, but there were no significant differences in C-C chemokine mRNA expression. In H pylori positive patients, chemokine mRNA expression in the corpus was less than in the antrum. In contrast to the antrum, only GRO alpha mRNA expression was significantly greater in cagA positive infection. Polymorphonuclear cell infiltration was correlated with C-X-C chemokine mRNA expression. Significant correlations were also found between bacterial density and C-X-C chemokine mRNA expression. CONCLUSIONS: In H pylori infection, C-X-C chemokines may play a primary role in active gastritis. Infection with cagA positive H pylori induces greater gastric chemokine mRNA expression in the antral mucosa, which may be relevant to the increased mucosal damage associated with cagA positive H pylori infection.  (+info)

The role of alternative splicing of the adhesion molecule, CD44, in lymphoid malignancy. (5/55562)

AIM: To investigate the expression of CD44 isoforms containing variant exon 6 (v6) in a well characterised cohort of patients with non-Hodgkin's lymphoma (NHL) and chronic lymphocytic leukaemia (CLL), and to correlate this with phenotype and disease course. METHODS: Cryostat sections of OCT embedded diagnostic nodal material from NHL patients and cryopreserved mononuclear preparations from CLL patients were used as sources of RNA. After reverse transcription, PCR was carried out with amplimers positioned at either side of the variant exon insertion site to amplify all possible CD44 isoforms. Those isoforms containing v6 were identified after Southern blotting and hybridisation with a radiolabelled oligonucleotide. RESULTS: Of 32 NHL samples analysed, 16 did not express CD44 isoforms containing v6, six expressed an isoform containing exon v6 alone, and 10 expressed v6 long isoforms which contained exon v6 in addition to other variant exons. These data did not correlate with lymphoma classification, disease staging, or the presence or absence of extranodal disease. However, those patients expressing v6 long CD44 isoforms had a worse overall survival than those that did not. The plateau of the survival curves was 50% compared with 82%. No v6 long isoforms were detected in the 21 CLL samples investigated. CONCLUSIONS: The expression of v6 long CD44 isoforms is associated with aggressive disease in NHL, independent of grade, stage, or presence of extranodal disease.  (+info)

Transcriptional regulation and induction of apoptosis: implications for the use of monomeric p53 variants in gene therapy. (6/55562)

The p53 tumour suppressor protein is a transcriptional activator, which can induce cell cycle arrest and apoptosis. p53 Gene mutations occur in more than 50% of all human tumours. Reintroduction of wild-type p53 but also of oligomerisation-independent p53 variants into tumour cells by gene transfer methods has been considered. We have investigated the biological properties of two carboxy-terminal deletion mutants of p53, p53 delta 300 (comprising amino acids 1-300) and p53 delta 326 (amino acids 1-326), to evaluate their potential deployment in gene therapy. Transactivation was measured in transiently transfected HeLa and SKBR3 cells. Both monomeric variants showed reduced activities compared with wild-type p53. Individual promoters were differently affected. In contrast to wild-type p53, monomeric variants were not able to induce apoptosis. We also provided wild-type p53 and p53 delta 326 with tetracycline-regulated promoters and stably introduced these constructs into Saos2 and SKBR3 cells. Upon induction, wild-type p53 expressing cells, but not p53 delta 326 expressing cells underwent apoptosis. Consistently, only wild-type p53 expressing cells accumulated p21/waf1/cip1 mRNA and protein and showed increased bax, Gadd45 and mdm2 mRNA. Neither wild-type p53 nor p53 delta 326 repressed the transcription of the IGF-1R gene in these cell lines. We conclude that the transactivation potential of monomeric, carboxy-terminally truncated p53 is not sufficient to cause induction of the endogenous target genes which trigger apoptosis.  (+info)

Astrocyte-specific expression of tyrosine hydroxylase after intracerebral gene transfer induces behavioral recovery in experimental parkinsonism. (7/55562)

Parkinson's disease is a neurodegenerative disorder characterized by the depletion of dopamine in the caudate putamen. Dopamine replacement with levodopa, a precursor of the neurotransmitter, is presently the most common treatment for this disease. However, in an effort to obtain better therapeutic results, tissue or cells that synthesize catecholamines have been grafted into experimental animals and human patients. In this paper, we present a novel technique to express tyrosine hydroxylase (TH) in the host's own astrocytes. This procedure uses a transgene in which the expression of a TH cDNA is under the control of a glial fibrillary acidic protein (GFAP) promoter, which confers astrocyte-specific expression and also increases its activity in response to brain injury. The method was tested in a rat model of Parkinson's disease produced by lesioning the striatum with 6-hydroxydopamine. Following microinjection of the transgene into the denervated striatum as a DNA-liposome complex, expression of the transgene was detected by RT-PCR and TH protein was observed specifically in astrocytes by using double-labeling immunofluorescence for GFAP and TH coupled with laser confocal microscopy. Efficacy was demonstrated by significant behavioral recovery, as assessed by a decrease in the pharmacologically induced turning behavior generated by the unilateral denervation of the rat striatum. These results suggest this is a valuable technique to express molecules of therapeutic interest in the brain.  (+info)

Increased expression of fibroblast growth factor 8 in human breast cancer. (8/55562)

Fibroblast growth factor 8 (FGF8) is an important developmental protein which is oncogenic and able to cooperate with wnt-1 to produce mouse mammary carcinoma. The level of expression of FGF8 mRNA was measured in 68 breast cancers and 24 non-malignant breast tissues. Elevated levels of FGF8 mRNA were found in malignant compared to non-malignant breast tissues with significantly more malignant tissues expressing FGF8 (P=0.019) at significantly higher levels (P=0.031). In situ hybridization of breast cancer tissues and analysis of purified populations of normal epithelial cells and breast cancer cell lines showed that malignant epithelial cells expressed FGF8 mRNA at high levels compared to non-malignant epithelial and myoepithelial cells and fibroblasts. Although two of the receptors which FGF8 binds to (FGFR2-IIIc, FGFR3-IIIc) are not expressed in breast cancer cells, an autocrine activation loop is possible since expression of fibroblast growth factor receptor (FGFR) 4 and FGFR1 are retained in malignant epithelial cells. This is the first member of the FGF family to have increased expression in breast cancer and a potential autocrine role in its progression.  (+info)

A quantitative real time reverse-transcription polymerase chain reaction (qRT-PCR) assay with specific primers recommended by the World Health Organization (WHO) has been widely used successfully for detection and monitoring of the pandemic H1N1/2009 influenza A virus. In this study, we report the design and characterization of a novel set of primers to be used in a qRT-PCR assay for detecting the pandemic H1N1/2009 virus. The newly designed primers target three regions that are highly conserved among the hemagglutinin (HA) genes of the pandemic H1N1/2009 viruses and are different from those targeted by the WHO-recommended primers. The qRT-PCR assays with the newly designed primers are highly specific, and as specific as the WHO-recommended primers for detecting pandemic H1N1/2009 viruses and other influenza viruses including influenza B viruses and influenza A viruses of human, swine, and raccoon dog origin. Furthermore, the qRT-PCR assays with the newly designed primers appeared to be at least 10-fold
In final result, this analysis implies a surrounding function for coinfecting infections in clients introducing with SARI and highlights the crucial role of viral coinfection. Persisted use of the rRT-PCR multiplex assay in combination with the SARI surveillance program will boost our capability to find blood circulation of respiratory trojans in clients hospitalized for SARI and aid explain the factor of these respiratory system viruses among individuals with SARI in Southwest Photography equipment. Although there happen to be increasing problems about the prospective for A(H1N1)pdm09 to reassort with pre-existing real human influenza infections and give go up to a very transmissible or pathogenic pathogen [22], no blended infections have been noticed with either subtypes in individuals with SARI in this analysis.. A lymphocytic meningitis had been current in 6 of 21 HIV -seropositive people but in zero of the HIV -seronegative patients. Perivascular infiltrates consisting of lymphocytes and ...
ONC201/TIC10 is a first-in-class small molecule inducer of TRAIL that causes early activation of the integrated stress response. Its promising safety profile and broad-spectrum efficacy in vitro have been confirmed in Phase I/II trials in several advanced malignancies. Binding and reporter assays have shown that ONC201 is a selective antagonist of the dopamine D2-like receptors, specifically, DRD2 and DRD3. We hypothesized that ONC201s interaction with DRD2 plays a role in ONC201s anticancer effects. Using cBioportal and quantitative reverse-transcription polymerase chain reaction analyses, we confirmed that DRD2 is expressed in different cancer cell types in a cell type-specific manner ...
Species, Scientific Experts, Genomes and Genes, Publications, Research Topics, Locale about Experts and Doctors on reverse transcriptase polymerase chain reaction in Netherlands
Gentaur molecular products has all kinds of products like :Abbexa , Abbexa \ rno-mir-542-5p RT-PCR Detection Kit \ abx096363 for more molecular products just contact us
How can one calculate the efficiency of isolated total RNA from different tissues treated at the same time, when it comes to doing quantitative real-time RT-PCR analysis afterwards? If one compare the real-time expression of a certain gene in different tissues, using housekeeping genes and an external standard reference gene.. How can one be sure that the possible difference in the expression pattern is not due to difference in the isolation efficiency?. ...
subject: discussion on Quantitative Competitive RT-PCR dear netters, I am busy writing a discussion for a report I hope graduate on. So at the moment I am looking for some additional comments and insights on Quantitative Competitive RT-PCR that will help me getting a more thorough discussion. Here are some of the questions I am taking in account: What are the strong and weak points in the QC RT-PCR system (internal control: insertion of approx. 4bp; 5 fluorescent labeled primer; genescan analysis/ABI 370)? What is the best way to validate the method you are trying to set up. And are the results obtained with this method reliable/reproducible enough to get accepted by reviewers. Is there some strong literature discussing the system including the disadvantages of it. Thanks in advance, David E. Sluijs Pathology, Academic Hospital Utrecht. please mail to: ,paspoort at dds.nl ...
Reverse transcription-polymerase chain reaction: …a laboratory technology known as reverse transcription-polymerase chain reaction (RT-PCR), a powerful tool used in research and in the diagnosis of diseases such as cancer.
Nowadays the role of genetic findings in determining the diagnosis, therapy and prognosis of acute myeloid leukemia (AML) has become more valuable. To improve and validate the detection of clonal chromosomal aberrations in leukemia, we designed a combined application of karyotyping with multiplex reverse transcription-polymerase chain reaction (RT-PCR) and fluorescence in situ hybridization (FISH), and addressed the expression and distribution of fusion genes among the subtypes of Chinese adult patients with de novo AML. Multiplex RT-PCR assays were performed on 477 samples from newly diagnosed AML patients, and cytogenetic data were obtained from 373 of them by R or G banding techniques and those in some cases were confirmed by FISH. The PCR products in some suspected cases were tested by two-directional sequencing. The results showed that except unqualified samples, fusion genes were detected by multiplex RT-PCR in 211 of 474 patients (44.51%), including AML1-ETO, CBFβ-MYH11, PML-RARα, ...
Some gene transcripts represented by more than one probe set (each detected similar levels of expression) Cancer Genome Anatoy Project verified expression of many genes Q-RT-PCR -- some of 100 genes selected and measured for transcript levels using Q-RT-PCR --results in agreement with relative levels of microarray gene expression Immunohisotchemical analysis of tumor samples: established protein expression levels of select 100 correlated with mRNA levels from microarray Several genes identified have already been previously shown to be differentially expressed in metastatic prostate cancer ...
Lets set the record straight about DDRT-PCR! This technique recieves an amazing amount of bad press, which I find utterly astonishing given that has major advantages over other methods for identifying differentially expressed genes. It is an extremely powerful tool. I work in a research group of 6 scientists and we all routinely use DDRT-PCR for a variety of different purposes, using RNA extracted from a wide variety of material, ranging from cultured cells, specific tissues to whole embryos. We have been using the technique for the last couple of years with a great deal of success. My particular project is concerned with hunting for brain transcripts up- or down-regulated in developing mouse brain as a direct result of the targeted deletion of a specific gene. This is designed to give us clues as to the function of the encoded protein (the null has no phenotype). For this project I am using whole mouse brains from a variety of wt/null developmental timepoints, which DDRT-PCR allows me to ...
What could be the possible reasons for a RT-PCR experiment that was working fine - posted in PCR, RT-PCR and Real-Time PCR: What could be the possible reasons for a RT-PCR experiment that was working fine to stop working, if nothing was changed? I seem to see quite a few questions about this. And Ive been battling with this problem for quite a few months now.... Thank you! Sakumi
Methods:This study used 63 peripheral blood and bone marrow (PB/BM) samples from children with ALL. Immunophenotyping of PB and BM samples were performed using flow cytometry to illustrate the lineage. Moreover, reverse transcriptase polymerase chain reaction (RT-PCR) technique was used to amplify transcripts of leukemia-specific chromosome fusion gene ETV6/RUNX1 and to monitor the expression levels of the ETV6/RUNX1 in patients according to Van Dongen et al protocol ...
Fig. 4 Tnnt temporal expression patterns in developing zebrafish embryos as detected by reverse transcriptase-polymerase chain reaction (RT-PCR). Total RNA was isolated from different developmental stages, and primers specific for sMyHC, Tnnt1, Tnnt2, Tnnt3a, and Tnnt3b were used for RT-PCR. β-actin was used as an internal control. Numbers in the right panel indicate the molecular mass of RT-PCR products. ...
In this article explain the finer points of the delta-delta-CT method to calculate up-/down- regulations. The following text is a writeup of a course I gave at a local highschool.
Hepcidin, a peptide hormone that decreases intestinal iron absorption and macrophage iron release, is a potential drug target for patients with iron overload syndromes because its levels are inappropriately low in these individuals. Endogenous stimulants of Hepcidin transcription include bone morphogenic protein 6 (BMP6) and interleukin-6 (IL-6) by effects on mothers against decapentaplegic homolog (Smad)4 or signal transducer and activator of transcription (Stat)3, respectively. We conducted a small-scale chemical screen in zebrafish embryos to identify small molecules that modulate hepcidin expression. We found that treatment with the isoflavone, genistein, from 28-52 hours postfertilization in zebrafish embryos enhanced Hepcidin transcript levels, as assessed by whole-mount in situ hybridization and quantitative real-time reverse-transcriptase polymerase chain reaction. Genisteins stimulatory effect was conserved in human hepatocytes: Genistein treatment of HepG2 cells increased both ...
Aberrant DNA methylation of CpG islands of cancer-related genes is among the earliest and most frequent alterations in cancerogenesis and might be of value for either diagnosing cancer or evaluating recurrent disease. This mechanism usually leads to inactivation of tumour-suppressor genes. We have designed the current study to validate our previous microarray data and to identify novel hypermethylated gene promoters. The validation assay was performed in a different set of 8 patients with colorectal cancer (CRC) by means quantitative reverse-transcriptase polymerase chain reaction analysis. The differential RNA expression profiles of three CRC cell lines before and after 5-aza-2-deoxycytidine treatment were compared to identify the hypermethylated genes. The DNA methylation status of these genes was evaluated by means of bisulphite genomic sequencing and methylation-specific polymerase chain reaction (MSP) in the 3 cell lines and in tumour tissues from 30 patients with CRC. Data from our previous
Cancer stem cells are associated with metastatic potential, treatment resistance, and poor patient prognosis. Distant recurrence remains the major cause of mortality in rectal cancer patients with preoperative chemoradiotherapy (CRT). We investigated the role of three stem cell markers (CD133, OCT4, and SOX2) in rectal cancer and evaluated the association between these gene levels and clinical outcome in rectal cancer patients with preoperative CRT. Thirty-three patients with rectal cancer underwent preoperative CRT. Total RNAs of rectal cancer cells before and after CRT were isolated. Residual cancer cells after CRT were obtained from formalin-fixed paraffin-embedded (FFPE) specimens using microdissection. The expression levels of three stem cell genes were measured using real-time reverse-transcription polymerase chain reaction (RT-PCR). The association between these gene levels and radiation was evaluated using colon cancer cell lines. Immunohistochemical staining of these markers after CRT was also
Among diabetes-susceptibility genes in NOD mice, only Idd-1 has been clearly assigned: Idd-1 could be a gene complex composed of class II major histocompatibility complex (MHC) genes, I-A beta and I-E. Employing restriction fragment length polymorphism (RFLP) analysis and nucleotide sequencing, we revealed that ILI and CTS mice, which are nondiabetic but are derived from the same Jcl-ICR mice as NOD mice, share the same class II MHC genes with NOD mice suggesting that both ILI and CTS mice also possess susceptible Idd-1 genotype. This was supported by a breeding study. To compare the usage of T cell receptor (TCR) V beta genes in NOD mice with that in ILI mice, we employed quantitative reverse-transcriptase polymerase chain reaction (RT-PCR) which revealed that TCR V beta usages of these mice were indistinguishable. RT-PCR method also revealed that the V beta transcript of T cells infiltrating into pancreas of NOD mice was not restricted but was rather diverse. Since NOD and ILI mice share the same
Five potential reference genes for RT-qPCR application, namely histone H3, beta-actin, GAPDH, ubiquitin and 18S rRNA, were evaluated for normalization of gene expression in four selected tissues (liver, kidney, thyroid and abdominal fat). Tissues were derived from fattening pigs exposed to different amounts and type of dietary iodine. Two software applications (geNorm and NormFinder) were used to evaluate the stability of the potential reference genes. All studied genes displayed high expression stability but different stability patterns between the investigated tissues. The results suggest GAPDH and 18S rRNA as reference genes applicable in all tissues investigated. Beta-actin and histone H3 are suitable reference genes for all tissues investigated except fat. In contrast, ubiquitin should be excluded from use as a reference gene in the porcine tissues analyzed due to variations in expression levels, despite the good expression stability.
Identification of potential reference genes. Potential reference genes are identified by (A) geNorm and (B) NormFinder. Low M-value or variability represents th
We report on the identification and genomic characterization of DEIN, a novel gene that exhibits a characteristic expression pattern in primary neuroblastoma. With a combined RACE and RT-PCR approach, the full-length sequences of the main transcript variants of this gene were characterized. According to SAGE, Northern blot, and quantitative real-time RT-PCR, variants A and B represent the major transcripts of DEIN in primary neuroblastoma. These isoforms are strongly expressed in stage IVS tumors, whereas lower expression levels were observed in stage IV tumors. In contrast, expression of transcript variant C did not differ in these stages, as determined by quantitative real-time RT-PCR, and seemed to be expressed at lower levels in neuroblastoma because it could not be detected by Northern blot hybridization and Ct values of quantitative real-time RT-PCR analysis were high (data not shown). In addition, low numbers of SAGE tag ATTTGTTACA corresponding to transcript D suggested that this isoform ...
To inform an example calculation, we use publicly published data for analytic specificity of the Quest Diagnostics reverse transcription polymerase chain reaction assay (likely 100%, minimum 95%, maximum 100%) and an informed but pessimistic assumption regarding the clinical sensitivity of the reverse transcription polymerase chain reaction assay (likely 90%, minimum 65%, maximum 99%). Estimation of population prevalence is challenging: the minimum in this scenario is based on a recent measurement of the prevalence of reverse transcription polymerase chain reaction positivity among asymptomatic individuals in Iceland (0.6%), while our maximum is based on a recently published estimate among asymptomatic parturients at a major academic center (13.8%).6,7 As is the case with nearly all measurements of disease prevalence, both of these estimates were measured in unique populations at specific points in time. We chose a "most likely" prevalence estimate of 1.0% based on preliminary, unpublished data ...
צעד אחד RT-PCR assay לגילוי וזיהוי genogroup של מבודד norovirus מ כיסאות ילדים, אשר מנצל primers ו בדיקות TaqMan ספציפיים מסגרת קריאה...
Reverse transcription polymerase chain reaction (RT‐PCR) expression patterns of the genes coding for Laccaria bicolor Zn finger protein and Ser/Threo protein
Quiescent and proliferating leukemia cells accumulate highly lethal DNA double-strand breaks that are repaired by 2 major mechanisms: BRCA-dependent homologous recombination and DNA-dependent protein kinase-mediated (DNA-PK-mediated) nonhomologous end-joining, whereas DNA repair pathways mediated by poly(ADP)ribose polymerase 1 (PARP1) serve as backups. Here we have designed a personalized medicine approach called gene expression and mutation analysis (GEMA) to identify BRCA- and DNA-PK-deficient leukemias either directly, using reverse transcription-quantitative PCR, microarrays, and flow cytometry, or indirectly, by the presence of oncogenes such as BCR-ABL1. DNA-PK-deficient quiescent leukemia cells and BRCA/DNA-PK-deficient proliferating leukemia cells were sensitive to PARP1 inhibitors that were administered alone or in combination with current antileukemic drugs. In conclusion, GEMA-guided targeting of PARP1 resulted in dual cellular synthetic lethality in quiescent and proliferating ...
Tissue RNA PrepMate™ uses a modified guanidium salt-lysis method to optimally extract total RNA from tissue. The amount of extracted total RNA can differ according to the tissue or cell type, so the starting amount should be adjusted to your needs. The extracted viral RNA can be used as a template of the RT-PCR or quantitative real time RT-PCR and cDNA synthesis, cDNA library construction, Microarray ...
Pregnancy in mammals featuring hemochorial placentation introduces a major conflict with the mothers immune system, which is dedicated to repelling invaders bearing foreign DNA and RNA. Numerous and highly sophisticated ...
This is an historical archive of the activities of the MRC Anatomical Neuropharmacology Unit (MRC ANU) that operated at the University of Oxford from 1985 until March 2015. The MRC ANU established a reputation for world-leading research on the brain, for training new generations of scientists, and for engaging the general public in neuroscience. The successes of the MRC ANU are now built upon at the MRC Brain Network Dynamics Unit at the University of Oxford.. ...
Recently we have reported that intermediate-frequency magnetic field (IF-MF) exposure transiently altered the mRNA expression levels of memory function-related genes in the hippocampi of adult male mice. However, the effects of IF-MF exposure during brain development on neurological biomarkers have not yet been clarified. In the present study, we investigated the effect of IF-MF exposure during development on neurological and immunological markers in the mouse hippocampus in 3- and 7-week-old male mice. Pregnant C57BL/6J mice were exposed to IF-MF (21 kHz, 3.8 mT) for one hour per day from organogenesis period day 7 to 17. At adolescence, some IF-MF-exposed mice were further divided into exposure, recovery, and sham-exposure groups. The adolescent-exposure groups were exposed again to IF-MF from postnatal day 27 to 48. The expression of mRNA in the hippocampi was examined using a real-time RT-PCR method, and microglia activation was examined by immunohistochemical analysis. The expression levels of NR1
Background: Current methodology of gene expression analysis limits the possibilities of comparison between cells/tissues of organs in which cell size and/or number changes as a consequence of the study (e.g. starvation). A method relating the abundance of specific mRNA copies per cell may allow direct comparison or different organs and/or changing physiological conditions. Methods: With a number of selected genes, we analysed the relationship of the number of bases and the fluorescence recorded at a present level using cDNA standards. A lineal relationship was found between the final number of bases and the length of the transcript. The constants of this equation and those of the relationship between fluorescence and number of bases in cDNA were determined and a general equation linking the length of the transcript and the initial number of copies of mRNA was deduced for a given pre-established fluorescence setting. This allowed the calculation of the concentration of the corresponding mRNAs per ...
There are currently no tests available over the counter or at a doctors office that can quickly detect and distinguish between the H7N9 virus and other flu viruses. However, a more sophisticated test that specifically detects H7N9 virus has been developed by CDC for use by qualified public health laboratories in the United States and internationally. This test involves collecting a respiratory tract (i.e., nose, throat, lung) sample from a sick patient. The sample is then sent to a public health laboratory where a procedure known as rRT-PCR (real-time reverse transcriptase polymerase chain reaction) is conducted. rRT-PCR is very accurate and sensitive at detecting flu viruses. This procedure typically provides results within 4 hours; however, the time involved in processing and reporting results may vary depending on the laboratory ...
Main focus of GENE QUANTIFICATION web page is to describe and summarize all technical aspects involved in quantitative gene expression analysis using real-time RT-PCR and competitive RT-PCR. It illustrates the usefulness of absolute and relative quantification assays in real-time PCR and real-time RT-PCR.
In order to identify biomarkers to predict the progression of Type 1 Diabetic Kidney Disease (DKD), we profiled the transcriptome (the set of RNA molecules produced) of leukocytes from 33 type 1 diabetic patients at the time of their enrollment in the study. Patients were followed for a minimum of five years and data were collected including information about the progression of DKD. We will identify genes that correlate to various outcomes with a focus on the decline of kidney function. To validate the expression, we will use a quantitative real-time reverse transcriptase polymerase chain reaction (qRT-PCR,) a laboratory method that is used to quantify RNA. Validated genes will be further studied in the future with more patients.. ...
ELISA and real-time qRT-PCR analyses demonstrated an increase of VEGF protein and mRNA levels in the inner ear after local EP2 or EP4 agonist application, indicating that the stimulation of EP2 and/or EP4 activates VEGF production in the inner ear ...
Cancer cells. (A) Relative expression levels of Nox1, 2, 3, 4, and 5 mRNAs in A549 cells were determined by real-time RT-PCR and are presented as mean delta Ct
assignmenthelp.net provides the best solution. Our online tutors are available to help you with Polymerase Chain Reaction home work problems.
Test with Confidence. Test with ZEUS. Clinical Performance Studies Four separate cohorts of clinically characterized specimens were tested: COVID-19 RT-PCR Positive Patient Specimens (n=35). The date between EUA-approved PCR test result and specimen draw was 3 to 37 days, with an average of 15.97 days and a median of 14 days.COVID-19 RT-PCR Negative Patient Specimens…
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed ...
Video created by Exploratorium for the course Tinkering Fundamentals: Motion and Mechanisms. A Chain Reaction machine is a deceptively simple concept, but one that allows for an incredibly complex and deep investigation into something we ...
Chain Reaction News. Find breaking news, commentary, and archival information about Chain Reaction From The tribunedigital-thecourant
TY - JOUR. T1 - Dysfunctional gastric emptying with down-regulation of muscle-specific MicroRNAs in helicobacter pylori-infected mice. AU - Saito, Yoshimasa. AU - Suzuki, Hidekazu. AU - Tsugawa, Hitoshi. AU - Suzuki, Sachiko. AU - Matsuzaki, Juntaro. AU - Hirata, Kenro. AU - Hibi, Toshifumi. PY - 2011/1. Y1 - 2011/1. N2 - Background & Aims: Little is known about the pathogenic mechanisms of functional dyspepsia. We investigated the role of microRNAs (miRNAs) in gastric motility disorders associated with Helicobacter pylori infection. Methods: Male C57BL/6 mice were infected with H pylori. After long-term infection, gastric emptying was examined and compared with that of uninfected mice (controls). The miRNA expression profile was analyzed by miRNA microarray and quantitative reverse-transcriptase polymerase chain reaction. The results obtained from the animal study were confirmed by in vitro experiments. Results: Gastric emptying was significantly accelerated in mice after chronic infection with ...
MicroRNAs (miRNAs) are short, non-coding RNAs (~22 nt) that play important roles in the pathogenesis of human diseases by negatively regulating gene expression. Although miR-196a has been implicated in several other cancers, its role in non-small cell lung cancer (NSCLC) is unknown. The aim of the present study was to examine the expression pattern of miR-196a in NSCLC and its clinical significance, as well as its biological role in tumor progression. Expression of miR-196a was analyzed in 34 NSCLC tissues and five NSCLC cell lines by quantitative reverse-transcription polymerase chain reaction (qRT-PCR). The effect of DNA methylation on miR-196a expression was investigated by 5-aza-2-deoxy-cytidine treatment and bisulfite sequencing. The effect of miR-196a on proliferation was evaluated by MTT and colony formation assays, and cell migration and invasion were evaluated by transwell assays. Analysis of target protein expression was determined by western blotting. Luciferase reporter plasmids were
Purpose: We previously revealed that the calreticulin (CRT) gene is a candidate oncogene promoting cell migration and invasion and that neuropilin-1 (NRP1) is a possible effector downstream of CRT in esophageal squamous carcinoma cells. This study aims to explore the mechanisms underlying the migration and invasion of esophageal cancer cells regulated by CRT through NRP1.. Experimental Design: Quantitative reverse-transcription polymerase chain reaction, Western blot analysis, chromatin immunoprecipitation, and reporter gene assays were used to investigate the relationship between CRT and NRP1. In vitro and in vivo assays were carried out to evaluate the effects of NRP1 on malignant phenotypes of ESCC cells and tumor metastasis in NOD/SCID mice. Immunohistochemistry was performed to analyze the expression of CRT and NRP1 in esophageal squamous cell carcinomas (ESCC).. Results: Knockdown of CRT decreased the expression of NRP1. Inhibition of NRP1 reduced ESCC cell motility in vitro and ...
PubMed journal article Kallikrein-related peptidase 4 gene (KLK4) in prostate tumors: quantitative expression analysis and evaluation of its clinical significanc were found in PRIME PubMed. Download Prime PubMed App to iPhone, iPad, or Android
Polyunsaturated fatty acid (PUFA)-activated two-pore domain potassium channels (K2P ) have been proposed to be expressed in the pulmonary vasculature. However, their physiological or pathophysiological roles are poorly defined. Here, we tested the hypothesis that PUFA-activated K2P are involved in pulmonary vasorelaxation and that alterations of channel expression are pathophysiologically linked to pulmonary hypertension. Expression of PUFA-activated K2P in the murine lung was investigated by quantitative reverse-transcription polymerase chain reaction (qRT-PCR), immunohistochemistry (IHC), by patch clamp (PC) and myography. K2P -gene expression was examined in chronic hypoxic mice. qRT-PCR showed that the K2P 2.1 and K2P 6.1 were the predominantly expressed K2P in the murine lung. IHC revealed protein expression of K2P 2.1 and K2P 6.1 in the endothelium of pulmonary arteries and of K2P 6.1 in bronchial epithelium. PC showed pimozide-sensitive K2P -like K(+) -current activated by docosahexaenoic ...
Quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) is a rapid and sensitive approach to identify miRNA and protein-coding gene expression in plants. However, because of the specially designated reverse transcription and shorter PCR products, very few reference genes have been identified for the quantitative analysis of miRNA expression in plants, and different internal reference genes are needed to normalize the expression of miRNAs and mRNA genes respectively. Therefore, it is particularly important to select the suitable common reference genes for normalization of quantitative PCR of miRNA and mRNA. In this study, a modified reverse transcription PCR protocol was adopted for selecting and validating universal internal reference genes of mRNAs and miRNAs. Eight commonly used reference genes, four stably expressed novel genes in Populus tremula, three small noncoding RNAs and three conserved miRNAs were selected as candidate genes, and the stability of their expression was examined
Introduction: Post-operative atrial fibrillation (POAF) develops in 1/3 of patients undergoing cardiac surgery and is associated with significant morbidity and mortality. MicroRNAs (miRs) are gene regulators linked to pathological atrial remodeling. Although genetic factors are implicated in susceptibility to POAF, no studies, to our knowledge, have examined atrial miR expression in relation to POAF.. Hypothesis: Changes in miR expression (estimated as fold difference in the delta cycle threshold compared to global mean) in human atria can be associated with POAF.. Methods: Atrial tissue (26 from right atrium; 2 from left atrium) was obtained from 28 participants with no history of atrial fibrillation undergoing elective cardiac surgery (36% coronary artery bypass grafting, 50% valve replacement and 14% combined surgeries or others). Based on pilot data and prior literature, the expression of 82 miRs was quantified using high-throughput quantitative reverse-transcriptase polymerase chain ...
In order to better understand cellular responses to viral infection at the transcriptional level, we employed differential display RT-PCR to analyze mRNAs from RD rhabdomyosarcoma cells following infection with a neurovirulent enterovirus 71 (EV71) strain, compared with mRNAs from uninfected cells. Of 250 expressed sequence tags (ESTs) isolated, sequenced, and identified, all were of cellular origin except 1 that was of viral origin. Of these, 156 were individual distinctive clones, comprising 45 mRNAs showing unaltered expression and 111 mRNAs exhibiting upregulation or downregulation. Of the 45 uniformly expressed mRNAs, 14 represented unknown genes. Of the 111 differentially expressed mRNAs, 63 did not match any known genes. Forty-eight of the 111 mRNAs modified by EV71 infection matched known genes, including those encoding components of cell cycle, cytoskeleton, and cell death mediators; protein degradation mediators; mitochondrial-related proteins; components of protein translation and ...
TY - JOUR. T1 - High-throughput real-time RT-PCR assay to detect the exotic Newcastle Disease Virus during the California 2002-2003 outbreak. AU - Crossley, Beate. AU - Hietala, Sharon K.. AU - Shih, Liu Mei. AU - Lee, Lou. AU - Skowronski, Evan W.. AU - Ardans, Alex. PY - 2005/3. Y1 - 2005/3. N2 - During the 2002-2003 Exotic Newcastle Disease (END) outbreak in Southern California, a high-throughput real-time reverse transcriptase-polymerase chain reaction (RRT-PCR) system was developed to respond to the large diagnostic and surveillance sample workload. A 96-well RNA extraction method, using magnetic bead technology, combined with a 96-well RRT-PCR assay, allowed 1 technician to process and test more than 400 samples per day. A 3-technician team could complete testing on approximately 1,900 samples per day. The diagnostic sensitivity of the high-throughput RRT-PCR assay was 0.9967 (95% CI 0.9937-0.9997) based on 926 virus isolation confirmed positive samples. Diagnostic specificity using an ...
Thank you for your interest in spreading the word about Haematologica.. NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address.. ...
MicroRNAs (miRs) have been identified as critical regulatory molecules in myocardial ischemia/reperfusion injury; however, the exact expression profile of miR-199a-5p in reperfusion injury and the underlying pathogenic mechanisms remain unclear. In the present study, it was revealed that miR-199a-5p expression was significantly increased in the plasma of patients with acute myocardial infarction and in a H9c2 cell model of oxygen-glucose deprivation and reperfusion (OGD/R) via reverse transcription-quantitative PCR. H9c2 cells were transfected with miR-199a-5p mimic or inhibitor, or short interfering RNA (siRNA) specific to hypoxia-inducible factor-1α (HIF-1α). MTS, lactate dehydrogenase (LDH), TUNEL staining and flow cytometry assays were performed to determine the proliferation, LDH activity, apoptosis and mitochondrial membrane potential (ΔΨm) of H9c2 cells, respectively. The overexpression of miR-199a-5p in the OGD/R cell model significantly decreased the viability and increased the ...
Real-time reverse-transcriptase Staurosporine purchase polymerase chain reaction (RT-PCR) was performed, as described previously,23 in a 96-well plate using a Bio-Rad iCycler iQ. The sequences of forward and reverse primers used for amplification are represented in Table 1. For each gene, a standard curve was established from four cDNA dilutions (1/10 to 1/10,000) and was used to determine relative gene-expression variation after normalization, with a geometric average of 18S and TATA box-binding protein expression. Results are expressed as means ± standard error of the mean (SEM). Data were subjected to one-way analysis of variance,. followed by the Tukey-Kramer post-hoc test. Differences were considered significant at P < 0.05. Concordant arguments from in vivo and in vitro studies suggest that hepatic expression of CB1R is submitted to an autoregulation process. HM781-36B cell line Activation of ECS by high-fat diets or by agonists is associated with an increase in the expression of CB1R, ...
We first examined whether there is any change in the expression of ARMS2 and HTRA1 between normal aged and AMD retinas without genotype constraints. The aged retinas were obtained from 20 unrelated individuals (average age=71.8 year), while the AMD group consisted of 12 retinas (average age=77.1 year). Gene expression was measured by real-time qRT-PCR and normalized to rRNA expression, with aged normal retinas as a reference. There was no significant difference in either ARMS2 or HTRA1 mRNA expression levels between the two groups (ARMS2, fold change average=1.051, p=0.487; HTRA1, fold change average=0.991, p=0.918). As predicted, the housekeeping genes (used as controls), HPRT1 and GAPDH, did not show significant change in expression with age (fold change average=0.963, p=0.376 and fold change average=0.997, p=0.934), validating a high quality of RNA from the human retinas for qRT-PCR analysis. To determine changes in RNA expression due to aging, we compared the gene expressions of normal young ...
MicroRNA-like RNAs (milRNAs) are short non-coding regulatory sRNAs which play an important role in regulating gene expression at the post-transcriptional level by targeting mRNAs for degradation or inhibiting protein translation. To explore the presence of milRNAs in Fusarium oxysporum f. sp. niveum (Fon) and analyze their expression at different propagules, two categories of sRNAs were identified ...
The quantitative polymerase chain reaction (qPCR) is a relatively new technique that combines the reliabiity of regular PCR with real-time screening.
Assessment of the reverse transcriptase polymerase chain reaction technique in the determination of the mRNA expression for the testicular angiotensin-converting enzyme in zinc treated rats ...
Sigma-Aldrich offers abstracts and full-text articles by [Youichi Higuchi, Motohiro Kojima, Genichiro Ishii, Kazuhiko Aoyagi, Hiroki Sasaki, Atsushi Ochiai].
cDNA library screening. A cDNA library constructed by H. Okayama (unpublished data) using mRNA from MCA16 cells (C3H10T1/2 mouse cells transformed by 3-methylcholanthrene; Shih et al., 1979) was screened with a 32P-labeled 782 bp PCR fragment (106 cpm/ml) coding for the motor domain of HsEg5 (human Eg5; nt 327-1109, accession number X85137; Blangy et al., 1995). A total of 1.5 × 105 colonies were transferred to nitrocellulose filters (Schleicher and Schuell, Keene, NH) and hybridized at 60°C for 24 hr in a hybridization buffer (6× SSC, 0.5× Denhardts solution, 0.1% SDS). Filters were washed four times at 60°C for 15 min in a solution containing 6× SSC and 0.5% SDS. Positive colonies were purified, and inserts were subcloned into pBluescript KS+ plasmid (Stratagene, La Jolla, CA). The remaining 120 bp at the 5′ end of the cDNA were obtained with a RT-PCR-based method using mRNA from mouse L cells primed with 5′ primer (5′-ATCTCGAGAACCATGGCGTCCCAGCCGAGTTC-3′) derived from genomic ...
We set out to investigate the serological response of TBE virus (TBEV)-specific IgM and IgG antibodies in stored serum and cerebrospinal fluid (CSF) in notified TBE patients, in order to confirm or reject the diagnosis. We applied the ELISA methods used in clinical practice, Enzygnost and Immunozym, and assessed RT-PCR as a diagnostic tool. A total of 173 TBE cases were notified to the Public Health Agency. Samples from 129 patients were eligible for the study. Stored serum samples were found for 111 patients and CSF samples for 88 patients. All serum samples were analyzed with both Enzygnost and Immunozym, as well as an additional 140 control samples. CSF samples, including samples from ten controls, were analyzed with Immunozym. RT-PCR for TBEV was performed on 126 serum, two whole blood, 96 CSF, two feces and four nasopharynx samples. Only two of 111 notified patients lacked detectable TBEV IgM in serum, from whom one sample was RT-PCR positive. According to the ECDC definition, 117/129 ...
Bioz Stars score, Techniques, Protocol Conditions and more for Polymerase Chain Reaction Pcr, supplied by . Data for Polymerase Chain Reaction Pcr gathered from related PubMed articles.
A literature search for non-uniform distributions of P values shows few citations [3, 5] and these both relate to statistical tests applied to expression results generated using Affymetrix microarrays. Huang et al. [5] compare gene expression profiles of tumours in three groups of mice using an Affymetrix Mouse Genechip array. When an ANOVA was performed on the expression of around 23,000 genes, a distribution of P values similar to Figure 1 was obtained. However when a t-test was applied to 2 of these groups, a distribution of P values similar to Figure 3 was obtained. The authors hypothesised that the reason for such a non-uniform distribution was due to excess biological similarity between some samples in the groups used for the t-test. This excess biological similarity was thought to be due to 2 pairs of samples being littermates of the same age and a further 2 pairs of samples were assayed at the same time. This resulted in the samples used for the t-test not being statistically ...
According to Stratistics MRC, the Global Polymerase Chain Reaction market is accounted for $6.95 billion in 2015 and is expected to reach $12.56 billion by...
Explore the structure of animal, plant, and bacteria cells along with their associated viruses with our three-dimensional graphics.
Targeting viral proteins early during infection may limit exacerbation of human cytomegalovirus infection. The viral chemokine-receptor homologue US28 interferes with leukocyte trafficking and, possibly, viral replication. Because US28 molecules are abundant on the surface of infected cells, this homologue is a potential target for antiviral therapy. To assess the relationship between US28 and disease activity, we measured, by quantitative reverse-transcription polymerase chain reaction, the levels of US28 and immediate-early (IE) 1 gene transcripts in the blood of lung-transplant recipients. We found that, during primary and secondary infection, the IE1 and US28 genes have early transcription kinetics and are expressed at similar levels. This may render US28 an attractive target for antiviral therapy ...
A neonate born to an Ebola virus-positive woman was diagnosed with Ebola virus infection on her first day of life. The patient was treated with monoclonal antibodies (ZMapp), a buffy coat transfusion from an Ebola survivor, and the broad-spectrum antiviral GS-5734. On day 20, a venous blood specimen tested negative for Ebola virus by quantitative reverse-transcription polymerase chain reaction. The patient was discharged in good health on day 33 of life. Further follow-up consultations showed age-appropriate weight gain and neurodevelopment at the age of 12 months. This patient is the first neonate documented to have survived congenital infection with Ebola virus ...
TY - JOUR. T1 - Quantitative real-time polymerase chain reaction (qRT-PCR) restriction fragment length polymorphism (RFLP) method for monitoring highly conserved transgene expression during gene therapy. AU - Bruzzone, Carol M.. AU - Belcher, John D.. AU - Schuld, Nathan J.. AU - Newman, Kristal A.. AU - Vineyard, Julie. AU - Nguyen, Julia. AU - Chen, Chunsheng. AU - Beckman, Joan D.. AU - Steer, Clifford J.. AU - Vercellotti, Gregory M.. PY - 2008/12. Y1 - 2008/12. N2 - Evaluation of the transfer efficiency of a rat heme oxygenase-1 (HO-1) transgene into mice requires differentiation of rat and mouse HO-1. However, rat and mouse HO-1 have 94% homology; antibodies and enzyme activity cannot adequately distinguish HO-1. We designed a quantitative real-time polymerase chain reaction (qRT-PCR) method to monitor HO-1 transcription relative to a housekeeping gene, GAPDH. The ratio of rat and mouse HO-1 mRNA could be estimated through restriction fragment length polymorphism (RFLP) analysis of the PCR ...
TY - JOUR. T1 - Hepatitis e virus (HEV) detection and quantification by a real-time reverse transcription-PCR assay calibrated to the world health organization standard for HEV RNA. AU - Germer, Jeffrey J.. AU - Ankoudinova, Irina. AU - Belousov, Yevgeniy S.. AU - Mahoney, Walt. AU - Dong, Chen. AU - Meng, Jihong. AU - Mandrekar, Jayawant. AU - Yao, Joseph D.. PY - 2017/5/1. Y1 - 2017/5/1. N2 - Hepatitis E virus (HEV) has emerged as a cause of chronic hepatitis among immunocompromised patients. Molecular assays have become important tools for the diagnosis and management of these chronically infected patients. A real-time reverse transcription-quantitative PCR (RT-qPCR) assay utilizing Pleiades probe chemistry and an RNA internal control for the simultaneous detection and quantification of HEV RNA in human serum was developed based on an adaptation of a previously described and broadly reactive primer set targeting the overlapping open reading frame 2/3 (ORF2/3) nucleotide sequence of HEV. A ...
We describe an improvement of an earlier reported real-time RT-PCR assay for the detection of enterovirus RNA, based on the 5 exonuclease digestion of a dual-labeled fluorogenic probe by Taq DNA polymerase. A different extraction method, real-time RT-PCR instrument and primer set were evaluated. Our data show that the optimized assay yields a higher sensitivity and reproducibility and resulted in a significant reduced hands-on time per sample.
PubMed Central Canada (PMC Canada) provides free access to a stable and permanent online digital archive of full-text, peer-reviewed health and life sciences research publications. It builds on PubMed Central (PMC), the U.S. National Institutes of Health (NIH) free digital archive of biomedical and life sciences journal literature and is a member of the broader PMC International (PMCI) network of e-repositories.
TY - JOUR. T1 - MRNA quantification after fluorescence activated cell sorting using locked nucleic acid probes. AU - Maruo, Rie. AU - Yamada, Hiroya. AU - Watanabe, Mikio. AU - Hidaka, Yoh. AU - Iwatani, Yoshinori. AU - Takano, Toru. PY - 2011/9/1. Y1 - 2011/9/1. N2 - Recently, we have established an in-tube in situ hybridization method named mRNA quantification after fluorescence activated cell sorting (FACS-mQ), in which a specific RNA in a particular cell type is stained with a florescent dye, allowing the stained cells to be selected by FACS without suffering excessive RNA degradation. Using this method, the biological characteristics of the sorted cells can be determined by analyzing their gene expression profile. In this study, we used locked nucleic acid (LNA) oligonucleotides, which are known to enhance both the sensitivity and specificity of RNA detection, as hybridization probes in FACS-mQ. When we used a LNA probe targeting the human 28S sequence, we were able to efficiently separate ...
Real time quantitative PCR (qPCR) and semi-quantitative PCR Transcript detection analysis was carried out by real time quantitative PCR (qPCR) with HotStarTaq DNA Polymerase (Qiagen). Selected genes were amplified from normalized cDNA samples (5 ml) with specific primers (0.8 µM of each primer) and probes (0.5 µM each probe) for Salmonella dnaK gene (accession no. U58360.1) and groEL gene (accession no. 1255856) were designed in this study with Primer3 software v.0.4.0: dnaK-Salm-FP 5accggtaactgaagccgtta3; dnaK-Salm-RP 5cgccatcaacttcgtcgatt3; dnaK-Salm-P 5FAM-gctggcttacggtctggata-TAMRA3; groEL-Salm-FP 5tgcaggatatcgctaccctg3; groEL-Salm-RP 5ctggatggcagcttcttcac3; groEL-Salm-P 5FAM-acaccaccaccatcatcgat3. The specific primers and probe for 16S rRNA gene (accession no.L26168) were designed by Vanghele (2013). For the semi-quantitative PCR, the amplicons were analysed on 1.5% agarose gel and visualized by ethidium bromide staining. Amplification program (iQ5 Real Time PCR ...
1. Chockalingm A, Campbell NR, Fodor JG. Worldwide epidemic of hypertension. Can J Cardio. 2006;22:553-555 2. Tomson J, Lip GYH. Blood Pressure demographic: nature or nurture…… genes or environment?. BMC Med. 2005;3:3 3. WHO. World Health Report 2002: Reducing Risks, Promoting Healthy life. Geneva: World Health Organization. 2002 4. Heller RA. et al. Discovery and analysis of inflammatory disease related genes using cDNA microarrays. Proc Nat Acad Sci. 1997;94:2150- 2155 5. Lockhart DJ, Dong H, Byrne MC, Follettie MT, Gallo MV, Chee MS, Mittmann M, Wang C, Kobayashi M, Horton H, Brown EL. Expression monitoring by hybridization to high-density oligonucleotide arrays. Nat Biotechnol. 1996;14:1675-80 6. Tzouvelekis A, Patlakas G, Bouros D. Application of Microarray Technology in pulmonary diseases. Respir Res. 2004;5:26 7. King HC, Sinha AA. Gene expression profile analysis by DNA microarrays: promise and pitfalls. JAMA. 2001;286:2280-2288 8. LI JJ. Inflammation in hypertension: primary ...
Cholesterol sulfate (CS) is a component of cell membranes that plays a role in stabilizing the cell membrane. We previously reported that CS increased in the endometrium during implantation, suggesting that CS plays an important role in reproduction. It has been reported that CS regulates progesterone and pregnenolone production in the placenta, adrenal glands and ovary. The regulatory mechanisms of steroid hormone production by CS, however, are still unknown. In the present study, we investigated the effect of CS on the expression of progesterone production-related genes in KGN cells, derived from human granulosa-like tumor. KGN cells were cultured with CS (10 μM) or cholesterol (10 μM) in the presence of 8-bromo-cAMP (1 mM). Progesterone levels in the culture media were measured by enzyme linked fluorescent assay at 24 h after treatment of CS and cAMP. Total RNAs were extracted for quantitative real time RT-PCR with specific primer of StAR protein, P450scc, HSD3B2, ferredoxin and ferredoxin ...
Search Results for Quantitative Real Time Pcr Qpcr on Bioz, providing objective ratings for all products used in life science research.
Two main patterns of gene expression of Streptococcus pneumoniae were observed during infection in the host by quantitative real time RT-PCR; one was characteristic of bacteria in blood and one of bacteria in tissue, such as brain and lung. Gene expression in blood was characterized by increased expression of pneumolysin, pspA and hrcA, while pneumococci in tissue infection showed increased expression of neuraminidases, metalloproteinases, oxidative stress and competence genes. In vitro situations with similar expression patterns were detected in liquid culture and in a newly developed pneumococcal model of biofilm respectively. The biofilm model was dependent on addition of synthetic competence stimulating peptide (CSP) and no biofilm was formed by CSP receptor mutants. As one of the differentially expressed gene sets in vivo were the competence genes, we exploited competence-specific tools to intervene on pneumococcal virulence during infection. Induction of the competence system by the ...
Background In this study, we investigated whether PKR protein expression is correlated with mRNA levels and also evaluated molecular biomarkers that are associated with PKR, such as phosphorylated PKR (p-PKR) and phosphorylated eIF2α (p-eIF2α). Methodology and Findings We determined the levels of PKR protein expression and mRNA in 36 fresh primary lung tumor tissues by using Western blot analysis and real-time reverse-transcriptase PCR (RT-PCR), respectively. We used tissue microarrays for immunohistochemical evaluation of the expression of p-PKR and p-eIF2α proteins. We demonstrated that PKR mRNA levels are significantly correlated with PKR protein levels (Spearmans rho = 0.55, p|0.001), suggesting that PKR protein levels in tumor samples are regulated by PKR mRNA. We also observed that the patients with high p-PKR or p-eIF2α expression had a significantly longer median survival than those with little or no p-PKR or p-eIF2α expression (p = 0.03 and p = 0.032, respectively). We further evaluated
In this study, we analyzed the expression of type I growth factor receptor gene family in a large series of primary breast cancers to establish the relationships between expression and the pathological, clinical, and biological parameters and the clinical outcome. The expression was quantified with a real-time RT-PCR assay. We recently developed a one-step RT-PCR method for the routine quantification of c-erbB-2 expression using a 7700 ABI PRISM sequence detector system (Perkin-Elmer-Applied Biosystems; Ref. 23 ). On the basis of this experience, we adapted the method to quantify the expression of the three other genes of the type I growth factor receptor family. The TBP gene was used to normalize the expression of the type I growth factor receptors. The use of TBP as a control RNA was relevant in these studies investigating prognosis because we observed that its expression was not associated with tumor aggressiveness (data not shown), in contrast with the widely used glyceraldehyde-3-phosphate ...
This is a temporary file and hence do not link it from a website, instead link the URL of this page if you wish to link the PDF file ...
Poon, L.L.M.; Peiris, J.S.Malik., 2008: Detection of group 1 coronaviruses in bats using universal coronavirus reverse transcription polymerase chain reactions
A novel nested reverse-transcriptase polymerase chain reaction method for rapid hepatitis C virus detection and genotyping. Saha, K.; Firdaus, R.; Biswas, A.; Mukherjee, A.; Sadhukhan, P. C. // Indian Journal of Medical Microbiology;Apr2014, Vol. 32 Issue 2, p130 Rapid and specific detection of viral nucleic acid is increasingly important in the diagnosis of infectious diseases. The objective was to develop a rapid, efficient process of nucleic acid based detection of hepatitis C virus (HCV) infection for its diagnosis and treatment follow-up. Materials... ...
TY - JOUR. T1 - Sustained upregulation of inflammatory chemokine and its receptor in aneurysmal and occlusive atherosclerotic disease. T2 - Results from tissue analysis with cDNA macroarray and real-time reverse transcriptional polymerase chain reaction methods. AU - Yamagishi, Masakazu. AU - Higashikata, Takeo. AU - Ishibashi-Ueda, Hatsue. AU - Sasaki, Hiroaki. AU - Ogino, Hitoshi. AU - Iihara, Koji. AU - Miyamoto, Susumu. AU - Nagaya, Noritoshi. AU - Tomoike, Hitonobu. AU - Sakamoto, Aiji. PY - 2005/12/1. Y1 - 2005/12/1. N2 - Background: Although cytokines are known to be pivotal in the development of atherosclerotic diseases, few data exist regarding their expressions in the established stages such as aneurysmal or occlusive lesions. Therefore, in the present study the gene expression levels of cytokine-related substances in abdominal aortic aneurysm (AAA) and carotid artery stenosis (CAS) were determined using cDNA macroarray and real-time reverse transcriptase polymerase chain reaction ...
Gene expression studies employing real-time PCR has become an intrinsic part of biomedical research. Appropriate normalization of target gene transcript(s) based on stably expressed housekeeping genes is crucial in individual experimental conditions to obtain accurate results. In multiple sclerosis (MS), several gene expression studies have been undertaken, however, the suitability of housekeeping genes to express stably in this disease is not yet explored. Recent research suggests that their expression level may vary under different experimental conditions. Hence it is indispensible to evaluate their expression stability to accurately normalize target gene transcripts. The present study aims to evaluate the expression stability of seven housekeeping genes in rat granule neurons treated with cerebrospinal fluid of MS patients. The selected reference genes were quantified by real time PCR and their expression stability was assessed using GeNorm and NormFinder algorithms. Both methods reported transferrin
Molecular characterization of two rocio flavivirus strains isolated during the encephalitis epidemic in são paulo state, brazil and the development of a one-step rt-pcr assay for diagnosis; Caracterização molecular de duas cepas do flavivírus Rocio, isoladas durante a epidemia de encefalite no Estado de São Paulo, Brasil e desenvolvimento do teste one-step RT-PCR para ...
The Ct or threshold cycle value is the cycle number at which the fluorescence generated within a reaction crosses the fluorescence threshold, a fluorescent signal significantly above the background fluorescence. At the threshold cycle, a detectable amount of amplicon product has been generated during the early exponential phase of the reaction. The threshold cycle is inversely proportional to the original relative expression level of the gene of interest ...
Chinese people; Western blotting; amino acids; anti-inflammatory activity; aspartate transaminase; asthma; blood serum; collagen; enzyme-linked immunosorbent assay; eosin; epinephrine; gene expression; guinea pigs; histopathology; immunoglobulin E; inflammation; interleukin-13; interleukin-4; interleukin-5; lungs; mass spectrometry; messenger RNA; metabolism; metabolites; metabolomics; ovalbumin; phospholipids; phosphorylation; protective effect; quantitative polymerase chain reaction; reverse transcriptase polymerase chain reaction; signal transduction; sphingolipids; staining; therapeutics; transcription factor NF-kappa B; ultra-performance liquid ...
in British Journal of Haematology (2012), 156(1), 76-88. The PRDM16 (1p36) gene is rearranged in acute myeloid leukaemia (AML) and myelodysplastic syndrome (MDS) with t(1;3)(p36;q21), sharing characteristics with AML and MDS with MECOM (3q26.2) translocations ... [more ▼]. The PRDM16 (1p36) gene is rearranged in acute myeloid leukaemia (AML) and myelodysplastic syndrome (MDS) with t(1;3)(p36;q21), sharing characteristics with AML and MDS with MECOM (3q26.2) translocations. We used fluorescence in situ hybridization to study 39 haematological malignancies with translocations involving PRDM16 to assess the precise breakpoint on 1p36 and the identity of the partner locus. Reverse-transcription polymerase chain reaction (PCR) was performed in selected cases in order to confirm the partner locus. PRDM16 expression studies were performed on bone marrow samples of patients, normal controls and CD34(+) cells using TaqMan real-time quantitative PCR. PRDM16 was rearranged with the RPN1 (3q21) locus in ...
Our portfolio of mRNA gene expression products include sample to insight solutions to enable quick, reliable gene expression analysis. As a leader in the field of high-performance SYBR® Green real-time PCR analysis, our qRT-PCR assays and arrays with comprehensive, easy-to-use data analysis tools deliver focused and accurate results, allowing you to overcome the bottlenecks in your gene expression studies. We provide you with the products that allow you to spend less time at the bench and more time interpreting your results ...
Touch DNA evidence is increasingly being collected and analyzed during criminal investigations. The purpose of this study was to determine if a significant amount of male (suspect) touch DNA can be collected from the clothes of assaulted victims after varying time intervals. A "grab and struggle" model was used to ...
The Titan One Step RT-PCR System is ideally suited for single-tube multiplex RT-PCR applications, such as gene expression assays which require normalization by comparison to a control (housekeeping) gene. Amplification of the gene(s) of interest simultaneously with the control gene in a single-tube reaction reduces the risk of introducing assay-to-assay variances which could influence the interpretation of results. An example of such single-tube duplex amplification of target and housekeeping gene can be found in Biochemica newsletter 1997, No 4: Optimization of the RT-PCR Method Using the Titan One Tube RT-PCR System ...
Aims: The object of the present study was to develop a novel multiplex reverse transcription-polymerase chain reaction (RT-PCR)-based assay to detect four common recurrent chromosomal translocations t(9;22)(q34;q11), t(15;17)(q22;q12), t(8;21)(q22;q22), and t(1;19)(q23;q13). Results: This novel multiplex RT-PCR method can specifically detect these six positive plasmids with known transcripts, and the sensitivities ...
Genomic amplification is associated frequently with an increased copy number of an oncogene or other cancer-related genes in human malignancy. Using the RLGS two-dimensional gel approach, we identified three amplified NotI/DpnII fragments in an esophageal adenocarcinoma (P16). The fragments were cloned, sequenced, and mapped to chromosome band 14q13. The core-amplified domain of the 14q13 amplicon was subsequently defined and characterized. The amplicon extends ,6 Mb, and the core-amplified domain is contained in a region ,0.3 Mb, which includes the HNF3α gene (Table 1) ⇓ . Real-time quantitative RT-PCR analysis revealed that HNF3α is overexpressed in all 5 of the amplified tumors (Table 2) ⇓ . Nuclear staining of the HNF3α protein was observed in the esophageal tumors containing the HNF3α amplicon. Amplification and overexpression of HNF3α were also found in lung adenocarcinomas. Overexpression of the HNF3α mRNA can be gene amplification dependent and independent, because elevated ...
Relative gene expression analysis requires precise, powerful and cutting edge technology called Real Time PCR, that is being utilized today by many research laboratories around the world.
Explore a wide spectrum of concepts in digital imaging in the Molecular Expressions library of information pertaining to digital photomicrography.
The desired end point for the description of a biological system is not the analysis of mRNA transcript levels alone but also the accurate measurement of protein expression levels and their respective activities. Quantitative analysis of global mRNA levels currently is a preferred method for the analysis of the state of cells and tissues (11). Several methods which either provide absolute mRNA abundance (34, 35) or relative mRNA levels in comparative analyses (20, 27) have been described elsewhere. The techniques are fast and exquisitely sensitive and can provide mRNA abundance for potentially any expressed gene. Measured mRNA levels are often implicitly or explicitly extrapolated to indicate the levels of activity of the corresponding protein in the cell. Quantitative analysis of protein expression levels (proteome analysis) is much more time-consuming because proteins are analyzed sequentially one by one and is not general because analyses are limited to the relatively highly expressed ...
Polymerase chain reaction Polymerase chain reaction (PCR) is a molecular biology technique[1] for enzymatically replicating DNA without using a living
Polymerase chain reaction (PCR) enables researchers to produce millions of copies of a specific DNA sequence in approximately two hours. This automated process bypasses the need to use bacteria for amplifying DNA.
Multiplex RT-PCR assays have been widely used tools for detection and differentiation of a panel of respiratory viral pathogens. In this study, we evaluated the Qiagen ResPlex II V2.0 kit and...
Quantitative real-time polymerase chain reaction (RT-qPCR) is a powerful tool used to measure gene expression. However, because of its high sensitivity, the method is strongly influenced by the quality and concentration of the template cDNA and by the amplification efficiency. Relative quantification is an effective strategy for correcting random and systematic errors by using the expression level of reference gene(s) to normalize the expression level of the genes of interest. To identify soybean reference genes for use in studies of flooding stress, we compared 5 candidate reference genes (CRGs) with the NormFinder and GeNorm programs to select the best internal control. The expression stability of the CRGs was evaluated in root tissues from soybean plants subjected to hypoxic conditions. Elongation factor 1-beta and actin-11 were identified as the most appropriate genes for RT-qPCR normalization by both the NormFinder and GeNorm analyses. The expression profiles of the genes for alcohol ...
Global Laser capture microdissection market is segmented into product, type, end-user and geographic regions. Laser Capture Microdissection (LCM) technology is a contagion free process for obtaining sub-populations of tissue cells under direct microscopic apparition. In addition, laser-capture Microdissection technology isolates specific cells by dissecting unwanted cells. Laser Capture Microdissection technology harvests the cells of attentionstraight to give pure enriched cells. This technology helps in preservingthe genuine morphology of the dissected cell or tissue sample. The Laser Capture Microdissection technology by type can be segmented into software, instruments, consumables, and services.. Rise inspending on healthcare along with technical advancement in the field of healthcare is one of the major factors for the Laser Capture Microdissection market. In addition, increasing information concerning the technical compensation obtained from Laser Capture Microdissection techniques is ...
The insulin-like growth factor system (insulin-like growth factor 1, insulin-like growth factor 2, insulin-like growth factor 1 receptor, insulin-like growth factor 2 receptor and six insulinlike growth factor-binding proteins) and insulin are essential to muscle metabolism and most aspects of male and female reproduction. Insulin-like growth factor and insulin play important roles in the regulation of cell growth, differentiation and the maintenance of cell differentiation in mammals. In order to better understand the local factors that regulate equine physiology, such as muscle metabolism and reproduction (e.g., germ cell development and fertilisation), real-time reverse transcription polymerase chain reaction assays for quantification of equine insulin-like growth factor 1 receptor and insulin receptor messenger ribonucleic acid were developed. The assays were sensitive: 192 copies/μL and 891 copies/μL for insulin-like growth factor 1 receptor, messenger ribonucleic acid and insulin ...
Purpose: Retinopathy of prematurity (ROP) is a common blinding disease caused by the abnormal growth of blood vessels in the retina of premature babies with low birth weight and low gestation period. However, the mechanisms and factors contributing to the progression of ROP are still unknown. The present study aimed to identify gene(s) responsible for ROP progression by a global gene expression profiling.. Methods: From a cohort of 600 subjects comprising ROP babies (n=350) and controls (n=250), 15 ROP babies at any stage (gestational age [GA] ≤ 35 weeks and/or birth weight [BW] ≤ 1700 g) and premature babies with no ROP (n=6) (GA ≤ 35 weeks and/or BW ≤ 1700 g) and full term babies of the same age and no ROP (n=3), were screened. RNA was isolated from 0.5-1 ml of blood using RNeasy mini kit from Qiagen and the purity and integrity of RNA was checked with Bioanalyzer 2100 (Agilent). Global gene expression profiling was performed by using Illumina bead Chip array having ~47,000 ...
Two different real-time polymerase chain reaction (PCR) detection approaches based on SYBR Green I dye and Taqman probe based assays were developed for the detection and differentiation of infectious bursal disease virus (IBDV) subtypes. Both approaches were able to detect and differentiate IBDV subtypes based on the use of subtype-specific primers or subtype-specific probes where the primers were designed based on single nucleotide polymorphism (SNP) concept. After optimization of the primer combinations and PCR parameters, very virulent-specific primer, IF & IVIR, and classical-specific primer, IF & RCLA were used in the SYBR Green I real-time RT-PCR assay. Plasmid DNA carrying the VP4 gene of the references IBDV strains: very virulent strain UPM94/273 and classical strain D78 were established and used as positive controls in the real time RT-PCR. The developed assay had a dynamic detection limit which spans over 5 log10 concentration range for very virulent and spans over 7 log10 ...
A correlative immunohistochemical and reverse-transcriptase polymerase chain reaction analysis". Virchows Arch. 440 (5): 461-75 ...
A correlative immunohistochemical and reverse-transcriptase polymerase chain reaction analysis". Virchows Archiv. 440 (5): 461- ...
Grillo M, Margolis FL (September 1990). "Use of reverse transcriptase polymerase chain reaction to monitor expression of ... Becker-André M, Hahlbrock K (November 1989). "Absolute mRNA quantification using the polymerase chain reaction (PCR). A novel ... RNA is first copied as complementary DNA (cDNA) by a reverse transcriptase enzyme before the resultant cDNA is sequenced. The ... and later Reverse Transcriptase quantitative PCR (RT-qPCR) methods, but these methods are laborious and can only capture a tiny ...
Biswal M, Ratho R, Mishra B (September 2007). "Usefulness of reverse transcriptase-polymerase chain reaction for detection of ... 10: PCR technology for lyssavirus diagnosis". In Clewley, J.P. The Polymerase Chain Reaction (PCR) for Human Viral Diagnosis. ... the viral polymerase will begin to synthesize new negative strands of RNA from the template of the positive strand RNA. These ... and the viral RNA polymerase (L). Once within a muscle or nerve cell, the virus undergoes replication. The trimeric spikes on ...
... in gynecologic malignancies and malignant effusions detected by nested reverse transcriptase-polymerase chain reaction". ...
... the altered activation will be examined by reverse-transcriptase-polymerase chain reaction (RTPCR) analysis of induced genes. ...
Feline coronavirus quantitative reverse transcriptase polymerase chain reaction on effusion samples in cats with and without ... Comparison of real-time reverse transcriptase polymerase chain reaction of peripheral blood mononuclear cells, serum and cell- ... Sensitivity and specificity of a real-time reverse transcriptase polymerase chain reaction detecting feline coronavirus ... by reverse-transcriptase polymerase chain reaction (RT-PCR) is diagnostic of effusive FIP. However, that does require that a ...
Reverse transcriptase polymerase chain reaction (RT-PCR) methods have been developed for detection of TSV and are very ... The IQ2000TM TSV detection system, a RT-PCR method, is said to have a detection limit of 10 copies per reaction. RNA-based ... These very high rates might be due to the lack of proofreading function of the RNA-dependent RNA polymerase and have resulted ...
... prognostic value of detection of circulating colorectal cancer cells using CGM2 reverse transcriptase-polymerase chain reaction ...
The genome is detectable by reverse transcriptase-polymerase chain reaction in the head, thorax, abdomen and wings of infected ... The genome structure is 5'UTR-L-VP2-(VP4)-VP1-VP3-RNA helicase-(VPg)-3C protease-RNA dependent RNA polymerase-3'UTR The ... a chymotrypsin-like 3C protease and an RNA-dependent RNA polymerase. VP1 is encoded between codons 486 to 880 and VP3 lies ...
ISBN 978-0-470-84475-5. Callahan JD, et al., Use of a portable real-time reverse transcriptase-polymerase chain reaction assay ... Quantitative PCR utilizes polymerase chain reaction chemistry to amplify viral DNA or RNA to produce high enough concentrations ... "Taqman Technology and Real-Time Polymerase Chain Reaction". In Crocker, J.; Murray, P.G. Molecular Biology in Cellular ... SYBR Green dye binds to all double-stranded DNA produced during the reaction. While SYBR Green is easy to use, its lack of ...
The role of reverse transcriptase polymerase chain reaction assay for prostate specific antigen in the selection of patients ... "Enhanced Reverse Transcriptase Polymerase Chain Reaction for Prostate-specific Antigen Combined With Needle Biopsy Results: A ... The detection of renal Carcinoma cells in the peripheral blood with an enhanced reverse transcriptase-polymerase chain reaction ...
These tags can be appended to gene specific primers for reverse transcriptase polymerase chain reaction (RT-PCR) experiments, ... In order to overcome genomic DNA contamination in transcriptional studies, reverse template-specific polymerase chain reaction ... of using tags whose sequences are not found in the genome further improves reverse specific polymerase chain reaction ... Shuldiner, Alan R.; Ajay Nirula; Jesse Roth (1990). "RNA template-specific polymerase chain reaction (RS-PCR): a novel strategy ...
Ikeguchi M, Hirooka Y, Kaibara N (Sep 2003). "Quantitative reverse transcriptase polymerase chain reaction analysis for KiSS-1 ...
2006). "A validated quantitative assay to detect occult micrometastases by reverse transcriptase-polymerase chain reaction of ... 2009). "GUCY2C reverse transcriptase PCR to stage pN0 colorectal cancer patients". Expert Rev. Mol. Diagn. 9 (8): 777-85. doi: ...
... and Application for Localization in Various Human Tissues by Real-Time Reverse Transcriptase-Polymerase Chain Reaction". Drug ... glucuronides is known to occur to nucleophilic sites on serum albumin via transacylation reactions, for example. Phenols, ...
... and Application for Localization in Various Human Tissues by Real-Time Reverse Transcriptase-Polymerase Chain Reaction". Drug ... Al-Zoughool M., Talaska, G. (2006). "4-Aminobiphenyl N-glucuronidation by liver microsomes: optimization of the reaction ...
The identification of HMPV has predominantly relied on reverse-transcriptase polymerase chain reaction (RT-PCR) technology to ...
"Detection of human 11 beta-hydroxysteroid dehydrogenase isoforms using reverse-transcriptase-polymerase chain reaction and ... In addition, the encoded protein can catalyze the reverse reaction, the conversion of cortisone to cortisol. Too much cortisol ...
Reverse transcriptase polymerase chain reaction (RT-PCR) has become a powerful and effective method for detection of potato ... Different types of reverse transcriptase polymerases are available to suit different needs and reaction conditions. Reverse ... It could also be that the reverse transcriptase polymerase and DNA polymerase is one and the same enzyme and that the enzyme ... the RNA of the virus must first be transcribed to DNA by means of a reverse transcriptase polymerase. This polymerase ...
... a reverse transcriptase-polymerase chain reaction (RT-PCR) study, Eastwood et al., Molecular Brain Research Vol44, Iss1, ... For the latter, PICK1 and PKC can displace GRIP1 to return AMPARs to the surface, reversing the effects of endocytosis and LTD ... of excitatory neurotransmission by decanoic acid in the brain contributes to the anticonvulsant effect of the medium-chain ...
Splice modification can be conveniently assayed by reverse-transcriptase polymerase chain reaction (RT-PCR) and is seen as a ... Morpholinos are used as research tools for reverse genetics by knocking down gene function. This article discusses only the ...
... reverse transcriptase-polymerase chain reaction (RT-PCR) and in situ-RT-PCR for the detection of canine distemper virus RNA in ... and other evidence suggests an intrinsic hyperresponsive reaction to vitamin D and RANK ligand is the cause.[citation needed] ...
... a reverse transcriptase-polymerase chain reaction (RT-PCR) study, Eastwood et al., Molecular Brain Research Vol44, Iss1, ... reversing the effects of endocytosis and LTD. when appropriate.[66] Nevertheless, the highlighted calcium-dependent, dynamin- ... of excitatory neurotransmission by decanoic acid in the brain contributes to the anticonvulsant effect of the medium-chain ...
... other interstitial lung disease during clinical studies applying quantitative reverse transcriptase-polymerase chain reaction ( ...
... and reverse transcriptase activity (using reverse transcriptase polymerase chain reaction techniques) from neoplastic tissue. ... amino acid identity in the pol region of reverse transcriptase. This finding suggests that they are different strains of the ...
... polymerase - Polymerase chain reaction (PCR) - polyneuritis - polypeptide - polyvalent vaccine - post-exposure prophylaxis (PEP ... reverse transcriptase - ribonucleic acid (RNA) - ribosome - RNA - route of administration - RT-PCR - RTI - Ryan White C.A.R.E. ... non-nucleoside reverse transcriptase inhibitors (NNRTI) - non-steroidal anti-inflammatory drugs (NSAID) - NRTI - nucleic acid ... nucleoside reverse transcriptase inhibitors (NRTI) - nucleotide - nucleotide analogs - nucleus - null cell ...
... reverse-transcriptase polymerase chain reaction, and nucleic acid microarrays for specialized studies of disease in tissues and ...
... and p21 were measured by reverse transcriptase-polymerase chain reaction (RT-PCR); changes of cell cycle,and expression of ... mRNA levels of human telomerase reverse transcriptase (h TERT), ... act ivity in SMMC-7721 cells was detected by polymerase chain ... reaction (PCR)-based telomeric repeat amplification protocol (TRAP) coupled with enzyme-linked immu ne sorbent assay(ELISA); ... mRNA levels of human telomerase reverse transcriptase (h TERT),and p21 were measured by reverse transcriptase-polymerase chain ...
A comparison of in situ hybridisation, reverse transcriptase-polymerase chain reaction (RT-PCR) and in situ-RT-PCR for the ... reverse transcriptase-polymerase chain reaction (RT-PCR), and in situ-RT-PCR (IS-RT-PCR), others have found no evidence of ...
Locale about Experts and Doctors on reverse transcriptase polymerase chain reaction in Netherlands ... Experts and Doctors on reverse transcriptase polymerase chain reaction in Netherlands. Summary. Locale: Netherlands ... You are here: Locale , Experts and Doctors on reverse transcriptase polymerase chain reaction in Netherlands ... beta chain t cell antigen receptor gene rearrangement*tribolium*hiv receptors*desmoplakins*earless seals*complement membrane ...
... of HPV-16 E6-E7 transcription in cervical intraepithelial neoplasia by reverse transcriptase polymerase chain reaction.. Hsu EM ...
A Study of an Ad26.RSV.preF-based Regimen in the Prevention of Reverse Transcriptase Polymerase Chain Reaction (RT-PCR)- ... A Study of an Ad26.RSV.preF-based Regimen in the Prevention of Reverse Transcriptase Polymerase Chain Reaction (RT-PCR)- ... is to demonstrate the efficacy of active study vaccine in the prevention of reverse transcriptase polymerase chain reaction (RT ...
A Study of an Ad26.RSV.preF-based Regimen in the Prevention of Reverse Transcriptase Polymerase Chain Reaction (RT-PCR)- ... Confirmed by Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) [ Time Frame: Up to 1.6 years ]. Percentage of ... is to demonstrate the efficacy of active study vaccine in the prevention of reverse transcriptase polymerase chain reaction (RT ... Participant has a known allergy, or history of anaphylaxis or other serious adverse reactions to vaccines or vaccine components ...
Rapid detection and typing of dengue viruses from clinical samples by using reverse transcriptase-polymerase chain reaction.. R ... Rapid detection and typing of dengue viruses from clinical samples by using reverse transcriptase-polymerase chain reaction. ... Rapid detection and typing of dengue viruses from clinical samples by using reverse transcriptase-polymerase chain reaction. ... Rapid detection and typing of dengue viruses from clinical samples by using reverse transcriptase-polymerase chain reaction. ...
... general DNA polymerases Analysis Dogs Gastroenteritis Polymerase chain reaction RNA ... Comparative Evaluation of Immunochromatographic and Reverse Transcriptase Polymerase Chain Reaction based tests for Diagnosis ... Reverse-transcriptase-polymerase chain reaction (RT-PCR) has been applied successfully for detection of canine distemper virus ... APA style: Comparative Evaluation of Immunochromatographic and Reverse Transcriptase Polymerase Chain Reaction based tests for ...
cDNA is made from RNA by the enzyme reverse transcriptase. The resultant cDNA is then amplified using PCR technique. ... reverse transcriptase polymerase chain reaction. Synonyms: *RT-PCR. German: Reverse Transkriptase-Polymerase-Kettenreaktion ...
... of the Whole Arabidopsis Shaggy-Like Kinase Multigene Family by Real-Time Reverse Transcriptase-Polymerase Chain Reaction. ... 2000) Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. J Mol Endocrinol ... of the family has been performed using the technique of real-time quantitative reverse transcriptase-polymerase chain reaction ... of the Whole Arabidopsis Shaggy-Like Kinase Multigene Family by Real-Time Reverse Transcriptase-Polymerase Chain Reaction ...
It is Reverse Transcriptase-Polymerase Chain Reaction Technique. Reverse Transcriptase-Polymerase Chain Reaction Technique ... Reverse Transcriptase-Polymerase Chain Reaction Technique. Looking for abbreviations of RT-PCR? ... Reverse Transcriptase-Polymerase Chain Reaction Technique - How is Reverse Transcriptase-Polymerase Chain Reaction Technique ... Reverse Transcriptase-Polymerase Chain Reaction Technique. RT-PCR. Reverse Transcription and Polymerase Chain Reaction Analysis ...
Multimarker Reverse Transcriptase-Polymerase Chain Reaction Assay in Lymphatic Drainage and Sentinel Node Tumor Burden. ... multimarker reverse transcriptase-polymerase chain reaction [MM-RT-PCR] with primers for tyrosinase, MART1 (MelanA), and uMAGE ... Multimarker Reverse Transcriptase-Polymerase Chain Reaction Assay in Lymphatic Drainage and Sentinel Node Tumor Burden. Annals ...
Use of a Portable Real-Time Reverse Transcriptase-Polymerase Chain Reaction Assay for Rapid Detection of Foot-And-Mouth Disease ... Use of a Portable Real-Time Reverse Transcriptase-Polymerase Chain Reaction Assay for Rapid Detection of Foot-And-Mouth Disease ... Objective: To evaluate a portable real-time reverse transcriptase-polymerase chain reaction (RT-PCR) assay designed to detect ... Foot-and-mouth disease virus detection on a handheld real-time polymerase chain reaction platform. Hole K, Nfon C. Hole K, et ...
Sensitivity and specificity of a real-time reverse transcriptase polymerase chain reaction detecting feline coronavirus ... aim of this study was to evaluate sensitivity and specificity of a real-time reverse transcriptase polymerase chain reaction ( ...
A reverse transcriptase-polymerase chain reaction assay was used to detect measles virus RNA in peripheral blood mononuclear ... Reverse Transcriptase Polymerase Chain Reaction, Support, Non-U.S. Govt, Support, U.S. Govt, P.H.S., Time Factors, Urine, ... detected by reverse transcriptase- polymerase chain reaction. The Journal of infectious diseases, 183 (4). pp. 532-8. ISSN 0022 ... detected by reverse transcriptase- polymerase chain reaction ...
Subject reverse transcriptase polymerase chain reaction Remove constraint Subject: reverse transcriptase polymerase chain ... reverse transcriptase polymerase chain reaction, etc ; Fusarium oxysporum f. sp. niveum; biosynthesis; conidia; gene expression ... quantitative polymerase chain reaction; trichothecenes; Show all 14 Subjects. Abstract:. ... MicroRNA-like RNAs (milRNAs) are ... reaction Journal 3 Biotech Remove constraint Journal: 3 Biotech Subject gene expression Remove constraint Subject: gene ...
Reverse Transcriptase-Polymerase Chain Reaction. Semiquantitative reverse transcriptase-polymerase chain reaction (RT-PCR) was ... reverse) (681 bp); and β-actin, TTCTA CAATG AGCTG CGTGT G (forward) and TTCAT GGATG CCACA GGATT C (reverse) (561 bp). The PCR ... Yang H, et al. (2004) Reversing established sepsis with antagonists of endogenous high-mobility group box 1. Proc. Natl. Acad. ... and the NO reaction products NO2−/NO3− (D) were measured as described in Materials and Methods. *p , 0.05 versus 0 time. ...
Reverse transcriptase polymerase chain reaction (RT-PCR). First-strand cDNA was synthesized by incubating 3 μg isolated mRNA, ... After chilling, reverse transcriptase, dithiothreitol and RNase inhibitor (Invitrogen Superscript III First-Strand Synthesis ... The reaction was inactivated by the addition of RNase H. PCR reactions were prepared in 50 μl volumes containing 1x ... Click-it reaction was performed according to the manufacturers description (Invitrogen). Flow cytometry was performed on a FACS ...
This is an historical archive of the activities of the MRC Anatomical Neuropharmacology Unit (MRC ANU) that operated at the University of Oxford from 1985 until March 2015. The MRC ANU established a reputation for world-leading research on the brain, for training new generations of scientists, and for engaging the general public in neuroscience. The successes of the MRC ANU are now built upon at the MRC Brain Network Dynamics Unit at the University of Oxford.. ...
Reverse-transcriptase quantitative polymerase chain reaction (RT-qPCR). Microarray results were validated using RT-qPCR of 41 ... immobilized onto DNA capture beads and emulsified in oil for polymerase chain reaction (emPCR). The emPCR was titrated to ... Briefly, 500 ng of total RNA was reverse transcribed into cDNA in a 6.3 μL reaction containing 250 ng of random primers and ... SuperScript III reverse transcriptase (Invitrogen, Carlsbad, CA), following the manufacturers protocol. RT-qPCR was performed ...
Semiquantitative reverse transcriptase polymerase chain reaction. Oligonucleotide primers (Tyndale et al., 1994) for α4 (503 bp ... Assessment of α4 mRNA levels after 3α,5α-THP withdrawal with semiquantitative reverse transcriptase polymerase chain reaction ( ... were housed in groups of three under a reverse light/dark cycle (14/10 hr light/dark). Food and water were available ad libitum ... Total RNA was isolated using Tri reagent and a chloroform extraction and was followed by reverse transcription (SuperScript II ...
Reverse transcriptase-polymerase chain reaction. Total RNA was extracted from cells using RNeasy Mini Kit (Qiagen, Hilden, ... PCR amplifications were performed using 2 μL of the reverse transcription products in 25 μL of reaction with puReTaq Ready-to- ... G) Mixed lymphocyte reaction (MLR) of myeloid cells differentiated by PU.1 or MafB activation. Ctrl, PU.1, and MafB clones were ... Pierre P, Mellman I. Developmental regulation of invariant chain proteolysis controls MHC class II trafficking in mouse ...
Reverse Transcriptase-Polymerase Chain Reaction. The relative expression of GTPCH, PTPS, cNOS, and iNOS mRNAs compared with the ... Reverse-transcription/limiting-dilution polymerase chain reaction analysis showed that in response to IFN/TNF/IL-1, mRNA ... and first-strand cDNA was used as a template in polymerase chain reaction (PCR). cDNA aliquots were amplified with the ... For comparative determination of mRNA levels, limiting-dilution PCRs of cDNA were performed.13 14 After reverse transcription ( ...
Reverse-Transcriptase Polymerase Chain Reaction. Cellular RNA was extracted with Trizol reagent and 20 μg glycogen followed by ... The CD4+CD28null phenotype was further confirmed by reverse-transcriptase polymerase chain reaction (RT-PCR) analysis of mRNA ... Detection of cell specific cluster determinant expression by reverse transcriptase polymerase chain reaction. J Immunol Methods ... cDNA synthesis with Superscript II reverse transcriptase and random hexamers (Life Technologies). Amplification of IFN-γ and ...
Reverse Transcriptase Polymerase Chain Reaction Type of study: Prevalence_studies / Screening_studies Clinical aspect: Etiology ... respiratory infections in children in southwestern Saudi Arabia using multiplex reverse-transcriptase polymerase chain reaction ... transcriptase polymerase chain reaction [RT-PCR], and to analyze the clinical and epidemiological features of these viruses. In ... Reverse Transcriptase Polymerase Chain Reaction , Child ...

No FAQ available that match "reverse transcriptase polymerase chain reaction"