Wakefulness-Promoting Agents: A specific category of drugs that prevent sleepiness by specifically targeting sleep-mechanisms in the brain. They are used to treat DISORDERS OF EXCESSIVE SOMNOLENCE such as NARCOLEPSY. Note that this drug category does not include broadly-acting central nervous system stimulants such as AMPHETAMINES.Receptors, Adrenergic, alpha-2: A subclass of alpha-adrenergic receptors found on both presynaptic and postsynaptic membranes where they signal through Gi-Go G-PROTEINS. While postsynaptic alpha-2 receptors play a traditional role in mediating the effects of ADRENERGIC AGONISTS, the subset of alpha-2 receptors found on presynaptic membranes signal the feedback inhibition of NEUROTRANSMITTER release.alpha 1-Antitrypsin: Plasma glycoprotein member of the serpin superfamily which inhibits TRYPSIN; NEUTROPHIL ELASTASE; and other PROTEOLYTIC ENZYMES.Receptors, Adrenergic, alpha: One of the two major pharmacological subdivisions of adrenergic receptors that were originally defined by the relative potencies of various adrenergic compounds. The alpha receptors were initially described as excitatory receptors that post-junctionally stimulate SMOOTH MUSCLE contraction. However, further analysis has revealed a more complex picture involving several alpha receptor subtypes and their involvement in feedback regulation.Hypoxia-Inducible Factor 1, alpha Subunit: Hypoxia-inducible factor 1, alpha subunit is a basic helix-loop-helix transcription factor that is regulated by OXYGEN availability and is targeted for degradation by VHL TUMOR SUPPRESSOR PROTEIN.Receptors, Adrenergic, alpha-1: A subclass of alpha-adrenergic receptors that mediate contraction of SMOOTH MUSCLE in a variety of tissues such as ARTERIOLES; VEINS; and the UTERUS. They are usually found on postsynaptic membranes and signal through GQ-G11 G-PROTEINS.Guanine Nucleotide Exchange Factors: Protein factors that promote the exchange of GTP for GDP bound to GTP-BINDING PROTEINS.Encyclopedias as Topic: Works containing information articles on subjects in every field of knowledge, usually arranged in alphabetical order, or a similar work limited to a special field or subject. (From The ALA Glossary of Library and Information Science, 1983)Receptors, Adrenergic, beta-2: A subclass of beta-adrenergic receptors (RECEPTORS, ADRENERGIC, BETA). The adrenergic beta-2 receptors are more sensitive to EPINEPHRINE than to NOREPINEPHRINE and have a high affinity for the agonist TERBUTALINE. They are widespread, with clinically important roles in SKELETAL MUSCLE; LIVER; and vascular, bronchial, gastrointestinal, and genitourinary SMOOTH MUSCLE.Molecular Sequence Data: Descriptions of specific amino acid, carbohydrate, or nucleotide sequences which have appeared in the published literature and/or are deposited in and maintained by databanks such as GENBANK, European Molecular Biology Laboratory (EMBL), National Biomedical Research Foundation (NBRF), or other sequence repositories.Receptors, Adrenergic: Cell-surface proteins that bind epinephrine and/or norepinephrine with high affinity and trigger intracellular changes. The two major classes of adrenergic receptors, alpha and beta, were originally discriminated based on their cellular actions but now are distinguished by their relative affinity for characteristic synthetic ligands. Adrenergic receptors may also be classified according to the subtypes of G-proteins with which they bind; this scheme does not respect the alpha-beta distinction.Adrenergic alpha-1 Receptor Antagonists: Drugs that bind to and block the activation of ADRENERGIC ALPHA-1 RECEPTORS.Electronic Mail: Messages between computer users via COMPUTER COMMUNICATION NETWORKS. This feature duplicates most of the features of paper mail, such as forwarding, multiple copies, and attachments of images and other file types, but with a speed advantage. The term also refers to an individual message sent in this way.Adrenergic alpha-1 Receptor Agonists: Compounds that bind to and activate ADRENERGIC ALPHA-1 RECEPTORS.Adrenergic alpha-Agonists: Drugs that selectively bind to and activate alpha adrenergic receptors.Adrenergic beta-2 Receptor Agonists: Compounds bind to and activate ADRENERGIC BETA-2 RECEPTORS.Amino Acid Sequence: The order of amino acids as they occur in a polypeptide chain. This is referred to as the primary structure of proteins. It is of fundamental importance in determining PROTEIN CONFORMATION.Basal Metabolism: Heat production, or its measurement, of an organism at the lowest level of cell chemistry in an inactive, awake, fasting state. It may be determined directly by means of a calorimeter or indirectly by calculating the heat production from an analysis of the end products of oxidation within the organism or from the amount of oxygen utilized.Base Sequence: The sequence of PURINES and PYRIMIDINES in nucleic acids and polynucleotides. It is also called nucleotide sequence.Peptides: Members of the class of compounds composed of AMINO ACIDS joined together by peptide bonds between adjacent amino acids into linear, branched or cyclical structures. OLIGOPEPTIDES are composed of approximately 2-12 amino acids. Polypeptides are composed of approximately 13 or more amino acids. PROTEINS are linear polypeptides that are normally synthesized on RIBOSOMES.Receptors, Thrombin: A family of proteinase-activated receptors that are specific for THROMBIN. They are found primarily on PLATELETS and on ENDOTHELIAL CELLS. Activation of thrombin receptors occurs through the proteolytic action of THROMBIN, which cleaves the N-terminal peptide from the receptor to reveal a new N-terminal peptide that is a cryptic ligand for the receptor. The receptors signal through HETEROTRIMERIC GTP-BINDING PROTEINS. Small synthetic peptides that contain the unmasked N-terminal peptide sequence can also activate the receptor in the absence of proteolytic activity.Peptide Fragments: Partial proteins formed by partial hydrolysis of complete proteins or generated through PROTEIN ENGINEERING techniques.Thrombin: An enzyme formed from PROTHROMBIN that converts FIBRINOGEN to FIBRIN.Saphenous Vein: The vein which drains the foot and leg.Adrenergic alpha-Antagonists: Drugs that bind to but do not activate alpha-adrenergic receptors thereby blocking the actions of endogenous or exogenous adrenergic agonists. Adrenergic alpha-antagonists are used in the treatment of hypertension, vasospasm, peripheral vascular disease, shock, and pheochromocytoma.Receptors, Adrenergic, beta-1: A subclass of beta-adrenergic receptors (RECEPTORS, ADRENERGIC, BETA). The adrenergic beta-1 receptors are equally sensitive to EPINEPHRINE and NOREPINEPHRINE and bind the agonist DOBUTAMINE and the antagonist METOPROLOL with high affinity. They are found in the HEART, juxtaglomerular cells, and in the central and peripheral nervous systems.GermanyHypertension: Persistently high systemic arterial BLOOD PRESSURE. Based on multiple readings (BLOOD PRESSURE DETERMINATION), hypertension is currently defined as when SYSTOLIC PRESSURE is consistently greater than 140 mm Hg or when DIASTOLIC PRESSURE is consistently 90 mm Hg or more.Rats, Inbred SHR: A strain of Rattus norvegicus with elevated blood pressure used as a model for studying hypertension and stroke.Rats, Inbred WKY: A strain of Rattus norvegicus used as a normotensive control for the spontaneous hypertensive rats (SHR).18-Hydroxycorticosterone: 11 beta,18,21-Trihydroxypregn-4-ene-3,20-dione.Blood Pressure: PRESSURE of the BLOOD on the ARTERIES and other BLOOD VESSELS.Prazosin: A selective adrenergic alpha-1 antagonist used in the treatment of HEART FAILURE; HYPERTENSION; PHEOCHROMOCYTOMA; RAYNAUD DISEASE; PROSTATIC HYPERTROPHY; and URINARY RETENTION.Methyldopa: An alpha-2 adrenergic agonist that has both central and peripheral nervous system effects. Its primary clinical use is as an antihypertensive agent.Dihydroergotoxine: A mixture of three different hydrogenated derivatives of ERGOTAMINE: DIHYDROERGOCORNINE; DIHYDROERGOCRISTINE; and DIHYDROERGOCRYPTINE. Dihydroergotoxine has been proposed to be a neuroprotective agent and a nootropic agent. The mechanism of its therapeutic actions is not clear, but it can act as an alpha-adrenergic antagonist and a dopamine agonist. The methanesulfonate salts of this mixture of alkaloids are called ERGOLOID MESYLATES.Blood Platelets: Non-nucleated disk-shaped cells formed in the megakaryocyte and found in the blood of all mammals. They are mainly involved in blood coagulation.Platelet Membrane Glycoproteins: Surface glycoproteins on platelets which have a key role in hemostasis and thrombosis such as platelet adhesion and aggregation. Many of these are receptors.Platelet Aggregation: The attachment of PLATELETS to one another. This clumping together can be induced by a number of agents (e.g., THROMBIN; COLLAGEN) and is part of the mechanism leading to the formation of a THROMBUS.Drug Partial Agonism: Drug agonism involving selective binding but reduced effect. This can result in some degree of DRUG ANTAGONISM.Cell Membrane: The lipid- and protein-containing, selectively permeable membrane that surrounds the cytoplasm in prokaryotic and eukaryotic cells.Periodicals as Topic: A publication issued at stated, more or less regular, intervals.PubMed: A bibliographic database that includes MEDLINE as its primary subset. It is produced by the National Center for Biotechnology Information (NCBI), part of the NATIONAL LIBRARY OF MEDICINE. PubMed, which is searchable through NLM's Web site, also includes access to additional citations to selected life sciences journals not in MEDLINE, and links to other resources such as the full-text of articles at participating publishers' Web sites, NCBI's molecular biology databases, and PubMed Central.BooksPublishing: "The business or profession of the commercial production and issuance of literature" (Webster's 3d). It includes the publisher, publication processes, editing and editors. Production may be by conventional printing methods or by electronic publishing.Cloning, Molecular: The insertion of recombinant DNA molecules from prokaryotic and/or eukaryotic sources into a replicating vehicle, such as a plasmid or virus vector, and the introduction of the resultant hybrid molecules into recipient cells without altering the viability of those cells.Personality: Behavior-response patterns that characterize the individual.MinnesotaComputer Security: Protective measures against unauthorized access to or interference with computer operating systems, telecommunications, or data structures, especially the modification, deletion, destruction, or release of data in computers. It includes methods of forestalling interference by computer viruses or so-called computer hackers aiming to compromise stored data.Confidentiality: The privacy of information and its protection against unauthorized disclosure.Privacy: The state of being free from intrusion or disturbance in one's private life or affairs. (Random House Unabridged Dictionary, 2d ed, 1993)Personality Disorders: A major deviation from normal patterns of behavior.

Transcriptional regulation of alpha1-adrenoceptor gene in the rat liver during different phases of sepsis. (1/1305)

Changes in alpha1-adrenoceptor (alpha1AR) gene expression in the rat liver during different phases of sepsis were studied. Sepsis was induced by cecal ligation and puncture (CLP). Septic rats exhibit two metabolically distinct phases: an initial hyperglycemic phase (9 h after CLP, early sepsis) followed by a hypoglycemic phase (18 h after CLP; late sepsis). The [3H]prazosin binding studies show that the density of alpha1AR was increased by 30% during the early phase while it was decreased by 24% during the late phase of sepsis. Western blot analyses reveal that alpha1AR protein level was elevated by 48% during early sepsis but was decreased by 55% during late sepsis. Northern blot analyses depict that the steady-state level of alpha1bAR mRNA was enhanced by 21% during the early phase but was declined by 29% during the late phase of sepsis. Nuclear run-off assays show that the transcription rate of alpha1bAR gene transcript was increased by 76% during early sepsis while it was decreased by 29% during late sepsis. The actinomycin D pulse-chase studies indicate that the half-life of alpha1bAR mRNA remained unaffected during the early and the late phases of sepsis. These findings demonstrate that during the early phase of sepsis, the increase in the rate of transcription of alpha1bAR gene paralleled with the elevations in the alpha1bAR mRNA abundance and alpha1AR protein level, while during the late phase of sepsis, the decrease in the rate of transcription of alpha1bAR gene coincided with the declines in the alpha1bAR mRNA abundance and the alpha1AR protein level in the rat liver. These observations indicate that the altered expression of alpha1AR genes in the rat liver during the progression of sepsis was regulated transcriptionally.  (+info)

Expression of alpha2-adrenergic receptors in rat primary afferent neurones after peripheral nerve injury or inflammation. (2/1305)

1. Immunocytochemistry with polyclonal antibodies directed against specific fragments of intracellular loops of alpha2A- and alpha2C-adrenergic receptors (alpha2A-AR, alpha2C-AR) was used to explore the possibility that expression of these receptors in dorsal root ganglion (DRG) neurones of rat alters as a result of peripheral nerve injury or localized inflammation. 2. Small numbers of neurones with positive alpha2A-AR immunoreactivity (alpha2A-AR-IR) were detected in DRG from normal animals or contralateral to nerve lesions. In contrast, after complete or partial sciatic nerve transection the numbers of ipsilateral L4 and L5 DRG somata expressing alpha2A-AR-IR sharply increased (>5-fold). There was no discernible change in the number of DRG neurones exhibiting alpha2A-AR-IR innervating a region in association with localized chemically induced inflammation. 3. After nerve injury, double labelling with Fluoro-Gold, a marker of retrograde transport from transected fibres, or by immunoreactivity for c-jun protein, an indicator of injury and regeneration, suggested that many of the neurones expressing alpha2A-AR-IR were uninjured by the sciatic lesions. 4. In general the largest proportionate increase in numbers of neurones labelled by alpha2A-AR-IR after nerve lesions appeared in the medium-large diameter range (31-40 microm), a group principally composed of cell bodies of low threshold mechanoreceptors. The number of small diameter DRG neurones labelled by alpha2A-AR-IR, a category likely to include somata of nociceptors, also increased but proportionately less. 5. Relatively few DRG neurones exhibited alpha2C-AR-IR; this population did not appear to change after either nerve lesions or inflammation. 6. These observations are considered in relation to effects of nerve injury on excitation of primary afferent neurones by sympathetic activity or adrenergic agents, sympathetically related neuropathy and reports of sprouting of sympathetic fibres in DRG.  (+info)

alpha-adrenergic stimulation mediates glucose uptake through phosphatidylinositol 3-kinase in rat heart. (3/1305)

We examined whether insulin and catecholamines share common pathways for their stimulating effects on glucose uptake. We perfused isolated working rat hearts with Krebs-Henseleit buffer containing [2-3H]glucose (5 mmol/L, 0.05 microCi/mL) and sodium oleate (0.4 mmol/L). In the absence or presence of the phosphatidylinositol 3-kinase (PI3-K) inhibitor wortmannin (3 micromol/L), we added insulin (1 mU/mL), epinephrine (1 micromol/L), phenylephrine (100 micromol/L) plus propranolol (10 micromol/L, selective alpha-adrenergic stimulation), or isoproterenol (1 micromol/L) plus phentolamine (10 micromol/L, selective beta-adrenergic stimulation) to the perfusate. Cardiac power was found to be stable in all groups (between 8.07+/-0.68 and 10.7+/-0. 88 mW) and increased (25% to 47%) with addition of epinephrine, but not with selective alpha- and beta-adrenergic stimulation. Insulin and epinephrine, as well as selective alpha- and beta-receptor stimulation, increased glucose uptake (the following values are in micromol/[min. g dry weight]: basal, 1.19+/-0.13; insulin, 3.89+/-0.36; epinephrine, 3.46+/-0.27; alpha-stimulation, 4.08+/-0.40; and beta-stimulation, 3.72+/-0.34). Wortmannin completely inhibited insulin-stimulated and selective alpha-stimulated glucose uptake, but it did not affect the epinephrine-stimulated or selective beta-stimulated glucose uptake. Sequential addition of insulin and epinephrine or insulin and alpha-selective stimulation showed additive effects on glucose uptake in both cases. Wortmannin further blocked the effects of insulin on glycogen synthesis. We conclude that alpha-adrenergic stimulation mediates glucose uptake in rat heart through a PI3-K-dependent pathway. However, the additive effects of alpha-adrenergic stimulation and insulin suggest 2 different isoforms of PI3-K, compartmentation of PI3-K, potentiation, or inhibition by wortmannin of another intermediate of the alpha-adrenergic signaling cascade. The stimulating effects of both the alpha- and the beta-adrenergic pathways on glucose uptake are independent of changes in cardiac performance.  (+info)

Sympathetic nervous system activity and alpha-adrenergic responsiveness in older hypertensive humans. (4/1305)

We have previously demonstrated in normotensive humans an age-associated increase in sympathetic nervous system (SNS) activity combined with appropriate downregulation of alpha-adrenergic responsiveness. Impaired downregulation of alpha-adrenergic responsiveness, despite a comparable level of SNS activity, could contribute to higher blood pressure in older hypertensive humans. We measured arterial plasma norepinephrine (NE) levels and the extravascular NE release rate (NE2) derived from [3H]NE kinetics (to assess systemic SNS activity), and platelet and forearm arterial adrenergic responsiveness in 20 normotensive (N) and in 24 hypertensive (H), otherwise healthy, older subjects (60-75 yr). Although plasma NE levels were similar (N 357 +/- 27 vs. H 322 +/- 22 pg/ml; P = 0.37), NE2 tended to be greater in the hypertensive group (H 2.23 +/- 0.21 vs. N 1.64 +/- 0.20 microgram. min-1. m-2; P = 0. 11), and the NE metabolic clearance rate was greater (H 1,100 +/- 30 vs. N 900 +/- 50 ml/m2; P = 0.004). In the hypertensive group, there was a greater alpha-agonist-mediated inhibition of platelet membrane adenylyl cyclase activity and a NE- but not ANG II-mediated decrease in forearm blood flow. Compared with normotensive subjects, in older hypertensive subjects 1) NE metabolic clearance rate is increased, 2) systemic SNS activity tends to be increased, and 3) arterial and platelet alpha-adrenergic responsiveness is enhanced. These results suggest that heightened SNS activity coupled with enhanced alpha-adrenergic responsiveness may contribute to elevated blood pressure in older hypertensive humans.  (+info)

Hemodynamic basis for the acute cardiac effects of troglitazone in isolated perfused rat hearts. (5/1305)

Troglitazone is a thiazolidinedione used for the treatment of NIDDM and potentially for other insulin-resistant disease states. Troglitazone has recently been shown to increase cardiac output and stroke volume in human subjects. These actions are thought to be mediated by the reduction of peripheral resistance, but a potential direct effect on cardiac function has not been studied. Therefore, we investigated the direct cardiac hemodynamic effects of troglitazone in isolated perfused rat hearts. Five groups of hearts were studied. Hearts were tested under isovolumetric contraction with a constant coronary flow, and troglitazone (0.2, 0.5, and 1.0 micromol) was administered by bolus injection. Peak isovolumetric left ventricular pressure (LVPmax), peak rate of rise of LVP (dP/dt(max)), and peak rate of fall of LVP (dP/dt(min)) were significantly increased 1 min after troglitazone administration in a dose-dependent manner, while the heart rate (HR) and coronary perfusion pressure (CPP) were significantly decreased (P < 0.05). HR was then fixed by pacing and/or CPP was fixed with nitroprusside to eliminate any effect of the two variables on the action of troglitazone. With constant HR and/or constant CPP, the effect of troglitazone on LVPmax, dP/dt(max), and dP/dt(min) was still unchanged. In addition, the positive inotropic, positive lusitropic, and negative chronotropic actions of troglitazone were not influenced even when hearts were pretreated with prazosin, propranolol, or nifedipine. In conclusion, troglitazone has direct positive inotropic, positive lusitropic, negative chronotropic, and coronary artery dilating effects. The inotropic and chronotropic actions of troglitazone are not mediated via adrenergic receptors or calcium channels. These findings have important clinical implications for diabetic patients with congestive heart failure.  (+info)

Non-specific action of methoxamine on Ito, and the cloned channels hKv 1.5 and Kv 4.2. (6/1305)

The alpha1-adrenoceptor agonist methoxamine acted independently of receptor activation to reduce Ito and the sustained outward current in rat ventricular myocytes, and hKv 1.5 and Kv 4.2 cloned K+ channel currents. Two hundred microM methoxamine reduced Ito by 36% in the presence of 2 microM prazosin, and by 37 and 38% after preincubation of myocytes with either N-ethylmaleimide or phenoxybenzamine (n=6). The EC50 values at +60 mV for direct reduction of Ito, hKv 1.5, and Kv 4.2 by methoxamine were 239, 276, and 363 microM, respectively, with Hill coefficients of 0.87-1.5. Methoxamine accelerated Ito and Kv 4.2 current inactivation in a concentration- and voltage-dependent manner. Apparent rate constants for methoxamine binding and unbinding gave Kd values in agreement with EC50 values measured from dose-response relations. The voltage-dependence of block supported charged methoxamine binding to a putative intracellular site that sensed approximately 20% of the transmembrane electrical field. In the presence of methoxamine, deactivating Kv 4.2 tail currents displayed a distinct rising phase, and were slowed relative to control, such that tail current crossover was observed. These observations support a dominant mechanism of open channel block, although closed channel block could not be ruled out. Single-channel data from hKv 1.5 patches revealed increased closed times with blank sweeps and decreased burst duration in the presence of drug, and a reduction of mean channel open time from 1.8 ms in control to 0.4 ms in 500 microM methoxamine. For this channel, therefore, both open and closed channel block appeared to be important mechanisms for the action of methoxamine.  (+info)

Human dynamic closed-loop accommodation augmented by sympathetic inhibition. (7/1305)

PURPOSE: A ciliary alpha-adrenoceptor accommodative effect has been proposed, caused by a small population of alpha1-inhibitory receptors in excised human ciliary muscle. This study was intended to investigate the effect on the closed-loop dynamic accommodative process of modulating alpha1-adrenoceptor activity by topical instillation of the alpha1-adrenergic agonist, phenylephrine hydrochloride. METHODS: A group of 10 visually normal subjects viewed a photopic (30 candela/m2) high-contrast Maltese cross, which was modulated sinusoidally (0.05-0.6Hz) and stepwise over a 2-D range (2-4 D). Monocular temporal accommodation responses were measured using a continuously recording dynamic tracking infrared optometer under two trial conditions: after instillation of saline control solution and 50 minutes subsequent to the instillation of 0.27 microl 0.4% benoxinate hydrochloride and 0.27 microl 2.5% phenylephrine hydrochloride. Pupil size and accommodative amplitude were measured at 90-second intervals for 50 minutes after drug instillation. All accommodative measurements were recorded through a fixed 4-mm pupil. RESULTS: A significant reduction in accommodative amplitude (11%; P < 0.05) was recorded, whereas pupil size showed a significant increase (33%; P < 0.05). No significant change in step-response dynamics was observed. However, phenylephrine hydrochloride caused a significant increase in accommodative gain in the low and midtemporal frequency ranges compared with the effect of a saline control treatment. No significant variation in phase lag was observed. CONCLUSIONS: For the first time in humans, this study shows that augmentation of the alpha1-inhibitory sympathetic contribution results in increased accommodative gain at low and midtemporal frequencies, which is consistent with findings in animal studies.  (+info)

Receptor subtype mediating the adrenergic sensitivity of pain behavior and ectopic discharges in neuropathic Lewis rats. (8/1305)

Receptor subtype mediating the adrenergic sensitivity of pain behavior and ectopic discharges in neuropathic Lewis rats. We attempted to identify the subtype of alpha-adrenergic receptor (alpha-AR) that is responsible for the sympathetic (adrenergic) dependency of neuropathic pain in the segmental spinal injury (SSI) model in the Lewis strain of rat. This model was chosen because our previous study showed that pain behaviors in this condition are particularly sensitive to systemic injection of phentolamine (PTL), a general alpha-AR blocker. We examined the effects of specific alpha1- and alpha2-AR blockers on 1) behavioral signs of mechanical allodynia, 2) ectopic discharges recorded in the in vivo condition, and 3) ectopic discharges recorded in an in vitro setup. One week after tight ligation of the L5 and L6 spinal nerves, mechanical thresholds of the paw for foot withdrawals were drastically lowered; we interpreted this change as a sign of mechanical allodynia. Signs of mechanical allodynia were significantly relieved by a systemic injection of PTL (a mixed alpha1- and alpha2-AR antagonist) or terazosin (TRZ, an alpha1-AR antagonist) but not by various alpha2-AR antagonists (idazoxan, rauwolscine, or yohimbine), suggesting that the alpha1-AR is in part the mediator of the signs of mechanical allodynia. Ongoing ectopic discharges were recorded from injured afferents in fascicles of the L5 dorsal root of the neuropathic rat with an in vivo recording setup. Ongoing discharge rate was significantly reduced after intraperitoneal injection of PTL or TRZ but not by idazoxan. In addition, by using an in vitro recording setup, spontaneous activity was recorded from teased dorsal root fibers in a segment in which the spinal nerve was previously ligated. Application of epinephrine to the perfusion bath enhanced ongoing discharges. This evoked activity was blocked by pretreatment with TRZ but not with idazoxan. This study demonstrated that both behavioral signs of mechanical allodynia and ectopic discharges of injured afferents in the Lewis neuropathic rat are in part mediated by mechanisms involving alpha1-ARs. These results suggest that the sympathetic dependency of neuropathic pain in the Lewis strain of the rat is mediated by the alpha1 subtype of AR.  (+info)

Synonyms for alpha-adrenergic receptor in Free Thesaurus. Antonyms for alpha-adrenergic receptor. 2 synonyms for alpha-adrenergic receptor: alpha receptor, alpha-adrenoceptor. What are synonyms for alpha-adrenergic receptor?
Cerebral and renal alpha-adrenergic receptors play an important role in the control of blood pressure. We studied alpha-adrenergic receptors in the cerebral and renal cortex of Milan hypertensive strain (MHS) and normotensive strain (MNS) rats, a genetic model of spontaneous hypertension linked to a kidney abnormality. Binding of the selective alpha 1-adrenergic antagonist [3H]prazosin and the alpha 2-adrenergic antagonist [3H]rauwolscine was used for receptor studies in tissues of prehypertensive (24-day-old) and hypertensive (60-day-old) rats. In the cerebral cortex, no between-strain differences in alpha 1-adrenergic and alpha 2-adrenergic receptor density and affinity were observed in prehypertensive and hypertensive periods. The density of these receptors increased similarly with age in MHS and MNS rats. In the renal cortex, the differences between MHS and MNS rats concerned alpha 2-adrenergic receptors only. Compared with their age-matched normotensive controls, MHS rats showed 1) a lower ...
Study Flashcards On cholinergic and adrenergic effects and side effects at Cram.com. Quickly memorize the terms, phrases and much more. Cram.com makes it easy to get the grade you want!
An alpha 2-adrenergic receptor subtype has been cloned from a human kidney cDNA library using the gene for the human platelet alpha 2-adrenergic receptor as a probe. The deduced amino acid sequence resembles the human platelet ...
Looking for online definition of Alpha adrenergic receptor in the Medical Dictionary? Alpha adrenergic receptor explanation free. What is Alpha adrenergic receptor? Meaning of Alpha adrenergic receptor medical term. What does Alpha adrenergic receptor mean?
The existence and significance of a hormone-sensitive, rapidly mobilizable intracellular pool of Ca2+ in hamster brown-fat cells was investigated with 45Ca2+-labelling techniques. It was shown that such a pool existed and was probably located within the abundant mitochondria. It was rapidly mobilized by norepinephrine (median effective concentration 50 nM) through alpha-adrenergic mechanisms. The mobilization of Ca2+ from the intracellular stores (mitochondria) required the presence of extracellular Na+, but not of Ca2+, K+ or Mg2+. It is concluded that the experiments are in agreement with a hypothesis linking the mobilization of intracellular Ca2+ pools with an alpha-adrenergically-induced increase in plasma membrane Na+ permeability (observed as a membrane depolarization), and a subsequent activation of the mitochondrial Na+/Ca2+ exchange, leading to mobilization of mitochondrial Ca2+ and the mediation of alpha-adrenergic effects as a result of an elevated cytosolic Ca2+ level.. ...
To more fully characterize the alterations in myocardial adrenergic and cholinergic receptors induced by the diabetic state, we investigated the binding characteristics of (-) [3H] dihydroalprenolol to beta adrenergic receptors (bAR), [3H] prazosin to alpha adrenergic receptors (aAR), and [3H] quinuclidinyl-benzilate to muscarinic cholinergic receptors (MCR) in myocardial membranes derived from rats 8 wk after treatment with streptozotocin. We also studied an equal number of animals from three control groups: free-eating nondi-abetics, pair-weighted nondiabetics, and streptozoto-cin-treated animals treated daily with insulin.. Diabetic hearts demonstrated 27% fewer bAR (P , 0.01) and 31% fewer aAR (P , 0.01) than free-eating controls, without changes in MCR, and without changes in antagonist affinity, agonist affinity, or agonist slope factor (pseudo-Hill coefficient) for any class of receptors. Food restriction had no effect on receptor characteristics, and treatment of diabetic rats with ...
3H]Dihydroergocryptine, a nonselective alpha adrenergic antagonist, the alpha-1 selective antagonist, [3H]prazosin and the alpha-2 selective antagonist, [3H]yohimbine, were used to study binding sites in rat renal membranes. To establish a correlation between binding and a biological function, the ability of alpha adrenergic agents to stimulate or inhibit vasoconstriction was quantified in vitro using an isolated perfused kidney preparation. Binding with each radioligand was rapid, saturable and specific. Moreover, the order of potencies of a variety of adrenergic agents, determined by competitive inhibition studies, suggested that the binding of each radioligand was to sites with alpha adrenergic specificity. The total number of binding sites in these rat renal membranes. determined with [3H]dihydroergocryptine (Bmax, 212 fmol/mg of protein; KD, 12.8 nM) was approximately equal to the sum of binding site concentrations determined with the alpha-1 and alpha-2 selective radioligands (Bmax, 57 and ...
TY - JOUR. T1 - Presynaptic modulation of the norepinephrine-induced β-adrenergic receptor desensitization phenomenon in vivo. AU - Nakamura, I.. AU - Yoshikawa, T.. AU - Anzai, T.. AU - Baba, A.. AU - Iwata, M.. AU - Wainai, Y.. AU - Suzuki, M.. AU - Ogawa, S.. PY - 2000/1/1. Y1 - 2000/1/1. N2 - Background: In vivo administration of norepinephrine fails to cause β-adrenergic receptor desensitization. However, short-term exposure of cultured cells to norepinephrine induces the phenomenon in vitro. We sought to identify the local regulatory mechanisms responsible for in vivo β-adrenergic receptor desensitization in congestive heart failure. Methods and Results: Control rabbits received norepinephrine (n = 7) or saline (n = 7) for 1 week, and rabbits with chemical denervation induced by 6-hydroxydopamine also received norepinephrine (n = 7) or saline (n = 7). Myocardial norepinephrine content decreased 80% in both groups of denervated rabbits. β1-Adrenergic receptor density in denervated ...
Alpha RecoverX ATTENTION: Do Not Buy Alpha RecoverX Male Enhancement Supplement Until You Read This SHOCKING Alpha RecoverX Review & Find Out If It Works!
Modern dentistry that is affordable in a fun, caring environment. Our passion is crafting beautiful, comfortable smiles. Learn more at Smile Fresh Dental
The invention features polymeric hydrogel contact lenses containing an anti-glaucoma medication, such as a beta adrenergic receptor antagonist, e.g., timolol maleate, or an alpha adrenergic receptor agonist, e.g., brimonidine tartrate, and methods of fabrication and uses thereof. A medication is passively transferred into a contact lens by absorption from a dilute aqueous solution. Such treated lenses are contacted with the ocular fluid of an individual to treat glaucoma.
Obesity often leads to hypertension. Previous work from my lab demonstrated that the adipocyte-derived hormone leptin reduces the ability of the aorta to contract in response to adrenergic stimulation, likely due to a decreased expression of the aorta alpha-adrenergic receptors. However, it is not known whether leptin decreases the expression of alpha-adrenergic receptors in such arteries like the mesenteric and renal arteries that play a key role in the control of blood pressure. To determine whether leptin decreases alpha-adrenergic receptor expression in renal and mesenteric arteries, I infused leptin (10ug/day) by implanting subcutaneous mini-pumps in five male C57bl/6 mice. Five mice did not receive leptin and served as controls. After seven days of treatment I euthanized nine mice as one mouse died. Renal and mesenteric arteries were taken from the mice and mRNa was extracted from the arteries. Reverse Transcription (RT) was completed in order to induce the transcription of mRNA into cDNA. ...
Although it is now well documented (6, 8) that pial as well as intracerebral vessels are amply supplied with sympathetic adrenergic nerves which, as shown for pial arteries, fulfill ultra-structural...
Semantic Scholar extracted view of Influence of adrenergic receptor stimulation on glucose metabolism during starvation in man: effects on circulating levels of insulin growth hormone and free fatty acids. by Robert I Misbin et al.
Thank you for your interest in spreading the word on Circulation.. NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address. ...
alpha 1 Adrenergic Receptor ELISA Kits für viele Reaktivitäten. Huhn, Rind (Kuh), Hund und weitere. alpha 1 Adrenergic Receptor ELISA Kits vergleichen und bestellen.
In order to have the best Alpha Cut HD before and after results , use the product daily. You can have the best results ever if youll tend to use this product religiously. Those people who have shown their satisfaction based on their individual Alpha Cut HD Review had gone th rough this process. Where To Buy Alpha Cut HD ? Simply, you can avoid Alpha Cut HD Scam and yet, you can have the positive Alpha Cut HD results by purchasing this product from its official website only. Click the link provided below and get your first legit bottle now. ...
HNF-4-alpha兔多克隆抗体(ab76649)可与人样本反应并经WB, ELISA实验严格验证。中国75%以上现货,所有产品均提供质保服务,可通过电话、电邮或微信获得本地专属技术支持。
Epinephrine hydrochloride produces beneficial effects in patients during cardiac arrest, primarily because of its α-adrenergic receptor-stimulating properties.1 The adrenergic effects of epinephrine increase myocardial and cerebral blood flow during CPR.2 The value and safety of the β-adrenergic effects of epinephrine are controversial because they may increase myocardial work and reduce subendocardial perfusion.3 Although epinephrine has been used universally in resuscitation, there is a paucity of evidence to show that it improves outcome in humans. For a number of years researchers and clinicians have also questioned the optimal dose of epinephrine. The "standard" dose of epinephrine (1.0 mg) is not based on body weight. Historically a standard dose of 1 mg epinephrine was used in surgical operating rooms for intracardiac injections.4 5 6 Surgeons observed that 1 to 3 mg of intracardiac epinephrine was effective in restarting the arrested heart.6 7 When these and other experts first ...
Electrical stimulation of the lower brain stem (ESLB) at sites presumed to be parts of the ascending noradrenergic system was carried out in unanaesthetized young guinea pigs. At neutral ambient...
AllMax Nutrition Yohimbine + Rauwolscine on sale now at Muscle & Strength! Read AllMax Nutrition Yohimbine + Rauwolscine reviews from M&S Customers.
Kaufen Sie AllMax Nutrition Yohimbine + Rauwolscine - 60 Kapseln aus einer großen Auswahl von AllMax Nutrition zu täglich niedrigen Preisen. Lesen Sie Rezensionen und finden Sie Coupons. Importieren Sie und erhalten Sie schnellen Versand aus den USA nach Deutschland.
alpha 2a Adrenergic Receptor兔多克隆抗体(ab92650)可与小鼠, 大鼠, 人样本反应并经IHC实验严格验证。所有产品均提供质保服务,中国75%以上现货。
how to become a alpha male, how to become an alpha male pdf, how to become an alpha male book, how to become an alpha male reddit, how to become an alpha male by john alexander, how to become the alpha male, how to become alpha male, how do i become an alpha male, how to become an alpha male book pdf, how to become an alpha male john alexander
Alpha Test Articles, Alpha Test images, Alpha Test links, Alpha Test resources, Alpha Test references, Alpha Test papers, Alpha Test blog posts, and all things related to Alpha Test
Prazosin, 1-(4-amino-6,7-dimetoksi-2-hinazolinil)-4-(2-furoil)-piperazin, se sintetiše iz 2-amino-4,5-dimetoksibenzoinske kiseline, koji nakon reakcije sa natrijum cijanatom podleže heterociklizaciji do 2,4-dihidroksi-6,7-dimetoksihinazolina. Supstituisanje hidroksilnih grupa ovog jedinjenja atomima hlora reakcijom sa tionil hloridom, ili smešom fosfor oksihlorida sa fosfor pentahloridom daje 2,4-dihloro-6,7-dimetoksihinazolin. Naknadnom reakcijom sa amonijakom, atom hlora u C4 poziciji pirimidinskog prstena se zamenjuje amino grupom, što dovodi do formiranja 4-amino-2-hloro-6,7-dimetoksihinazolina. Njegovim uvođenjem u reakciju sa 1-(2-furoil)piperazinom formira se prazosin.[3][4][5][6][7][8][9][10][11][12]. ...
Ny fahaizana mamokatra sy manamboatra be dia be ani Yohimbine (146-48-5) miaraka aminny rafitra fanaraha-maso kalitao aminny famokarana CGMP.
The RELX Alpha Pod System Vape Kit builds upon the original RELX pod system with extra features and quality of life improvements. The RELX Alpha features the unique AlphaStream design which has an elongated alpha-shaped airway for extra flavorful vapor and draws similarly to a cigarette.
Лучшие варианты W4cko Alpha Protocol качай и слушай на портале поисковом портале ultratreki.com
高い抗原親和性、特異性と安定した品質を兼ね備えたアブカムのウサギ・モノクローナル抗体 RabMAb® ab109320 交差種: Hu 適用: WB,IP,IHC-P,ICC,Flow Cyt
So am I to understand that Ive just gone to nutraplanet in an attempt to order more of my tried and true AT2 and its not even close to the same
Prazosin for nightmares side effects. Prazosin cheap flights. Prazosin for blood pressure. Prazosin synthesis energy. Can prazosin get you high. Buy prazosin online uk pharmacy. Prazosin side effects erectile dysfunction. Prazosin contraindication. Prazosin mechanism. Prazosin purchase. Prazosin bladder control. Prazosin xli. Prazosin xlr8. Prazosin rxlist advanced. Prazosin hcl 2mg cap side effects. Prazosin xl. Prazosin bladder pain. Prazosin dose in cats. Prazosin for day time anxiety. Prazosin solubility test. Ptsd nightmares prazosin. Prazosin pharmacology made. Prazosin and alcohol dependence. Doxazosin vs prazosin. the patient should also be cautioned to avoid situations where injury could result should syncope occur during the initiation of prazosin therapy.. ...
Drop tests. Theres much to be said about how eye drops and other examination maneuvers can be used as aids in your differential diagnosis. Take a case of Horners Syndrome, for example. Most people just image the entire sympathetic pathway anyway, but its kind of interesting to know. So, by giving a patient 0.5% topical apraclonidine to both eyes, the affected eye by the Horners Syndrome will dilate to a much greater size than the contralateral pupil. This is due to subacute (,48hours) or chronic denervation of that eye leading to overexpression of alpha adrenergic receptors and hypersensitivity of that pupil to sympathetic stimulation. This confirms the Horners, but wont tell you where the lesion is. Next, you administer hydroxyamphetamine, which stimulates release of norepinephrine from the intact post-ganglionic neuron (3rd order neuron in the 3-neuron Horner pathway). If the affected pupil also dilates in response to these eye drops, then the 3rd order neuron is alive and thus the ...
BACKGROUND AND PURPOSE: In mouse tail arteries, selective alpha(2)-adrenoceptor antagonism with rauwolscine caused powerful dilation during constriction to the alpha(1)-adrenoceptor agonist phenylephrine. This study therefore assessed phenylephrines selectivity at vascular alpha-adrenoceptors and the mechanism(s) underlying dilation to rauwolscine. EXPERIMENTAL APPROACH: Mouse isolated tail arter
Dan E. Berkowitz, David T. Price, Elizabeth A. Bello, Stella O. Page, Debra A. Schwinn; Localization of Messenger RNA for Three Distinct α2-Adrenergic Receptor Subtypes in Human Tissues: Evidence for Species Heterogeneity and Implications for Human Pharmacology. Anesthesiology 1994;81(5):1235-1244. Download citation file:. ...
Cocaine increases production of the potent vasoconstrictor endothelin, and simultaneously decreases production of nitrous oxide, a powerful vasodilator. As a result of alpha-adrenergic stimulation, co... more
... are cell‐surface receptors for two major catecholamine hormones and neurotransmitters that regulate key physiological responses, including cardiovascular and pulmonary functions
Phenoxybenzamine hydrochloride, calmodulin and alpha-adrenoceptor antagonist (CAS 63-92-3), with |95% purity. Join researchers using our high quality biochemicals.
Kaufen Prazosin in der Internet-Apotheke. Möchten Sie eine Ermäßigung auf Prazosin bekommen Kaufe und spare dein Geld. Sicher und komfortabel. Schnelle Lieferung.
Read the latest Yohimbine HCl by NutraKey reviews and find the latest results, side effects and user experiences from eVitamins. Have you taken Yohimbine HCl by NutraKey? Submit your own Yohimbine HCl review and let the world know what you think.
Ruuskanen JO, Xhaard H, Marjamäki A, Salaneck E, Salminen T, Yan YL, Postlethwait JH, Johnson MS, Larhammar D, Scheinin M (2004). „Identification of duplicated fourth alpha2-adrenergic receptor subtype by cloning and mapping of five receptor genes in zebrafish". Molecular Biology and Evolution. 21 (1): 14-28. PMID 12949138. doi:10.1093/molbev/msg224 ...
No, he draws a pixel with r=1,g=0,b=0,a=0. With a blend mode of ADD/ALPHA/INVERSE this would mean that r/g/b/a is multiplied with a first so everything is multiplied with 0 so it all gets 0. Nothing at all is drawn. With the blend mode he uses (ADD/ONE/ZERO) the r/g/b/a are simply copied (the destination is multiplied with 0, the source is multiplied with 1 therefore left as is). The alpha value (a=0) is not used at all.. The only unexpected thing is that when he reads the pixel back the alpha magically turned 1. This is a bug if the bitmap does have an alpha channel, otherwise is expected (a bitmap without alpha always behaves like a bitmap with an alpha channel of all 1). ...
No, he draws a pixel with r=1,g=0,b=0,a=0. With a blend mode of ADD/ALPHA/INVERSE this would mean that r/g/b/a is multiplied with a first so everything is multiplied with 0 so it all gets 0. Nothing at all is drawn. With the blend mode he uses (ADD/ONE/ZERO) the r/g/b/a are simply copied (the destination is multiplied with 0, the source is multiplied with 1 therefore left as is). The alpha value (a=0) is not used at all.. The only unexpected thing is that when he reads the pixel back the alpha magically turned 1. This is a bug if the bitmap does have an alpha channel, otherwise is expected (a bitmap without alpha always behaves like a bitmap with an alpha channel of all 1). ...
Yohimbine Hydrochloride Alias: Corynine;Aphrodine CAS No: 65-19-0 Einecs No: 200-600-4 MF: C21H27ClN2O3 MW: 390.91 Purity: 98% Appearance:White crystalline
aldrin-transdiol: dieldrin metabolite suggested as active neurotoxic form; RN refers to (1 alpha,2 alpha,3 beta,4 alpha,4a beta,5 alpha,8 alpha,8a beta)-isomer
Schopnosť vyrábať syntetizovať a vyrábať veľké množstvá Yohimbinu (146-48-5) s kontrolným systémom kvality podľa CGMP výrobných predpisov.
ウサギ・ポリクローナル抗体 ab199 交差種: Ms,Rat,Hu 適用: WB,ICC/IF…HIF-2-alpha抗体一覧…画像、プロトコール、文献などWeb上の情報が満載のアブカムの Antibody 製品。国内在庫と品質保証制度も充実。
Browse products from the Potentiometers category - listing products sorted by recommended, showing only products where Brand value is Alpha, page 5
Ever wanted an overpriced version of a flagship phone from last year? The Lamborghini Alpha One fits the bill, coming in at almost $2500.
Alpha-2 adrenergic receptor agonistsEdit. Central alpha agonists lower blood pressure by stimulating alpha-receptors in the ... an alpha-adrenergic receptor blocker, had a higher incidence of heart failure events, and the doxazosin arm of the study was ... These alpha 2 receptors are known as autoreceptors which provide a negative feedback in neurotransmission (in this case, the ... Endothelium receptor blockersEdit. Bosentan belongs to a new class of drug and works by blocking the receptors of the hormone ...
Newer, third-generation beta blockers can cause vasodilation through blockade of alpha-adrenergic receptors.[69] ... β2 and β3 receptors.[5] β1-adrenergic receptors are located mainly in the heart and in the kidneys.[4] β2-adrenergic receptors ... β3-adrenergic receptors are located in fat cells.[6] Beta receptors are found on cells of the heart muscles, smooth muscles, ... β-adrenergic receptors and others are selective for one of the three known types of beta receptors, designated β1, ...
Among other alkaloids is corynanthine, an alpha-1 adrenergic receptor blocker and raubasine. Extracts from the bark of yohimbe ... ISBN 9789290814955 Doxey, JC; Lane AC; Roach AG; Virdee NK (Feb 1984). "Comparison of the alpha-adrenoceptor antagonist ...
The alpha(2a)-adrenergic receptor plays a protective role in mouse behavioral models of depression and anxiety. J Neurosci 2001 ... α2A adrenergic receptor knockout mice, glucocorticoid receptor heterozygous mice, and cAMP response element-binding protein ... Mice with genetically altered glucocorticoid receptor expression show altered sensitivity for stress-induced depressive ...
Norepinephrine works by binding and activating alpha adrenergic receptors. Norepinephrine was discovered in 1946 and was ... Norepinephrine acts on beta-1 adrenergic receptors, causing increase in heart rate and cardiac output. Norepinephrine is the ... It stimulates α1 and α2 adrenergic receptors to cause blood vessel contraction, thus increases peripheral vascular resistance ...
... α2-adrenergic receptor agonist. Guanfacine - Sympatholytic, α2-adrenergic receptor agonist. Prazosin - Sympatholytic, alpha ... 5-HT1A receptor partial agonists, such as buspirone and tandospirone. Serotonin-norepinephrine reuptake inhibitors (SNRIs), ... Hydroxyzine - Antihistamine, 5-HT2A receptor antagonist. Propranolol - Sympatholytic, beta blocker. Clonidine - Sympatholytic, ...
"Multiple alpha-2 adrenergic receptor subtypes. II. Evidence for a role of rat R alpha-2A adrenergic receptors in the control of ... "Vestibular dysfunction in vitamin D receptor mutant mice". J Steroid Biochem Mol Biol. 114 (3-5): 161-6. doi:10.1016/j.jsbmb. ...
Pure β-blockers do not inhibit lid-retraction in the eyes, which is mediated by alpha adrenergic receptors. ... Thyroid-stimulating immunoglobulins recognize and bind to the thyrotropin receptor (TSH receptor) which stimulates the ... Measuring TSH-receptor antibodies with the h-TBII assay has been proven efficient and was the most practical approach found in ... The bacterium Yersinia enterocolitica bears structural similarity with the human thyrotropin receptor[10] and was hypothesized ...
Dopamine binds to alpha-1 and beta-1 adrenergic receptors. Mediated through myocardial beta-1 adrenergic receptors, dopamine ... dopamine mainly triggers dopamine receptors and β1-adrenergic receptors while at high doses it works via α-adrenergic receptors ... Alpha-1 adrenergic receptor stimulation on vascular smooth muscle, leads to vasoconstriction and results in an increase in ... Dopamine binds to beta-1, beta-2, alpha-1 and dopaminergic receptors. Pharmacy and pharmacology portal Medicine portal. ...
alpha-1 adrenergic receptors, causing constriction of the body's arteries. This constriction raises the total resistance of ... The nature of receptors mediating the Cushing response is also unknown. Some research suggests the existence of intracranial ...
Noradrenaline and adrenaline have effects on alpha and beta adrenergic receptors. Other hormones (catecholamine, renin- ...
The alpha-1 adrenergic receptor is specifically implicated. Although it has not yet been thoroughly investigated, there is ... Administering a norepinephrine receptor agonist (a substance that initiates a cell response when it binds with a receptor) to ... these findings are based on the effects of other commonly prescribed drugs that happen to block noradrenergic receptors. ...
... is an α1-adrenergic receptor antagonist. Alpha blocker Tham, TC; Guy, S; Shanks, RG; Harron, DW (1992). "Dose-dependent alpha 1 ...
"Guanfacine Extended-Release Tablets (Intuniv), a Nonstimulant Selective Alpha(2A)-Adrenergic Receptor Agonist For Attention- ... α2A adrenergic receptor, with negligible affinity for any other receptor.[11] However, it may also be a potent 5-HT2B receptor ... "Alpha-2 receptor agonists for the treatment of posttraumatic stress disorder". Drugs in context. 4: 212286. doi:10.7573/dic. ... Arnsten AF (October 2010), "The use of α2A adrenergic agonists for the treatment of attention-deficit/hyperactivity disorder", ...
... is an inhibitor of adrenergic alpha-receptors and tryptamine receptors. The inhibition of adrenergic alpha-receptors ...
"Renal alpha-1 and alpha-2 adrenergic receptors: Biochemical and pharmacological correlations". The Journal of Pharmacology and ... Elliott, J. (1997). "Alpha-adrenoceptors in equine digital veins: Evidence for the presence of both alpha1 and alpha2-receptors ... Sagrada, A; Fargeas, M J; Bueno, L (1987). "Involvement of alpha-1 and alpha-2 adrenoceptors in the postlaparotomy intestinal ... Woodman, OL; Vatner, SF (1987). "Coronary vasoconstriction mediated by alpha 1- and alpha 2-adrenoceptors in conscious dogs". ...
... is an antagonist of the 5-HT2 and α1-adrenergic receptors. Villalobos-Molina, R; Ibarra, M; Hong, E (1995). "The 5- ... HT2 receptor antagonist, pelanserin, inhibits alpha 1-adrenoceptor-mediated vasoconstriction in vitro". European Journal of ...
"Effects of iminodibenzyl antipsychotic drugs on cerebral dopamine and alpha-adrenergic receptors". European Journal of ... Clocapramine has been reported to act as an antagonist of the D2, 5-HT2A, α1-adrenergic, and α2-adrenergic receptors, and does ... "Interaction of neuroleptics and antidepressants with rat brain alpha 2-receptors: a possible relationship between alpha 2- ... It has also been shown to have affinity for the σ receptors. Clocapramine's affinity for the 5-HT2A receptor is greater than ...
"Molecular Evolution of the Mammalian Alpha 2B Adrenergic Receptor". Molecular Biology and Evolution. 19 (12): 2150-2160. doi: ... adrenergic receptors, and apolipoproteins. In 2001, the fossil limbs of a Pakicetus (amphibioid cetacean the size of a wolf) ...
... drugs with 5-hydroxytryptamine1A and alpha 2-adrenergic receptors". Behavioral Neuroscience. 100 (5): 664-8. doi:10.1037/0735- ... It acts as a D2-like receptor agonist and also has some serotonin and adrenergic agonist effects, as well as some ... Sahin I, Tuncer M, Ilhan M (March 1990). "Dopamine receptor agonists, N,N-dipropyl-2-aminotetralin (TL-68) and 2-di-n- ... Arnerić SP, Long JP (May 1984). "Evidence that a novel dopamine receptor agonist, RDS-127 [2-di-n-propylamino-4,7- ...
... dopaminergic and alpha-adrenergic receptors. Its specific binding and activation pattern on these receptors leads to a highly, ... dopaminergic and adrenergic receptors". In Vladimír Křen,Ladislav Cvak. Ergot: the genus Claviceps. CRC Press. pp. 411-440. ... due to its agonistic action at the 5HT2A-mGlu2 receptor protomers. Clinical efficacy occurs around 200 µg, ten times lower than ... which is also an agonist at the 5HT2A-mGlu2 receptor protomer and increases the chances of a patient experiencing ...
... its humoral mediators and alpha-beta adrenergic receptors". Chest. 71 (2 suppl): 249-251. doi:10.1378/chest.71.2_Supplement.249 ... such as transient receptor potential canonical 6 (TRPC6) channels, and transient receptor potential vanilloid 4 (TRPV4) ... "Classical transient receptor potential channel 6 (TRPC6) is essential for hypoxic pulmonary vasoconstriction and alveolar gas ...
Alpha α1 adrenergic receptors: This action accounts for its orthostatic hypotensive effects and perhaps some of the sedating ... Alpha α2 adrenergic receptors: Perhaps greater positive, negative, affective and cognitive symptom control. Histamine H1 ... Hecht EM, Landy DC (2012). "Alpha-2 receptor antagonist add-on therapy in the treatment of schizophrenia; a meta-analysis". ... Serotonin receptors: Its action at these receptors may be responsible for its lower extrapyramidal side effect liability (via ...
McClue SJ, Milligan G (Sep 1990). "The alpha 2B adrenergic receptor of undifferentiated neuroblastoma x glioma hybrid NG108-15 ... Osawa S, Dhanasekaran N, Woon CW, Johnson GL (Nov 1990). "G alpha i-G alpha s chimeras define the function of alpha chain ... "Characterization and distribution of alpha 2-adrenergic receptors in the human intestinal mucosa". The Journal of Clinical ... GNAI2 has been shown to interact with: EYA2, GPSM2, Interleukin 8 receptor, alpha, MDFI, RGS5, and RIC8A. GRCh38: Ensembl ...
... is both a non-selective beta adrenergic receptor blocker (β1, β2) and an alpha adrenergic receptor blocker (α1). The ... Carvedilol reversibly binds to beta adrenergic receptors on cardiac myocytes. Inhibition of these receptors prevents a response ... Carvedilol also blocks alpha receptors, which are found on blood vessels, and relaxes the blood vessels, dilating them, which ... Beta blockers block the beta receptors on heart muscle and other cells, making them more relaxed and less responsive to stress ...
ReceptorEdit. The endogenous receptor for substance P is neurokinin 1 receptor (NK1-receptor, NK1R).[8] It belongs to the ... Azzolina A, Bongiovanni A, Lampiasi N (Dec 2003). "Substance P induces TNF-alpha and IL-6 production through NF kappa B in ... administered through the non-adrenergic, non-cholinergic nervous system (branch of the vagal system). ... "Absence of the SP/SP receptor circuitry in the substance P-precursor knockout mice or SP receptor, neurokinin (NK)1 knockout ...
"Expansion of the alpha 2-adrenergic receptor family: cloning and characterization of a human alpha 2-adrenergic receptor ... The alpha-2B adrenergic receptor (α2B adrenoceptor), is a G-protein coupled receptor. It is a subtype of the adrenergic ... Klein U, Ramirez MT, Kobilka BK, von Zastrow M (Aug 1997). "A novel interaction between adrenergic receptors and the alpha- ... McClue SJ, Milligan G (Sep 1990). "The alpha 2B adrenergic receptor of undifferentiated neuroblastoma x glioma hybrid NG108-15 ...
The alpha-1D adrenergic receptor (α1D adrenoreceptor), also known as ADRA1D, is an alpha-1 adrenergic receptor, and also ... This gene encodes alpha-1D-adrenergic receptor. Similar to alpha-1B-adrenergic receptor gene, this gene comprises 2 exons and a ... 1994). "Cloning, expression and characterization of human alpha adrenergic receptors alpha 1a, alpha 1b and alpha 1c". Biochem ... Receptor[edit]. There are 3 alpha-1 adrenergic receptor subtypes: alpha-1A, -1B and -1D, all of which signal through the Gq/11 ...
Myocardial alpha 1-adrenergic receptor stimulation.. R Curiel, J F Pérez-González ...
Term: alpha-1 adrenergic receptor. ID: PIRSF038550 Mouse Protein Superfamily Annotations. Select one or more mouse PIRSF ...
The alpha-2B adrenergic receptor (α2B adrenoceptor), is a G-protein coupled receptor. It is a subtype of the adrenergic ... "Expansion of the alpha 2-adrenergic receptor family: cloning and characterization of a human alpha 2-adrenergic receptor ... ReceptorEdit. α2-adrenergic receptors include 3 highly homologous subtypes: α2A, α2B, and α2C. These receptors have a critical ... adrenergic receptor activity. • protein binding. • alpha2-adrenergic receptor activity. Cellular component. • integral ...
Alpha-adrenergic agonists. Class Summary. These agents stimulate alpha-adrenoreceptors in brain stem, activating an inhibitory ... A central alpha-adrenergic agonist that suppresses peripheral release of norepinephrine, resulting in lower blood pressure; ... H2 receptor antagonists. Class Summary. These agents are reversible competitive blockers of histamine at the H2 receptors, ... A pure peripheral alpha-adrenergic agonist, which causes peripheral vasoconstriction and raises blood pressure without ...
Richards E.M., Raizada M.K., Sumners C. (1987) Insulin Downregulates Alpha-2 Adrenergic Receptors in Cultured Glial Cells. In: ... Using [3H]-yohimbine as a ligand for α2-adrenergic receptors, we have demonstrated that insulin is able to decrease [3H]- ... These results suggest that insulin, by modulating α2adrenergic receptor levels, is able to regulate the amount of NE present in ... Neuronal and glial cells in culture contain a2-adrenergic receptors, in preparation.Google Scholar ...
Buy our alpha 1 Adrenergic Receptor peptide. Ab41797 is a blocking peptide for ab3462 and has been validated in Neut, BL. Abcam ... alpha 1 Adrenergic Receptor peptide. See all alpha 1 Adrenergic Receptor proteins and peptides. ... This alpha-adrenergic receptor mediates its effect through the influx of extracellular calcium. ... Belongs to the G-protein coupled receptor 1 family. Adrenergic receptor subfamily. ADRA1D sub-subfamily. ...
Alpha-2A adrenergic receptor. Details. Name. Alpha-2A adrenergic receptor. Kind. protein. Organism. Humans. Protein. Name. ... Alpha-2A adrenergic receptor. P08913. Details. Drug Relations. Drug Relations. DrugBank ID. Name. Drug group. Pharmacological ...
Alpha-2BAR. Gene Name. ADRA2B. Organism. Human. Amino acid sequence. ,lcl,BSEQ0010396,Alpha-2B adrenergic receptor ... Alpha-2 adrenergic receptors mediate the catecholamine-induced inhibition of adenylate cyclase through the action of G proteins ... lcl,BSEQ0010397,Alpha-2B adrenergic receptor (ADRA2B) ATGGACCACCAGGACCCCTACTCCGTGCAGGCCACAGCGGCCATAGCGGCGGCCATCACC ... blood coagulation / activation of MAPK activity by adrenergic receptor signaling pathway / activation of protein kinase B ...
Chicken polyclonal alpha 1b Adrenergic Receptor antibody validated for WB and tested in Human. Referenced in 1 publication. ... Anti-alpha 1b Adrenergic Receptor antibody. See all alpha 1b Adrenergic Receptor primary antibodies. ... This alpha-adrenergic receptor mediates its action by association with G proteins that activate a phosphatidylinositol-calcium ... Ten commercial antibodies for alpha-1-adrenergic receptor subtypes are nonspecific.. Naunyn Schmiedebergs Arch Pharmacol 379: ...
The rank order of potency for agonists of this receptor is oxymetazoline > clonidine > epinephrine > norepinephrine > ... Alpha-2 adrenergic receptors mediate the catecholamine-induced inhibition of adenylate cyclase through the action of G proteins ... alpha-1B adrenergic receptor binding Source: BHF-UCL. *alpha-2C adrenergic receptor binding Source: BHF-UCLInferred from ... alpha-1B adrenergic receptor binding Source: BHF-UCL. *alpha2-adrenergic receptor activity Source: BHF-UCL ,p>Inferred from ...
Adrenergic, alpha-2C-, receptorImported. ,p>Information which has been imported from another database using automatic ... tr,Q4W594,Q4W594_HUMAN Adrenergic, alpha-2C-, receptor OS=Homo sapiens OX=9606 GN=ADRA2C PE=2 SV=1 ... G-protein coupled receptorUniRule annotation. ,p>Information which has been generated by the UniProtKB automatic annotation ... Belongs to the G-protein coupled receptor 1 family.UniRule annotation. Automatic assertion according to rulesi ...
3H]rauwolscine (alpha-yohimbine): a specific antagonist radioligand for brain alpha 2-adrenergic receptors.. Perry BD, ... 3H]Rauwolscine, a specific and potent alpha 2-antagonist radioligand, was used to characterize alpha 2-receptor binding in ... These results suggest that [3H]rauwolscine specifically labels both the high and low affinity states of the alpha 2-receptor in ... rauwolscine labeled the alpha 2-receptor. Agonists inhibited [3H]rauwolscine binding in a shallow, GTP-sensitive manner. ...
1994). "Cloning, expression and characterization of human alpha adrenergic receptors alpha 1a, alpha 1b and alpha 1c". Biochem ... formerly known also as the alpha-1C adrenergic receptor, is an alpha-1 adrenergic receptor, and also denotes the human gene ... a potent alpha 1-adrenergic receptor agonist, selective for the alpha 1A receptor subtype". J. Pharmacol. Exp. Ther. 274 (1): ... There are 3 alpha-1 adrenergic receptor subtypes: alpha-1A, -1B and -1D, all of which signal through the Gq/11 family of G- ...
alpha 1 Adrenergic Receptor ELISA Kits vergleichen und bestellen. ... alpha 1 Adrenergic Receptor ELISA Kits für viele Reaktivitäten ... alpha-1C adrenergic receptor , adrenergic alpha 1c receptor , adrenergic receptor alpha 1c subtype , adrenergic receptor, alpha ... adrenergic, alpha-1A-, receptor variant 5 , adrenergic, alpha-1A-, receptor variant 8 , alpha-1A adrenergic receptor , alpha-1A ... alpha 1C-adrenergic receptor , alpha 1a-adrenoceptor , alpha-1A-adrenergic receptor , adrenergic receptor alpha-1A ...
In the cerebral cortex, no between-strain differences in alpha 1-adrenergic and alpha 2-adrenergic receptor density and ... Cerebral and renal alpha-adrenergic receptors play an important role in the control of blood pressure. We studied alpha- ... Binding of the selective alpha 1-adrenergic antagonist [3H]prazosin and the alpha 2-adrenergic antagonist [3H]rauwolscine was ... Selective modification of renal alpha 2-adrenergic receptors in Milan hypertensive rat strain.. A Parini, L Diop, P Ferrari, G ...
beta-Adrenergic regulation of alpha 2-adrenergic receptors in the central nervous system ... beta-Adrenergic regulation of alpha 2-adrenergic receptors in the central nervous system ... beta-Adrenergic regulation of alpha 2-adrenergic receptors in the central nervous system ... beta-Adrenergic regulation of alpha 2-adrenergic receptors in the central nervous system ...
Order alpha 1b Adrenergic Receptor Proteins from many different species. Find the right product on antibodies-online.com. ... alpha-1B-adrenergic receptor , Adrenergic alpha 1B- receptor , adrenergic receptor, alpha 1b , alpha 1B-adrenoceptor , alpha 1B ... alpha-1B adrenoceptor , adrenergic, alpha-1B-, receptor , alpha-1B adrenergic receptor-like , alpha-1B adrenergic receptor , ... alpha 1b Adrenergic Receptor (ADRA1B) Protein Überblick Protein Überblick Alpha-1-adrenergic receptors (alpha-1-ARs) are ...
The down regulation of alpha 2-adrenergic receptors and the up regulation of alpha 1-adrenergic receptors are compatible with ... larger up regulation of alpha 1-adrenergic receptors, and greater down regulation of alpha 2-adrenergic receptors than did the ... Changes in brain alpha-adrenergic receptors after alpha-methyldopa administration to spontaneously hypertensive rats.. C R ... Changes in brain alpha-adrenergic receptors after alpha-methyldopa administration to spontaneously hypertensive rats. ...
... alpha-2B adrenergic receptor explanation free. What is alpha-2B adrenergic receptor? Meaning of alpha-2B adrenergic receptor ... Looking for online definition of alpha-2B adrenergic receptor in the Medical Dictionary? ... redirected from alpha-2B adrenergic receptor) ADRA2B. A gene on chromosome 2p13-q13 that encodes alpha-2B-adrenergic receptor, ... Alpha-2B adrenergic receptor , definition of alpha-2B adrenergic receptor by Medical dictionary https://medical-dictionary. ...
Intracerebroventricular injection of the adrenergic alpha-2-receptor agonist, clonidine, stimulated food intake. ... The present study was designed to investigate the role of brain adrenergic alpha-2-receptors on feeding regulation of layer- ... 0/Adrenergic alpha-Agonists; 0/Adrenergic alpha-Antagonists; 0/Neuropeptide Y; 0/Neurotransmitter Agents; 0/Receptors, ... Adrenergic alpha-Agonists / pharmacology. Adrenergic alpha-Antagonists / pharmacology. Animals. Chickens / physiology*. ...
0/Adrenergic alpha-Agonists; 0/Iodine Radioisotopes; 0/Receptors, Adrenergic, alpha; 108294-53-7/4-iodoclonidine; 146-48-5/ ... 125I]PIC bound to the same number of high affinity sites as the alpha 2-adrenergic receptor (alpha 2-AR) full agonist [3H] ... Adrenergic alpha-Agonists / pharmacokinetics*. Blood Platelets / metabolism*. Cell Membrane / metabolism. Chromatography, Thin ... 6147954 - Adrenergic nerves and the alpha 2-adrenoceptor system regulating melanosome aggregation.... 14557414 - Prevention of ...
The second alpha 1-adrenergic receptor cloned represents the rat homolog of the hamster alpha 1B subtype. Expression of mRNA ... We have now cloned two alpha 1-adrenergic receptors from a rat cerebral cortex cDNA library, using the hamster alpha 1B- ... Molecular cloning and expression of the cDNA for the alpha 1A-adrenergic receptor. The gene for which is located on human ... The primary structure though most closely resembles that of an alpha 1-adrenergic receptor, having approximately 73% amino acid ...
Platelet alpha 2-adrenergic receptor density is increased in hypercholesterolemia and directly correlates with plasma total and ... Conclusion: Platelet alpha 2-adrenergic receptor density is increased in hypercholesterolemia and directly correlates with ... Platelet alpha 2-adrenergic receptors in hypercholesterolemia: relationship between binding studies and epinephrine-induced ... A statistically significantly higher alpha 2-adrenergic receptor density was observed in a subgroup of 13 patients with ...
  • Analysis of the ligand binding properties of RA42 expressed in COS-7 cells with a variety of adrenergic ligands demonstrates a unique alpha 1-adrenergic receptor pharmacology. (nih.gov)
  • As assessed by NaDodSO4/polyacrylamide gel electrophoresis, the Mr 80,000 alpha 1-receptor ligand-binding subunit is a phosphopeptide containing 1.2 mol of phosphate per mol of alpha 1 receptor. (duke.edu)
  • In spite of significant sequence differences between human alpha-1ARs and their other species counterparts, previously established ligand selectivity remains fairly comparable. (duke.edu)
  • It is interesting to note that the ligand binding activity is lost on treatment with most common detergents like Triton X-100 or sodium cholate, but not digitonin, and that [beta] adrenergic receptors as well as rhodopsin and muscarinic receptors were also found to be solubilized in their active forms only with digitonin (14) when these three proteins were not thought to belong to the same family. (thefreedictionary.com)
  • The present studies were designed to examine whether agents that interact with Na+/H+ antiporters also might influence alpha 2-adrenergic receptor-ligand interactions. (elsevier.com)
  • These values are close to the theoretical binding activity of 15.6 nmol/mg protein for 1 mol of the ligand binding 1 mol of the receptor protein. (cshl.edu)
  • Chimeric alpha 2-,beta 2-adrenergic receptors: delineation of domains involved in effector coupling and ligand binding specificity. (duke.edu)
  • Observational Study in Patients Suffering From Benign Prostatic Hyperplasia Treated With Alpha - adrenergic Blockade Observational Study in Patients Suffering From Benign Prostatic Hyperplasia Treated With Alpha - adrenergic Blockade - Full Text View - ClinicalTrials.gov Hide glossary Glossary Study record managers: refer to the if submitting registration or results information. (tripdatabase.com)
  • It is to be noted that in male sexual performance, erection is linked to cholinergic activity and to alpha-2 adrenergic blockade which may theoretically result in increased penile inflow, decreased penile outflow or both. (rxlist.com)
  • Association, dissociation, and saturation studies revealed one site interactions (k -1/k+1 = 1.2 nM, KD = 2.5 nM, Bmax = 160 fmol/mg protein) and competition studies indicated that [3H]rauwolscine labeled the alpha 2-receptor. (nih.gov)
  • 3H] Rauwolscine bound in a saturable manner to a single class of receptors, with an equilibrium dissociation constant (KD) of 1.4 nM and a density (Bmax) of 71 fmol/mg of protein, in crude synaptic membrane preparations from bovine pineal gland. (aspetjournals.org)
  • These agents are reversible competitive blockers of histamine at the H2 receptors, particularly those in the gastric parietal cells where they inhibit acid secretion. (medscape.com)
  • Apart from the well-known angioedema/urticaria from ACE inhibitors, lichen planus / lichenoid reaction from beta adrenergic blockers and photosensitivity from thiazid diuretics, ACDR from CV drugs might be seen in a wide spectrum extending to rare but life-threatening conditions such as erythroderma, Stevens-Johnson syndrome, toxic epidermal necrolysis or drug hypersensitivity syndrome. (springer.com)
  • In these subgroups plasma total and levels of low-density lipoprotein (LDL) cholesterol were inversely correlated with platelet aggregation but directly correlated with platelet receptor density. (nih.gov)