Microphthalmos: Congenital or developmental anomaly in which the eyeballs are abnormally small.Transcription Factors: Endogenous substances, usually proteins, which are effective in the initiation, stimulation, or termination of the genetic transcription process.Anophthalmos: Congenital absence of the eye or eyes.Microphthalmia-Associated Transcription Factor: A basic helix-loop-helix leucine zipper transcription factor that regulates the CELL DIFFERENTIATION and development of a variety of cell types including MELANOCYTES; OSTEOCLASTS; and RETINAL PIGMENT EPITHELIUM. Mutations in MITF protein have been associated with OSTEOPETROSIS and WAARDENBURG SYNDROME.Transcription, Genetic: The biosynthesis of RNA carried out on a template of DNA. The biosynthesis of DNA from an RNA template is called REVERSE TRANSCRIPTION.DNA-Binding Proteins: Proteins which bind to DNA. The family includes proteins which bind to both double- and single-stranded DNA and also includes specific DNA binding proteins in serum which can be used as markers for malignant diseases.Coloboma: Congenital anomaly in which some of the structures of the eye are absent due to incomplete fusion of the fetal intraocular fissure during gestation.Promoter Regions, Genetic: DNA sequences which are recognized (directly or indirectly) and bound by a DNA-dependent RNA polymerase during the initiation of transcription. Highly conserved sequences within the promoter include the Pribnow box in bacteria and the TATA BOX in eukaryotes.Molecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.Base Sequence: The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.Sp1 Transcription Factor: Promoter-specific RNA polymerase II transcription factor that binds to the GC box, one of the upstream promoter elements, in mammalian cells. The binding of Sp1 is necessary for the initiation of transcription in the promoters of a variety of cellular and viral GENES.Gene Expression Regulation: Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control (induction or repression) of gene action at the level of transcription or translation.Eye Abnormalities: Congenital absence of or defects in structures of the eye; may also be hereditary.Transcriptional Activation: Processes that stimulate the GENETIC TRANSCRIPTION of a gene or set of genes.Homeodomain Proteins: Proteins encoded by homeobox genes (GENES, HOMEOBOX) that exhibit structural similarity to certain prokaryotic and eukaryotic DNA-binding proteins. Homeodomain proteins are involved in the control of gene expression during morphogenesis and development (GENE EXPRESSION REGULATION, DEVELOPMENTAL).Trans-Activators: Diffusible gene products that act on homologous or heterologous molecules of viral or cellular DNA to regulate the expression of proteins.Binding Sites: The parts of a macromolecule that directly participate in its specific combination with another molecule.RNA, Messenger: RNA sequences that serve as templates for protein synthesis. Bacterial mRNAs are generally primary transcripts in that they do not require post-transcriptional processing. Eukaryotic mRNA is synthesized in the nucleus and must be exported to the cytoplasm for translation. Most eukaryotic mRNAs have a sequence of polyadenylic acid at the 3' end, referred to as the poly(A) tail. The function of this tail is not known for certain, but it may play a role in the export of mature mRNA from the nucleus as well as in helping stabilize some mRNA molecules by retarding their degradation in the cytoplasm.Repressor Proteins: Proteins which maintain the transcriptional quiescence of specific GENES or OPERONS. Classical repressor proteins are DNA-binding proteins that are normally bound to the OPERATOR REGION of an operon, or the ENHANCER SEQUENCES of a gene until a signal occurs that causes their release.Basic Helix-Loop-Helix Transcription Factors: A family of DNA-binding transcription factors that contain a basic HELIX-LOOP-HELIX MOTIF.Mutation: Any detectable and heritable change in the genetic material that causes a change in the GENOTYPE and which is transmitted to daughter cells and to succeeding generations.Gene Expression Regulation, Developmental: Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action during the developmental stages of an organism.Protein Binding: The process in which substances, either endogenous or exogenous, bind to proteins, peptides, enzymes, protein precursors, or allied compounds. Specific protein-binding measures are often used as assays in diagnostic assessments.Nuclear Proteins: Proteins found in the nucleus of a cell. Do not confuse with NUCLEOPROTEINS which are proteins conjugated with nucleic acids, that are not necessarily present in the nucleus.Transcription Factor AP-1: A multiprotein complex composed of the products of c-jun and c-fos proto-oncogenes. These proteins must dimerize in order to bind to the AP-1 recognition site, also known as the TPA-responsive element (TRE). AP-1 controls both basal and inducible transcription of several genes.Forkhead Transcription Factors: A subclass of winged helix DNA-binding proteins that share homology with their founding member fork head protein, Drosophila.Cell Line: Established cell cultures that have the potential to propagate indefinitely.Amino Acid Sequence: The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.Signal Transduction: The intracellular transfer of information (biological activation/inhibition) through a signal pathway. In each signal transduction system, an activation/inhibition signal from a biologically active molecule (hormone, neurotransmitter) is mediated via the coupling of a receptor/enzyme to a second messenger system or to an ion channel. Signal transduction plays an important role in activating cellular functions, cell differentiation, and cell proliferation. Examples of signal transduction systems are the GAMMA-AMINOBUTYRIC ACID-postsynaptic receptor-calcium ion channel system, the receptor-mediated T-cell activation pathway, and the receptor-mediated activation of phospholipases. Those coupled to membrane depolarization or intracellular release of calcium include the receptor-mediated activation of cytotoxic functions in granulocytes and the synaptic potentiation of protein kinase activation. Some signal transduction pathways may be part of larger signal transduction pathways; for example, protein kinase activation is part of the platelet activation signal pathway.Aphakia: Absence of crystalline lens totally or partially from field of vision, from any cause except after cataract extraction. Aphakia is mainly congenital or as result of LENS DISLOCATION AND SUBLUXATION.Skin Abnormalities: Congenital structural abnormalities of the skin.Cell Differentiation: Progressive restriction of the developmental potential and increasing specialization of function that leads to the formation of specialized cells, tissues, and organs.DNA: A deoxyribonucleotide polymer that is the primary genetic material of all cells. Eukaryotic and prokaryotic organisms normally contain DNA in a double-stranded state, yet several important biological processes transiently involve single-stranded regions. DNA, which consists of a polysugar-phosphate backbone possessing projections of purines (adenine and guanine) and pyrimidines (thymine and cytosine), forms a double helix that is held together by hydrogen bonds between these purines and pyrimidines (adenine to thymine and guanine to cytosine).Paired Box Transcription Factors: A family of transcription factors that control EMBRYONIC DEVELOPMENT within a variety of cell lineages. They are characterized by a highly conserved paired DNA-binding domain that was first identified in DROSOPHILA segmentation genes.Basic-Leucine Zipper Transcription Factors: A large superfamily of transcription factors that contain a region rich in BASIC AMINO ACID residues followed by a LEUCINE ZIPPER domain.Transcription Factor AP-2: A family of DNA binding proteins that regulate expression of a variety of GENES during CELL DIFFERENTIATION and APOPTOSIS. Family members contain a highly conserved carboxy-terminal basic HELIX-TURN-HELIX MOTIF involved in dimerization and sequence-specific DNA binding.Transfection: The uptake of naked or purified DNA by CELLS, usually meaning the process as it occurs in eukaryotic cells. It is analogous to bacterial transformation (TRANSFORMATION, BACTERIAL) and both are routinely employed in GENE TRANSFER TECHNIQUES.Cell Nucleus: Within a eukaryotic cell, a membrane-limited body which contains chromosomes and one or more nucleoli (CELL NUCLEOLUS). The nuclear membrane consists of a double unit-type membrane which is perforated by a number of pores; the outermost membrane is continuous with the ENDOPLASMIC RETICULUM. A cell may contain more than one nucleus. (From Singleton & Sainsbury, Dictionary of Microbiology and Molecular Biology, 2d ed)Kruppel-Like Transcription Factors: A family of zinc finger transcription factors that share homology with Kruppel protein, Drosophila. They contain a highly conserved seven amino acid spacer sequence in between their ZINC FINGER MOTIFS.Helix-Loop-Helix Motifs: Recurring supersecondary structures characterized by 20 amino acids folding into two alpha helices connected by a non-helical "loop" segment. They are found in many sequence-specific DNA-BINDING PROTEINS and in CALCIUM-BINDING PROTEINS.Transcription Factors, TFII: The so-called general transcription factors that bind to RNA POLYMERASE II and that are required to initiate transcription. They include TFIIA; TFIIB; TFIID; TFIIE; TFIIF; TFIIH; TFII-I; and TFIIJ. In vivo they apparently bind in an ordered multi-step process and/or may form a large preinitiation complex called RNA polymerase II holoenzyme.Abnormalities, MultipleChromatin Immunoprecipitation: A technique for identifying specific DNA sequences that are bound, in vivo, to proteins of interest. It involves formaldehyde fixation of CHROMATIN to crosslink the DNA-BINDING PROTEINS to the DNA. After shearing the DNA into small fragments, specific DNA-protein complexes are isolated by immunoprecipitation with protein-specific ANTIBODIES. Then, the DNA isolated from the complex can be identified by PCR amplification and sequencing.Cells, Cultured: Cells propagated in vitro in special media conducive to their growth. Cultured cells are used to study developmental, morphologic, metabolic, physiologic, and genetic processes, among others.Genes, Reporter: Genes whose expression is easily detectable and therefore used to study promoter activity at many positions in a target genome. In recombinant DNA technology, these genes may be attached to a promoter region of interest.Phenotype: The outward appearance of the individual. It is the product of interactions between genes, and between the GENOTYPE and the environment.Basic Helix-Loop-Helix Leucine Zipper Transcription Factors: A family of transcription factors that contain regions rich in basic residues, LEUCINE ZIPPER domains, and HELIX-LOOP-HELIX MOTIFS.Melanocytes: Mammalian pigment cells that produce MELANINS, pigments found mainly in the EPIDERMIS, but also in the eyes and the hair, by a process called melanogenesis. Coloration can be altered by the number of melanocytes or the amount of pigment produced and stored in the organelles called MELANOSOMES. The large non-mammalian melanin-containing cells are called MELANOPHORES.YY1 Transcription Factor: A ubiquitously expressed zinc finger-containing protein that acts both as a repressor and activator of transcription. It interacts with key regulatory proteins such as TATA-BINDING PROTEIN; TFIIB; and ADENOVIRUS E1A PROTEINS.HeLa Cells: The first continuously cultured human malignant CELL LINE, derived from the cervical carcinoma of Henrietta Lacks. These cells are used for VIRUS CULTIVATION and antitumor drug screening assays.STAT3 Transcription Factor: A signal transducer and activator of transcription that mediates cellular responses to INTERLEUKIN-6 family members. STAT3 is constitutively activated in a variety of TUMORS and is a major downstream transducer for the CYTOKINE RECEPTOR GP130.Reverse Transcriptase Polymerase Chain Reaction: A variation of the PCR technique in which cDNA is made from RNA via reverse transcription. The resultant cDNA is then amplified using standard PCR protocols.GATA4 Transcription Factor: A GATA transcription factor that is expressed in the MYOCARDIUM of developing heart and has been implicated in the differentiation of CARDIAC MYOCYTES. GATA4 is activated by PHOSPHORYLATION and regulates transcription of cardiac-specific genes.Transcription Factor TFIID: The major sequence-specific DNA-binding component involved in the activation of transcription of RNA POLYMERASE II. It was originally described as a complex of TATA-BOX BINDING PROTEIN and TATA-BINDING PROTEIN ASSOCIATED FACTORS. It is now know that TATA BOX BINDING PROTEIN-LIKE PROTEINS may take the place of TATA-box binding protein in the complex.Monophenol Monooxygenase: An enzyme of the oxidoreductase class that catalyzes the reaction between L-tyrosine, L-dopa, and oxygen to yield L-dopa, dopaquinone, and water. It is a copper protein that acts also on catechols, catalyzing some of the same reactions as CATECHOL OXIDASE. EC 1.14.18.1.Activating Transcription Factor 3: An activating transcription factor that plays a key role in cellular responses to GENOTOXIC STRESS and OXIDATIVE STRESS.NFATC Transcription Factors: A family of transcription factors characterized by the presence of highly conserved calcineurin- and DNA-binding domains. NFAT proteins are activated in the CYTOPLASM by the calcium-dependent phosphatase CALCINEURIN. They transduce calcium signals to the nucleus where they can interact with TRANSCRIPTION FACTOR AP-1 or NF-KAPPA B and initiate GENETIC TRANSCRIPTION of GENES involved in CELL DIFFERENTIATION and development. NFAT proteins stimulate T-CELL activation through the induction of IMMEDIATE-EARLY GENES such as INTERLEUKIN-2.Leucine Zippers: DNA-binding motifs formed from two alpha-helixes which intertwine for about eight turns into a coiled coil and then bifurcate to form Y shaped structures. Leucines occurring in heptad repeats end up on the same sides of the helixes and are adjacent to each other in the stem of the Y (the "zipper" region). The DNA-binding residues are located in the bifurcated region of the Y.Sp3 Transcription Factor: A specificity protein transcription factor that regulates expression of a variety of genes including VASCULAR ENDOTHELIAL GROWTH FACTOR and CYCLIN-DEPENDENT KINASE INHIBITOR P27.Transcription Initiation Site: The first nucleotide of a transcribed DNA sequence where RNA polymerase (DNA-DIRECTED RNA POLYMERASE) begins synthesizing the RNA transcript.NF-kappa B: Ubiquitous, inducible, nuclear transcriptional activator that binds to enhancer elements in many different cell types and is activated by pathogenic stimuli. The NF-kappa B complex is a heterodimer composed of two DNA-binding subunits: NF-kappa B1 and relA.Zinc Fingers: Motifs in DNA- and RNA-binding proteins whose amino acids are folded into a single structural unit around a zinc atom. In the classic zinc finger, one zinc atom is bound to two cysteines and two histidines. In between the cysteines and histidines are 12 residues which form a DNA binding fingertip. By variations in the composition of the sequences in the fingertip and the number and spacing of tandem repeats of the motif, zinc fingers can form a large number of different sequence specific binding sites.Eye: The organ of sight constituting a pair of globular organs made up of a three-layered roughly spherical structure specialized for receiving and responding to light.SOXB1 Transcription Factors: A subclass of SOX transcription factors that are expressed in neuronal tissue where they may play a role in the regulation of CELL DIFFERENTIATION. Members of this subclass are generally considered to be transcriptional activators.Electrophoretic Mobility Shift Assay: An electrophoretic technique for assaying the binding of one compound to another. Typically one compound is labeled to follow its mobility during electrophoresis. If the labeled compound is bound by the other compound, then the mobility of the labeled compound through the electrophoretic medium will be retarded.Activating Transcription Factor 2: An activating transcription factor that regulates expression of a variety of GENES including C-JUN GENES; CYCLIN A; CYCLIN D1; and ACTIVATING TRANSCRIPTION FACTOR 3.Transcription Factor TFIIB: An RNA POLYMERASE II specific transcription factor. It plays a role in assembly of the pol II transcriptional preinitiation complex and has been implicated as a target of gene-specific transcriptional activators.Enhancer Elements, Genetic: Cis-acting DNA sequences which can increase transcription of genes. Enhancers can usually function in either orientation and at various distances from a promoter.Regulatory Sequences, Nucleic Acid: Nucleic acid sequences involved in regulating the expression of genes.E2F1 Transcription Factor: An E2F transcription factor that interacts directly with RETINOBLASTOMA PROTEIN and CYCLIN A and activates GENETIC TRANSCRIPTION required for CELL CYCLE entry and DNA synthesis. E2F1 is involved in DNA REPAIR and APOPTOSIS.RNA Polymerase II: A DNA-dependent RNA polymerase present in bacterial, plant, and animal cells. It functions in the nucleoplasmic structure and transcribes DNA into RNA. It has different requirements for cations and salt than RNA polymerase I and is strongly inhibited by alpha-amanitin. EC 2.7.7.6.Gene Expression Profiling: The determination of the pattern of genes expressed at the level of GENETIC TRANSCRIPTION, under specific circumstances or in a specific cell.Cloning, Molecular: The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.MEF2 Transcription Factors: Activating transcription factors of the MADS family which bind a specific sequence element (MEF2 element) in many muscle-specific genes and are involved in skeletal and cardiac myogenesis, neuronal differentiation and survival/apoptosis.Recombinant Fusion Proteins: Recombinant proteins produced by the GENETIC TRANSLATION of fused genes formed by the combination of NUCLEIC ACID REGULATORY SEQUENCES of one or more genes with the protein coding sequences of one or more genes.Plasmids: Extrachromosomal, usually CIRCULAR DNA molecules that are self-replicating and transferable from one organism to another. They are found in a variety of bacterial, archaeal, fungal, algal, and plant species. They are used in GENETIC ENGINEERING as CLONING VECTORS.GATA3 Transcription Factor: A GATA transcription factor that is found predominately in LYMPHOID CELL precursors and has been implicated in the CELL DIFFERENTIATION of HELPER T-CELLS. Haploinsufficiency of GATA3 is associated with HYPOPARATHYROIDISM; SENSORINEURAL HEARING LOSS; and renal anomalies syndrome.GATA1 Transcription Factor: A GATA transcription factor that is specifically expressed in hematopoietic lineages and plays an important role in the CELL DIFFERENTIATION of ERYTHROID CELLS and MEGAKARYOCYTES.Otx Transcription Factors: A family of VERTEBRATE homeodomain proteins that share homology with orthodenticle protein, Drosophila. They regulate GENETIC TRANSCRIPTION and play an important role in EMBRYONIC DEVELOPMENT of the BRAIN.GATA2 Transcription Factor: An essential GATA transcription factor that is expressed primarily in HEMATOPOIETIC STEM CELLS.Gene Expression: The phenotypic manifestation of a gene or genes by the processes of GENETIC TRANSCRIPTION and GENETIC TRANSLATION.Gene Expression Regulation, Fungal: Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action in fungi.Mice, Transgenic: Laboratory mice that have been produced from a genetically manipulated EGG or EMBRYO, MAMMALIAN.TCF Transcription Factors: A family of DNA-binding proteins that are primarily expressed in T-LYMPHOCYTES. They interact with BETA CATENIN and serve as transcriptional activators and repressors in a variety of developmental processes.GATA Transcription Factors: A family of transcription factors that contain two ZINC FINGER MOTIFS and bind to the DNA sequence (A/T)GATA(A/G).Eye ProteinsGene Deletion: A genetic rearrangement through loss of segments of DNA or RNA, bringing sequences which are normally separated into close proximity. This deletion may be detected using cytogenetic techniques and can also be inferred from the phenotype, indicating a deletion at one specific locus.Luciferases: Enzymes that oxidize certain LUMINESCENT AGENTS to emit light (PHYSICAL LUMINESCENCE). The luciferases from different organisms have evolved differently so have different structures and substrates.Sequence Homology, Amino Acid: The degree of similarity between sequences of amino acids. This information is useful for the analyzing genetic relatedness of proteins and species.STAT1 Transcription Factor: A signal transducer and activator of transcription that mediates cellular responses to INTERFERONS. Stat1 interacts with P53 TUMOR SUPPRESSOR PROTEIN and regulates expression of GENES involved in growth control and APOPTOSIS.Protein Structure, Tertiary: The level of protein structure in which combinations of secondary protein structures (alpha helices, beta sheets, loop regions, and motifs) pack together to form folded shapes called domains. Disulfide bridges between cysteines in two different parts of the polypeptide chain along with other interactions between the chains play a role in the formation and stabilization of tertiary structure. Small proteins usually consist of only one domain but larger proteins may contain a number of domains connected by segments of polypeptide chain which lack regular secondary structure.Activating Transcription Factors: Activating transcription factors were originally identified as DNA-BINDING PROTEINS that interact with early promoters from ADENOVIRUSES. They are a family of basic leucine zipper transcription factors that bind to the consensus site TGACGTCA of the cyclic AMP response element, and are closely related to CYCLIC AMP-RESPONSIVE DNA-BINDING PROTEIN.Proto-Oncogene Proteins: Products of proto-oncogenes. Normally they do not have oncogenic or transforming properties, but are involved in the regulation or differentiation of cell growth. They often have protein kinase activity.Tumor Cells, Cultured: Cells grown in vitro from neoplastic tissue. If they can be established as a TUMOR CELL LINE, they can be propagated in cell culture indefinitely.Mice, Knockout: Strains of mice in which certain GENES of their GENOMES have been disrupted, or "knocked-out". To produce knockouts, using RECOMBINANT DNA technology, the normal DNA sequence of the gene being studied is altered to prevent synthesis of a normal gene product. Cloned cells in which this DNA alteration is successful are then injected into mouse EMBRYOS to produce chimeric mice. The chimeric mice are then bred to yield a strain in which all the cells of the mouse contain the disrupted gene. Knockout mice are used as EXPERIMENTAL ANIMAL MODELS for diseases (DISEASE MODELS, ANIMAL) and to clarify the functions of the genes.Mice, Inbred C57BLTranscription Factor RelA: A subunit of NF-kappa B that is primarily responsible for its transactivation function. It contains a C-terminal transactivation domain and an N-terminal domain with homology to PROTO-ONCOGENE PROTEINS C-REL.In Situ Hybridization: A technique that localizes specific nucleic acid sequences within intact chromosomes, eukaryotic cells, or bacterial cells through the use of specific nucleic acid-labeled probes.E2F Transcription Factors: A family of basic helix-loop-helix transcription factors that control expression of a variety of GENES involved in CELL CYCLE regulation. E2F transcription factors typically form heterodimeric complexes with TRANSCRIPTION FACTOR DP1 or transcription factor DP2, and they have N-terminal DNA binding and dimerization domains. E2F transcription factors can act as mediators of transcriptional repression or transcriptional activation.Cell Line, Tumor: A cell line derived from cultured tumor cells.Phosphorylation: The introduction of a phosphoryl group into a compound through the formation of an ester bond between the compound and a phosphorus moiety.Chromatin: The material of CHROMOSOMES. It is a complex of DNA; HISTONES; and nonhistone proteins (CHROMOSOMAL PROTEINS, NON-HISTONE) found within the nucleus of a cell.Saccharomyces cerevisiae: A species of the genus SACCHAROMYCES, family Saccharomycetaceae, order Saccharomycetales, known as "baker's" or "brewer's" yeast. The dried form is used as a dietary supplement.Oligonucleotide Array Sequence Analysis: Hybridization of a nucleic acid sample to a very large set of OLIGONUCLEOTIDE PROBES, which have been attached individually in columns and rows to a solid support, to determine a BASE SEQUENCE, or to detect variations in a gene sequence, GENE EXPRESSION, or for GENE MAPPING.Sequence Alignment: The arrangement of two or more amino acid or base sequences from an organism or organisms in such a way as to align areas of the sequences sharing common properties. The degree of relatedness or homology between the sequences is predicted computationally or statistically based on weights assigned to the elements aligned between the sequences. This in turn can serve as a potential indicator of the genetic relatedness between the organisms.Saccharomyces cerevisiae Proteins: Proteins obtained from the species SACCHAROMYCES CEREVISIAE. The function of specific proteins from this organism are the subject of intense scientific interest and have been used to derive basic understanding of the functioning similar proteins in higher eukaryotes.Zebrafish: An exotic species of the family CYPRINIDAE, originally from Asia, that has been introduced in North America. They are used in embryological studies and to study the effects of certain chemicals on development.Gene Expression Regulation, Plant: Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action in plants.GATA6 Transcription Factor: A GATA transcription factor that is expressed predominately in SMOOTH MUSCLE CELLS and regulates vascular smooth muscle CELL DIFFERENTIATION.Activating Transcription Factor 4: An activating transcription factor that regulates the expression of a variety of GENES involved in amino acid metabolism and transport. It also interacts with HTLV-I transactivator protein.Models, Biological: Theoretical representations that simulate the behavior or activity of biological processes or diseases. For disease models in living animals, DISEASE MODELS, ANIMAL is available. Biological models include the use of mathematical equations, computers, and other electronic equipment.Transcription Factor 7-Like 1 Protein: A transcription factor that takes part in WNT signaling pathway where it may play a role in the differentiation of KERATINOCYTES. The transcriptional activity of this protein is regulated via its interaction with BETA CATENIN.Activating Transcription Factor 1: An activating transcription factor that regulates expression of a variety of genes including C-JUN GENES and TRANSFORMING GROWTH FACTOR BETA2.Cyclic AMP Response Element-Binding Protein: A protein that has been shown to function as a calcium-regulated transcription factor as well as a substrate for depolarization-activated CALCIUM-CALMODULIN-DEPENDENT PROTEIN KINASES. This protein functions to integrate both calcium and cAMP signals.Gene Expression Regulation, Enzymologic: Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action in enzyme synthesis.Transcription Factor TFIIIA: One of several general transcription factors that are specific for RNA POLYMERASE III. It is a zinc finger (ZINC FINGERS) protein and is required for transcription of 5S ribosomal genes.Conserved Sequence: A sequence of amino acids in a polypeptide or of nucleotides in DNA or RNA that is similar across multiple species. A known set of conserved sequences is represented by a CONSENSUS SEQUENCE. AMINO ACID MOTIFS are often composed of conserved sequences.Corneal Opacity: Disorder occurring in the central or peripheral area of the cornea. The usual degree of transparency becomes relatively opaque.Blotting, Western: Identification of proteins or peptides that have been electrophoretically separated by blot transferring from the electrophoresis gel to strips of nitrocellulose paper, followed by labeling with antibody probes.HMGB Proteins: A family of sequence-related proteins similar to HMGB1 PROTEIN that contains specific HMG-BOX DOMAINS.TATA Box: A conserved A-T rich sequence which is contained in promoters for RNA polymerase II. The segment is seven base pairs long and the nucleotides most commonly found are TATAAAA.NFI Transcription Factors: Transcription factors that were originally identified as site-specific DNA-binding proteins essential for DNA REPLICATION by ADENOVIRUSES. They play important roles in MAMMARY GLAND function and development.Models, Genetic: Theoretical representations that simulate the behavior or activity of genetic processes or phenomena. They include the use of mathematical equations, computers, and other electronic equipment.Down-Regulation: A negative regulatory effect on physiological processes at the molecular, cellular, or systemic level. At the molecular level, the major regulatory sites include membrane receptors, genes (GENE EXPRESSION REGULATION), mRNAs (RNA, MESSENGER), and proteins.Proto-Oncogene Proteins c-jun: Cellular DNA-binding proteins encoded by the c-jun genes (GENES, JUN). They are involved in growth-related transcriptional control. There appear to be three distinct functions: dimerization (with c-fos), DNA-binding, and transcriptional activation. Oncogenic transformation can take place by constitutive expression of c-jun.DNA Mutational Analysis: Biochemical identification of mutational changes in a nucleotide sequence.Syndrome: A characteristic symptom complex.Lens, Crystalline: A transparent, biconvex structure of the EYE, enclosed in a capsule and situated behind the IRIS and in front of the vitreous humor (VITREOUS BODY). It is slightly overlapped at its margin by the ciliary processes. Adaptation by the CILIARY BODY is crucial for OCULAR ACCOMMODATION.Drosophila Proteins: Proteins that originate from insect species belonging to the genus DROSOPHILA. The proteins from the most intensely studied species of Drosophila, DROSOPHILA MELANOGASTER, are the subject of much interest in the area of MORPHOGENESIS and development.Proto-Oncogene Proteins c-ets: A family of transcription factors that share a unique DNA-binding domain. The name derives from viral oncogene-derived protein oncogene protein v-ets of the AVIAN ERYTHROBLASTOSIS VIRUS.Sequence Deletion: Deletion of sequences of nucleic acids from the genetic material of an individual.Up-Regulation: A positive regulatory effect on physiological processes at the molecular, cellular, or systemic level. At the molecular level, the major regulatory sites include membrane receptors, genes (GENE EXPRESSION REGULATION), mRNAs (RNA, MESSENGER), and proteins.Embryo, Nonmammalian: The developmental entity of a fertilized egg (ZYGOTE) in animal species other than MAMMALS. For chickens, use CHICK EMBRYO.CCAAT-Enhancer-Binding Proteins: A class of proteins that were originally identified by their ability to bind the DNA sequence CCAAT. The typical CCAAT-enhancer binding protein forms dimers and consists of an activation domain, a DNA-binding basic region, and a leucine-rich dimerization domain (LEUCINE ZIPPERS). CCAAT-BINDING FACTOR is structurally distinct type of CCAAT-enhancer binding protein consisting of a trimer of three different subunits.Transcription Factor TFIIH: A general transcription factor that is involved in basal GENETIC TRANSCRIPTION and NUCLEOTIDE EXCISION REPAIR. It consists of nine subunits including ATP-DEPENDENT DNA HELICASES; CYCLIN H; and XERODERMA PIGMENTOSUM GROUP D PROTEIN.SOX9 Transcription Factor: A SOXE transcription factor that plays a critical role in regulating CHONDROGENESIS; OSTEOGENESIS; and male sex determination. Loss of function of the SOX9 transcription factor due to genetic mutations is a cause of CAMPOMELIC DYSPLASIA.Transcription Factor TFIIA: An RNA POLYMERASE II specific transcription factor. It may play a role in transcriptional activation of gene expression by interacting with the TATA-BOX BINDING PROTEIN component of TRANSCRIPTION FACTOR TFIID.DNA-Directed RNA Polymerases: Enzymes that catalyze DNA template-directed extension of the 3'-end of an RNA strand one nucleotide at a time. They can initiate a chain de novo. In eukaryotes, three forms of the enzyme have been distinguished on the basis of sensitivity to alpha-amanitin, and the type of RNA synthesized. (From Enzyme Nomenclature, 1992).Consensus Sequence: A theoretical representative nucleotide or amino acid sequence in which each nucleotide or amino acid is the one which occurs most frequently at that site in the different sequences which occur in nature. The phrase also refers to an actual sequence which approximates the theoretical consensus. A known CONSERVED SEQUENCE set is represented by a consensus sequence. Commonly observed supersecondary protein structures (AMINO ACID MOTIFS) are often formed by conserved sequences.Histones: Small chromosomal proteins (approx 12-20 kD) possessing an open, unfolded structure and attached to the DNA in cell nuclei by ionic linkages. Classification into the various types (designated histone I, histone II, etc.) is based on the relative amounts of arginine and lysine in each.Gene Expression Regulation, Bacterial: Any of the processes by which cytoplasmic or intercellular factors influence the differential control of gene action in bacteria.STAT5 Transcription Factor: A signal transducer and activator of transcription that mediates cellular responses to a variety of CYTOKINES. Stat5 activation is associated with transcription of CELL CYCLE regulators such as CYCLIN KINASE INHIBITOR P21 and anti-apoptotic genes such as BCL-2 GENES. Stat5 is constitutively activated in many patients with acute MYELOID LEUKEMIA.Transcription Factor DP1: A transcription factor that possesses DNA-binding and E2F-binding domains but lacks a transcriptional activation domain. It is a binding partner for E2F TRANSCRIPTION FACTORS and enhances the DNA binding and transactivation function of the DP-E2F complex.Arabidopsis Proteins: Proteins that originate from plants species belonging to the genus ARABIDOPSIS. The most intensely studied species of Arabidopsis, Arabidopsis thaliana, is commonly used in laboratory experiments.DNA Footprinting: A method for determining the sequence specificity of DNA-binding proteins. DNA footprinting utilizes a DNA damaging agent (either a chemical reagent or a nuclease) which cleaves DNA at every base pair. DNA cleavage is inhibited where the ligand binds to DNA. (from Rieger et al., Glossary of Genetics: Classical and Molecular, 5th ed)Polymerase Chain Reaction: In vitro method for producing large amounts of specific DNA or RNA fragments of defined length and sequence from small amounts of short oligonucleotide flanking sequences (primers). The essential steps include thermal denaturation of the double-stranded target molecules, annealing of the primers to their complementary sequences, and extension of the annealed primers by enzymatic synthesis with DNA polymerase. The reaction is efficient, specific, and extremely sensitive. Uses for the reaction include disease diagnosis, detection of difficult-to-isolate pathogens, mutation analysis, genetic testing, DNA sequencing, and analyzing evolutionary relationships.T-Box Domain Proteins: Proteins containing a region of conserved sequence, about 200 amino acids long, which encodes a particular sequence specific DNA binding domain (the T-box domain). These proteins are transcription factors that control developmental pathways. The prototype of this family is the mouse Brachyury (or T) gene product.Fungal Proteins: Proteins found in any species of fungus.3T3 Cells: Cell lines whose original growing procedure consisted being transferred (T) every 3 days and plated at 300,000 cells per plate (J Cell Biol 17:299-313, 1963). Lines have been developed using several different strains of mice. Tissues are usually fibroblasts derived from mouse embryos but other types and sources have been developed as well. The 3T3 lines are valuable in vitro host systems for oncogenic virus transformation studies, since 3T3 cells possess a high sensitivity to CONTACT INHIBITION.Sequence Analysis, DNA: A multistage process that includes cloning, physical mapping, subcloning, determination of the DNA SEQUENCE, and information analysis.DNA, Complementary: Single-stranded complementary DNA synthesized from an RNA template by the action of RNA-dependent DNA polymerase. cDNA (i.e., complementary DNA, not circular DNA, not C-DNA) is used in a variety of molecular cloning experiments as well as serving as a specific hybridization probe.Octamer Transcription Factor-1: A ubiquitously expressed octamer transcription factor that regulates GENETIC TRANSCRIPTION of SMALL NUCLEAR RNA; IMMUNOGLOBULIN GENES; and HISTONE H2B genes.Regulatory Elements, Transcriptional: Nucleotide sequences of a gene that are involved in the regulation of GENETIC TRANSCRIPTION.Arabidopsis: A plant genus of the family BRASSICACEAE that contains ARABIDOPSIS PROTEINS and MADS DOMAIN PROTEINS. The species A. thaliana is used for experiments in classical plant genetics as well as molecular genetic studies in plant physiology, biochemistry, and development.Recombinant Proteins: Proteins prepared by recombinant DNA technology.Gene Expression Regulation, Neoplastic: Any of the processes by which nuclear, cytoplasmic, or intercellular factors influence the differential control of gene action in neoplastic tissue.Mice, Mutant Strains: Mice bearing mutant genes which are phenotypically expressed in the animals.TATA-Box Binding Protein: A general transcription factor that plays a major role in the activation of eukaryotic genes transcribed by RNA POLYMERASES. It binds specifically to the TATA BOX promoter element, which lies close to the position of transcription initiation in RNA transcribed by RNA POLYMERASE II. Although considered a principal component of TRANSCRIPTION FACTOR TFIID it also takes part in general transcription factor complexes involved in RNA POLYMERASE I and RNA POLYMERASE III transcription.Homozygote: An individual in which both alleles at a given locus are identical.Genetic Diseases, X-Linked: Genetic diseases that are linked to gene mutations on the X CHROMOSOME in humans (X CHROMOSOME, HUMAN) or the X CHROMOSOME in other species. Included here are animal models of human X-linked diseases.Immunohistochemistry: Histochemical localization of immunoreactive substances using labeled antibodies as reagents.Erythroid-Specific DNA-Binding Factors: A group of transcription factors that were originally described as being specific to ERYTHROID CELLS.Retinal Dysplasia: Congenital, often bilateral, retinal abnormality characterized by the arrangement of outer nuclear retinal cells in a palisading or radiating pattern surrounding a central ocular space. This disorder is sometimes hereditary.Two-Hybrid System Techniques: Screening techniques first developed in yeast to identify genes encoding interacting proteins. Variations are used to evaluate interplay between proteins and other molecules. Two-hybrid techniques refer to analysis for protein-protein interactions, one-hybrid for DNA-protein interactions, three-hybrid interactions for RNA-protein interactions or ligand-based interactions. Reverse n-hybrid techniques refer to analysis for mutations or other small molecules that dissociate known interactions.Drosophila: A genus of small, two-winged flies containing approximately 900 described species. These organisms are the most extensively studied of all genera from the standpoint of genetics and cytology.Cataract: Partial or complete opacity on or in the lens or capsule of one or both eyes, impairing vision or causing blindness. The many kinds of cataract are classified by their morphology (size, shape, location) or etiology (cause and time of occurrence). (Dorland, 27th ed)Transcription Factors, TFIII: Factors that bind to RNA POLYMERASE III and aid in transcription. They include the assembly factors TFIIIA and TFIIIC and the initiation factor TFIIIB. All combine to form a preinitiation complex at the promotor that directs the binding of RNA POLYMERASE III.Waardenburg Syndrome: Rare, autosomal dominant disease with variable penetrance and several known clinical types. Characteristics may include depigmentation of the hair and skin, congenital deafness, heterochromia iridis, medial eyebrow hyperplasia, hypertrophy of the nasal root, and especially dystopia canthorum. The underlying cause may be defective development of the neural crest (neurocristopathy). Waardenburg's syndrome may be closely related to piebaldism. Klein-Waardenburg Syndrome refers to a disorder that also includes upper limb abnormalities.GA-Binding Protein Transcription Factor: A heterotetrameric transcription factor composed of two distinct proteins. Its name refers to the fact it binds to DNA sequences rich in GUANINE and ADENINE. GA-binding protein integrates a variety of SIGNAL TRANSDUCTION PATHWAYS and regulates expression of GENES involved in CELL CYCLE control, PROTEIN BIOSYNTHESIS, and cellular METABOLISM.Cell Lineage: The developmental history of specific differentiated cell types as traced back to the original STEM CELLS in the embryo.Protein Inhibitors of Activated STAT: A family of structurally related proteins that are constitutively expressed and that negatively regulate cytokine-mediated SIGNAL TRANSDUCTION PATHWAYS. PIAS proteins inhibit the activity of signal transducers and activators of transcription.Gene Regulatory Networks: Interacting DNA-encoded regulatory subsystems in the GENOME that coordinate input from activator and repressor TRANSCRIPTION FACTORS during development, cell differentiation, or in response to environmental cues. The networks function to ultimately specify expression of particular sets of GENES for specific conditions, times, or locations.Blotting, Northern: Detection of RNA that has been electrophoretically separated and immobilized by blotting on nitrocellulose or other type of paper or nylon membrane followed by hybridization with labeled NUCLEIC ACID PROBES.Early Growth Response Protein 1: An early growth response transcription factor that has been implicated in regulation of CELL PROLIFERATION and APOPTOSIS.Sequence Homology, Nucleic Acid: The sequential correspondence of nucleotides in one nucleic acid molecule with those of another nucleic acid molecule. Sequence homology is an indication of the genetic relatedness of different organisms and gene function.RNA Interference: A gene silencing phenomenon whereby specific dsRNAs (RNA, DOUBLE-STRANDED) trigger the degradation of homologous mRNA (RNA, MESSENGER). The specific dsRNAs are processed into SMALL INTERFERING RNA (siRNA) which serves as a guide for cleavage of the homologous mRNA in the RNA-INDUCED SILENCING COMPLEX. DNA METHYLATION may also be triggered during this process.Microcephaly: A congenital abnormality in which the CEREBRUM is underdeveloped, the fontanels close prematurely, and, as a result, the head is small. (Desk Reference for Neuroscience, 2nd ed.)RNA, Small Interfering: Small double-stranded, non-protein coding RNAs (21-31 nucleotides) involved in GENE SILENCING functions, especially RNA INTERFERENCE (RNAi). Endogenously, siRNAs are generated from dsRNAs (RNA, DOUBLE-STRANDED) by the same ribonuclease, Dicer, that generates miRNAs (MICRORNAS). The perfect match of the siRNAs' antisense strand to their target RNAs mediates RNAi by siRNA-guided RNA cleavage. siRNAs fall into different classes including trans-acting siRNA (tasiRNA), repeat-associated RNA (rasiRNA), small-scan RNA (scnRNA), and Piwi protein-interacting RNA (piRNA) and have different specific gene silencing functions.Zebrafish Proteins: Proteins obtained from the ZEBRAFISH. Many of the proteins in this species have been the subject of studies involving basic embryological development (EMBRYOLOGY).High Mobility Group Proteins: A family of low-molecular weight, non-histone proteins found in chromatin.Bacterial Proteins: Proteins found in any species of bacterium.Chromosome Mapping: Any method used for determining the location of and relative distances between genes on a chromosome.Cell Proliferation: All of the processes involved in increasing CELL NUMBER including CELL DIVISION.Transcription Factor 7-Like 2 Protein: A transcription factor that takes part in WNT signaling pathway. The activity of the protein is regulated via its interaction with BETA CATENIN. Transcription factor 7-like 2 protein plays an important role in the embryogenesis of the PANCREAS and ISLET CELLS.Exons: The parts of a transcript of a split GENE remaining after the INTRONS are removed. They are spliced together to become a MESSENGER RNA or other functional RNA.Proto-Oncogene Protein c-ets-1: An ets proto-oncogene expressed primarily in adult LYMPHOID TISSUE; BRAIN; and VASCULAR ENDOTHELIAL CELLS.Deoxyribonuclease I: An enzyme capable of hydrolyzing highly polymerized DNA by splitting phosphodiester linkages, preferentially adjacent to a pyrimidine nucleotide. This catalyzes endonucleolytic cleavage of DNA yielding 5'-phosphodi- and oligonucleotide end-products. The enzyme has a preference for double-stranded DNA.RNA: A polynucleotide consisting essentially of chains with a repeating backbone of phosphate and ribose units to which nitrogenous bases are attached. RNA is unique among biological macromolecules in that it can encode genetic information, serve as an abundant structural component of cells, and also possesses catalytic activity. (Rieger et al., Glossary of Genetics: Classical and Molecular, 5th ed)Reverse Transcription: The biosynthesis of DNA carried out on a template of RNA.Pedigree: The record of descent or ancestry, particularly of a particular condition or trait, indicating individual family members, their relationships, and their status with respect to the trait or condition.Plant Proteins: Proteins found in plants (flowers, herbs, shrubs, trees, etc.). The concept does not include proteins found in vegetables for which VEGETABLE PROTEINS is available.Apoptosis: One of the mechanisms by which CELL DEATH occurs (compare with NECROSIS and AUTOPHAGOCYTOSIS). Apoptosis is the mechanism responsible for the physiological deletion of cells and appears to be intrinsically programmed. It is characterized by distinctive morphologic changes in the nucleus and cytoplasm, chromatin cleavage at regularly spaced sites, and the endonucleolytic cleavage of genomic DNA; (DNA FRAGMENTATION); at internucleosomal sites. This mode of cell death serves as a balance to mitosis in regulating the size of animal tissues and in mediating pathologic processes associated with tumor growth.Escherichia coli: A species of gram-negative, facultatively anaerobic, rod-shaped bacteria (GRAM-NEGATIVE FACULTATIVELY ANAEROBIC RODS) commonly found in the lower part of the intestine of warm-blooded animals. It is usually nonpathogenic, but some strains are known to produce DIARRHEA and pyogenic infections. Pathogenic strains (virotypes) are classified by their specific pathogenic mechanisms such as toxins (ENTEROTOXIGENIC ESCHERICHIA COLI), etc.Twist Transcription Factor: A basic helix-loop-helix transcription factor that was originally identified in DROSOPHILA as essential for proper gastrulation and MESODERM formation. It plays an important role in EMBRYONIC DEVELOPMENT and CELL DIFFERENTIATION of MUSCLE CELLS, and is found in a wide variety of organisms.Chromosomes, Human, X: The human female sex chromosome, being the differential sex chromosome carried by half the male gametes and all female gametes in humans.NF-E2 Transcription Factor, p45 Subunit: A tissue-specific subunit of NF-E2 transcription factor that interacts with small MAF PROTEINS to regulate gene expression. P45 NF-E2 protein is expressed primarily in MEGAKARYOCYTES; ERYTHROID CELLS; and MAST CELLS.Carrier Proteins: Transport proteins that carry specific substances in the blood or across cell membranes.DNA Primers: Short sequences (generally about 10 base pairs) of DNA that are complementary to sequences of messenger RNA and allow reverse transcriptases to start copying the adjacent sequences of mRNA. Primers are used extensively in genetic and molecular biology techniques.Chloramphenicol O-Acetyltransferase: An enzyme that catalyzes the acetylation of chloramphenicol to yield chloramphenicol 3-acetate. Since chloramphenicol 3-acetate does not bind to bacterial ribosomes and is not an inhibitor of peptidyltransferase, the enzyme is responsible for the naturally occurring chloramphenicol resistance in bacteria. The enzyme, for which variants are known, is found in both gram-negative and gram-positive bacteria. EC 2.3.1.28.Mutagenesis, Site-Directed: Genetically engineered MUTAGENESIS at a specific site in the DNA molecule that introduces a base substitution, or an insertion or deletion.Agenesis of Corpus Callosum: Birth defect that results in a partial or complete absence of the CORPUS CALLOSUM. It may be isolated or a part of a syndrome (e.g., AICARDI'S SYNDROME; ACROCALLOSAL SYNDROME; ANDERMANN SYNDROME; and HOLOPROSENCEPHALY). Clinical manifestations include neuromotor skill impairment and INTELLECTUAL DISABILITY of variable severity.
Its expression is regulated by the Microphthalmia-associated transcription factor. GRCh38: Ensembl release 89: ENSG00000120215 ... Protein melan-A also known as melanoma antigen recognized by T cells 1 or MART-1 is a protein that in humans is encoded by the ... at the National Cancer Institute coined the term MART-1, which stands for "melanoma antigen recognized by T-cells." Coulie et ... 2002). "Thymic selection generates a large T cell pool recognizing a self-peptide in humans". J. Exp. Med. 195 (4): 485-94. doi ...
MITF recognizes E-box (CAYRTG) and M-box (TCAYRTG or CAYRTGA) sequences in the promoter regions of target genes. Known target ... "The microphthalmia transcription factor and the related helix-loop-helix zipper factors TFE-3 and TFE-C collaborate to activate ... "The gene encoding the T-box factor Tbx2 is a target for the microphthalmia-associated transcription factor in melanocytes". J. ... Microphthalmia-associated transcription factor also known as class E basic helix-loop-helix protein 32 or bHLHe32 is a protein ...
MITF recognizes E-box (CAYRTG) and M-box (TCAYRTG or CAYRTGA) sequences in the promoter regions of target genes. Known target ... microphthalmia-associated transcription factor, melanogenesis associated transcription factor, COMMAD, melanocyte inducing ... Microphthalmia-associated transcription factor also known as class E basic helix-loop-helix protein 32 or bHLHe32 is a protein ... "The microphthalmia transcription factor and the related helix-loop-helix zipper factors TFE-3 and TFE-C collaborate to activate ...
In melanocytic cell types, the SLC45A2 gene is regulated by microphthalmia-associated transcription factor. SLC45A2 has been ... "Use of an in vitro immunoselected tumor line to identify shared melanoma antigens recognized by HLA-A*0201-restricted T cells ... In humans, it has been identified as a factor in the light skin of Europeans and as an ancestry-informative marker (AIM) for ...
... a repressor of microphthalmia transcription factor". The Journal of Biological Chemistry. 277 (3): 1962-6. doi:10.1074/jbc. ... such as scaffold attachment factor A and B. The SAP domain can recognize and bind to AT-rich DNA sequences present in scaffold- ... Subsequently, PIAS3 was also found to be a regulator protein of other key transcription factors, including MITF, NFκB, SMAD and ... The PIAS family contains more than 60 proteins, most of them transcription factors that can be either positively or negatively ...
"Microphthalmia-associated transcription factor interacts with LEF-1, a mediator of Wnt signaling". EMBO J. 21 (11): 2703-14. ... "The nuclear localization signal of lymphoid enhancer factor-1 is recognized by two differentially expressed Srp1-nuclear ... Brantjes H, Roose J, van De Wetering M, Clevers H (2001). "All Tcf HMG box transcription factors interact with Groucho-related ... Skokowa J, Welte K (2007). "LEF-1 is a decisive transcription factor in neutrophil granulopoiesis". Ann. N. Y. Acad. Sci. 1106 ...
The expression of the PMEL gene is regulated by the microphthalmia-associated transcription factor (MITF). GRCh38: Ensembl ... 2003). "Identification of a novel gp100/pMel17 peptide presented by HLA-A*6801 and recognized on human melanoma by cytolytic T ... 1994). "Identification of a human melanoma antigen recognized by tumor-infiltrating lymphocytes associated with in vivo tumor ...
2002). "Microphthalmia-associated transcription factor interacts with LEF-1, a mediator of Wnt signaling". EMBO J. 21 (11): ... 1997). "Identification of TRP-2 as a Human Tumor Antigen Recognized by Cytotoxic T Lymphocytes". J. Exp. Med. 184 (6): 2207-16 ... Its expression is regulated by the microphthalmia-associated transcription factor (MITF). Tyrosinase-related protein 1 (TYRP1) ...
April 2008). "Epistatic connections between microphthalmia-associated transcription factor and endothelin signaling in ... This specialized testing enables geneticists to recognize the gene mutation that is the cause of ABCD syndrome. New findings ...
The intracellular domain of teneurin-1 induces the activity of microphthalmia-associated transcription factor (MITF) by binding ... Today it is recognized that different matrix proteins influence cell adhesion, cell growth and migration, tissue morphology and ... and elucidated how tenascin C expression is controlled by the transcription factor MKL1, that links cellular mechanosensation ... regulator megakaryoblastic leukemia-1 mediates serum response factor-independent activation of tenascin-C transcription by ...
"The microphthalmia transcription factor and the related helix-loop-helix zipper factors TFE-3 and TFE-C collaborate to activate ... Dintilhac A, Bernués J (2002). "HMGB1 interacts with many apparently unrelated proteins by recognizing short amino acid ... "Synergism between transcription factors TFE3 and Smad3 in transforming growth factor-beta-induced transcription of the Smad7 ... Microphthalmia-associated transcription factor, and Mothers against decapentaplegic homolog 3 A proportion of renal carcinomas ...
This is due to chromosomes being highly condensed, preventing RNA polymerase and other transcription factors from recognizing ... "Aberrant miR-182 expression promotes melanoma metastasis by repressing FOXO3 and microphthalmia-associated transcription factor ... It was reported that luciferase expression, which was driven by the 3'UTRs of integrin alpha 3 (ITGA3) or transcription factor ... However, in an altered methylation of the CpG islands (generally where the methylation pattern is inverted), transcription can ...
"Regulation of microphthalmia-associated transcription factor MITF protein levels by association with the ubiquitin-conjugating ... It recognizes a particular motif of amino acid residues in these substrates: A large hydrophobic residue, followed by a lysine ... Sapetschnig A, Rischitor G, Braun H, Doll A, Schergaut M, Melchior F, Suske G (October 2002). "Transcription factor Sp3 is ... Firestein R, Feuerstein N (March 1998). "Association of activating transcription factor 2 (ATF2) with the ubiquitin-conjugating ...
Microphthalmia-associated transcription factor (MITF) is the master transcription factor that controls the expression of TYR, ... In addition to its many recognized biological functions, glutathione has also been associated with skin lightening ability. ... the microphthalmia-associated transcription factor (MITF) is a basic helix-loop-helix leucine zipper transcription factor that ... and microphthalmia (Mitf) transcription factors. CREB and Mitf directly enhance melanin production by raising levels of ...
As a transcription factor, Pax6 acts at the molecular level in the signaling and formation of the central nervous system. The ... Microphthalmia Overview GeneReviews/NCBI/NIH/UW entry on Aniridia OMIM entries on Aniridia Gene Expression Patterns from the ... However it has been recognized that a suite of genes is necessary for eye development, and therefore the term of "master ... This transcription factor is most noted for its use in the interspecifically induced expression of ectopic eyes and is of ...
Melanocyte inducing transcription factor (MITF) is the master regulator of melanocyte differentiation, essential for ... BET proteins as regulators of cell identity and differentiation through their interactions with lineage-specific factors. ... melanocyte inducing transcription factor (MITF, historically also called microphthalmia-associated transcription factor) ... BET proteins have two bromodomains, defined as motifs of 110 amino acids that recognize acetylated lysines, as well as a ...
MITF recognizes E-box (CAYRTG) and M-box (TCAYRTG or CAYRTGA) sequences in the promoter regions of target genes. Known target ... microphthalmia-associated transcription factor, melanogenesis associated transcription factor, COMMAD, melanocyte inducing ... Microphthalmia-associated transcription factor also known as class E basic helix-loop-helix protein 32 or bHLHe32 is a protein ... "The microphthalmia transcription factor and the related helix-loop-helix zipper factors TFE-3 and TFE-C collaborate to activate ...
MITF recognizes E-box (CAYRTG) and M-box (TCAYRTG or CAYRTGA) sequences in the promoter regions of target genes. Known target ... "The microphthalmia transcription factor and the related helix-loop-helix zipper factors TFE-3 and TFE-C collaborate to activate ... "The gene encoding the T-box factor Tbx2 is a target for the microphthalmia-associated transcription factor in melanocytes". J. ... Microphthalmia-associated transcription factor also known as class E basic helix-loop-helix protein 32 or bHLHe32 is a protein ...
Full length MITF-M and its splice variant cDNA were cloned from human melanoma cell line 624 mel by reverse transcription ... including tyrosinase and melanoma-associated antigen recognized by T cells (MART-1). However, the lower than expected frequency ... Detection of microphthalmia-associated transcription factor (MITF)-Mdel and MITF-M in melanoma cell lines and other carcinoma ... Relative expression of microphthalmia-associated transcription factor (MITF)-M (A) and MITF-Mdel (B) in 31 melanoma cell lines ...
Primer sequences used are as followed: microphthalmia-associated transcription factor (MITF) forward, GCCTGAAACCTTGCTATGCTGGAA ... 2B). Together, these data indicate that BP cells are likely to be recognized by CD8+ T cells, while also having the potential ... suggesting that the differences in minor histocompatibility antigens are not a major factor in the antitumor immunity in these ... melanoma antigen recognized by T cells (MLANA) forward, TCGGCTGCTGGTACTGTAGA; MLANA reverse, GGTGATCAGGGCTCTCACAT; 18S forward ...
Its expression is regulated by the Microphthalmia-associated transcription factor. GRCh38: Ensembl release 89: ENSG00000120215 ... Protein melan-A also known as melanoma antigen recognized by T cells 1 or MART-1 is a protein that in humans is encoded by the ... at the National Cancer Institute coined the term MART-1, which stands for "melanoma antigen recognized by T-cells." Coulie et ... 2002). "Thymic selection generates a large T cell pool recognizing a self-peptide in humans". J. Exp. Med. 195 (4): 485-94. doi ...
This MAb recognizes a nuclear protein, which is expressed in the majority of primary and metastatic epithelioid malignant ... Mouse Monoclonal anti-MiTF (Microphthalmia Transcription Factor) (MITF/915) MITF (microphthalmia transcription factor) is a ... MITF (microphthalmia transcription factor) is a basic helix-loop-helix-leucine-zipper (bHLH-Zip) transcription factor that ... Age-resolving osteopetrosis: a rat model implicating microphthalmia and the related transcription factor TFE3. J. Exp.Med. 1998 ...
Transcription of genes related to growth factor, MAPK and PI3K-Akt pathways increased with time of light exposure, suggesting ... showed light-induced transcription, suggesting a dominating role of morphological color change (MCC) in this process. ... Melanoma antigen recognized by T-cells 1 isoform X1. MITF:. Microphthalmia-associated transcription factor ... which activate the transcription of microphthalmia-associated transcription factor (MITF), the key transcriptional factor in ...
Primer sequences used are as followed: microphthalmia-associated transcription factor (MITF) forward, GCCTGAAACCTTGCTATGCTGGAA ... 2B). Together, these data indicate that BP cells are likely to be recognized by CD8+ T cells, while also having the potential ... suggesting that the differences in minor histocompatibility antigens are not a major factor in the antitumor immunity in these ... melanoma antigen recognized by T cells (MLANA) forward, TCGGCTGCTGGTACTGTAGA; MLANA reverse, GGTGATCAGGGCTCTCACAT; 18S forward ...
... the melanogenesis cascade begins from activation of microphthalmia transcription factor (MITF) for induction of either eu- or ... tyrosinase could be recognized as a melanoma-specific tumor antigen in relation to the systemic immune responses. ... P. Quaglino, F. Marenco, S. Osella-Abate et al., "Vitiligo is an independent favourable prognostic factor in stage III and IV ... by forming quinone-haptens to tyrosinase protein and by inducing the release of tyrosinase and melanoma antigen recognized by T ...
... or heterooligomers with other members of the microphthalmia transcription factor (MiTF) subfamily and resulting in up- ... TFEB specifically recognizes and binds regulatory sequences within the CLEAR box (GTCACGTGAC) of lysosomal and autophagy genes ... Background: Transcription factor EB (TFEB) is a member of the Myc-related, bHLH leucine-zipper family of transcription factors ... Background: Transcription initiation factor IIE subunit alpha (TFIIE-α) is part of TFIIE, a general transcription factor made ...
microphthalmia, a critical factor in melanocyte development, defines a discrete transcription factor family. Genes Dev 1994;8: ... The MiT/TFE family of basic helix-loop-helix (bHLH) transcription factors recognizes the transcription initiation or E-box ( ... Microphthalmia-associated transcription factor in the Wnt signaling pathway. Pigment Cell Res 2003;16:261-5. ... The microphthalmia family (MITF, TFEB, TFE3, and TFEC) of transcription factors is emerging as global regulators of cancer cell ...
... melanoma antigen recognized by T cells 1 (Mart-1), microphthalmia-associated transcription factor (MiTF) and Melan-A. ... transcription factor E3 and transcription factor EB (TFE3/TFEB), and HMB45.. Practical Applications of Immunohistochemistry in ... The tumor cells were positive for paired box gene 8 (PAX8), transcription factor E3 (TFE3), human melanoma black 45 (HMB45), [ ...
... this we have combined a catalytic DNAzyme sequence and the consensus sequence recognized by specific transcription factors to ... whose activities are triggered upon binding either TATA binding protein or the microphthalmia-associated transcription factor. ... this we have combined a catalytic DNAzyme sequence and the consensus sequence recognized by specific transcription factors to ... A general approach to the design of allosteric, transcription factor-regulated DNAzymes G. Adornetto, A. Porchetta, G. ...
Melanocyte antigen recognized by T-cells 1. MITF: Microphthalmia-associated transcription factor ... This case presented a diagnostic challenge due to a number of factors: the patient fit the epidemiology of CSSTA (younger adult ... Prognostic factors analysis of 17,600 melanoma patients: validation of the American joint committee on cancer melanoma staging ...
Focal expression of Melan-A, microphthalmia transcription factor, and HMB-45 is also revealed. Mutations in BRAF and NRAS genes ... CONCLUSION: The importance of recognizing osteogenic melanoma is based on difficulties for histologic recognition and its ... Overall, 56.54% had a PD-L1 TPS < 1%, 25.63% a TPS of 1% to 49%, and 17.83% a TPS of ≥ 50%. The factors associated with PD-L1 ... Is primary sidedness a prognostic factor in patients with resected colon cancer liver metastases (CLM)? ...
Microphthalmia, a critical factor in melanocyte development, defines a discrete transcription factor family. Genes Dev. 8: 2770 ... Mi, as a member of this family, recognizes a subset of E box sequences, notably those of the M box sequence CATGTG (12). The ... The microphthalmia locus encodes a basic helix-loop-helix-leucine zipper (bHLH-Zip)3 transcription factor (Mi) (1, 2) that is ... Targeting the microphthalmia basic helix-loop-helix-leucine zipper transcription factor to a subset of E-box elements in vitro ...
B. MITF (microphthalmia-associated transcription factor), melan A (MART1, melanoma antigen recognized by T cells). C. Melan A, ...
Microphthalmia-associated transcription factor (MITF) is a melanocyte-specific transcription factor that plays a key role in ... This antibody recognizes all the S-100 isoforms and stains schwannomas, ependymomas, astrogliomas, and almost all benign and ... Microphthalmia Transcription Factor, A sensitive and specific melanocyte marker for melanoma diagnosis. Am J Pathol. 155(3): ... Microphthalmia-associated transcription factor) stain may confirm the diagnosis Jeff F. Wang M.D. Department of Pathology ...
Haq R, Fisher DE (2011) Biology and clinical relevance of the microphthalmia family of transcription factors in human cancer. J ... TFEB recognizes E‐box‐type DNA sequences (Palmieri et al, 2011) and resides in the cytosol, moving to the nucleus when ... Transcription factor EB (TFEB) belongs to the microphthalmia family of bHLH‐leucine zipper molecules. It is involved in the ... Fan Y, Lu H, Liang W, Garcia‐Barrio MT, Guo Y, Zhang J, Zhu T, Hao Y, Chen YE (2018) Endothelial TFEB (transcription factor EB ...
We also report that both the MSEu and MSEi are recognized by the brachyury-related transcription factor Tbx2, a member of the ... microphthalmia, or glyceraldehyde-3-phosphate dehydrogenase (G3PDH) promoter, is repressed by Tbx2 in cotransfection assays; a ... Several lines of evidence tend to point to the brachyury-related transcription factor Tbx2 as being the repressor of TRP-1 ... bind a melanocyte-specific factor termed MSF but are also recognized by a previously uncharacterized repressor, since mutations ...
MITF-H is an isoform of MITF (microphthalmia-associated transcription factor), a transcription factor that contains both basic ... Oct-3/4 is the most recognized marker for totipotent ES cells. Ectopic expression of OCT3/4 has been used to produce iPS… ... Microphthalmia-associated transcription factor (MITF) is a member of the basic/helix-loop-helix/leucine zipper (b-HLH-ZIP) ... The homeodomain transcription factor Chx10 is one of the earliest markers of the developing retina. It is required for retinal ...
His team also cloned MITF-Mdel, a novel melanocyte/melanoma-specific isoform of microphthalmia-associated transcription factor- ... The isoform encoded an HLA-A2-restricted antigenic epitope recognized by anti-melanoma T cells. He also identified, for the ... the presence of de novo cellular immune reactivity against the transcription factor SOX10, using tumor-infiltrating lymphocytes ...
... has been mapped to heritable mutations in the microphthalmia-associated transcription factor (MITF), a key regulator of ... It is now well recognized that the endothelin B receptor (EDNBR) is critical for the faithful derivation of melanocytic cells ... 4B). Thus, response to free drug is probably not a significant factor contributing to the potency of the ADC on these cell ... Waardenburg syndrome type 2 caused by mutations in the human microphthalmia (MITF) gene. Nat Genet 1994;8:251-5. ...
Anti-Microphthalmia Transcription Factor Antibody. Reactivity Hu, Ms(-) and Rt(-). Tested In FC, IF, IHC. Isotype Ms IgG1, κ. ... Anti-MITF, D5, recognizes a nuclear protein, which is expressed in the majority of primary, metastatic epithelioid malignant ... General Description of Microphthalmia Transcription Factor.. MITF (microphthalmia transcription factor) is a basic helix-loop- ... own distinct pattern of Microphthalmia Transcription Factor expression as measured by anti-Microphthalmia Transcription Factor ...
  • BET proteins have two bromodomains, defined as motifs of 110 amino acids that recognize acetylated lysines, as well as a conserved extra-terminal domain which mediates additional protein-protein interactions. (biomedcentral.com)
  • In keeping with this, latest evidence acquired using real-time intravital imaging of melanoma syngeneic tumors manufactured expressing a Brn-2 promoter-green fluorescent proteins (GFP) reporter offers exposed that high degrees of Brn-2 promoter activity recognizes intrusive melanoma cells and confirms that melanoma cells personal renew and change phenotypes from stem cell like (intrusive) to proliferative/differentiated (regularly) and back again (infrequently) (42). (biogeology.org)
  • A number of eukaryotic proteins, which probably are sequence specific DNA- binding proteins that act as transcription factors, share a conserved domain of 40 to 50 amino acid residues. (embl.de)
  • The hairy-related proteins (hairy, E(spl), deadpan) also repress transcription although they can bind DNA. (embl.de)
  • In mammals, AH receptor nuclear translocator (ARNT), single-minded homologues (SIM1 and SIM2), hypoxia-inducible factor 1 alpha (HIF1A), AH receptor (AHR), neuronal pas domain proteins (NPAS1 and NPAS2), endothelial pas domain protein 1 (EPAS1), mouse ARNT2, and human BMAL1. (embl.de)
  • Mouse helix-loop-helix proteins MATH-1 and MATH-2 which activate E box- dependent transcription in collaboration with E47. (embl.de)
  • Some studies have also implicated BET proteins as regulators of cell identity and differentiation through their interactions with lineage-specific factors. (biomedcentral.com)
  • BET proteins have two bromodomains, defined as motifs of 110 amino acids that recognize acetylated lysines, as well as a conserved extra-terminal domain which mediates additional protein-protein interactions. (biomedcentral.com)
  • LSD1 is a histone modifier that participates in key aspects of gene transcription as well as in the regulation of methylation dynamics of non-histone proteins. (blogspot.com)
  • In addition, MiT/TFE factors can regulate lysosomal signaling, which includes the mTORC1 and Wnt/β-catenin pathways, which are both substantial contributors to oncogenic signaling. (aacrjournals.org)
  • Transcription of genes related to growth factor, MAPK and PI3K-Akt pathways increased with time of light exposure, suggesting that light could induce significant growth signal, which might facilitate the rapid skin darkening. (biomedcentral.com)
  • Constitutional activation of molecular signaling pathways that transduce growth factor stimuli leads to both vascular and pigment cell anomalies. (marseille-medical-genetics.org)
  • Apart from this, newer theories implicated in the pathogenesis of melasma include neural and vascular factors, impairment of barrier function, function of visible light, and other molecular pathways. (jsstd.org)
  • Third, mammalian KRS is a component of the multi-ARS complex ( 16 ), specifically interacting with an auxiliary factor, p38 ( 17 , 18 ), and contains a lysine-rich N-terminal extension that binds tRNA and enhances the catalytic efficiency ( 19 , 20 ). (pnas.org)
  • with improved access to molecular testing, a wider range of phenotypes has been recognized in association with pathogenic variants in PAX2 . (nih.gov)
  • Mammalian transcription factors HES, which repress transcription by acting on two types of DNA sequences, the E box and the N box. (embl.de)
  • Mammalian Upstream Stimulatory Factor 1 and 2 (USF1 and USF2), which bind to a symmetrical DNA sequence that is found in a variety of viral and cellular promoters. (embl.de)
  • Its gene resides at the mi locus in mice, and its protumorogenic targets include factors involved in cell death, DNA replication , repair, mitosis, microRNA production, membrane trafficking, mitochondrial metabolism, and much more. (wikipedia.org)
  • 1 Molecules that are necessary for osteoclastogenesis are macrophage colony-stimulating factor 4,5, and the receptor for activation of nuclear factor B ligand. (healthdocbox.com)
  • 4,6,8 Macrophage colony-forming units, under the stimulation of macrophage colony-stimulating factor, proliferate to form monocyte-macrophage cells, which under continued stimulation by macrophage colony-stimulating factor and receptor for activation of nuclear factor B ligand differentiate into osteoclast precursor mononuclear cells, which are tartrate-resistant acid phosphatase (TRAP) positive. (healthdocbox.com)
  • 4 These mononuclear cells, under further stimulation by macrophage colony-stimulating factor, receptor for activation of nuclear factor B ligand, and interleukin 1, differentiate to multinucleated osteoclasts. (healthdocbox.com)
  • Exchange Regulating Factor) -- NimO (Aspergillus) -- NINAC (p174, p132) -- NIPK -- NK Receptor / Bin Xu, Mesfin Gewe, Kathryn Finton and Roland K. Strong -- NKG2D / Michael T. McCarthy and Christopher A. O'Callaghan -- NKp46 / Simona Sivori -- NLS (Nuclear Localization Sequence) -- NMT -- NMT (N-Myristoyltransferase) / Sujeet Kumar, Ponniah Selvakumar, Jonathan R. Dimmock and Rajendra K. Sharma -- Nociceptin Opioid Receptor -- Non-Lysosomal Cysteine Protease. (opal-libraries.org)
  • The underlying mechanism appears to be mediated by SphK1 induced upregulation of select gene transcription programs such as that of CBP/p300 and PCAF, two histone acetyl transferases (HAT), and the down regulation of cell cycle dependent kinase inhibitor genes such as p27kip1 and p21cip1. (docplayer.net)
  • Several paracrine factors secreted from these cell types upon UV exposure regulate melanogenesis, causing skin tanning and hyperpigmentation [ 2 ]. (thno.org)
  • leading to Vision IP, an initiation of the World Intellectual Property Organization( WIPO) was to binding recessive to zone, less than 5 metabolism of deficiencies have probable in connective complexes p53-dependent as Braille or many factors within the poor disease of ligase, while 33 physical of gangliosides with well domains and 47 maintenance of thus intracellular mechanisms circulate endothelial to initiate aggregates in the winds they bind. (evakoch.com)